Vous êtes sur la page 1sur 70

BIOCHIMIE I (CHMI 2227 F) Problmes et solutions

Eric R. Gauthier, Ph.D. Dpartement de chimie et de biochimie Universit Laurentienne Janvier 2007
1

Note:
Ce cahier d'exercice est destin avant tout aux tudiants qui sont inscrits au cours Biochimie I (CHMI 2227F) tel qu'offert l'Universit Laurentienne. Il comporte de nombreux exercices et problmes tires soit de manuels de rfrence, soit de l'imagination de l'auteur. Quoique la majorit des problmes retrouvs dans ce manuel peuvent tre rsolus assez aisment l'aide des notes de cours, certains problmes d'un niveau de difficult plus avanc furent aussi inclus. Ainsi, les problmes marqus d'une astrisque (*) ncessiteront davantage de recherche de la part de l'tudiant(e). Quand aux problmes marqus d'une double astrisque (**), qui sont peu nombreux, ils devraient constituer un excellent dfi pour l'tudiant intress les rsoudre. L'tudiant(e) trouvera aprs la section "Problmes" la solution dtaille de tous ces exercices. Pour des raison pdagogiques videntes, nous suggrons l'tudiant(e) de n'y avoir recours qu'aprs avoir pris le temps de rflchir sur le problme. La liste des pKas et pI des 20 acides amins naturels, ainsi que le tableau du code gntique, sont inclus en annexe la fin de la section "Problmes". Les manuels de rfrence suivants furent consults lors de l'laboration de cet ouvrage: 1) Kuchel, P. W. et Ralston, G. B. Biochimie 1. Cours et problmes. Srie Schaum. McGrawHill. 1989. 2) Lehninger, A. L., Nelson, D. L., Cox, M. M. Principles of Biochemistry. 2ime dition. Worth Publishers. 1993. 3) Mathews, C. K. et van Holde, K. E. Biochemistry. 2ime dition. Benjamin/Cummings Publishing Company, INC. 1996. 4) Rawns, J. D. Trait de biochimie. Editions du renouveau pdagogique. 1990. (disponible la rserve de la bibliothque). 5) Wood, W. B., Wilson, J. H., Benbow, R. M., Hood, L. E. Biochemistry. A Problems Approach. Benjamin/Cummings Publishing Company, INC. 1981. (disponible la rserve de la bibliothque). 6) Zubay, G. L., Parson, W. W., Vance, D. E. Principles of Biochemistry. Wm. C. Brown Publishers. 1995. Des exercices et problmes supplmentaires peuvent tre trouvs dans ces rfrences.

Problmes

Chapitre 1 : quilibre acide-base et spectrophotomtrie


1.1 quilibre acide-base : Quel est le pH de chacune de ces solutions? a) Acide chlorhydrique 0.35M b) Acide actique 0.35M (pKa=4.76) c) Acide actique 0.035M 1.2 quilibre acide-base : Un acide faible HA dune concentration totale de 0.20M est ionis (dissoci) 2%. a) Quel est le Ka de cet acide? b) Quel est le pH de cette solution?

1.3 quilibre acide-base : Quel est le pH des mlanges suivants : a) 1M dacide actique avec 0.5M dactate de sodium b) 0.3M dacide phosphorique avec 0.8M de KH2PO4 (pKa=2.14)

1.4 quilibre acide-base : Vous dsirez prparer une solution tampon de pH = 7.00 en utilisant du KH2PO4 et Na2HPO4 (pKa=7.21). Si vous disposez dune solution de 0.1M de KH2PO4, quelle devra-tre la concentration de Na2HPO4 que vous devrez utiliser? 1.5 quilibre acide-base : Vous dsirez prparer une solution tampon de pH=7.00 en utilisant du KH2PO4 et du Na2HPO4. Quelles devront-tre les concentrations respectives de ces substances si vous dsirez obtenir une concentration finale en phosphate ([HPO4-2] + [H2PO4-1]) de 0.3M? 1.6 Spectrophotomtrie : Quelle sera la concentration de lacide amin tyrosine (=1 420 L mol-1 cm-1) si on obtient une absorbance de 0.71 laide dune cuvette de 1cm? Avec une cuvette de 0.1 cm? 1.7 Spectrophotomtrie : Quelle sera labsorbance dune solution de 37 mM de tyrosine? 1.8 Spectrophotomtrie : Vous dsirez dterminer la concentration dhmoglobine dans un chantillon sanguin par spectrophotomtrie. Pour cela, vous tablissez une courbe standard de labsorbance 412 nm de solutions dhmoglobine de concentration connues. Les rsultats obtenus sont prsents dans le tableau ci-dessous. Quelle est la concentration (en g/mL) en hmoglobine dans votre chantillon, si vous obtenez une valeur dabsorbance 412 nm de 0.303?

Absorbance (412nm) 0.069 0.113 0.201 0.377 0.730

Concentration du standard (g/mL) 1 2 4 8 16

Chapitre 2: Acides amins


* 2.1. Masse molculaire d'un acide amin. 1.812 g d'un acide -amin cristallis (pKa1: 2.4; pKa2; 9.7) donne une solution de pH 10.4 quand il est dissout dans 100 mL de NaOH 0,1M. Calculez la masse molculaire de cet acide amin. 2.2. Courbe de titrage. Calculez le pI de l'histidine et tracez sa courbe de titrage. Indiquez la position du pI, des pKas, ainsi que le pourcentage des formes ioniques chacun des pKas ainsi qu'au dbut et la fin du titrage. La liste des pKas des 20 acides amins est disponible la fin de la section Problmes du cahier dexercices. 2.3. Charge nette des acides amins. Quelle est la charge nette (+, 0, -) de chacun des acides amins suivants: glycine, srine, acide aspartique, glutamine et arginine, : a) pH 2.01 b) pH 3.96 c) pH 5.68 d) pH 10.76

2.4. Chromatographie changeuse d'ions. On spare un mlange de lysine, glycine, alanine, isoleucine et d'acide glutamique par chromatographie changeuse d'ions. Quel sera l'ordre d'lution des acides amins si on utilise un tampon allant progressivement de pH 10 pH 2, et si on utilise: a) une rsine changeuse de cations b) une rsine changeuse d'anions Quelle est selon vous la colonne donnant la meilleure sparation? 2.5. Acides amins Quels acides amins peuvent tre convertis en d'autres acides amins par hydrolyse douce, avec libration d'ammoniaque?
4

2.7. Acides amins La phosphosrine se retrouve dans les hydrolysats enzymatiques de la casine, une protine du lait. Cependant, elle ne fait pas partie des 20 acides amins cods lors de la synthse protique. Fournissez une explication plausible. CH2-CH2-CH-COOH O NH2 -2 PO3

Phosphosrine

*2.8. Chromatographie changeuse d'ions. La glycine, l'alanine, la valine et la leucine peuvent tre spars efficacement par chromatographie changeuse d'ions. Pourtant les pKas de ces acides amins sont presque identiques. Expliquez ce comportement des acides amins.

2.9. Peptides. Un petit peptide a t hydrolys et on a effectu l'analyse de ses acides amins. En outre, comme l'hydrolyse acide dtruit le tryptophane, on a estim le contenu en tryptophane par une mesure au spectrophotomtre. D'aprs les donnes fournies ci-dessous, tablissez la formule empirique du peptide:
Acide amin Ala Glu Leu Lys Arg Trp mmol 2.74 1.41 0.69 2.81 0.72 0.65

2.10. Peptides. Dessinez la structure du peptide GWYQR. Indiquez la forme ionise de ce peptide aux pH suivants: a) pH 2.0 b) pH 7.0 c) pH 10.5

Chapitre 3. Proprits gnrales et purification des protines


3.1. Purification des protines. Pourquoi utilise-t-on souvent la procdure de prcipitation au sulfate d'ammonium comme tape initiale de purification d'une protine? 3.2. Purification des protines. Une colonne de DEAE cellulose est rarement utilise un pH suprieur 8.5. Pourquoi? 3.3. Purification des protines. La 6-phosphogluconate dshydrognase possde un pI de 6. Expliquez pourquoi le tampon utilis lors d'une chromatographie sur DEAE-cellulose devra avoir un pH suprieur 6 mais infrieur 9 pour que l'enzyme puisse lier efficacement la colonne. 3.4. Purification des protines. Est-ce-que la 6-phosphogluconate dshydrognase pourra se lier une rsine de CM-cellulose si on utilise les mmes conditions de tampon qu'au problme prcdent? Pourquoi? 3.5. Purification des protines. Rfrant au problme prcdent, quel pH approximatif le tampon devra-t-il possder afin de permettre la dshydrognase de lier efficacement la colonne de CM-cellulose? 3.6. Purification des protines. On charge une colonne de DEAE-cellulose pH 6.5 avec un mlange de protines: ovalbumine (pI 4.6), urase (pI 5.0), et myoblobine (pI 7.0). La colonne est lue avec un tampon de faible force ionique pH 6.5, puis avec le mme tampon contenant des concentrations croissantes de chlorure de sodium. Dans quel ordre les protines apparatront-elles dans l'luant? 3.7. Purification des protines. Une enzyme (Mr 24 kDa, pI 5.5) est contamine par deux autres protines, l'une de masse molculaire analogue et de pI 7.0, et l'autre de Mr 100 kDa et de pI 5.4. Suggrez un protocole gnral de purification de l'enzyme. 3.8. Purification des protines. Une procdure servant purifier la 6-gluconate dshydrognase dE. coli est prsente cidessous. a) Pour chaque tape, calculez (1) l'activit spcifique, (2) le pourcentage de rendement par rapport la quantit initiale d'enzyme, et (3) le degr de purification (p.ex. 5 fois plus pur). b) Indiquez quelle tape permet la plus grande purification de la protine. c) Assumant que la protine est pure aprs le tamisage molculaire (Bio-Gel A), quel pourcentage de l'extrait initial tait constitu de 6-gluconate dshydrognase?

tape de purification 1- Extrait cellulaire 2- Sulfate d'ammonium 3- Dnaturation chaleur 4- Chromato. DEAE 5- CM-cellulose 6- Bio-Gel A

Volume (mL) 2 800 3 000 3 000 80.00 50.00 7.00

Protines totales (mg) 70 000 25 400 16 500 390.00 47.00 35.00

Activit enzymatique (g/min) 2 700 2 300 1 980 1 680 1 350 1 120

3.9. Purification des protines. Pourquoi n'ajoute-t-on jamais de SDS des protines devant subir une focalisation isolectrique? 3.10. Purification des protines. Une srie de protines de masse molculaire connue et une enzyme inconnue ont t tudies par chromatographie sur gel de sphadex G-200. Le volume d'lution (Vel) pour chaque protine est donn dans le tableau ci-dessous. Estimez la masse molculaire de la protine inconnue. Protine Mr Vel (mL) 85.00 200.00 190.00 170.00 150.00 125.00 90.00 92.00 160.00 130.00

dextran bleu 1 000 kDa lysozyme 14 kDa chymotrypsinogne 25 kDa ovalbumine 45 kDa srum albumine 65 kDa aldolase 150 kDa urase 500 kDa ferritine 700 kDa ovomucoide 28 kDa inconnu ?

