PLANT GENOMICS

Experiment No.1 Aim: To study the plant genome organization and evolution of Arabidopsis thaliana. Principle: The plant genome organization describes the genomic size, chromosome number, repeat sequences, how the genes are organized etc. For the genome organization and evolution the “NCBI” Databases & Tools are used. NCBI is used to predict the genome organization of any plant genome. Introduction Arabidopsis was the first plant genome to be sequenced, and is a popular tool for understanding the molecular biology of many plant traits, including flower development and light sensing. Arabidopsis thaliana (A-ra-bi-dóp-sis tha-li-á-na; thale cress, mouse-ear cress or arabidopsis) is a small flowering plant and is a popular model organism in plant biology and genetics. The advanced fields of bioinformatics and biotechnology have changed this paradigm, enabling the analysis of organisms in terms of genome organization, expression and interaction. The study of the way genes and genetic information are organized within the genome, the methods of collecting and analyzing this information and how this organization determines their biological functionality is referred to as genomics. Genomic approaches are permeating every aspect of plant biology, and since they rely on DNA-coded information, they expand molecular analyses from a single to a multispecies level. Plant genomics is reversing the previous paradigm of identifying genes behind biological functions and instead focuses on finding biological functions behind genes. It also reduces the gap between phenotype and genotype and helps to comprehend not only the isolated effect of a gene, but also the way its genetic context and the genetic networks it interacts with can modulate its activity. Requirments: Plant: Arabidopsis thaliana Database: NCBI Procedure: The genome organization and evolution is predicted by the following steps.  Open the “Genome” resource from the NCBI resources(http://www.ncbi.nlm.nih.gov/genome/)  From the custom resources of Genome select the “Plant” resource.  Select the plant Arabidopsis thaliana.  It will provide the genome organization of Arabidopsis thaliana.

Results: Genome Resource

Plant Resource: Genome Organization and Evolution: .

brassicaceae (Cruciferae).924 131 117 Chloroplast Genome Pltd 26-Mar-2010 07-Apr-2000 154. The sequencing was done by an international collaboration collectively termed the Arabidopsis Genome Initiative (AGI).Arabidopsis thaliana is a small flowering plant of mustard family. an important source of vegetable oil. Though of no economic importance. particularly to members of the same family.176 Mitochondrial Genome Last record update Last sequence update Size Number of genes Number of proteins Last record update Last sequence update Size Number of genes Number of proteins 31-Jul-2008 12-Dec-2002 366. Arabidopsis thaliana is a diploid plant with 2n = 10 chromosomes. Genome Assembly and Annotation: Assembly and Annotation Default assembly 1 other assemblies are available Assembly Name Last sequence update Highest level of assembly Size (total bases) Number of genes Number of proteins TAIR9 19-Jun-2009 complete sequence genome 119. which includes canola. It is distributed throughout the world and was first reported in the sixteenth century by Johannes Thal. It became the first plant genome to be fully sequenced based on the fact that it has a (1) small genome of ~120 Mb with a simple structure having few repeated sequences (2) short generation time of six weeks from seed germination to seed set. and (3) produces large number of seeds.323 35.348 33.478 129 85 Arabidopsis thaliana . It is now being used as a model organism to study different aspects of plant biology.146. It has been used for over fifty years to study plant mutations and for classical genetic analysis. it is an invaluable resource to agriculturally important crops.

