PLANT GENOMICS

Experiment No.1 Aim: To study the plant genome organization and evolution of Arabidopsis thaliana. Principle: The plant genome organization describes the genomic size, chromosome number, repeat sequences, how the genes are organized etc. For the genome organization and evolution the “NCBI” Databases & Tools are used. NCBI is used to predict the genome organization of any plant genome. Introduction Arabidopsis was the first plant genome to be sequenced, and is a popular tool for understanding the molecular biology of many plant traits, including flower development and light sensing. Arabidopsis thaliana (A-ra-bi-dóp-sis tha-li-á-na; thale cress, mouse-ear cress or arabidopsis) is a small flowering plant and is a popular model organism in plant biology and genetics. The advanced fields of bioinformatics and biotechnology have changed this paradigm, enabling the analysis of organisms in terms of genome organization, expression and interaction. The study of the way genes and genetic information are organized within the genome, the methods of collecting and analyzing this information and how this organization determines their biological functionality is referred to as genomics. Genomic approaches are permeating every aspect of plant biology, and since they rely on DNA-coded information, they expand molecular analyses from a single to a multispecies level. Plant genomics is reversing the previous paradigm of identifying genes behind biological functions and instead focuses on finding biological functions behind genes. It also reduces the gap between phenotype and genotype and helps to comprehend not only the isolated effect of a gene, but also the way its genetic context and the genetic networks it interacts with can modulate its activity. Requirments: Plant: Arabidopsis thaliana Database: NCBI Procedure: The genome organization and evolution is predicted by the following steps.  Open the “Genome” resource from the NCBI resources(http://www.ncbi.nlm.nih.gov/genome/)  From the custom resources of Genome select the “Plant” resource.  Select the plant Arabidopsis thaliana.  It will provide the genome organization of Arabidopsis thaliana.

Results: Genome Resource

Plant Resource: Genome Organization and Evolution: .

which includes canola. It became the first plant genome to be fully sequenced based on the fact that it has a (1) small genome of ~120 Mb with a simple structure having few repeated sequences (2) short generation time of six weeks from seed germination to seed set.Arabidopsis thaliana is a small flowering plant of mustard family. It has been used for over fifty years to study plant mutations and for classical genetic analysis. It is now being used as a model organism to study different aspects of plant biology. brassicaceae (Cruciferae). Though of no economic importance. it is an invaluable resource to agriculturally important crops.176 Mitochondrial Genome Last record update Last sequence update Size Number of genes Number of proteins Last record update Last sequence update Size Number of genes Number of proteins 31-Jul-2008 12-Dec-2002 366.478 129 85 Arabidopsis thaliana .323 35. particularly to members of the same family. The sequencing was done by an international collaboration collectively termed the Arabidopsis Genome Initiative (AGI). It is distributed throughout the world and was first reported in the sixteenth century by Johannes Thal. an important source of vegetable oil.146.924 131 117 Chloroplast Genome Pltd 26-Mar-2010 07-Apr-2000 154. Genome Assembly and Annotation: Assembly and Annotation Default assembly 1 other assemblies are available Assembly Name Last sequence update Highest level of assembly Size (total bases) Number of genes Number of proteins TAIR9 19-Jun-2009 complete sequence genome 119.348 33. Arabidopsis thaliana is a diploid plant with 2n = 10 chromosomes. and (3) produces large number of seeds.

