Msc tics Practical. | Primer (Molecular Biology) | Arabidopsis Thaliana

PLANT GENOMICS

Experiment No.1 Aim: To study the plant genome organization and evolution of Arabidopsis thaliana. Principle: The plant genome organization describes the genomic size, chromosome number, repeat sequences, how the genes are organized etc. For the genome organization and evolution the “NCBI” Databases & Tools are used. NCBI is used to predict the genome organization of any plant genome. Introduction Arabidopsis was the first plant genome to be sequenced, and is a popular tool for understanding the molecular biology of many plant traits, including flower development and light sensing. Arabidopsis thaliana (A-ra-bi-dóp-sis tha-li-á-na; thale cress, mouse-ear cress or arabidopsis) is a small flowering plant and is a popular model organism in plant biology and genetics. The advanced fields of bioinformatics and biotechnology have changed this paradigm, enabling the analysis of organisms in terms of genome organization, expression and interaction. The study of the way genes and genetic information are organized within the genome, the methods of collecting and analyzing this information and how this organization determines their biological functionality is referred to as genomics. Genomic approaches are permeating every aspect of plant biology, and since they rely on DNA-coded information, they expand molecular analyses from a single to a multispecies level. Plant genomics is reversing the previous paradigm of identifying genes behind biological functions and instead focuses on finding biological functions behind genes. It also reduces the gap between phenotype and genotype and helps to comprehend not only the isolated effect of a gene, but also the way its genetic context and the genetic networks it interacts with can modulate its activity. Requirments: Plant: Arabidopsis thaliana Database: NCBI Procedure: The genome organization and evolution is predicted by the following steps.  Open the “Genome” resource from the NCBI resources(http://www.ncbi.nlm.nih.gov/genome/)  From the custom resources of Genome select the “Plant” resource.  Select the plant Arabidopsis thaliana.  It will provide the genome organization of Arabidopsis thaliana.

Results: Genome Resource

Plant Resource: Genome Organization and Evolution: .

It became the first plant genome to be fully sequenced based on the fact that it has a (1) small genome of ~120 Mb with a simple structure having few repeated sequences (2) short generation time of six weeks from seed germination to seed set. It is distributed throughout the world and was first reported in the sixteenth century by Johannes Thal.Arabidopsis thaliana is a small flowering plant of mustard family. brassicaceae (Cruciferae). It is now being used as a model organism to study different aspects of plant biology.348 33. The sequencing was done by an international collaboration collectively termed the Arabidopsis Genome Initiative (AGI). which includes canola. Though of no economic importance.478 129 85 Arabidopsis thaliana . an important source of vegetable oil. particularly to members of the same family.924 131 117 Chloroplast Genome Pltd 26-Mar-2010 07-Apr-2000 154. Genome Assembly and Annotation: Assembly and Annotation Default assembly 1 other assemblies are available Assembly Name Last sequence update Highest level of assembly Size (total bases) Number of genes Number of proteins TAIR9 19-Jun-2009 complete sequence genome 119.323 35.176 Mitochondrial Genome Last record update Last sequence update Size Number of genes Number of proteins Last record update Last sequence update Size Number of genes Number of proteins 31-Jul-2008 12-Dec-2002 366. it is an invaluable resource to agriculturally important crops. Arabidopsis thaliana is a diploid plant with 2n = 10 chromosomes.146. It has been used for over fifty years to study plant mutations and for classical genetic analysis. and (3) produces large number of seeds.