37 44.140 924 1.9 5.323 1 1 AJ270060.1 18. 23. 3.2 0.40 6 1.8 CP002686.1 AP000423. 14.2 Y08501.8 CP002688.05 36. 23.1 26.560 3 NC_003074.8 117 85 123 127 7.228 31 92 8 4 BA000015.908 4 NC_003075.5 36.22 36. 5.98 35. 14.67 35. 4.35 1 4. 3.The Arabidopsis Information Resource (TAIR) Arabidopsis assembly project Na Loc Type me Nuc Chr Nuc Chr Nuc Chr Nuc Chr Nuc Chr MT Chl Chr Chr RefSeq INSDC Size other (Mb) GC% protein rrna trna rna gene pseudogene 2 2 3 7 240 218 8.128 - 7 - AE005172. 3.263 2 NC_003071.43 35.513 134 6.83 0 2.15 36.107 5 - 10 - Nu Chr 1 bottom c arm Nu Chr c 1 top arm - .46 36.3 Arabidopsis thaliana Arabidopsis Genome Initiative Arabidopsis thaliana legacy genome sequence Loc Typ RefSe e Name q 3 - INSDC Size GC protei rrn trn other pseudogen (Mb) % n a a rna gene e 6 4.72 7 817 5 Nu Chr 4 long c arm Nu Chr 4 short c arm - - 55 - - - - 8 - - .140 1 5 .9 9. 3.730 116 5.089 MT NC_001284.7 CP002685.59 36.4 36.7 CP002687.1 0.1 30.2 5.507 21 37 131 129 Pltd NC_000932.3 6.9 8.1 23.9 CP002684.156 1 0 AJ270058.71 1 79 Nu Chr c Nu Chr c BA000014. 1 2 554 1 78 1 2.043 1.433 96 93 79 149 5. 14.356 5 NC_003076.1 19.080 832 948 - 1 NC_003070.7 35.710 5 0 AE005173.81 36.

Conclusion: The genome organization and evolution of Arabiopsis thaliana was successfully studied. I found that Arabidopsis thaliana is a small flowering plant of mustard family having 10 chromosomes with ~ 120 Mb genome size. .

Chemgenome is an ab-intio gene prediction software. Read more about ChemGenome Procedure: Genome: Arabidopsis thaliana chromosome1 Tool: ChemGenome 2. 78-85. J. 2006. which find genes in prokaryotic genomes in all six reading frames. Agrawal P.Experiment No.. 2. Dutta S. Mod. "Decoding the design principles of amino acids and the chemical logic of protein sequences". Tomer R. 2008.. 2 Aim of the experiment: “ To identify gene in Arabidopsis thaliana for transgenic approach in plants” Principle: For the identification of the genes in Arabidopsis thaliana I have used the “ChemGenome2. A Physico-Chemical model for analyzing DNA sequences".... and Jayaram B.0 Reference: 1. Jayaram B. Kritee. Singhal P. Khurana E. Nature Precedings.. . The methodology follows a physico-chemical approach and has been validated on 372 prokaryotic genomes. Inf. Chem. 46(1)..0”software.

Principle Outcome: Conclusion: We have successfully identifed gene in Arabidopsis thaliana which can be transferred from one plant to another. .

Principle: Metabolic pathways are series of chemical reactions occurring within a cell. Pentose phosphate pathway 3. The first committed step of glycolysis is the reversible conversion of β-D-glucose-6-phosphate into Dfructose-6-phosphate by hexose phosphate isomerase. made from starch degradation. Glycolysis The pathway starts with β-D-glucose-6-phosphate. Photorespiration Principle Outcome: 1. Glycolysis 2. For the metabolic pathway analysis the AraCyc database is used Method Specification: Database: AraCyc (BioCyc) Pathways: 1. The third step is catalyzed by an aldolase which cleaves fructose-1. 3 Aim: To study plant metabolic pathway in Arabidopsis thaliana.6-bisphosphate into interconvertable . The second step is catalyzed by a phosphofructokinase in the presence of ATP. this step is irreversible. which changes the pyranose configuration of glucose into the furanose configuration of fructose.Experiment No. a principal chemical is modified by a series of chemical reactions. In each pathway.