433 96 93 79 149 5.263 2 NC_003071.156 1 0 AJ270058. 14. 3.3 6. 5. 14.1 26. 3.7 35.5 36.81 36.2 0. 23.1 23.1 AP000423. 4.080 832 948 - 1 NC_003070.043 1. 3.323 1 1 AJ270060.67 35.8 CP002686.560 3 NC_003074.15 36.46 36.1 30.98 35. 3.356 5 NC_003076.1 18.513 134 6.1 19.The Arabidopsis Information Resource (TAIR) Arabidopsis assembly project Na Loc Type me Nuc Chr Nuc Chr Nuc Chr Nuc Chr Nuc Chr MT Chl Chr Chr RefSeq INSDC Size other (Mb) GC% protein rrna trna rna gene pseudogene 2 2 3 7 240 218 8.2 5.40 6 1.228 31 92 8 4 BA000015.05 36.9 8.908 4 NC_003075.507 21 37 131 129 Pltd NC_000932.3 Arabidopsis thaliana Arabidopsis Genome Initiative Arabidopsis thaliana legacy genome sequence Loc Typ RefSe e Name q 3 - INSDC Size GC protei rrn trn other pseudogen (Mb) % n a a rna gene e 6 4.7 CP002687.72 7 817 5 Nu Chr 4 long c arm Nu Chr 4 short c arm - - 55 - - - - 8 - - .730 116 5. 1 2 554 1 78 1 2. 14.2 Y08501. 23.71 1 79 Nu Chr c Nu Chr c BA000014.35 1 4.089 MT NC_001284.43 35.140 1 5 .59 36.107 5 - 10 - Nu Chr 1 bottom c arm Nu Chr c 1 top arm - .140 924 1.83 0 2.4 36.9 9.9 CP002684.128 - 7 - AE005172.710 5 0 AE005173.37 44.8 117 85 123 127 7.22 36.1 0.8 CP002688.9 5.7 CP002685.

Conclusion: The genome organization and evolution of Arabiopsis thaliana was successfully studied. . I found that Arabidopsis thaliana is a small flowering plant of mustard family having 10 chromosomes with ~ 120 Mb genome size.

Nature Precedings. and Jayaram B. 46(1). which find genes in prokaryotic genomes in all six reading frames. 2. Agrawal P.. The methodology follows a physico-chemical approach and has been validated on 372 prokaryotic genomes.. Chemgenome is an ab-intio gene prediction software.. .0 Reference: 1. Chem. Kritee.Experiment No. "Decoding the design principles of amino acids and the chemical logic of protein sequences".. Khurana E. 2006...0”software. Jayaram B. J. Dutta S. 2008. Inf. Mod. 2 Aim of the experiment: “ To identify gene in Arabidopsis thaliana for transgenic approach in plants” Principle: For the identification of the genes in Arabidopsis thaliana I have used the “ChemGenome2. Singhal P. Read more about ChemGenome Procedure: Genome: Arabidopsis thaliana chromosome1 Tool: ChemGenome 2. Tomer R. A Physico-Chemical model for analyzing DNA sequences".. 78-85.

.Principle Outcome: Conclusion: We have successfully identifed gene in Arabidopsis thaliana which can be transferred from one plant to another.

a principal chemical is modified by a series of chemical reactions. The first committed step of glycolysis is the reversible conversion of β-D-glucose-6-phosphate into Dfructose-6-phosphate by hexose phosphate isomerase. Glycolysis 2. The third step is catalyzed by an aldolase which cleaves fructose-1. The second step is catalyzed by a phosphofructokinase in the presence of ATP. Principle: Metabolic pathways are series of chemical reactions occurring within a cell. Photorespiration Principle Outcome: 1. Glycolysis The pathway starts with β-D-glucose-6-phosphate. 3 Aim: To study plant metabolic pathway in Arabidopsis thaliana. which changes the pyranose configuration of glucose into the furanose configuration of fructose. In each pathway. Pentose phosphate pathway 3.Experiment No. this step is irreversible. For the metabolic pathway analysis the AraCyc database is used Method Specification: Database: AraCyc (BioCyc) Pathways: 1.6-bisphosphate into interconvertable . made from starch degradation.