*3.11. Purification des protines. Rfrant au problme prcdent, fournissez une explication plausible quant au comportement bizarre de la ferritine lors de sa chromatographie sur gel de sphadex. 3.12. Purification des protines. Une tudiante isole une protine partir d'une bactrie anarobique et soumet son chantillon une lectrophorse en gel de polyacrylamide en prsence de SDS (PAGE-SDS). Aprs coloration, une seule bande est visualise, ce qui enthousiasme beaucoup le superviseur de l'tudiante. Cependant, ce dernier suggre l'tudiante d'effectuer une seconde lectrophorse de son chantillon, mais cette fois sous des conditions natives (i.e. non-dnaturantes, i.e. sans SDS).
7

Elle observe alors deux bandes aprs coloration du gel. Assumant que l'tudiante n'a pas fait de gaffes au cours de ses expriences, expliquez ces observations. 3.13. Purification des protines. Un tudiant du cours CHMI 2227 F effectue l'analyse de la srum albumine bovine (bovine serum albumin-BSA) en lectrophorse sur gel de polyacrylamide (PAGE-SDS). Au cours de son exprience, il omet d'ajouter du -mercaptothanol son chantillon. En comparant ses rsultats ceux de ses collgues, il s'aperoit que la masse molculaire apparent de son chantillon de BSA dtermin par PAGE-SDS est de 57 kDa, alors que la valeur obtenue par tous les autres tudiants (qui eux n'ont pas oubli d'ajouter le -mercaptothanol) est de 68 kDa. Expliquez l'origine de cette diffrence. 3.14. Squenage de polypeptides Considrant le peptide suivant: A-L-K-M-P-E-Y-I-S-T-D-Q-S-N-W-H-H-R Indiquez quels fragments seront gnrs suite la digestion avec: a) la trypsine b) la pepsine c) la protase V8 d) le bromure de cyanogne

3.15. Squenage de polypeptides Dduisez la squence du polypeptide pour lequel on a obtenu les rsultats suivants: a) hydrolyse acide: (Ala2 , Arg , Lys2 , Met, Phe, Ser2); b) digestion la carboxypeptidase A: Ala; c) digestion la trypsine: (Ala, Arg) (Lys, Phe, Ser) (Lys) (Ala, Met, Ser) d) traitement au bromure de cyanogne: (Ala, Arg, Lys2 , Met, Phe, Ser) (Ala, Ser) e) digestion la thermolysine: (Ala) (Ala, Arg, Ser) (Lys2 , Met, Phe, Ser)

3.16. Squenage de polypeptides Un polypeptide est rduit avec le -mercaptothanol et donne deux fragments peptidiques de la squence suivante:
8

chane 1: A-C-F-P-K-R-W-C-R-R-V-C chane 2: C-Y-C-F-C Le polypeptide sous sa forme non-rduite est digr avec la thermolysine et donne les fragments suivants: (A,C,C,V) (R,K,F,P) (R,R,C,C,W,Y) (C,C,F) Indiquez la position des ponts disulfure dans le polypeptide. 3.17. Squenage de polypeptides On procde l'analyse du polypeptide Shawi isol de la bactrie Chrtientus ngativii, et on obtient les rsultats suivants: a) hydrolyse acide: (Ala4 , Val, Lys2 , Arg, Gly, Asp, Met, Pro, Trp) b) digestion la carboxypeptidase: Lys c) traitement au dinitrofluorobenzne: Val d) traitement au bromure de cyanogne: gnration de deux peptides: peptide A: (Gly, Arg, Trp, Asp, Lys, Ala) Le traitement de ce peptide au DNBF et carboxypeptidase donne: DNFB: Gly Carboxypeptidase: Lys

peptide B: (Ala3 , Lys, Val, Met, Pro) Le traitement de ce peptide au DNFB et carboxypeptidase donne: DNFB: Val Carboxypeptidase: Met

e) digestion la trypsine: gnre trois peptides: peptide C: (Lys, Trp, Ala) Le traitement de ce peptide au DNFB et carboxypeptidase donne: DNFB: Trp
9

peptide D: (Ala3 , Val, Lys, Pro)

peptide E: (Met, Asp, Gly, Arg) Le traitement de ce peptide au DNFB et carboxypeptidase donne: DNFB: Met

Finalement, le traitement du peptide D avec la thermolysine donne : Val Ala Ala (Ala, Lys, Pro)

Quelle est la structure primaire de ce peptide?

Chapitre 4. Structure tridimensionnelle des protines


4.1. Structure 3-D des protines Quels acides amins parmi les suivants vous attendriez-vous retrouver a) l'intrieur, et b) la surface d'une protine globulaire typique, en solution aqueuse et pH 7? Glu Arg Val Phe Ileu Asn Lys Ser Thr 4.2. Structure 3-D des protines D'aprs la structure de l'ure, dduisez comment ce compos provoque la dnaturation des protines. 4.3. Structure 3-D des protines Quoique la phnylalanine est un acide amin hydrophobe, on la rencontre frquemment la surface de protines natives et fonctionnelles. Donnez le rle le plus probable de la phnylalanine dans cette situation. *4.4. Structure 3-D des protines Quoique l'aspartate est un acide amin charg, on le rencontre frquemment l'intrieur de protines natives et fonctionnelles. Expliquez comment cela peut tre possible. 4.5. Structure 3-D des protines
10

Le tableau suivant dcrit la composition en acides amins de trois protines.

acide amin Rsidus polaires Arg Asn Asp Cys Gln Glu His Lys Ser Thr Trp Tyr Rsidus apolaires Ala Gly Ileu Leu Met Phe Pro Val

nombre de rsidus par molcule protine 1 protine 2 protine 3 12.00 9.00 14.00 7.00 8.00 11.00 4.00 22.00 20.00 15.00 2.00 7.00 14.00 9.00 5.00 3.00 7.00 9.00 8.00 16.00 4.00 6.00 5.00 2.00 7.00 4.00 2.00 6.00 5.00 3.00 3.00 7.00 28.00 9.00 16.00 19.00 11.00 13.00 13.00 29.00 7.00 5.00 9.00 6.00 6.00 6.00 4.00 15.00 11.00 11.00 3.00 6.00 25.00 8.00 9.00 7.00 9.00 11.00 10.00 21.00

Sachant que la protine A possde une forme de btonnet, la protine B est une protine globulaire monomrique, et que la protine C est une protine globulaire forme de quatre sousunits identiques, dduisez quelle composition en acides amins correspondent ces protines. 4.6. Structure 3-D des protines Indiquez quelle(s) structure(s) secondaire (hlice , feuillet , pelote statistique) adoptera le peptide suivant en solution aqueuse pH 7:

Ileu-Glu-Asn-Glu-Gln-Asn-Met-Ala-His-Phe-Trp-Tyr 4.7. Structure 3-D des protines Indiquez quelle(s) structure(s) secondaire (hlice , feuillet , pelote statistique) adoptera le peptide suivant en solution aqueuse pH 7:

Gly-Ala-Gly-Ala-Gly-Ser-Gly-Ala-Gly-Ser-Gly-Ala

4.8. Structure 3-D des protines Indiquez quelle(s) structure(s) secondaire (hlice , feuillet , pelote statistique) adoptera le
11

peptide suivant en solution aqueuse pH 7:

Lys-Gly-Arg-Arg-Lys-Gly-Arg-Gly-Arg-Pro 4.9. Structure 3-D des protines Indiquez quelle(s) structure(s) secondaire (hlice , feuillet , pelote statistique) adoptera le peptide suivant en solution aqueuse pH 7:
1 10 20

Gly-Pro-Glu-Ser-Ala-Tyr-Lys-Thr-Leu-Phe-Asp-Val-Pro-Asp-Asp-Glu-Asp-Gly-Gly-Ser-Ala26

Gly-Ser-Ser-Gly-Ala

4.10. Structure 3-D des protines Le tableau suivant dcrit la composition en acides amins de trois protines. Dterminez si ces protines adopteront une structure en hlice , en feuillet ou en triple hlice de collagne.
Protine Ala Arg Asp Cys Glu Gly His Hypro Ileu A 29.40 0.50 1.30 1.00 44.60 0.20 0.70 B 5.00 7.20 6.00 11.20 12.10 8.10 0.70 2.80 C 10.70 5.00 4.50 7.10 33.00 0.40 9.40 0.90 Protine Leu Lys Met Phe Pro Ser Trp Tyr Val A 0.50 0.30 0.50 0.30 12.20 0.20 5.20 2.20 B 6.90 2.30 0.50 2.50 7.50 10.20 1.20 4.20 5.10 C 2.40 3.40 0.80 1.20 12.20 4.30 0.40 2.30

Chapitre 5. Enzymologie
5.1. Cintique enzymatique Soient les rsultats suivants obtenus lors de l'analyse de l'activit d'une enzyme. Dterminez: a) le Vmax b) pourquoi la vitesse v est-elle constante [S] suprieure 2 x 10-3 M? c) quelle est la [E] libre une [S] de 2 x 10-2 M?
[S] (mol/L) 2 x 10-1 2 x 10-2 2 x 10-3 2 x 10-4 1,5 x 10-4 1,3 x 10-5 v (mol/min) 60,00 60,00 60,00 48,00 45,00 12,00 12

5.2. Cintique enzymatique Vous trouverez ci-dessous les rsultats de l'analyse de l'activit d'une enzyme. Sans faire de graphique, dterminez: a) le Vmax; b) le Km; c) la vitesse initiale [S] de 1 x 10-1 M; d) la quantit de produit form au cours des 5 premires minutes une [S] de 2 x 10-3 M. une [S] de 2 x 10-6 M? e) quel est le Km et le Vmax si on augmente la [E] d'un facteur 4?
[S] (mol/L) 5 x 10-2 5 x 10-3 5x 10-4 5x 10-5 5 x 10-6 5 x 10-7 v (mol/min) 0.25 0.25 0.25 0.20 0.07 0.01

5.3. Cintique enzymatique Le tableau suivant dcrit les rsultats d'une exprience d'enzymologie. Trouvez grce au graphe de Lineweaver-Burke: a) le Km; b) le Vmax;
[S] (mol/L) 1 x 10-3 5 x 10-4 1x 10-4 5x 10-5 3 x 10-5 2 x 10-5 1 x 10-5 5 x 10-6 1 x 10-6 5 x 10-7 v (mol/min) 65.00 63.00 51.00 42.00 33.00 27.00 17.00 9.50 2.20 1.10

5.4. Cintique enzymatique On tudie l'influence du pH sur l'activit enzymatique de la 6-phosphogluconate dshydrognase. Cette enzyme catalyse la raction: 6-phosphogluconate + NADP
13

acide 6- phosphogluconique + NADPH2

Le NADPH2 absorbe 340 nm. L'activit de la dshydrognase a t mesure spectrophotomtriquement en mesurant la densit optique 340 nm, qui est proportionnelle la concentration de NADPH2.

[S] x 104 M

Accroissement de labsorbance pH 7.6 0.074 0.085 0.098 0.114 -

Accroissement de labsorbance pH 9.0 0.034 0.047 0.075 0.128 0.167

0.174 0.267 0.526 1.666 4.000

quel pH l'enzyme a-t-il le plus d'affinit pour le substrat? 5.5. Cintique enzymatique Les rsultats suivants dcrivent l'effet d'un inhibiteur sur l'activit enzymatique d'une enzyme. Dterminez: a) le Vmax en prsence et en absence de l'inhibiteur b) le Km en prsence et en absence de l'inhibiteur c) le Ki d) de quel type d'inhibition s'agit-il?

[S] (mol/L)

Sans inhibiteur v (mol/min) 28.00 36.00 43.00 65.00 74.00

1 x 10-4 1,5 x 10-4 2x 10-4 5x 10-4 7,5 x 10-4

Avec inhibiteur [I] = 2,2 x 10-4 M v (mol/min) 17.00 23.00 29.00 50.00 61.00

5.6. Cintique enzymatique Une biochimiste tudie les proprits d'une enzyme mtabolique qu'elle vient tout juste d'isoler. Elle obtient les rsultats d'analyse cintique suivants en absence et en prsence de deux inhibiteurs diffrents (A et B). L'identit des inhibiteurs est inconnue, mais on sait que l'un d'eux est un analogue du substrat et l'autre est un agent alkylant.
14

Dterminez: a) le Km et le Vmax de cette enzyme; b) quel inhibiteur est l'analogue du substrat. Lequel est l'agent alkylant? c) quelles sont les constantes d'inhibition (Ki) respectives des inhibiteurs A et B? d) quel sera le Vo de cette raction enzymatique une concentration de substrat de 3 x 10-4 M et en prsence de 2 x 10-5 M de l'inhibiteur A?

[S] (mol/L)

Sans inhibiteur v (mol/min) 1.25 0.87 0.67 0.54 0.45

5 x 10-4 2,5 x 10-4 1,7 x 10-4 1,2 x 10-4 1 x 10-4

Avec inhibiteur A [I] = 5 x 10-4 M v (mol/min) 0.82 0.49 0.36 0.26 0.23

Avec inhibiteur B [I] = 3,2 x 10-6 M v (mol/min) 0.48 0.33 0.25 0.20 0.17

5.7. Catalyse enzymatique L'effet du pH sur l'activit d'une enzyme est dmontr dans le graphique ci-dessous: Activit enzymatique (%)

pH

Comment expliquez-vous l'effet du pH sur l'activit de l'enzyme?