4 36. 14.46 36.9 CP002684.8 CP002686.263 2 NC_003071. 14.2 0.5 36. 3.323 1 1 AJ270060.1 23.089 MT NC_001284.080 832 948 - 1 NC_003070.140 1 5 .107 5 - 10 - Nu Chr 1 bottom c arm Nu Chr c 1 top arm - .560 3 NC_003074.507 21 37 131 129 Pltd NC_000932.1 19.140 924 1.7 35.3 Arabidopsis thaliana Arabidopsis Genome Initiative Arabidopsis thaliana legacy genome sequence Loc Typ RefSe e Name q 3 - INSDC Size GC protei rrn trn other pseudogen (Mb) % n a a rna gene e 6 4.9 8.05 36.71 1 79 Nu Chr c Nu Chr c BA000014.2 5.156 1 0 AJ270058.8 CP002688. 3. 14.67 35.37 44.730 116 5. 23.9 5. 1 2 554 1 78 1 2.83 0 2.1 0.The Arabidopsis Information Resource (TAIR) Arabidopsis assembly project Na Loc Type me Nuc Chr Nuc Chr Nuc Chr Nuc Chr Nuc Chr MT Chl Chr Chr RefSeq INSDC Size other (Mb) GC% protein rrna trna rna gene pseudogene 2 2 3 7 240 218 8.513 134 6.8 117 85 123 127 7.59 36.9 9.3 6.22 36. 3.710 5 0 AE005173.81 36.7 CP002685.128 - 7 - AE005172.043 1.1 26.43 35. 23.908 4 NC_003075. 5. 4.433 96 93 79 149 5.228 31 92 8 4 BA000015.40 6 1.7 CP002687. 3.1 18.15 36.1 AP000423.1 30.98 35.2 Y08501.356 5 NC_003076.35 1 4.72 7 817 5 Nu Chr 4 long c arm Nu Chr 4 short c arm - - 55 - - - - 8 - - .

I found that Arabidopsis thaliana is a small flowering plant of mustard family having 10 chromosomes with ~ 120 Mb genome size. .Conclusion: The genome organization and evolution of Arabiopsis thaliana was successfully studied.

. 2. "Decoding the design principles of amino acids and the chemical logic of protein sequences". Agrawal P.Experiment No. Chem. and Jayaram B... Chemgenome is an ab-intio gene prediction software.0 Reference: 1. .. Nature Precedings. Singhal P. 2006. 46(1). 2008. Jayaram B. which find genes in prokaryotic genomes in all six reading frames. J. The methodology follows a physico-chemical approach and has been validated on 372 prokaryotic genomes.. 2 Aim of the experiment: “ To identify gene in Arabidopsis thaliana for transgenic approach in plants” Principle: For the identification of the genes in Arabidopsis thaliana I have used the “ChemGenome2.. Kritee. 78-85. Inf.. Dutta S.0”software. Tomer R. Khurana E. Mod. Read more about ChemGenome Procedure: Genome: Arabidopsis thaliana chromosome1 Tool: ChemGenome 2. A Physico-Chemical model for analyzing DNA sequences".

Principle Outcome: Conclusion: We have successfully identifed gene in Arabidopsis thaliana which can be transferred from one plant to another. .

Principle: Metabolic pathways are series of chemical reactions occurring within a cell.Experiment No. this step is irreversible. a principal chemical is modified by a series of chemical reactions. Photorespiration Principle Outcome: 1. In each pathway. For the metabolic pathway analysis the AraCyc database is used Method Specification: Database: AraCyc (BioCyc) Pathways: 1. The second step is catalyzed by a phosphofructokinase in the presence of ATP. Glycolysis The pathway starts with β-D-glucose-6-phosphate. The first committed step of glycolysis is the reversible conversion of β-D-glucose-6-phosphate into Dfructose-6-phosphate by hexose phosphate isomerase. The third step is catalyzed by an aldolase which cleaves fructose-1. made from starch degradation. which changes the pyranose configuration of glucose into the furanose configuration of fructose. Pentose phosphate pathway 3. Glycolysis 2.6-bisphosphate into interconvertable . 3 Aim: To study plant metabolic pathway in Arabidopsis thaliana.