is freely reversible and requires NAD+ and phosphate . The removal of a molecule of water by an enolase in the presence of Mg2+ converts 2phosphoglycerate into phosphoenolpyruvate (PEP). The interconversion of these tautomers is facilitated by a triose phosphate isomerase. The next step releases one molecule of ATP during the conversion of 1. which adds one phosphate residue to D-glyceraldehyde-3phosphate to form 1. The following reaction.to the 2-hydroxyl group of glycerate.two three-carbon fragments: D-glyceraldehyde-3-phosphate and dihydroxyacetone phosphate. The final step of glycolysis involves the ketolization of PEP to pyruvate by a pyruvate kinase. The next step requires little energy change and leads to the reversible transfer of a phosphate group from the 3. leading to the release of a molecule of ATP.3-diphosphateglycerate . leading to the formation of 2-phosphoglycerate . .3-diphosphateglycerate into 3-phosphoglycerate by a Mg2+-dependent glyceraldehyde-3-phosphate kinase.

.

The H2O2 generated during this step is detoxified by catalases in the peroxisome. The methylene group is then transferred to another glycine molecule to form serine by a serine hydroxylmetyltransferase. serine is used to convert glyoxylate into hydroxypyruvate via serine:glyoxylate aminotransferase as mentioned above. Glycerate is then redirected to the chloroplast where it is phosphorylated to 3-phosphoglycerate and reenters the Calvin cycle .2. Glycine is in fact converted into serine in the mitochondrion by glycine decarboxylase where it is extremely abundant. and production of NADH. which catalyze the transfer of a methylene group from glycine to tetrahydrofolate with the concomitant release of NH3 and CO2. Photorespiration The first step of the pathway involves the dephosphorylation of 2-phosphoglycolate. H. T and L). Back in the peroxisome. Glycine decarboxylase has four different subunit (P. In its dephosphorylated form glycolate is exported to the cytoplasm where it is oxidized in the peroxisomes to glyoxylate . The last of the peroxisome steps consists in the reduction of hydroxypyruvate into glycerate by an NADH-dependent hydroxypyruvate reductase. Glyoxylate is then converted into glycine by two different enzymes: serine:glyoxylate aminotransferase and glutamate: glyoxylate aminotransferase.

3. In the former. this step is the source of reducing equivalents for biosynthesis reactions in the shape of NADPH. The pathway has two primary reaction sequences: the pentose phosphate pathway (oxidative branch) and the pentose phosphate pathway (nonoxidative branch). As a result this pathway is a source of reducing power and is also important for the conversion of hexoses to pentoses Conclusion: We have successfully studied the above three pathways in Arabidopsis thaliana from the AraCyc (BioCyc) pathway database. in which D-ribulose-5-phosphate is converted into D-fructose-6phosphate and D-glyceraldehyde-3-phosphate. The subsequent non-oxidative portion represents a series of transaldolase and transketolase reactions. This oxidation is coupled with NADPH synthesis. . β-D-glucose-6-phosphate is oxidized to D-ribulose-5phosphate0. Pentose phosphate pathway The pentose phosphate pathway is an alternative way of oxidizing glucose.