5.8. Catalyse enzymatique Plusieurs enzymes montrent une dpendance vis--vis le pH qui est similaire celle schmatise dans le graphique du problme prcdent. Cependant, le pH optimal varie beaucoup d'une enzyme l'autre. Quelles chanes latrales retrouverait-on au site actif d'enzymes dont le pH optimal est de: a) pH 4
15

b) pH 11

5.9. Allostrie On tudie la cintique de deux enzymes (A et B). partir des donnes suivantes, distinguez le type d'enzyme (c'est--dire si il s'agit d'un enzyme ordinaire ou allostrique) et expliquez l'allure des courbes reprsentant la vitesse en fonction de la concentration du substrat.
[S] (x 103 M) 0.00 0.50 1.00 2.00 3.00 4.00 5.00 6.00 8.00 v (enzyme A) (mol/min) 0.00 8.80 14.00 19.00 21.50 22.80 22.30 23.50 23.60 v (enzyme B) (mol/min) 0.00 0.30 1.00 4.70 12.40 19.00 21.80 22.80 23.30

Chapitre 6. Structure et proprits des acides nucliques.


6.1. Structure des acides nucliques. Soit le polynuclotide suivant: AUUACGUGGUGCACUCGGGAACAUCCCGAGUGCACCACGUAAUGGA Dessinez les deux structures secondaires intramolculaires les plus stables que ce polymre peut adopter. *6.2. Structure des acides nucliques. Une solution d'ADN double-brin est chauffe puis refroidie la temprature de la pice pendant deux minutes. Prdisez qualitativement la variation dans l'absorbance 260 nm dans les conditions suivantes: a) la solution est chauffe jusqu' ce que la temprature soit juste sous le Tm avant d'tre refroidie; b) la solution est chauffe jusqu' ce que la temprature dpasse largement le Tm, puis est refroidie; c) suggrez la structure de deux polynuclotides (synthtiques ou naturels) qui rsulteront dans un profil d'absorbance suite au refroidissement qui sera l'inverse parfait du patron obtenu suite au chauffage de la molcule au-dessus du Tm. 6.3. Structure des acides nucliques.
16

Expliquez pourquoi l'ARN, mais non l'ADN, est hydrolys sous des conditions de pH basique. 6.4. Structure des acides nucliques. Les rsultats suivants sont obtenus lors d'une exprience de dnaturation/renaturation d'un acide nuclique simple (polyA:polyU). Comment interprtez-vous ces donnes?

Solution refroidie rapidement Absorbance (260 nm)

Solution refroidie lentement

Temprature (oC) Tm 6.5. Structure des acides nucliques. L'IMP (inosine monophosphate) est prsent chez E. coli en tant qu'intermdiaire de la biosynthse des nuclotides puriques, et il est possible d'incorporer de l'IMP l'ADN si le dITP (inosine triphosphate) est prsent dans le milieu ractionnel. Pourtant, le dIMP n'est jamais prsent dans l'ADN dans la nature. Proposez une explication. 6.6. Structure des acides nucliques Quels sont les produits de la digestion de l'oligoribonuclotide: 5'pACGAUGCUAUC 3' par chacun des enzymes suivants: a) ribonuclase pancratique; b) ribonuclase T2; c) ribonuclase T1;

6.7. Structure des acides nucliques On veut procder l'analyse d'un ARN. Sa composition globale en bases est 2A, 2C, 1U, 1G. Le traitement par la phosphodiestrase de venin de serpent libre pC.

17

L'hydrolyse par la ribonuclase pancratique libre 1C, un dinuclotide qui comprend A et C, et un trinuclotide qui contient A, G et U. L'action de la ARNase T2 donne pAp, un dinuclotide qui contient U et C, et un trinuclotide ayant A, G et C. Quelle est la structure primaire de cet ARN?

6.8. Structure des acides nucliques On procde l'analyse d'un ARN dont la composition brute en bases est 2A, 4C, 2G, 1U. La ribonuclase pancratique libre 2Cp, deux dinuclotides dont un contient G et C et l'autre A et U, et un trinuclotide fait de A, C et G. Un mlange de ARNase T1 et T2 produit C, Ap, pGp, et deux trinuclotides, le premier contenant A et C et le deuxime CG et U. La phosphodiestrase du venin de serpent libre pC. Quelle est la formule de cet ARN?

6.9. Structure des acides nucliques Quelle est la charge globale porte par le trinuclotide ApGpUpC pH neutre? 6.10. Structure des acides nucliques Pourquoi d'un duplex circulaire d'ADN se renature-t-il plus rapidement qu'un duplex linaire? 6.11. Structure des acides nucliques Pourquoi l'ADN se dnature-t-il dans l'eau pure, c'est--dire force ionique voisine de zro? 6.12. Structure des acides nucliques La taille du chromosome de E. coli est de 4000 kpb. Quelle longueur d'ADN contient-il? 6.13. Synthse des acides nucliques. Au cours d'une exprience du type de celle effectue par Meselson et Stahl, vous laissez les bactries pousser pour 3 gnrations (au lieu de 2 dans l'exprience classique) dans un milieu ne contenant que du 14N. Suite l'isolation de l'ADN et son analyse par centrifugation analytique, quelle proportion de molcule d'ADN lourdes, hybrides ou lgres obtiendrez-vous? 6.14. Synthse des acides nucliques. Un brin isol (+) d'ADN (composition en bases: 10% de A, 20% de G, 30% de C et 40% de T) est rpliqu par la ADN polymrase de E. coli en un brin complmentaire (-). L'ADN bicatnaire sert ensuite de modle la ARN polymrase de E. coli qui transcrit le brin (-).

18

Indiquez la composition en bases (en % de A, C, G et T/U) du brin form. *6.15. Synthse des acides nucliques. Le temps requis pour synthtiser compltement le gnome dE. coli est de 40 minutes. Pourtant, le temps de gnration de cette bactrie est de seulement 20 minutes. Trouvez une explication ce paradoxe.

**6.16. Synthse des acides nucliques. Vous avez l'insigne honneur d'tre le premier scientifique analyser un micro-organisme provenant de la plante Mars. Cette bactrie contenant de l'ADN double-brin comme matriel gntique, vous dcidez d'effectuer une analyse de type Meselson-Stahl. et vous obtenez les rsultats dcrits la page suivante. a) comment interprtez-vous ces rsultats? b) afin de mieux comprendre ce phnomne, vous isolez tous les composants impliqus dans la rplication de l'ADN chez cet organisme. Vous identifiez: - une activit d'ARN polymrase; - une ADN polymrase qui fonctionne seulement sur de l'ADN monocatnaire (simple brin); - une nouvelle enzyme qui peut gnrer un produit sensible la ADNase en prsence de NADH et d'un produit insensible la ADNase et rsistant la chaleur. D'aprs ces informations, dduisez le mcanisme selon lequel ce micro-organisme rplique son ADN. Gnrations aprs transfert dans 14N 0 1 2

LL

HL

HH

6.17. ARNm et transcription la diffrence de lADN polymrase, lARN polymrase neffectue pas de relecture avec correction ventuelle de son produit. a) Pourquoi cette absence dautocorrection de la synthse dARN ne menace-t-elle pas la viabilit cellulaire?

19

b) En quoi le fait, pour un organisme, de possder une enzyme utilisant lARN comme matrice pour synthtiser lADN modifierait-il le taux de mutation de cet organisme? *6.18. ARNm et transcription La trs grande majorit des ARNm ont une demi-vie trs courte de lordre de 3 minutes chez les bactries. Quelle raison a pouss lvolution faonner les ARNm en molcules aussi instables? 6.19. ARNm et transcription Si lARN polymrase allonge lARN la vitesse de 35 70 nuclotides par seconde et si chaque molcule de polymrase saccole 70 paires de bases dADN : a) Quelle est la vitesse maximale de transcription par minute laquelle un gne de 6000 paires de bases est transcrit en molcules dARN? b) Quel est le nombre maximal de molcules de polymrases qui pourraient se retrouver attaches ce gne un moment donn? 6.20. Codage des protines. Soit l'ARNm suivant: AGU CUC UGU CUC CAU UUG AAG AAG GGG AAG GGG a) indiquez la squence d'acides amins qui sont cods (lecture de 5' vers 3'). Le tableau contenant le code gntique est inclus en annexe. b) on obtient des mutations qui consistent en l'addition ou la dltion d'un seul nuclotide. Si on insre G entre le troisime et le quatrime nuclotide de la squence prcdente, et que l'on limine le dixime nuclotide partir de la droite (cest un G), quelle sera la squence peptidique obtenue? 6.21. Codage des protines. La squence d'acides amins d'une partie du lysozyme provenant d'un bactriophage T4 de type sauvage et d'un mutant sont: type sauvage: mutant: -Tyr-Lys-Ser-Pro-Ser-Leu-Asn-Ala-Ala-Lys-Tyr-Lys-Val-His-His-Leu-Met-Ala-Ala-Lys-

a) ce mutant peut-il tre le rsultat du changement d'une seule paire de bases dans l'ADN du phage T4? Si non comment ce mutant peut-il avoir t produit? b) quelle est la squence en bases de l'ARNm qui code pour les cinq acides amins du type sauvage qui sont diffrents dans le mutant? 6.22. Codage des protines.
20

Un brin d'ADN comporte la squence indique ci-dessous: 5' TCGTTTACGATCCCCATTTCGTACTCGA 3' a) quelle est la squence des bases de l'autre brin d'ADN? b) quelle est la squence des bases de l'ARNm transcrit partir du premier brin? c) quelle est la squence en acides amins cods? d) quelle est la squence en acides amins cods si le second T de l'extrmit 3' de l'ADN fait l'objet d'une dltion?

6.23. Gnie gntique. Donnez les fragments de restriction obtenus suite la digestion du fragment suivant avec lenzyme EcoR I : 5ATGCTCGATCGATCGAATTCTATAGCCCGGGGCTGGATCCAGGTACCAAGTTAAGCTTG3 3TACGAGCTAGCTAGCTTAAGATATCGGGCCCCGACCTAGGTCCATGGTTCAATTCGAAC5 6.24. Gnie gntique. Donnez les fragments de restriction obtenus suite la digestion du fragment prsent au problme 6.23 avec lenzyme BamH I. 6.25. Gnie gntique. Donnez les fragments de restriction obtenus suite la digestion du fragment prsent au problme 6.23 avec lenzyme Sma I. 6.26. Gnie gntique. Donnez les fragments de restriction obtenus suite la digestion du fragment prsent au problme 6.23 avec la fois les enzymes Kpn I et Hind III. 6.27. Gnie gntique. Vous dsirez cartographier le gnome du bactriophage (ADN double brin linaire). Pour cela, vous marquez le gnome de (longueur totale de 48,500 pb) une seule de ses extrmits 5 avec du phosphore radioactif (32P). Vous le digrez ensuite avec diffrentes enzymes de restriction sous des conditions permettant une digestion partielle de lADN. Vous analysez les fragments obtenus par lectrophorse sur gel dagarose, suivie dune autoradiographie afin de visualiser lADN radioactif. Vous obtenez alors les rsultats dcrits dans le tableau ci-dessous. a) Calculez la longueur des fragments de restriction obtenus. b) tablissez une carte de restriction du phage .

21

ADN standard Longueur (pb) Distance migre (cm) 23 130 3.5 9 416 4.1 6 557 4.5 4 361 4.9 2 320 5.25 2 027 6.15 560 6.7

Apa I Distance migre (cm) 2.76 4.12

Pvu I Distance migre (cm) 2.76 3.02 3.29 3.98

BamH I Distance migre (cm) 2.76 2.89 3.06 3.24 3.43 4.65

22

Annexes

23

Annexe 1 pKas et pI des acides amins

pKa1 G A V L I P F Y W S T C M N Q D E K R H 2,34 2,34 2,32 2,36 2,36 1,99 1,83 2,20 2,83 2,21 2,63 1,71 2,28 2,02 2,17 2.09 2,19 2,18 2,17 1,82

pKa2 9,60 9,69 9,62 9,60 9,68 10,6 9,13 9,11 9,39 9,15 10.43 10.78 9,21 8,80 9,13 9,82 9,67 8,95 9,04 9,17

pKr

pI 5,97 6,01 5,97 5,98 6,02 6,48 5,48 5,66 5,89 5,68 5,87 5,07 5,74 5,41 5,65 2,77 3,22 9,74 10,76 7,59

10,07

13,60 13,60 8.33

3,86 4,25 10,79 12,48 6,00

24

Annexe 2 Le code gntique


Base en 5' Base centrale
U Phe Phe Leu Leu Leu Leu Leu Leu Ile Ile Ile Met Val Val Val Val C Ser Ser Ser Ser Pro Pro Pro Pro Thr Thr Thr Thr Ala Ala Ala Ala A Tyr Tyr Stop Stop His His Gln Gln Asn Asn Lys Lys Asp Asp Glu Glu G Cys Cys Stop Trp Arg Arg Arg Arg Ser Ser Arg Arg Gly Gly Gly Gly

Base en 3'

U C A G U C A G U C A G U C A G

25

Solutions

26

Chapitre 1: Equilibre acide-base et spectrophotomtrie


1.1 quilibre acide-base : a) Comme le HCl est un acide fort, il se dissociera compltement lorsque mis en solution : HCl H+ + Cl-

Ainsi, comme la concentration de HCl de dpart est de 0.35M, la stoechiomtrie nous indique que la concentration finale de H+ dans la solution sera aussi de 0.35M. Nous aurons donc : pH = - log[H+] = -log 0.35 = 0.46 b) Lacide actique en solution se dissociera lui aussi : CH3-COOH CH3-COO- + H+

Par contre, comme il sagit dun acide faible, il ne se dissociera pas compltement. Nous devrons donc tenir compte de la constante dassociation (Ka) dans nos calculs. Cette constante est dfinie de la manire suivante : pKa = - log Ka Donc Ka = 1/10pKa = 1.74 x 10-5M On peut alors facilement calculer la concentration en H+ : Ka = [H+] [CH3COO-] [CH3COOH] 1.74 x 10-5M = [H+] [CH3COO-] 0.35 M 1.74 x 10-5M x 0.35M = [H+] [CH3COO-] = [H+]2 [H+] = (6.09 x 10-6 M2)1/2 = 2.47 x 10-3M Enfin: pH = - log [H+] = - log 2,47 x 10-3 = 2.61

c) Suivant la mme procdure quen (b), nous obtenons un pH de 3.11.