The following reaction.to the 2-hydroxyl group of glycerate. The removal of a molecule of water by an enolase in the presence of Mg2+ converts 2phosphoglycerate into phosphoenolpyruvate (PEP). which adds one phosphate residue to D-glyceraldehyde-3phosphate to form 1. is freely reversible and requires NAD+ and phosphate . The next step requires little energy change and leads to the reversible transfer of a phosphate group from the 3. The next step releases one molecule of ATP during the conversion of 1. . leading to the release of a molecule of ATP.3-diphosphateglycerate into 3-phosphoglycerate by a Mg2+-dependent glyceraldehyde-3-phosphate kinase. leading to the formation of 2-phosphoglycerate .3-diphosphateglycerate .two three-carbon fragments: D-glyceraldehyde-3-phosphate and dihydroxyacetone phosphate. The interconversion of these tautomers is facilitated by a triose phosphate isomerase. The final step of glycolysis involves the ketolization of PEP to pyruvate by a pyruvate kinase.

.

Glyoxylate is then converted into glycine by two different enzymes: serine:glyoxylate aminotransferase and glutamate: glyoxylate aminotransferase. serine is used to convert glyoxylate into hydroxypyruvate via serine:glyoxylate aminotransferase as mentioned above. In its dephosphorylated form glycolate is exported to the cytoplasm where it is oxidized in the peroxisomes to glyoxylate . The H2O2 generated during this step is detoxified by catalases in the peroxisome. Photorespiration The first step of the pathway involves the dephosphorylation of 2-phosphoglycolate. Glycerate is then redirected to the chloroplast where it is phosphorylated to 3-phosphoglycerate and reenters the Calvin cycle . Glycine decarboxylase has four different subunit (P. and production of NADH. H. The methylene group is then transferred to another glycine molecule to form serine by a serine hydroxylmetyltransferase. Back in the peroxisome.2. T and L). Glycine is in fact converted into serine in the mitochondrion by glycine decarboxylase where it is extremely abundant. which catalyze the transfer of a methylene group from glycine to tetrahydrofolate with the concomitant release of NH3 and CO2. The last of the peroxisome steps consists in the reduction of hydroxypyruvate into glycerate by an NADH-dependent hydroxypyruvate reductase.

As a result this pathway is a source of reducing power and is also important for the conversion of hexoses to pentoses Conclusion: We have successfully studied the above three pathways in Arabidopsis thaliana from the AraCyc (BioCyc) pathway database.3. this step is the source of reducing equivalents for biosynthesis reactions in the shape of NADPH. The subsequent non-oxidative portion represents a series of transaldolase and transketolase reactions. This oxidation is coupled with NADPH synthesis. in which D-ribulose-5-phosphate is converted into D-fructose-6phosphate and D-glyceraldehyde-3-phosphate. In the former. β-D-glucose-6-phosphate is oxidized to D-ribulose-5phosphate0. Pentose phosphate pathway The pentose phosphate pathway is an alternative way of oxidizing glucose. . The pathway has two primary reaction sequences: the pentose phosphate pathway (oxidative branch) and the pentose phosphate pathway (nonoxidative branch).