Principle Outcomes: DNA molecule: arabidpsis thaliana Length = 453 base pairs Molecular Weight = 136212 Daltons. the evolution of the small but essential portion of the genome that actually encodes the organism's genes has proceeded relatively slowly.A. Arabidopsis thaliana(Model Plant) >gi|281199944|gb|GU223224.Experiment No. the study of the similarities and differences in structure and function of hereditary information across taxa. Hall. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. as a result. uses molecular tools to investigate many notions that long preceded identification of DNA as the hereditary molecule. In most plants. 41:95-98. 4 Aim: To comparatively study the plant genomes. Method Specification: Tool: BioEdit Plants: 1. 1999. double stranded . complete cds ATGGCGGCGAGCAACTTTCTGCTGCAGCTGCCGCTGCGCAGCTTTACCGTGATTAACGTGGCGAGCGCGA GCAGCAGCAACGGTTCGCCGCCGGTGATCGGAGGATCTAGCGGCGGTGTAGGACCGATGATTGTGGAATT ACCGTTGGAGAAGATACGAAGACCGTTGATGCGAACCAGATCCAACGATCAGAACAAAGTGAAAGAGCTT ATGGATAGTATCCGTCAAATCGGTCTTCAAGTTCCGATTGATGTGATTGAAGTTGATGGAACTTACTATG GGTTCTCGGGATGTCACAGATACGAGGCGCATCAGAAGCTAGGGCTTCCAACTATACGTTGCAAAATCCG TAAAGGAACAAAGGAAACATTAAGGCATCATCTTCGCTGA 2.1| Arabidopsis thaliana sph6 gene for S Protein Homologue 6 ATGAATTCGTCTAACATAAATTTCCTAACAATTTTCTACTCAATGTTTATAATCATCTTTATAGTATTAA TATCTTTGATAGGCTGTGAAACTCTACAACATGATGGAAAAGTATTTCCAATGAAAGGTCCTCTTACTAG GGTTGTGATTTATAATGACAATGATTATCTTTTAGGAGTTCATTGTAAATCAAGAGATGATGATCATGGC TTCCATATTCTACAAAAAGGTGGATTATATGGTTGGATGTTTTACGTGAATTTTATGAATTCGACACTCT ACTTCTGTGGATTTAGCCAAGAACAAGTAAAAAAAGGTGTGTTCGATATTTATAAAGCGGTTAGAGATTC TTCTAGATGTAGAAATTGTACTTGGGAAGCAAAGGAAGATGGTATTTATGGATATGGCGAGATTCCTAAG AAAAATCCTTTGTTTTATAAGTGGCTAATGTAA References: 1. Principle: Comparative genomics. Pisum sativum (Target Plant) >gi|326937563|emb|FN691474. Ser. Acids. Symp. Nucl.1| Pisum sativum sulfiredoxin precursor protein (Srx) gene. taxa that have been reproductively isolated for millions of years have retained recognizable intragenic DNA sequences as well as similar arrangements of genes along the chromosomes. single stranded Molecular Weight = 273979 Daltons. T.

35% A+T content = 68.54 DNA molecule: pisum sativum Length = 390 base pairs Molecular Weight = 118241 Daltons.31 .11 12.00% A+T content = 50.14 19. double stranded G+C content = 50.G+C content = 31.69 21.28 28.65% Nucleotide A C G T Number 150 55 87 161 Mol% 33.00% Nucleotide A C G T Number 108 83 112 87 Mol% 27.21 35. single stranded Molecular Weight = 237117 Daltons.72 22.

Pairwise Alignment: Sequence 1: arabidpsis thaliana Sequence 2: pisum sativum Optimal Global aligment Alignment score: 84 Identities: 0. we found that the both sequences are 43% identical. .43 Conclusion: We have successfully compared two plant nucleotide sequences from Arabidopsis thaliana and Pisum sativum.

J.. Van Dyke. Docking is frequently used to predict the binding orientation of small molecule drug candidates to their protein targets in order to in turn predict the affinity and activity of the small molecule. the lowest level of information is individual atoms Docking is a method which predicts the preferred orientation of one molecule to a second when bound to each other to form a stable complex. Science 252:1162-1164 .3 Reference: Lupas.5 Aim: To identify the Drug targets in plants.Experiment No. and Stock. A. Method Specification: Receptor: 3O74 Ligand: 2XZP Tool: HEX6. Principle: Molecular modelling encompasses all theoretical methods and computational techniques used to model or mimic the behaviour of molecules. M.. The common feature of molecular modelling techniques is the atomistic level description of the molecular systems. (1991) Predicting Coled Coils from Protein Sequences.

Principle Outcome: Conclusion: We have successfully identified ligand drug target 2XZP for receptor 3O74 of Pseudomonas putida as it shows maximum binding affinity in Docking .