27

1.2 quilibre acide-base : a) On a un acide faible. Lquilibre acide-base sera donc le suivant : HA H+ + A-

On peut dterminer le Ka de la manire suivante : Ka = [H+] [A-] [HA] Lnonc du problme indique que cet acide nest ionis qu 2% (ou 0.20, cest pareil). Ceci nous permet de dterminer les concentrations respectives de HA, H+ et A- : [H+] = [A-] = 0.20M x 0.02 = 0.004M [HA] = 0.2M [H+] = 0.196 M Ainsi : Ka = [H+] [A-] [HA] Ka = 0.004M x 0.004M 0.196 M Ka = 8.16 x 10-5 M b) Le pH de cette solution sera donc de : pH = - log [H+] = - log 0.004M = 2.39

1.3 quilibre acide-base : a) Ce mlange constitue une solution tampon fabrique avec lacide actique et sa base conjugue, lactate de sodium : H+ + CH3COO- Na+

CH3COOH

Le pH de ce type de solution peut facilement tre dtermin grce lquation dHendersonHasselbach :

pH = pKa + log [Base conjugue] [Acide]

28

pH = 4.76 + log 0.5M = 4.46 1M

b) On a lquilibre suivant : H3PO4 H+ + H2PO4- K+

Utilisant la mme procdure quen (a), on obtient : pH = pKa + log [H2PO4-] [H3PO4] pH = 2.14 + log 0.8 M 0.3 M pH = 2.57

1.4 quilibre acide-base : Nous avons ici lquilibre suivant : H2PO4Et le pKa donn est de 7.21. Lquation dHenderson-Hasselbach nous donne: pH = pKa + log [HPO4-2] [H2PO4-] 7,00 = 7.21 + log [x] 0.1 M H+ + HPO4-2

-0.21 = log x log 0.1 M -0.21 + log 0.1 M = log x = -1,21 x = 10logx = 0.062 M

1.5 quilibre acide-base : On a toujours lquilibre acide base suivant : H2PO4H+ + HPO4-2

29

Daprs lnonc du problme, on a : [H2PO4-] + [HPO4-2] = 0.3M Ainsi : [H2PO4-] = 0.3 M - [HPO4-2] partir de lquation dHenderson-Hasselbach, on aura donc : pH = pKa + log [HPO4-2] [H2PO4-] 7,00 = 7.21 + log [HPO4-2] [H2PO4-] 7,00 = 7.21 + log [HPO4-2] [H2PO4-] -0.21 = log [HPO4-2] [H2PO4-] 10-0.21 = [HPO4-2] [H2PO4-] 0.616 = [HPO4-2] [H2PO4-] 0.616 x [H2PO4-] = [HPO4-2] Ceci est identique : 0.616 x (0.3M - [HPO4-2]) = [HPO4-2] 0.185 0.616 x [HPO4-2] = [HPO4-2] 0.185 = 1.616 x [HPO4-2] 0.114 M = [HPO4-2] Et la concentration de [H2PO4-] sera : [H2PO4-] = 0.3M - [HPO4-2] = 0.186 M

1.6 Spectrophotomtrie La relation entre labsorbance dune solution et sa concentration est donne par lquation de Beer-Lambert : A = cl

30

O :

A = absorbance = coefficient dextinction molaire (units : litres x mol-1 x cm-1) c = concentration (units : mol/l = M) l = trajet optique (paisseur de la cuvette; units : cm)

On aura alors : 0.71 = 1.420 l mol-1 cm-1 x c x 1 cm c = 0.71 mol cm 1420 l x 1 cm c = 5 x 10-4 M Si on utilise une cuvette de 0.1 cm, on aura: 0.71 = 1.420 l mol-1 cm-1 x c x 0.1 cm c = 0.71 mol cm 1420 l x 0.1 cm c = 0.005 M

1.7 Spectrophotomtrie Grce lquation de Beer-Lambert, on a : A = cl Ainsi : A = 1420 l mol-1 cm-1 x (37 x 10-3M) x 1cm A = 52.54

1.8 Spectrophotomtrie Nous devons tout dabords tracer la courbe standard de labsorbance en fonction de la concentration en hmoglobine. Ce graphique est reprsent la page suivante. Comme linconnu a une absorbance de 0.303, nous pouvons reporter cette valeur sur la courbe standard afin de trouver la concentration en hmoglobine correspondante, qui est de 6.31g/mL. Cette valeur peut aussi tre obtenue avec beaucoup plus de prcision en utilisant lquation dune droite : y = mx + b o y = valeur sur laxes des y x = valeur sur laxe des x
31

m = pente de la droite b = intersection sur laxe des y Les valeurs de m et b sont obtenues soit directement sur le graphique, soit en les calculant par rgression linaire (de loin la meilleure mthode). Donc, on aura : y = 0.0441x + 0.0246 x = (y-b)/m x = (0.303-0.0246)/0.0441mLg-1 = 6.31 g/mL.

0.8

0.7

0.6

Absorbance

0.5

A = 0.303
0.4

0.3

0.2

6.31 g
0.1

0 0 2 4 6 8 10 12 14 16 18

Concentration hmoglobine (g/mL)

32

Chapitre 2: Acides amins


* 2.1. Poids molculaire d'un acide amin. Suite l'ajout du NaOH, on assiste un dplacement de l'quilibre acide-base de l'acide amin vers la forme basique:

NH3+-CH(R)-COO-

NH2-CH(R)-COO-

l'aide de l'quation d'Henderson-Hasselbach, il est possible d'obtenir la proportion d'acide amin sous forme de base et d'acide suite l'ajout du NaOH: pH = pKa + Log [base] / [acide] 10,4 = 9,7 + Log [base] / [acide] 0,7 = Log [base] / [acide] 5,011 = [base] / [acide] Comme 0,01 mol de NaOH (100 ml de 0,1M) a t utilise afin d'atteindre pH 10,4, ceci nous indique que 0,01 mol de l'acide amin a t convertie en base. Nous aurons donc: 5,011 = [base] / [acide] 5,011 = 0,01 mol /[acide] [acide] = 0,002 mol La somme de la quantit d'acide amin sous forme basique et acide nous donne la quantit totale d'acide amin, soit 0,012 mol. Il ne reste plus qu' utiliser ces donnes afin d'obtenir le poids molculaire: 1,812 g = 0,012 mol Donc, poids molculaire: g / mol = 1,812 g /0,012 mol = 151 g / mol

2.2. Courbe de titrage. Le titrage de l'histidine implique les quilibres acide/base suivants:
H+N CH2 CH COOH HN NH3
+

H+N CH2 CH COO HN NH3


+

N CH2 CH COO HN NH3


+

N CH2 CH COO HN NH2

pKa1

pKaR
33

pKa2

Afin de dessiner la courbe de titrage, nous avons besoin des valeurs des pKas et des points d'inflexions. Pour l'histidine, les pKas sont les suivants: pKa1: 1,82 pKaR: 6,00 pKa2: 9,17 Par dfinition toujours, le pKa est le point o la moiti de l'acide amin dans la solution a perdu un proton, alors que l'autre moiti possde encore ce proton. Les points d'inflexion sont dtermins par la moyenne arithmtique de deux pKa conscutifs: point d'inflexion no. 1: (1,82 + 6,00) / 2 = 3,91 point d'inflexion no. 2: ( 6,00 + 9,17) / 2 = 7,59 Le pI est dfini comme tant le pH o la charge nette de l'acide amin est neutre, et il est dtermin par la moyenne arithmtique des pKas prcdant et suivant l'espce neutre de l'acide amin. Pour l'histidine, le pI sera donc de 7,59 (soit le point d'inflexion no. 2). On peut ainsi dessiner la courbe de titrage de l'histidine (voir page suivante).

2.3. Charge nette des acides amins. Pour dterminer la charge nette d'acides amins diffrents pH, on doit d'abord dterminer le pI de ces diffrents acides amins. Avec cette information, la charge de l'acide amin peut tre dduite diffrents pH: en effet, par dfinition, la charge de l'acide amin un pH gal son pI est nulle. un pH infrieur son pI, l'acide amin est charg positivement, alors qu'il est charg ngativement un pH suprieur son pI. Ainsi, pour ce qui est de ce problme, nous obtenons les rsultats suivants:

pH

glycine (pI: 5.97) + + + -

srine (pI: 5.68) + + 0 -

2.01 3.96 5.68 10.76

acide aspartique (pI: 2.77) + -

glutamine (pI: 5.68) + + 0 -

arginine (pI: 10.76) + + + 0

34

Graphe du problme 2.2.


pKa2=9.17

9.0

pI = 7.59

7.5

100%
HN

CH2 CH COO NH3+

pKaR=6.0

pH

6.0

H+N

3.91

100%
HN

CH2 CH COO NH3+

pKa1=1.82

1.82

0.5

1.0

1.5

2.0

2.5

3.0

quivalents dions OHH+N

50% pKa1 50%


HN N HN H+N

CH2 CH COOH NH3


+

H+N

50% pKaR 50%


HN HN N

CH2 CH COO NH3+ CH2 CH COO NH3+

CH2 CH COO NH3+

50% pKa2 50%

CH2 CH COO HN N HN NH3+ CH2 CH COO NH2

35

2.4. Chromatographie changeuse d'ions. On dbute la chromatographie pH 10. ce pH, tous les acides amins dans le mlange seront chargs ngativement (pH est suprieur au pI). a) sur une rsine changeuse de cations, aucun des acides amins ne s'accrochera la rsine et ils seront donc tous retrouvs dans l'luant. b) sur une rsine changeuse d'anions, tous les acides amins s'accrocheront la rsine. Au fur et mesure que l'on diminue le pH, les acides amins lueront ds que le pH du tampon deviendra infrieur leur pI. Ainsi, dans l'ordre, on recueillera: 1- lysine 2- isoleucine, alanine, glycine (tous trois peu prs en mme temps cause de leur pI rapprochs) 3- acide glutamique. videmment, c'est la rsine changeuse d'anions qui donnera la meilleure sparation.

2.5. Acides amins Seulement deux acides amins peuvent gnrer d'autres acides amins en librant de l'ammoniac: l'asparagine et la glutamine: O C-CH2-CH-COOH H2N H2N ASN HO H2O NH3 O C-CH2-CH-COOH H2N ASP

O C-CH2-CH2-CH-COOH H2N GLN H2N

H2O

NH3

O C-CH2-CH2-CH-COOH HO GLU H2N

*2.6. Acides amins Cette observation ne peut tre explique que si l'on assume que la srine est d'abord insre dans la casine lors de la traduction, et que le groupe phosphate lui est attach une fois la synthse protique termine. Les rsultats exprimentaux confirment cette hypothse.