3-diphosphateglycerate . which adds one phosphate residue to D-glyceraldehyde-3phosphate to form 1. The following reaction.to the 2-hydroxyl group of glycerate. The removal of a molecule of water by an enolase in the presence of Mg2+ converts 2phosphoglycerate into phosphoenolpyruvate (PEP). The next step releases one molecule of ATP during the conversion of 1. leading to the release of a molecule of ATP. . The final step of glycolysis involves the ketolization of PEP to pyruvate by a pyruvate kinase. The interconversion of these tautomers is facilitated by a triose phosphate isomerase.two three-carbon fragments: D-glyceraldehyde-3-phosphate and dihydroxyacetone phosphate. is freely reversible and requires NAD+ and phosphate . leading to the formation of 2-phosphoglycerate .3-diphosphateglycerate into 3-phosphoglycerate by a Mg2+-dependent glyceraldehyde-3-phosphate kinase. The next step requires little energy change and leads to the reversible transfer of a phosphate group from the 3.

.

The last of the peroxisome steps consists in the reduction of hydroxypyruvate into glycerate by an NADH-dependent hydroxypyruvate reductase. The methylene group is then transferred to another glycine molecule to form serine by a serine hydroxylmetyltransferase. In its dephosphorylated form glycolate is exported to the cytoplasm where it is oxidized in the peroxisomes to glyoxylate .2. Glyoxylate is then converted into glycine by two different enzymes: serine:glyoxylate aminotransferase and glutamate: glyoxylate aminotransferase. Glycerate is then redirected to the chloroplast where it is phosphorylated to 3-phosphoglycerate and reenters the Calvin cycle . which catalyze the transfer of a methylene group from glycine to tetrahydrofolate with the concomitant release of NH3 and CO2. T and L). Photorespiration The first step of the pathway involves the dephosphorylation of 2-phosphoglycolate. Back in the peroxisome. Glycine decarboxylase has four different subunit (P. and production of NADH. H. The H2O2 generated during this step is detoxified by catalases in the peroxisome. Glycine is in fact converted into serine in the mitochondrion by glycine decarboxylase where it is extremely abundant. serine is used to convert glyoxylate into hydroxypyruvate via serine:glyoxylate aminotransferase as mentioned above.

3. . in which D-ribulose-5-phosphate is converted into D-fructose-6phosphate and D-glyceraldehyde-3-phosphate. In the former. Pentose phosphate pathway The pentose phosphate pathway is an alternative way of oxidizing glucose. The subsequent non-oxidative portion represents a series of transaldolase and transketolase reactions. As a result this pathway is a source of reducing power and is also important for the conversion of hexoses to pentoses Conclusion: We have successfully studied the above three pathways in Arabidopsis thaliana from the AraCyc (BioCyc) pathway database. β-D-glucose-6-phosphate is oxidized to D-ribulose-5phosphate0. This oxidation is coupled with NADPH synthesis. The pathway has two primary reaction sequences: the pentose phosphate pathway (oxidative branch) and the pentose phosphate pathway (nonoxidative branch). this step is the source of reducing equivalents for biosynthesis reactions in the shape of NADPH.