the evolution of the small but essential portion of the genome that actually encodes the organism's genes has proceeded relatively slowly. complete cds ATGGCGGCGAGCAACTTTCTGCTGCAGCTGCCGCTGCGCAGCTTTACCGTGATTAACGTGGCGAGCGCGA GCAGCAGCAACGGTTCGCCGCCGGTGATCGGAGGATCTAGCGGCGGTGTAGGACCGATGATTGTGGAATT ACCGTTGGAGAAGATACGAAGACCGTTGATGCGAACCAGATCCAACGATCAGAACAAAGTGAAAGAGCTT ATGGATAGTATCCGTCAAATCGGTCTTCAAGTTCCGATTGATGTGATTGAAGTTGATGGAACTTACTATG GGTTCTCGGGATGTCACAGATACGAGGCGCATCAGAAGCTAGGGCTTCCAACTATACGTTGCAAAATCCG TAAAGGAACAAAGGAAACATTAAGGCATCATCTTCGCTGA 2. Principle Outcomes: DNA molecule: arabidpsis thaliana Length = 453 base pairs Molecular Weight = 136212 Daltons.A. Symp. as a result. Hall. Nucl. single stranded Molecular Weight = 273979 Daltons. 41:95-98. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Arabidopsis thaliana(Model Plant) >gi|281199944|gb|GU223224.1| Arabidopsis thaliana sph6 gene for S Protein Homologue 6 ATGAATTCGTCTAACATAAATTTCCTAACAATTTTCTACTCAATGTTTATAATCATCTTTATAGTATTAA TATCTTTGATAGGCTGTGAAACTCTACAACATGATGGAAAAGTATTTCCAATGAAAGGTCCTCTTACTAG GGTTGTGATTTATAATGACAATGATTATCTTTTAGGAGTTCATTGTAAATCAAGAGATGATGATCATGGC TTCCATATTCTACAAAAAGGTGGATTATATGGTTGGATGTTTTACGTGAATTTTATGAATTCGACACTCT ACTTCTGTGGATTTAGCCAAGAACAAGTAAAAAAAGGTGTGTTCGATATTTATAAAGCGGTTAGAGATTC TTCTAGATGTAGAAATTGTACTTGGGAAGCAAAGGAAGATGGTATTTATGGATATGGCGAGATTCCTAAG AAAAATCCTTTGTTTTATAAGTGGCTAATGTAA References: 1.Experiment No. 1999. Ser. T. Acids. the study of the similarities and differences in structure and function of hereditary information across taxa. In most plants. double stranded . uses molecular tools to investigate many notions that long preceded identification of DNA as the hereditary molecule. taxa that have been reproductively isolated for millions of years have retained recognizable intragenic DNA sequences as well as similar arrangements of genes along the chromosomes.1| Pisum sativum sulfiredoxin precursor protein (Srx) gene. Method Specification: Tool: BioEdit Plants: 1. 4 Aim: To comparatively study the plant genomes. Pisum sativum (Target Plant) >gi|326937563|emb|FN691474. Principle: Comparative genomics.

35% A+T content = 68.11 12.72 22.28 28.65% Nucleotide A C G T Number 150 55 87 161 Mol% 33. single stranded Molecular Weight = 237117 Daltons.31 .21 35.00% A+T content = 50.54 DNA molecule: pisum sativum Length = 390 base pairs Molecular Weight = 118241 Daltons.69 21.00% Nucleotide A C G T Number 108 83 112 87 Mol% 27. double stranded G+C content = 50.G+C content = 31.14 19.

.Pairwise Alignment: Sequence 1: arabidpsis thaliana Sequence 2: pisum sativum Optimal Global aligment Alignment score: 84 Identities: 0.43 Conclusion: We have successfully compared two plant nucleotide sequences from Arabidopsis thaliana and Pisum sativum. we found that the both sequences are 43% identical.

Docking is frequently used to predict the binding orientation of small molecule drug candidates to their protein targets in order to in turn predict the affinity and activity of the small molecule.3 Reference: Lupas. J.Experiment No.. M. Science 252:1162-1164 . A. The common feature of molecular modelling techniques is the atomistic level description of the molecular systems. and Stock.. the lowest level of information is individual atoms Docking is a method which predicts the preferred orientation of one molecule to a second when bound to each other to form a stable complex. Principle: Molecular modelling encompasses all theoretical methods and computational techniques used to model or mimic the behaviour of molecules. Method Specification: Receptor: 3O74 Ligand: 2XZP Tool: HEX6. Van Dyke. (1991) Predicting Coled Coils from Protein Sequences.5 Aim: To identify the Drug targets in plants.

Principle Outcome: Conclusion: We have successfully identified ligand drug target 2XZP for receptor 3O74 of Pseudomonas putida as it shows maximum binding affinity in Docking .