36

*2.7. Chromatographie changeuse d'ions. Comme ces quatre acides amins peuvent tre spars sur une rsine changeuse d'ions, mais que leurs pKa est presque qu'identique, une diffrence structurale quelconque doit logiquement tre responsable de la diffrence de comportement de ces acides amins lors de la chromatographie. L'examen de la structure de la glycine, l'alanine, la valine et la leucine rvle une augmentation croissante du caractre hydrophobe de la chane latrale. On peut donc conclure que ces acides amins forment des interactions hydrophobes d'intensit diffrente avec la rsine changeuse d'ions, ce qui permet leur sparation. 2.8. Peptides. Comme les rendements en leucine, arginine et tryptophane sont similaires, on peu conclure qu'ils devraient tre en proportion gale. De plus, comparativement la leucine, l'arginine et le tryptophane, on a recueilli approximativement deux fois plus de glutamate et quatre fois plus d'alanine et de lysine. La formule empirique de ce petit peptide devrait donc tre: (Arg, Leu, Trp, Glu2, Ala4, Lys4)n Cette exprience ne nous permet pas cependant de connatre la squence de ce peptide.

2.9. Peptides. La structure du peptide GWYQR (Glycyl-Tryptophanyl-Tyrosyl-Glutaminyl-Arginine) est:

O O O O H2N-CH2-C-NH-CH-C-NH-CH-C-NH-CH-C-NH-CH-COOH CH2 (CH2)3 CH2 CH2 CH2 NH C C NH O NH NH2 NH2 OH Afin de dterminer quelle sera la forme ionise de ce peptide aux diffrents pH, il suffit de prendre note du pKa des diffrents groupes chargs (y compris les chanes latrales), et de dduire l'tat d'ionisation de chacun de ces groupes ( pH<pKa: forme protone; pH>pKa: forme non-protone):

pH 2: Tous les groupes sont protons: O O O O H3N-CH2-C-NH-CH-C-NH-CH-C-NH-CH-C-NH-CH-COOH CH2 (CH2)3 CH2 CH2 CH2 NH C C NH2+ O NH NH2 NH2 OH
+

37

pH 7: Le groupe carboxyl de l'arginine est ionis (pH>pKa). Par contre, la chane latrales de larginine et le groupe amino de la glycine sont toujours protons (pH<pKa): O O O O H3N-CH2-C-NH-CH-C-NH-CH-C-NH-CH-C-NH-CH-COO CH2 (CH2)3 CH2 CH2 CH2 NH C C NH2+ O NH NH2 NH2 OH
+

pH 10,5: Ici, le groupe amino de la glycine et la chane latrale de la tyrosine sont dprotons (pH>pKa). Par contre, le groupe amino de la chane latrale de l'arginine demeure proton (pH<pKa):

O O O O H2N-CH2-C-NH-CH-C-NH-CH-C-NH-CH-C-NH-CH-COO CH2 (CH2)3 CH2 CH2 CH2 NH C C NH2+ O NH NH2 NH2 O-

Chapitre 3. Proprits gnrales et purification des protines


3.1. Purification des protines. La prcipitation au sulfate d'ammonium permet de concentrer la protine d'intrt en prcipitant de manire non-spcifique une proportion gnralement importante des protines contenues dans l'extrait brut. On obtient donc trs aisment une purification partielle de la protine, qui peut ensuite subir d'autres tapes de purification. 3.2. Purification des protines. Le groupe dithylamino (-CH2-CH2-NH+-CH2-CH3) du DEAE-cellulose porte une charge positive qui est la base du fonctionnement de cette colonne. En effet, les acides amins/protines charges ngativement vont lier (via des liaisons lectrostatiques) le groupe dithylamino, alors que les acides amins/protines chargs positivement se retrouveront dans l'luant. Comme le groupe dithylamino possde un pKa voisin de 8,5, ce groupe sera dproton un pH suprieur 8,5, ce qui lui enlve toute sa capacit lier des substances charges
38

ngativement. 3.3. Purification des protines. un pI suprieur 6, la 6-phosphogluconate dshydrognase possde une charge globale ngative (pH>pI): elle peut donc lier la colonne. un pH suprieur 9, le groupe dithylamino de la colonne perd son proton, empchant du mme coup toute sparation de l'enzyme selon sa charge. 3.4. Purification des protines. Non, car la CM-cellulose (CM = carboxymthyl = -CH2-COOH) est une rsine changeuse de cations: un pH suprieur 6, la 6-phosphogluconate dshydrognase est charge ngativement (voir problme 3.3) et ne peut donc pas lier la colonne. 3.5. Purification des protines. Afin de sparer la 6-phosphogluconate dshydrognase sur une colonne de CM-cellulose, on doit s'assurer que la protine possde une charge globale positive. Le pH du tampon devra donc tre infrieur au pI de la protine, soit infrieur 6. 3.6. Purification des protines. Afin d'luer des protines lies sur une rsine changeuse d'ions, deux possibilits s'offrent au biochimiste: utiliser soit un gradient de pH, soit de sel (gnralement du NaCl). Dans la cas o l'on a choisi d'utiliser un gradient de NaCl, on dbute gnralement avec un tampon de faible force ionique, pour par la suite utiliser une srie de tampons dont la concentration en NaCl augmente graduellement. Les ions Na+ ou Cl- dcrocheront les protines de la colonne en neutralisant les charges ngatives ou positives qui permettent aux protines d'interagir avec la rsine. Le rsultat est l'lution des protines selon leur densit de charge: en effet, afin d'tre dcroches d'une colonne changeuse de cations, les protines possdant moins de charges positive ncessiteront moins d'ions Cl- (donc une concentration de NaCl moins leve) pour neutraliser leurs charges que des protines possdant plus de charges positives. La mme logique s'applique aux ions Na+ lors de l'lution de protines fixes une rsine changeuse d'anions (e.g. CM-cellulose). Dans le cas qui nous concerne, on peut donc conclure que : - la myoglobine luera la premire car elle ne se fixera pas la colonne (pH<pI: donc charge nette positive); - le pI de l'urase (5,4) est plus rapproch du pH du tampon que le pI de l'ovalbumine (4,6): l'urase possdera donc une charge globale nette moins ngative que l'ovalbumine. On peut donc prdire que l'urase luera une concentration de NaCl infrieure celle requise pour luer l'ovalbumine. L'ordre d'lution sera donc: myoglobine, urase, ovalbumine. 3.7. Purification des protines. Une manire simple et rapide de sparer ces protines est d'effectuer d'abord une chromatographie sur rsine changeuse d'ions: il est alors possible de se dbarrasser de la
39

protine dont le pI est diffrent de notre enzyme. En seconde tape, on peut effectuer un tamisage molculaire afin de sparer notre enzyme (Mr 24 kDa) de l'autre protine contaminante (Mr 100 kDa). Note: Des rsultats similaires seraient obtenus si l'on effectue d'abord le tamisage, suivi de la chromatographie sur rsine changeuse d'ions. 3.8. Purification des protines. a) L'activit spcifique tant dfinie comme tant le nombre d'unit enzymatique par mg de protine, nous n'avons qu' diviser le nombre d'units enzymatiques dtermines exprimentalement par la quantit de protine dans l'extrait. Ainsi, pour l'tape du traitement la chaleur, on aura: activit spcifique = activit enzymatique / mg protine activit spcifique = 1 980 U/16 500 mg = 0,12 U/mg Le pourcentage de rendement est dfini comme la quantit d'enzyme (ou de protine) recueilli aprs x tapes par rapport la quantit prsente initialement dans l'extrait brut. Il est obtenu en divisant l'activit enzymatique l'tape x par l'activit enzymatique initiale. Toujours pour l'tape de dnaturation la chaleur, on aura: Pourcentage de rendement = act. enzym. tape x / act. enzym. initiale Pourcentage de rendement = (1 980 U/2 700U) x 100 = 73,3 %

Quant au degr de purification, il est obtenu en divisant l'activit spcifique aprs l'tape x par l'activit spcifique initiale. On obtient alors le nombre de fois que notre enzyme fut concentre (donc purifie) aprs les traitements effectus. Pour l'tape de dnaturation la chaleur, on aura: Degr de purification = act. spcif. tape x / act. spcif. initiale Degr de purification = 0,12/0,039 = 3,07 fois.

Les rsultats pour chacune des tapes de purification sont indiqus dans le tableau ci-dessous:

tape de purification Extrait cellulaire Sulfate d'ammonium

Activit spcifique (U/mg) 0,039 0,09

Pourcentage de rendement 100% 85,2%

Degr de purification (n fois) --2,30

40

tape de purification Dnaturation chaleur Chromato. DEAE CM-cellulose Bio-Gel A

Activit spcifique (U/mg) 0,12 4,31 28,72 32,00

Pourcentage de rendement 73,3% 62,2% 50% 41,5%

Degr de purification (n fois) 3,07 110,50 736,40 820,50

b) Afin de dterminer quelle tape fut la plus efficace dans la purification de notre enzyme, il s'agit de diviser le degr de purification aprs une tape x par le degr de purification de l'tape prcdente. Ainsi, l'tape de chromatographie sur DEAE a permis la plus grande purification de l'enzyme, soit 36 fois. c) Considrant que la protine est pure aprs tamisage molculaire, on aura donc recueilli 35 mg de 6-gluconate dshydrognase. Ceci correspond 41,5 % de la quantit d'enzyme prsente initialement dans l'extrait (c.f. pourcentage de rendement). Ainsi, dans notre extrait initial, on avait: 35 mg / 41,5% = 75,9 mg Et cette quantit d'enzyme tait initialement prsente dans 70 000 mg de protine. On avait donc dans l'extrait brut: (75,9 mg / 70 000 mg) x 100 = 0,108 % de 6-gluconate dshydrognase

3.9. Purification des protines. Le but de la focalisation lectrique consiste sparer des protines selon leur point isolectrique, donc selon leur diffrence de charge diffrents pH. Le fait d'ajouter du SDS ferait en sorte que toutes les protines auraient la mme densit de charge et, donc, ne pourraient pas tre spares selon ce type d'lectrophorse. 3.10. Purification des protines. Afin de dterminer le poids molculaire de la protine inconnue, il suffit de tracer le graphe du volume d'lution en fonction du log du poids molculaire (voir graphe la page suivante). Protine dextran bleu lysozyme chymotrypsinogne ovalbumine Log Mr 6,000 4,146 4,398 4,653 Vel (ml) 85,00 200,00 190,00 170,00
41

Protine srum albumine aldolase urase ferritine ovomucoide

Log Mr 4,813 5,176 5,699 5,845 4,447

Vel (ml) 150,00 125,00 90,00 92,00 160,00

En dterminant sur le graphe le poids molculaire correspondant au volume d'lution obtenu pour l'inconnu, on obtient une valeur de 139 kDa. Note: la valeur de volume d'lution obtenue pour la ferritine et l'ovomucoide furent exclus de la courbe car ces protines semblent se comporter diffremment aux autres standards lors de la chromatographie sur gel de sphadex. Graphique, problme 3.10

Lysozyme
200

Chymotrypsinogne
180

Ovalbumine
160

Volume d'lution

Ovomucoide
140

Albumine Aldolase

120

100

Ferritine Urase Dextran

80

Log Mr =5.14 Mr = 139 kDa

60 4 4.2 4.4 4.6 4.8 5 5.2 5.4 5.6 5.8 6

Log masse molculaire

42

*3.11. Purification des protines. La ferritine possde un noyau d'hydroxyde ferrique, lui confrant une densit suprieure aux protines de mme poids molculaire, ce qui influence son comportement en chromatographie sur gel de sphadex. 3.12. Purification des protines. En prsence de SDS, toutes les protines possdent une densit de charge identique: c'est ce qui permet de d'utiliser le systme PAGE-SDS afin d'valuer la masse molculaire des protines. Ainsi, deux protines de pI diffrent mais de masse molculaire identique formeront une seule bande en gel PAGE-SDS. Par contre, en absence de SDS (donc dans des conditions dites natives ou non-dnaturantes), la migration des protines vers les bornes ngatives ou positives se fera en fonction de leur charge globale, donc de leur pI. Dans ce cas, deux protines de masse molculaire identique mais de pI diffrents donneront deux bandes distinctes suite la coloration du gel. 3.13. Purification des protines. En absence de -mercaptothanol, les ponts disulfure au sein de la protine demeurent intacts. Ainsi la protine adoptera une conformation plus compacte, et migrera plus rapidement en gel de PAGE-SDS qu'un chantillon de la mme protine dont les ponts disulfure ont t rduits et qui, par le fait mme, possde une structure plus allonge. 3.14. Squenage de polypeptides a) La trypsine hydrolyse le lien peptidique du ct carboxy de acides amins basiques arginine et lysine. Les fragments de digestion avec la trypsine possderont tous des rsidus Arg ou Lys en C-terminal, sauf bien entendu le fragment correspondant l'extrmit C-terminal du peptide. Ainsi, avec le peptide dcrit ici, nous obtiendrons les deux fragments suivants: A-L-K M-P-E-Y-I-S-T-D-Q-S-N-W-H-H-R

b) la pepsine hydrolyse le lien peptidique du ct N-terminal des acides amins aromatiques Phe, Trp, et Tyr. Les fragments de digestion la pepsine possderont donc tous un rsidu Tyr, Trp ou Phe leur extrmit N-terminale, sauf bien sr le fragment possdant le rsidu N-terminal du peptide initial. On obtiendra donc les trois produits de digestion suivants: A-L-K-M-P-E Y-I-S-T-D-Q-S-N W-H-H-R

c) la protase V8 hydrolyse le lien peptidique du ct C-terminal des acides amins acides Asp et Glu. Les fragments de digestion obtenus possderont donc tous un rsidu Asp ou Glu leur Cterminal, sauf bien sr le fragment possdant le rsidu C-terminal du peptide initial. On obtiendra alors les trois fragments suivants: A-L-K-M-P-E Y-I-S-T-D Q-S-N-W-H-H-R