as a result. double stranded . taxa that have been reproductively isolated for millions of years have retained recognizable intragenic DNA sequences as well as similar arrangements of genes along the chromosomes. Method Specification: Tool: BioEdit Plants: 1. the evolution of the small but essential portion of the genome that actually encodes the organism's genes has proceeded relatively slowly.A. the study of the similarities and differences in structure and function of hereditary information across taxa.1| Arabidopsis thaliana sph6 gene for S Protein Homologue 6 ATGAATTCGTCTAACATAAATTTCCTAACAATTTTCTACTCAATGTTTATAATCATCTTTATAGTATTAA TATCTTTGATAGGCTGTGAAACTCTACAACATGATGGAAAAGTATTTCCAATGAAAGGTCCTCTTACTAG GGTTGTGATTTATAATGACAATGATTATCTTTTAGGAGTTCATTGTAAATCAAGAGATGATGATCATGGC TTCCATATTCTACAAAAAGGTGGATTATATGGTTGGATGTTTTACGTGAATTTTATGAATTCGACACTCT ACTTCTGTGGATTTAGCCAAGAACAAGTAAAAAAAGGTGTGTTCGATATTTATAAAGCGGTTAGAGATTC TTCTAGATGTAGAAATTGTACTTGGGAAGCAAAGGAAGATGGTATTTATGGATATGGCGAGATTCCTAAG AAAAATCCTTTGTTTTATAAGTGGCTAATGTAA References: 1. Acids. 4 Aim: To comparatively study the plant genomes. Nucl.Experiment No. single stranded Molecular Weight = 273979 Daltons.1| Pisum sativum sulfiredoxin precursor protein (Srx) gene. Ser. 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. uses molecular tools to investigate many notions that long preceded identification of DNA as the hereditary molecule. Pisum sativum (Target Plant) >gi|326937563|emb|FN691474. Arabidopsis thaliana(Model Plant) >gi|281199944|gb|GU223224. T. Hall. Principle Outcomes: DNA molecule: arabidpsis thaliana Length = 453 base pairs Molecular Weight = 136212 Daltons. Principle: Comparative genomics. complete cds ATGGCGGCGAGCAACTTTCTGCTGCAGCTGCCGCTGCGCAGCTTTACCGTGATTAACGTGGCGAGCGCGA GCAGCAGCAACGGTTCGCCGCCGGTGATCGGAGGATCTAGCGGCGGTGTAGGACCGATGATTGTGGAATT ACCGTTGGAGAAGATACGAAGACCGTTGATGCGAACCAGATCCAACGATCAGAACAAAGTGAAAGAGCTT ATGGATAGTATCCGTCAAATCGGTCTTCAAGTTCCGATTGATGTGATTGAAGTTGATGGAACTTACTATG GGTTCTCGGGATGTCACAGATACGAGGCGCATCAGAAGCTAGGGCTTCCAACTATACGTTGCAAAATCCG TAAAGGAACAAAGGAAACATTAAGGCATCATCTTCGCTGA 2. Symp. In most plants. 41:95-98.

00% A+T content = 50.11 12.69 21.54 DNA molecule: pisum sativum Length = 390 base pairs Molecular Weight = 118241 Daltons.35% A+T content = 68.14 19. single stranded Molecular Weight = 237117 Daltons.65% Nucleotide A C G T Number 150 55 87 161 Mol% 33.28 28. double stranded G+C content = 50.G+C content = 31.72 22.21 35.00% Nucleotide A C G T Number 108 83 112 87 Mol% 27.31 .

.Pairwise Alignment: Sequence 1: arabidpsis thaliana Sequence 2: pisum sativum Optimal Global aligment Alignment score: 84 Identities: 0. we found that the both sequences are 43% identical.43 Conclusion: We have successfully compared two plant nucleotide sequences from Arabidopsis thaliana and Pisum sativum.

(1991) Predicting Coled Coils from Protein Sequences. and Stock. the lowest level of information is individual atoms Docking is a method which predicts the preferred orientation of one molecule to a second when bound to each other to form a stable complex. Principle: Molecular modelling encompasses all theoretical methods and computational techniques used to model or mimic the behaviour of molecules. Method Specification: Receptor: 3O74 Ligand: 2XZP Tool: HEX6.Experiment No. Van Dyke.3 Reference: Lupas. Science 252:1162-1164 ..5 Aim: To identify the Drug targets in plants. The common feature of molecular modelling techniques is the atomistic level description of the molecular systems. A. J.. M. Docking is frequently used to predict the binding orientation of small molecule drug candidates to their protein targets in order to in turn predict the affinity and activity of the small molecule.

Principle Outcome: Conclusion: We have successfully identified ligand drug target 2XZP for receptor 3O74 of Pseudomonas putida as it shows maximum binding affinity in Docking .