The polymerase starts replication at the 3'-end of the primer. Thierer T. Available from http://www. Moir R. Sturrock S. They are required for DNA replication because the enzymes that catalyze this process.5 Reference: Drummond AJ. In most cases of natural DNA replication. complete cds.Experiment No. Heled J. GenBank: U39480.com/ Principle Outcome: . Ashton B. Wilson A (2011) Geneious v5. the primer for DNA synthesis and replication is a short strand of RNA Method Specification: Sequence: Arabidopsis thaliana actin 3 gene. Buxton S. Principle: A primer is a strand of nucleic acid that serves as a starting point for DNA synthesis. Markowitz S. Stones-Havas S.3.1 Tool: Geneious Pro 5. Kearse M.6 Aim: To design plant nucleotide primer using primer designing tool. Cheung M. Duran C. and copies the opposite strand.4. Cooper A. can only add new nucleotides to an existing strand of DNA. DNA polymerases.geneious. Field M.

5 .3.Type primer_bind primer_bind primer_bind primer_bind primer_bind primer_bind_reverse primer_bind_reverse primer_bind_reverse primer_bind_reverse primer_bind_reverse Name 1st forward primer 2nd forward primer 3rd forward primer 4th forward primer 5th forward primer 1st reverse primer 2nd reverse primer 3rd reverse primer 4th reverse primer 5th reverse primer Sequence TGAGCAGGAGCTTGAGACGGC GCCTTAACCGAGGCCGAGCG GCCTTAACCGAGGCCGAGCG GCCTTAACCGAGGCCGAGCG GCCTTAACCGAGGCCGAGCG ACCTCAGGGCAACGGAAACGC GCTTCGAATTCGGCACACCTCGT GCTTCGAATTCGGCACACCTCG GGCTTCGAATTCGGCACACCT AGGCTTCGAATTCGGCACACC Minimum 2501 848 848 848 848 2591 933 934 936 937 Maximum 2521 867 867 867 867 2611 955 955 956 957 Length 21 20 20 20 20 21 23 22 21 21 # Intervals 1 1 1 1 1 1 1 1 1 1 Direction forward forward forward forward forward reverse reverse reverse reverse reverse Conclusion: We have successfully designed primers for Arabidopsis thaliana actin 3 gene. complete cds sequence using primer designing tool Geneious Pro 5.

7 Principle Outcomes: .Experiment No. Method specification: Plants: 1.1. Principle: Phylogenetic methods can be used for many purposes.7 Aim: To draw phylogram using different plant protein sequence. oryza sativa 2. solanum tuberosum Tool: Geneious 5. including analysis of morphological and several kinds of molecular data. Pseudoterranova decipiens and 3.

0.'Pseudoterranova decipiens':1. Pseudoterranova decipiens and solanum tuberosum .'solanum tuberosum':0.242189.Tree: + oryza sativa | +========================================================================== ========================= Pseudoterranova decipiens | +=============================== solanum tuberosum In Newick format: ('oryza sativa':0. Conclusion: we have successfully drawn phylogram using plant protein sequences of oryza sativa.3923650000000001).

and Stock.Experiment No.3 Reference: Lupas. flavorings.8 Aim: To identify the secondary metabolites as drug targets for diseases in plants. A. sometimes having complex structures. They function in processes as diverse as immunity. (1991) Predicting Coled Coils from Protein Sequences. maintaining symbiotic associations with soil flora. J. Secondary metabolites are essentially low molecular weight compounds. enhancing the rate of fertilization etc. pollinator attraction. Secondary metabolites often play an important role in plant defense against herbivory and other interspecies defenses.. or reproduction of an organism. M. development. Science 252:1162-1164 Principle Outcome: . Principle: Secondary metabolites are organic compounds that are not directly involved in the normal growth.. and recreational drugs. Van Dyke. and hence are significant from the evo-devo perspective Method Specification: Receptor: 2XAM (Plant Hydrocarbon) Ligand: 2XAL Tool: HEX6. communication between plants.. anti-herbivory. Plants use secondary metabolites as medicines.

3.Conclusion: We have successfully identified ligand drug target 2XZP for receptor 3O74 of Pseudomonas putida as it shows maximum binding affinity in Docking using HEX6. .

Sign up to vote on this title
UsefulNot useful