43

d) le bromure de cyanogne hydrolyse le lien peptidique au niveau du C-terminal des rsidus mthionine. Les fragments de digestion obtenus auront donc tous un rsidu Met leur Cterminal, sauf bien entendu le fragment correspondant au C-terminal du peptide. On aura alors les deux fragments suivants: A-L-K-M P-E-Y-I-S-T-D-Q-S-N-W-H-H-R

3.15. Squenage de polypeptides La digestion la carboxypeptidase A nous indique que le rsidu C-terminal du peptide est Ala. La digestion la trypsine nous permet d'ordonner partiellement deux des quatre fragments obtenus (rappel: la trypsine gnre des fragments dont le C-terminal est Arg ou Lys): Ala-Arg (Phe, Ser)-Lys

De plus, la digestion la trypsine indique quune Lys est situ du ct C-terminal de Lys ou Arg (libration d'une lysine avec la trypsine). La digestion la trypsine indique aussi que le tripeptide (Ala, Met, Ser) correspond au Cterminal du peptide (il n'y a pas de Arg ou Lys dans ce fragment). De plus, la digestion au CNBr nous permet de dduire la position de la mthionine dans ce tripeptide comme tant: Met-(Ala, Ser) L'alanine tant le rsidu C-terminal du peptide (voir digestion la carboxypeptidase A), la squence des trois rsidus du C-terminal du peptide sera: Met-Ser-Ala La thermolysine coupe du ct N-terminal de rsidus hydrophobes: on peut donc dduire la position des rsidus hydrophobes des deux fragments obtenus: Ala-(Arg, Ser) Phe-(Lys, Lys,)-Met-Ser

Avec cette dernire information et considrant le patron de digestion la trypsine, on peut conclure que la squence du peptide est: Ala-Arg-Ser-Phe-Lys-Lys-Met-Ser-Ala 3.16. Squenage de polypeptides La thermolysine coupe le lien peptidique du ct N-terminal de rsidus hydrophobes. La digestion des deux fragments du peptide suite la rduction des ponts S-S nous donne: chane 1: chane 2: A-C C F-P-R-K Y-C F-C
44

W-C-R-R

V-C

Comme les liens disulfures du peptide sont intacts lors de la digestion la thermolysine, certains des fragments dcrits ci-dessus seront lis via des ponts S-S impliquant des Cys. Selon les fragments de digestion alors obtenus, on peut dduire la position des ponts S-S comme tant: S-S A-C-F-P-K-R-W-C-R-R-V-C S-S C-Y-C-F-C -S SNote: n'oublions pas qu' la fois des ponts S-S- intrachane et interchanes peuvent tre prsents dans la molcule. 3.17. Squenage de polypeptides La digestion la carboxypeptidase indique que le C-terminal est Lys Le traitement au DNFB indique que le N-terminal est Val La digestion la trypsine nous permet d'ordonner partiellement les peptides obtenus comme suit: peptide C: Try-Ala-Lys terminal) peptide D: Val-(Ala, Ala, Ala, Pro)-Lys (rappel: Val est N-

peptide E: Met-(Asp, Gly)-Arg On peut ordonner le peptide E grce aux rsultats du traitement au CNBr: Met-Gly-Asp-Arg Finalement, le traitement avec la thermolysine permet dordonner les Ala par rapport Pro : Val-Ala-Ala-Ala-Pro-Lys La squence du peptide est donc: Val-Ala-Ala-Ala-Pro-Lys-Met-Gly-Asp-Arg-Try-Ala-Lys

Chapitre 4. Structure tridimensionnelle des protines


4.1. Structure 3-D des protines Rgle gnrale, les acides amins hydrophobes sont retrouvs l'intrieur des protines (donc
45

l'abri du solvant aqueux), et les rsidus polaires ou chargs sont retrouvs la surface des protines. On aura donc la distribution suivante: Intrieur: Val, Phe, Ileu Surface: Glu, Arg, Asn, Lys, Ser, Thr *4.2. Structure 3-D des protines La structure de l'ure suggre que celle-ci dnature les protines en brisant les ponts H stabilisant la structure tridimensionnelle de la macromolcule (interaction des groupes amino et ctone de l'ure avec les groupes amino et ctone du lien peptidique et avec les chanes latrales). 4.3. Structure 3-D des protines Mme si elle est situe la surface d'une protine, la phnylalanine doit viter le contact avec le solvant aqueux. Ceci peut tre accompli si deux ou plusieurs sous-units d'une protine globulaire tablissent des contacts entre-elles via des rgions hydrophobes (pouvant inclure la Phe), protgeant ainsi ces rsidus non-polaires du solvant aqueux. *4.4. Structure 3-D des protines La prsence de lAsp l'intrieur des protines est possible si ce dernier peut tablir des interactions intermolculaires impliquant ses groupements polaires et chargs. Ceci est entreautre possible via l'inclusion de l'Asp dans une structure secondaire de type hlice . 4.5. Structure 3-D des protines La protine 1 possde un contenu lev en acides amins hydrophiles, et relativement peu de rsidus hydrophobes (65% hydrophiles/35% hydrophobes). Ceci suggre que de nombreux rsidus de cette protine sont en contact avec le solvant, ce qui est le cas pour les protines en forme de btonnets (qui sont allonges). Il s'agirait donc de la protine A. La protine 3 possde un rapport acides amins hydrophiles/hydrophobe de 50%/50%, alors que celui de la protine 2 est de 30%/70%. Ceci tend suggrer que la protine 3 serait de forme globulaire, avec de nombreux rsidus hydrophobes enfouis l'intrieur, et plusieurs acides amins hydrophobes la surface. La protine 3 serait donc la protine B. Quand la protine 2, son contenu lev en acides amins hydrophobes et le petit nombre d'acides amins hydrophiles prsents suggre qu'elle pourrait tre la protine C, o l'association des diffrentes sous-units monomriques s'effectuerait au niveau d'acides amins hydrophobes localiss la surface de la protine. 4.6. Structure 3-D des protines La structure primaire de ce peptide ne montre aucune caractristique des structures en feuillet , et il y a absence de rsidus (Gly et Pro) qui normalement dtruisent les structures secondaires. On peut donc en dduire que ce peptide pourrait adopter une structure secondaire en hlice . 4.7. Structure 3-D des protines La structure primaire de ce peptide est caractristique des protines adoptant un structure
46

secondaire en segment . 4.8. Structure 3-D des protines La prsence de plusieurs rsidus chargs positivement (Arg et Lys) ainsi que de la glycine indique que ce peptide n'adoptera aucune structure secondaire prcise (donc pelote statistique).

4.9. Structure 3-D des protines Grce aux mmes critres tablis au cours des trois problmes prcdents, on peut dduire que: acides amins 2-12: hlice ; acides amins 13-17: pelote statistique (random coil); acides amins 18-26: segment en structure .

4.10. Structure 3-D des protines La composition leve en Pro et Hypro indique que la protine C adopte un structure en triple hlice de collagne. La protine A est riche en acides amins chane latrale petite (Gly, Ser, Ala): elle adoptera donc une structure en feuillet . La protine B possde une composition en acides amins qui pourrait mener la formation d'une hlice . Cependant, cette hlice pourrait tre dstructure par la prsence occasionnelle de rsidus Gly et Pro, et par la prsence d'acides amins basiques ou acides conscutifs.

Chapitre 5. Enzymologie
5.1. Cintique enzymatique a) D'aprs les donnes disponibles, on remarque que la vitesse de la raction enzymatique n'augmente pas lorsque la concentration de substrat dpasse 2 x 10-3 M. Ceci constitue donc la vitesse maximale (Vmax) de l'enzyme, soit 60 mol/min. b) v est constant une [S] suprieure 2 x 10-3 M car l'enzyme est alors sature par le substrat. c) Comme une concentration de 2 x 10-2 M on a atteint la vitesse maximale de catalyse par l'enzyme, presque tout l'enzyme existe sous la forme d'un complexe enzyme/substrat. La quantit d'enzyme libre dans le milieu ractionnel est alors ngligeable. 5.2. Cintique enzymatique a) Vmax = 0,25 mol/min; b) Le Km peut tre dtermin en utilisant l'quation de Michaelis-Menten:
47

v = [S] Vmax [S] + Km v[S] + vKm = [S]Vmax vKm = [S]Vmax - v[S] vKm = [S] (Vmax - v) Km = [S] (Vmax - v) v Prenant les donnes pour une [S] de 5 x 10-6: Km = 5 x 10-6 M x (0,25 mol/min - 0,071 mol/min) 0,071 mol/min Km = 1,26 X 10-5 M Note: le mme rsultat sera obtenu si l'on utilise une concentration de substrat diffrente, en autant que v < Vmax.

c) La vitesse initiale sera directement obtenue l'aide de l'quation de Michaelis-Menten: - pour [S] = 1 x 10-6 M: v = [S] Vmax [S] + Km v = 1 x 10-6 M x 0,25 mol/min 1 x 10-6M + 1,26 x 10-5 M v = 0,0184 mol/min - pour [S] = 1 x 10-1M: v = 0,25 mol/min (concentration saturante de substrat: v = Vmax). d) Pour une concentration de substrat de 2 x 10-3 M, la vitesse initiale sera gale au Vmax. On aura alors: v = Vmax = 0,25 mol/min Aprs 5 minutes, on aura alors: 0,25 mol/min x 5 min. = 1,25 mol de produit form.

48

- Pour une concentration de substrat de 2 x 10-6 M, il nous faut d'abord trouver la vitesse de la raction, ce qui est possible grce l'quation de Michaelis-Menten: v = [S] Vmax [S] + Km v = 2 x 10-6 M x 0,25 mol/min 2 x 10-6 M + 1,25 x 10-5 M v = 0,035 mol/min Donc, aprs 5 minutes de raction, on aura: v = 0,035 mol/min x 5 min. = 0,175 mol de produit form. e) Comme le Km est indpendant de la concentration d'enzyme, il ne sera pas affect par l'augmentation de [E] de demeurera gal 1,25 x 10-5 M. Par contre, le Vmax sera altr car: Vmax = kcat x [Et]. Ainsi, comme kcat est une constante, l'augmentation de la concentration d'enzyme par un facteur 4 multipliera aussi le Vmax d'un facteur 4. On aura alors Vmax = 1 mol/min.