DNA polymerases.5 Reference: Drummond AJ. Available from http://www.Experiment No.1 Tool: Geneious Pro 5. Cooper A. Principle: A primer is a strand of nucleic acid that serves as a starting point for DNA synthesis. They are required for DNA replication because the enzymes that catalyze this process. Cheung M. the primer for DNA synthesis and replication is a short strand of RNA Method Specification: Sequence: Arabidopsis thaliana actin 3 gene. can only add new nucleotides to an existing strand of DNA. Buxton S. Sturrock S. Wilson A (2011) Geneious v5. Thierer T. complete cds. Kearse M. Duran C. GenBank: U39480. and copies the opposite strand. In most cases of natural DNA replication.6 Aim: To design plant nucleotide primer using primer designing tool.4. Ashton B. Field M. The polymerase starts replication at the 3'-end of the primer.geneious.com/ Principle Outcome: . Heled J. Stones-Havas S. Moir R. Markowitz S.3.

complete cds sequence using primer designing tool Geneious Pro 5.Type primer_bind primer_bind primer_bind primer_bind primer_bind primer_bind_reverse primer_bind_reverse primer_bind_reverse primer_bind_reverse primer_bind_reverse Name 1st forward primer 2nd forward primer 3rd forward primer 4th forward primer 5th forward primer 1st reverse primer 2nd reverse primer 3rd reverse primer 4th reverse primer 5th reverse primer Sequence TGAGCAGGAGCTTGAGACGGC GCCTTAACCGAGGCCGAGCG GCCTTAACCGAGGCCGAGCG GCCTTAACCGAGGCCGAGCG GCCTTAACCGAGGCCGAGCG ACCTCAGGGCAACGGAAACGC GCTTCGAATTCGGCACACCTCGT GCTTCGAATTCGGCACACCTCG GGCTTCGAATTCGGCACACCT AGGCTTCGAATTCGGCACACC Minimum 2501 848 848 848 848 2591 933 934 936 937 Maximum 2521 867 867 867 867 2611 955 955 956 957 Length 21 20 20 20 20 21 23 22 21 21 # Intervals 1 1 1 1 1 1 1 1 1 1 Direction forward forward forward forward forward reverse reverse reverse reverse reverse Conclusion: We have successfully designed primers for Arabidopsis thaliana actin 3 gene.5 .3.

1. Pseudoterranova decipiens and 3. oryza sativa 2.7 Aim: To draw phylogram using different plant protein sequence.7 Principle Outcomes: . solanum tuberosum Tool: Geneious 5. Method specification: Plants: 1. Principle: Phylogenetic methods can be used for many purposes.Experiment No. including analysis of morphological and several kinds of molecular data.

3923650000000001).'solanum tuberosum':0. Conclusion: we have successfully drawn phylogram using plant protein sequences of oryza sativa.242189.Tree: + oryza sativa | +========================================================================== ========================= Pseudoterranova decipiens | +=============================== solanum tuberosum In Newick format: ('oryza sativa':0.0. Pseudoterranova decipiens and solanum tuberosum .'Pseudoterranova decipiens':1.

3 Reference: Lupas. Secondary metabolites are essentially low molecular weight compounds... flavorings.. development. A. sometimes having complex structures. anti-herbivory. and hence are significant from the evo-devo perspective Method Specification: Receptor: 2XAM (Plant Hydrocarbon) Ligand: 2XAL Tool: HEX6. J. or reproduction of an organism. and recreational drugs.8 Aim: To identify the secondary metabolites as drug targets for diseases in plants. Secondary metabolites often play an important role in plant defense against herbivory and other interspecies defenses. They function in processes as diverse as immunity. Science 252:1162-1164 Principle Outcome: . (1991) Predicting Coled Coils from Protein Sequences. M. Plants use secondary metabolites as medicines. Van Dyke. pollinator attraction. enhancing the rate of fertilization etc. and Stock.Experiment No. maintaining symbiotic associations with soil flora. communication between plants. Principle: Secondary metabolites are organic compounds that are not directly involved in the normal growth.

Conclusion: We have successfully identified ligand drug target 2XZP for receptor 3O74 of Pseudomonas putida as it shows maximum binding affinity in Docking using HEX6. .3.

Sign up to vote on this title
UsefulNot useful