The polymerase starts replication at the 3'-end of the primer.5 Reference: Drummond AJ. Available from http://www. Ashton B. can only add new nucleotides to an existing strand of DNA. Duran C.Experiment No. Wilson A (2011) Geneious v5. Kearse M. Markowitz S. Thierer T. and copies the opposite strand. Heled J. Cheung M.1 Tool: Geneious Pro 5. Principle: A primer is a strand of nucleic acid that serves as a starting point for DNA synthesis. the primer for DNA synthesis and replication is a short strand of RNA Method Specification: Sequence: Arabidopsis thaliana actin 3 gene.4. DNA polymerases.3. Field M. They are required for DNA replication because the enzymes that catalyze this process. Moir R.com/ Principle Outcome: .geneious. Stones-Havas S. In most cases of natural DNA replication. Cooper A. Sturrock S. GenBank: U39480.6 Aim: To design plant nucleotide primer using primer designing tool. Buxton S. complete cds.

3. complete cds sequence using primer designing tool Geneious Pro 5.5 .Type primer_bind primer_bind primer_bind primer_bind primer_bind primer_bind_reverse primer_bind_reverse primer_bind_reverse primer_bind_reverse primer_bind_reverse Name 1st forward primer 2nd forward primer 3rd forward primer 4th forward primer 5th forward primer 1st reverse primer 2nd reverse primer 3rd reverse primer 4th reverse primer 5th reverse primer Sequence TGAGCAGGAGCTTGAGACGGC GCCTTAACCGAGGCCGAGCG GCCTTAACCGAGGCCGAGCG GCCTTAACCGAGGCCGAGCG GCCTTAACCGAGGCCGAGCG ACCTCAGGGCAACGGAAACGC GCTTCGAATTCGGCACACCTCGT GCTTCGAATTCGGCACACCTCG GGCTTCGAATTCGGCACACCT AGGCTTCGAATTCGGCACACC Minimum 2501 848 848 848 848 2591 933 934 936 937 Maximum 2521 867 867 867 867 2611 955 955 956 957 Length 21 20 20 20 20 21 23 22 21 21 # Intervals 1 1 1 1 1 1 1 1 1 1 Direction forward forward forward forward forward reverse reverse reverse reverse reverse Conclusion: We have successfully designed primers for Arabidopsis thaliana actin 3 gene.

7 Principle Outcomes: . oryza sativa 2. Method specification: Plants: 1. Principle: Phylogenetic methods can be used for many purposes. solanum tuberosum Tool: Geneious 5. including analysis of morphological and several kinds of molecular data. Pseudoterranova decipiens and 3.7 Aim: To draw phylogram using different plant protein sequence.Experiment No.1.

Tree: + oryza sativa | +========================================================================== ========================= Pseudoterranova decipiens | +=============================== solanum tuberosum In Newick format: ('oryza sativa':0.3923650000000001).0. Conclusion: we have successfully drawn phylogram using plant protein sequences of oryza sativa.242189.'solanum tuberosum':0.'Pseudoterranova decipiens':1. Pseudoterranova decipiens and solanum tuberosum .

8 Aim: To identify the secondary metabolites as drug targets for diseases in plants. maintaining symbiotic associations with soil flora.. and hence are significant from the evo-devo perspective Method Specification: Receptor: 2XAM (Plant Hydrocarbon) Ligand: 2XAL Tool: HEX6. development. Principle: Secondary metabolites are organic compounds that are not directly involved in the normal growth.Experiment No. or reproduction of an organism. communication between plants. Science 252:1162-1164 Principle Outcome: . and recreational drugs. J. Van Dyke. anti-herbivory.3 Reference: Lupas. flavorings. Secondary metabolites are essentially low molecular weight compounds. A. They function in processes as diverse as immunity.. (1991) Predicting Coled Coils from Protein Sequences. and Stock. enhancing the rate of fertilization etc. Plants use secondary metabolites as medicines. sometimes having complex structures. pollinator attraction.. Secondary metabolites often play an important role in plant defense against herbivory and other interspecies defenses. M.

Conclusion: We have successfully identified ligand drug target 2XZP for receptor 3O74 of Pseudomonas putida as it shows maximum binding affinity in Docking using HEX6.3. .

Sign up to vote on this title
UsefulNot useful