5.3. Cintique enzymatique Le graphe de Lineweaver-Burke reprsente la rciproque de la vitesse initiale (1/v) en fonction de la rciproque de la concentration du substrat (1/[S]). D'aprs les donnes du problme, on aura alors les valeurs suivantes:

1/[S] M-1 1000,00 2000,00 10 000 20 000 33 333 50 000 100 000 200 000 1 000 000 2 000 000

1/v (mmol-1 x min.) 0,0154 0,0158 0,0196 0,0238 0,0303 0,0370 0,0588 0,1050 0,4550 0,9090

49

Le graphique de Lineweaver-Burke est reprsent ci-dessous. Le Km est facilement obtenu par la rciproque de l'intersection sur l'axe des x. Dans ce cas-ci, Km = 2.7 x 10-5 M. Quant lui, le Vmax est obtenu par la rciproque de l'intersection sur l'axe des y. Ici, Vmax = 67 mol/min.
1 0.9 0.8 0.7 0.6

-1/Vmax = 0.0149 Vmax = 67 mol/min

1/v

0.5
y = 4E-07x + 0.0149

0.4 0.3

-1/Km = 36,750 Km = 2.7 x 10-5M

0.2 0.1 0

-500000

500000

1000000

1500000

2000000

1/[S]

5.4. Cintique enzymatique Pour dterminer l'affinit de l'enzyme pour son substrat, on doit trouver la valeur de la constante de Michaelis-Menten. Ceci est facilement ralis grce au graphe de Lineweaver-Burke:

1/ [S] (M-1 x 10-4) 5,74 3,75 1,90 0,60 0,25

1/v (mol-1 x min.) (pH 7,6) 13,51 11,76 10,20 8,77 -

1/v (mol-1 x min.) (pH 9,0) 29,41 21,28 13,33 7,81 5,99

50

Le graphe de Lineweaver-Burke est reprsent ci-dessous. L'intersection des droites avec l'axe des x donne la valeur de -1/Km. Sur le graphique, plus la valeur de -1/Km est petite, plus Km sera grand. Km est une constante d'affinit de l'enzyme pour le substrat et est quivalent la concentration de substrat ncessaire afin d'atteindre 1/2 Vmax. Ainsi lorsque Km est lev, l'enzyme a peu d'affinit pour le substrat: il faut beaucoup de substrat l'enzyme afin d'atteindre 1/2 Vmax. D'aprs le graphique, on peut donc constater, sans dterminer exactement leur valeur, que le Km de l'enzyme est suprieur pH 9 par rapport pH 7,6. Ainsi, se sera donc pH 7,6 que l'enzyme aura la plus forte affinit pour son substrat.
35

30

pH = 9
25

20

1/V

15

10

pH = 7.6

0 -10 -8 -6 -4 -2 0 2 4 6 8

1/[S]

5.5. Cintique enzymatique Afin de rsoudre ce problme, nous devons d'abord dessiner le graphe de Lineweaver-Burke. La transformation des donnes donne les rsultats suivants:
1/[S] (M-1) 10 000 6 666,67 5 000 1/v (mmol-1 x min.) 1/v (mmol-1 x min.) sans inhibiteur avec inhibiteur 0,0357 0,0277 0,0233 0,0588 0,0435 0,0345 51

2 000 1 333,33

0,0154 0,0135

0,0200 0,0164

Et le graphe de Lineweaver-Burke est donn ci-dessous. a) le Vmax nous est donn par la rciproque de l'intersection sur l'axe des y. Dans ce cas-ci: 1/Vmax = 0,0101 mol-1 x min. Vmax = 99 mol/min Comme l'intersection sur l'axe des y est la mme en absence qu'en prsence de l'inhibiteur, on peut conclure qu'il s'agit d'une inhibition comptitive.

b) le Km nous est donn par le ngatif de la rciproque de l'intersection sur l'axe des x. Dans ce cas-ci, les Km seront les suivants: - en absence d'inhibiteur: -1/Km = 3 800 M-1 Km = 2,63 x 10-4 M - en prsence de l'inhibiteur: -1/Kmapp = 2000 M-1 Kmapp = 5 x 10-4 M

c) le Ki peut tre dtermin l'aide des donnes prcdentes grce l'quation: Kmapp = Km + Km [I] Ki Ki = Km [I] (Kmapp-Km)

Ki = 2,63 x 10-4 M x 2,2 x 10-4M (5 x 10-4 M - 2,63 x 10-4 M) Ki = 2,44 x 10-4 M

52

0.07

0.06
y = 5E-06x + 0.01

Avec inhibiteur

0.05

1/V

1/Vmax = 0.0101 mol-1min Vmax = 99 mol/min

0.04

Sans inhibiteur

1/V

-1/Kmapp =2000 M-1 Kmapp= 5 x 10-4 M

0.03

y = 3E-06x + 0.0097

0.02

-1/Km = 3800 M Km= 2.63 x 10-4 M


0.01

-1

0 -6000 -4000 -2000 0 2000 4000 6000 8000 10000 12000

1/[S]

5.6. Cintique enzymatique a) afin de trouver le Km et le Vmax, nous devons tracer le graphe Lineweaver-Burke (reprsent ci-dessous):

1/[S] (M-1) 2000,00 4000,00 5882,00 8333,00 10 000

1/v (mol-1x min.) 0,80 1,15 1,49 1,85 2,22

1/v (mol-1x min.) inhibiteur A 1,22 2,02 2.78 3.76 4,42

1/v (mol-1x min.) inhibiteur B 2,08 3,03 4,00 5,00 5,88

53

6
Sans inhibiteur Inhibiteur A Inhibiteur B

1/v
-4000 -2000

0
0 2000 4000 6000 8000 10000 12000

-1

1/[S]

La valeur du Vmax de l'enzyme nous est donne par la rciproque de l'intersection de la droite sur l'axe des y. Ainsi, Vmax = 2,36 mol/min. De mme, le Km de l'enzyme nous est donn par le ngatif de la rciproque de l'intersection sur l'axe des x. Ainsi, Km = 4,4 x 10-4 M. b) D'aprs le graphe de Lineweaver-Burke, l'inhibiteur A possde un Vmaxapp de 2,36 mmol/min et un Kmapp de 8.3 x 10-4 M. Ceci correspond un inhibiteur de type comptitif, tel un analogue du substrat. Quand l'inhibiteur B, son Vmaxapp est de 0,889 mol/min et son Km est de 4,4 x 10-4 M. Le Km est identique celui de l'enzyme sans inhibiteur: on a donc une inhibition non-comptitive. Ce type d'inhibition est observ lorsque l'inhibiteur n'interfre pas avec l'interaction enzymesubstrat. Ceci est le cas pour un agent alkylant, qui inhibe l'activit enzymatique en alkylant l'enzyme. Lalkylation des enzymes peut modifier la conformation de la protine, modifiant lgrement la structure du site actif et, par le fait mme, rendre lenzyme moins efficace comme catalyseur de ractions. c) Constante d'inhibition de l'inhibiteur A: pour l'inhibition comptitive, on a:

54

Kmapp = Km + Km [I] Ki Ki = Km [I] (Kmapp-Km)

Ki = 4,25 x 10-4 M x 5 x 10-4M (1,11 x 10-3 M - 4,25 x 10-4 M) Ki = 5.64 x 10-4 M Constante d'inhibition pour l'inhibiteur B: pour l'inhibition non-comptitive, on a: Vmaxapp = Vmax (1 + [I]/Ki) Ki = Vmaxapp [I] Vmax- Vmaxapp Ki = 0,889 mol/min (3,2 x 10-6M) (2,36 mol/min - 0,889 mmol/min) Ki = 1.93 x 10-6 M

d) la vitesse initiale peut tre dtermine par la modification de l'quation de Michaelis-Menten pour les inhibiteur comptitifs: v = Vmax x [S] [S] + Kmapp et Kmapp = Km + Km [I] Ki

Kmapp = 4,4 x 10-4 M + 4,4 x 10-4 M x 2 x 10-5 M 5.64 x 10-4 M Kmapp = 4,56 x 10-4 M

On aura alors:

55

v = Vmax x [S] [S] + Kmapp v = 2,36 mol/min x 3 x 10-4 M 3 x 10-4 M + 4,56 x 10-4 M v = 0,936 mol/min

5.7. Catalyse enzymatique Le fait que le pH optimal de l'enzyme soit pH 8,0 suggre que l'tat d'ionisation (ou de protonation) de rsidus d'acide amin du centre actif de l'enzyme est important pour l'activit de cette dernire. Par exemple, pH infrieur 8, la protonation de la chane latrale d'un rsidu histidine (pKaR = 6) pourrait altrer le mcanisme de catalyse enzymatique soit directement au sein du site actif, soit indirectement en induisant un changement conformationnel de la protine. un pH suprieur 8, la dprotonation de groupements prcis (e.g chane latrale de Tyr ou Lys; groupe amino-terminal) pourrait avoir la mme consquence sur l'activit enzymatique. 5.8. Catalyse enzymatique a) Pour une enzyme dont le pH optimal est de 4, on peut supposer que la partie ascendante de la courbe pourrait tre attribuable l'ionisation du groupe carboxyl de la chane latrale d'un Asp, ou du groupe -carboxyl de l'acide amin C-terminal. Pour la partie descendante, elle pourrait tre le rsultat de la dprotonation de l'His ou de l'ionisation de la Glu. b) Pour une enzyme dont le pH optimal est de 11, la portion ascendante de la courbe pourrait tre attribuable la dprotonation du groupe amino de la chane latrale de Lys. Quant la partie descendante de la courbe, elle pourrait tre la consquence de la dprotonation de Arg. 5.9. Catalyse enzymatique Afin de rpondre cette question, nous devons d'abord dessiner le graphe de la vitesse de la raction en fonction de la concentration en substrat (voir page suivante). D'aprs l'allure du graphe, A est une enzyme ordinaire qui suit la cintique de Michaelis-Menten. La vitesse initiale de la raction catalyse par l'enzyme A ne dpend que de la concentration du substrat, la vitesse maximale tant atteinte en prsence d'un excs de substrat. Grce au graphique, on peut aussi conclure que l'enzyme B est une enzyme allostrique. En effet, des concentrations peu leves de substrat, l'enzyme (qui possde plusieurs sites de liaison du substrat) adopte une conformation telle que son affinit pour le substrat est faible. La vitesse de raction est alors lente. Par contre, la liaison d'une molcule de substrat l'enzyme induit un changement conformationnel chez cette protine qui a pour consquence d'augmenter l'affinit des autres sites envers le substrat. Plus la concentration en substrat augmente, plus le nombre de sites haute affinit pour le substrat augmente, ce qui conduit une plus grande vitesse de raction.
56

25

20

V (mmol/min)

15

Enzyme A Enzyme B

10

0 0 1 2 3 4 5 6 7 8 9

[S] (x 103M)

Chapitre 6. Structure et proprits des acides nucliques.


6.1. Structure des acides nucliques. Le polynuclotide dont il est question ici est de l'ARN (remarquez la prsence de l'uracile comme base azote). Mme si l'ARN n'existe pas, comme l'ADN, sous forme d'une double hlice, il peut tout de mme adopter une structure secondaire hlicodale via l'appariement de rgions complmentaires l'intrieur mme de la molcule. Les structures secondaires les plus stables seront videmment celles impliquant le plus de pont H (donc, celles o l'on aura le plus grand nombre de paires de base). Dans le cas de la molcule qui nous intresse, les deux structures les plus stables seront: A C C G C U A G C AUCCCGAGUGCACCACGUAAUGGA3 AUCCCGA GUAAUGGA3 C C AAGGGCUCACGUGGUGCAUUA5 AAGGGCU CAUUA5 C G A U C G G G U
57

*6.2. Structure des acides nucliques. a) Comme le Tm n'a pas t atteint, les deux chanes polynuclotidiques ne se sont pas compltement spares, et sont donc encore alignes selon leur squence complmentaire. On obtiendra alors une courbe du style suivant: Temprature juste sous le Tm

A260nm

Temprature (oC) Temprature augmente Temprature diminue

b) Comme on a largement dpass le Tm, les deux chane polynuclotidiques se sont spares. Lors de la rhybridation, les deux molcules devront s'aligner selon leurs paires de bases complmentaires, ce qui est un processus relativement long (implique des collisions au hasard de nos deux molcules monocatnaires). Comme le temps allou pour le refroidissement est assez court, la molcule d'ADN n'aura pas le temps de se rhybrider. L'absorbance ne diminuera donc que trs peu suite au chauffage, et on aura une courbe du style: Temprature>>>Tm

A260nm

Temprature (oC) Temprature augmente Temprature diminue

c) Une courbe parfaitement rversible peut tre obtenue si l'alignement peut se faire trs facilement. Ceci est le cas si l'on a affaire des polynuclotides peu complexes du type poly(G):poly(C), ou poly (AT):poly(AT).

58

6.3. Structure des acides nucliques. L'hydrolyse des acides nucliques implique la cassure des liens phophodiesters liant chaque nuclotides dans l'orientation 5' vers 3'. La seule diffrence majeurs dans le squelette sucrephosphate entre l'ARN et l'ADN est la prsence d'un groupe hydroxyl en position 2' du ribose chez l'ARN. Ainsi, en milieu alcalin, ce groupe peut tre facilement ionis, gnrant un O- qui peut facilement briser le lien phosphodiester en attaquant le groupe phosphoryl adjacent: B a s e OO
-

O
-

O-P-O-CH2 OO
-

O-P-O-CH2 O-

B a s e

H+

O-P-O O CH2

O O
-

B a s e O-

O O-P O-

+
OHCH2 O O
-

B a s e O-

O-P-O O

O-P-O O

6.4. Structure des acides nucliques. Ces donnes peuvent tre interprte de la manire suivante: a) si l'on refroidi la solution d'acide nuclique rapidement, l'absorbance 280nm ne varie que trs peu, indiquant que les chanes de polynuclotides restent l'tat monocatnaire (la molcule reste donc dnature). b) si l'on refroidi la solution d'acide nuclique lentement, on observe un diminution progressive de l'absorbance 260 nm, indiquant que notre molcule est passe de l'tat monocatnaire bicatnaire (il y a donc eu rhybridation). 6.5. Structure des acides nucliques. La structure de l'IMP est la suivante:
O H N N N N

Ribose L'IMP peut donc former des ponts H avec l'adnosine et avec la cytosine (compare la structure de lIMP avec celle de lAMP et de la CMP). Donc, lincorporation dans l'ADN mettrait
59

videmment en danger l'intgrit du code gntique en permettant une ambigut dans le pairage des bases, ce qui serait ltal court terme pour l'organisme. 6.6. Structure des acides nucliques. a) la ribonuclase pancratique coupe l'ARN du ct 3' des nuclotides pyrimidiques, gnrant une extrmit 3' phosphate. Dans le polynuclotide suggr dans cet exemple, la ribonuclase pancratique donnera donc les produits de digestion suivants:
5'

pACp3'

5'

GAUp3'

5'

GCp3'

5'

Up3'

5'

AUp3'

5'

C3'

b) la ribonuclase T2 coupe du ct 3' des nuclotides adnosine, et gnrera une extrmit 3' phosphate. On aura alors:
5'

pAp3'

5'

CGAp3'

5'

UGCUA3'

5'

UC3'

c) la ribonuclase T1 coupe du ct 3' des nuclotides guanosine, et gnrera une extrmit 3' phosphate. On aura alors:
5'

pACGp3'

5'

AUGp3'

5'

CUAUC3'

6.7. Structure des acides nucliques. La phosphodiestrase de venin de serpent ne coupe que le nuclotide situ en 3'-terminal de l'ARN, gnrant un nuclotide 5'phosphate. Cette information nous indique que Cp est situ en 3'-terminal de notre polynuclotide. La ribonuclase pancratique coupe du ct 3' des nuclotides pyrimidiques, gnrant des produits de digestion se terminant par une pyrimidine 3' phosphate. D'aprs les rsultats obtenus, on peut dduire les squences suivantes:

5'

ACp3'

5'

(A,G)Up3'

Finalement, la ribonuclase T2 coupe aprs l'adnosine, gnrant des fragments se terminant avec une adnosine 3'phosphate. On peut donc utiliser cette information afin d'ordonner les squences du produit obtenu:
5'

(CG)Ap3'

De plus, la prsence de pAp aprs digestion avec la ribonuclase T2 indique que A est le nuclotide 5'-terminal. En recoupant les informations obtenues par l'utilisation de ces trois enzymes, on obtient la squence finale suivante:
60

5'

pACGAUCp3'

6.8. Structure des acides nucliques. La phosphodiestrase de venin de serpent libre le nuclotide situ l'extrmit 3' du fragment. Le rsultat obtenu nous indique que pC est le nuclotide 3' terminal pour notre polynuclotide. La ribonuclase pancratique coupe les molcules d'ARN du ct 3' des pyrimidines, gnrant des fragments se terminant avec une pyrimidine 3' phosphate. Grce aux fragments obtenus, on peut dduire en partie leur squence:
5'

GCp3'

5'

AUp3'

5'

(A,G)Cp3'

De plus, le fait que l'on a libr 2 Cp indique ces nuclotides sont situs tout de suite aprs U ou C. L'ARNase T1 coupe du ct 3' de la guanosine, gnrant des fragments se terminant avec une guanosine 3'phosphate. Quant la ARNase T2, elle coupe du ct 3' des adnosine, gnrant des adnosine 3'phosphate. L'utilisation combine de ces deux enzymes donnera un mlange de fragments coups par l'un ou l'autre de ces enzymes, ou mme par les deux enzymes. On peut dduire la squence des fragments obtenus:
5'

CCAp3'

5'

(C,U)Gp3'

Note: on a dduit la prsence de deux C dans le premier fragment car on mentionne qu'il s'agit d'un trinuclotide, et qu'il manque un C si l'on fait le dcompte des nuclotides obtenus aprs digestion avec le mlange T1 + T2. D'aprs le rsultat obtenu avec la ribonuclase pancratique, l'uridine est prcde de l'adnosine. On aura alors le fragment suivant:
5'

AUCGp3'

De plus, toujours d'aprs le rsultat avec T1 + T2, l'obtention de pGp indique que ce dernier est le nuclotide 5'-terminal. Le rsultat obtenu avec la ribonuclase pancratique indique aussi que ce G est suivi de C. Aussi, le fait d'avoir obtenu C et Ap indique que ces deux nuclotides sont situs tout de suite aprs A ou G. On a donc jusqu'ici la squence suivante:
5'

pGC....AUCG....C3'

Il ne nous reste que A et C placer. Comme avec la digestion avec T1 + T2 on a eu la squence 5'CCAp3', ceci suggre que C est plac entre pGC...AUCG. Enfin, le dernier nuclotide, A, devrait logiquement tre situ l'avant-dernire place.

61

En tenant compte de ces diffrents rsultats, on arrive la squence suivante:


5'

pGCCAUCGAC3'

6.9. Structure des acides nucliques. pH neutre, les bases azotes sont non-ionises. Les charges ne proviendront donc que des groupes phosphates. Comme on a dans l'exemple suggr trois phosphate formant les liaisons phosphodiester, on aura 3 x (1-) = 3 charges ngatives. 6.10. Structure des acides nucliques. Une fois l'ADN circulaire dnatur, les deux brins, quoique spars, forment deux cercles qui s'enchevtrent. Au cours de la renaturation, il se retrouvent donc beaucoup plus facilement que les brins complmentaires spars d'un ADN linaire dont la rencontre s'effectue au hasard des collisions. 6.11. Structure des acides nucliques. La temprature de fusion dpend de la force ionique: en diminuant la force ionique, on abaisse la temprature de fusion. Dans le cas extrme d'une force ionique nulle, la rpulsion lectrostatique l'intrieur de l'ADN, dont les groupements ne sont pas protgs par des contre-ions, est suffisante pour rduire la temprature de fusion moins de 20oC. 6.12. Structure des acides nucliques. L'ADN sous la forme B a une longueur de 3,4 nm (34 A) pour 10 paires de bases. Le chromosome de E. coli, avec 4 000 kb (donc 4 000 000 pb), possde ainsi une longueur de 1,36 x 106 nm, soit prs de 1,4 mm. 6.13. Synthse des acides nucliques. Lors de l'exprience de Meselson et Stahl, on incube d'abord les bactries dans un milieu de culture ne contenant que du 15N, et on transfre ensuite les cellules dans un milieu ne contenant que du 14N. Les rsultats suivants sont alors obtenus: Aprs 0 gnration: 100% ADN lourd :

Aprs 1 gnration: 100% hybride :

Aprs 2 gnrations: 50% hybride, 50% lger

Aprs 3 gnrations: 25% hybride, 75% lger.

62

6.14. Synthse des acides nucliques. Le brin de dpart (+) est compos de: 10% A, 20%G, 30%C et 40%T. Suite sa rplication, le brin (-) qui lui est complmentaire aura la composition: 40%A, 30%G, 20%C et 10%T (parce que A s'apparie uniquement avec T, et C uniquement avec G). Enfin, lors de la transcription du brin (-), l'ARN form possdera une composition en base qui lui sera complmentaire, soit 10%A, 20%G, 30%C et 40% U. 6.15. Synthse des acides nucliques. Cette observation ne peut s'expliquer que si le gnome de E. coli s'est rpliqu 1 1/2 fois lors de la sparation physique des bactries. **6.16. Synthse des acides nucliques. a) comme aucune molcule hybride n'est obtenue, nous devons conclure qu'un mcanisme de rplication conservatif a lieu, au cours duquel les brins servant de gabarit reforment le duplex initial aprs chaque ronde de rplication. b) La prsence d'ARN polymrase suggre qu l'ADN bactrien est d'abord transcrit en une molcule d'ARN. Par la suite, cet ARN (rsistant la ADNase) est converti en ADN (sensible la ADNase) via la rduction du carbone 2' par la nouvelle activit enzymatique et le NADH. Finalement, cet ADN sert de gabarit l'ADN polymrase, formant une molcule d'ADN bicatnaire identique au duplex parental initial. 6.17. ARNm et transcription. a) Lintroduction de mutations par absence dactivit ddition est un phnomne alatoire naffectant quun petit nombre de copies dun ARN donn. De plus, chaque ARNm a une demivie trs courte et il ne dirige la synthse que de quelques molcules de protines avant dtre dgrad. Lintroduction de mutations dans lARNm naffectera donc quune infime minorit des molcules dune protine donne, ce qui sera sans effet apparent pour la cellule. b) Lutilisation dun intermdiaire ARN afin de synthtiser lADN rsulterait dans lapparition rapide de mutations dans le matriel gntique de lorganisme cause de lincapacit de lARN polymrase corriger les erreurs survenues lors de la transcription. Ceci explique entre autre pourquoi certains virus ARN (p.ex. HIV) possdent un taux de mutation trs lev et peuvent ainsi chapper plusieurs formes traditionnelles de thrapie anti-virale. 6.18.ARNm et transcription. La courte demi-vie des ARNm permet 1) de se dbarrasser rapidement de transcrits ayant subi des mutations, et 2) de rguler rapidement lexpression des gnes. En effet, larrt de la transcription dun gne sera suivie rapidement de la dgradation complte des ARNm correspondants, assurant ainsi un arrt rapide de la synthse de la protine encode par ce gne. 6.19. ARNm et transcription. a) La vitesse maximale de transcription tant de 4,300 nuclotides par minute (70 nuclotides par seconde x 60 secondes), un gne de 6,000 pb sera alors transcrit en approximativement 1.4 minutes.

63

b) tant donn que 70 pb sont couvertes par chaque molcule dARN polymrase, on aura quun maximum de 86 molcules de polymrase pourront se retrouver attach ce gne un instant donn. 6.20.Codage des protines. a) l'aide du code gntique, on a la squence en acides amins suivante: AGU CUC UGU CUC CAU UUG AAG AAG GGG AAG GGG Ser - Leu - Cys - Leu - His - Leu - Lys - Lys - Gly - Lys - Gly

b) Le rsultat des mutations sera: G AGU GCU CUG UCU CCA UUU GAA GAA GGG AAG GGG Ser - Ala - Leu - Ser - Pro - Phe - Glu - Glu - Gly - Lys - Gly

6.21. Codage des protines. a) Commenons par convertir la squence en acides amins du type sauvage en squence en nuclotides: - Tyr - Lys - Ser - Pro - Ser - Leu - Asn - Ala - Ala - Lys A UAU - AAA - UCX - CCX - UCX - UUG - AAC - GCX - GCX - AAG C G - AGU - AGU - CUX U A C C

Convertissons maintenant la squence en acides amins du mutant en squence en nuclotides: - Val - His - His - Leu - Met - GUX - CAU - CAU - UUA - AUG C C G - CUX Le mutant n'a donc pas pu tre form par une seule mutation: on a besoin d'une mutation pour changer la squence sauvage en squence mutante, et d'une seconde mutation pour faire l'opration inverse (i.e. mutant sauvage). Si l'on tudie attentivement les squences sauvages et mutantes, on s'aperoit que la squence mutante peut tre obtenue suite la dltion de la septime base de la squence sauvage (i.e. le A du codon AGU de Ser). On obtient effectivement:

64

Sauvage:

A UCX - CCX - UCX - UUG - AAC AGU - AGU - CUX U C C GU - CCX - UCX - UUX - AAU C

Dltion:

La lecture du dltant nous donne donc les codons suivants: GUC - CXU- CXU - UAA - AU C G C En remplaant les X par A, on constate que cette squence correspond celle du mutant: GUC - CAU - CAU - UUA - AUVal - His - His - Leu Enfin, l'insertion d'un G la fin de cette squence nous donne le dernier codon (AUG/Met) et replace le cadre de lecture son tat original.

b) La squence en bases de l'ARNm qui code pour les cinq acides amins du type sauvage qui sont diffrents dans le mutant est: AGU - CCA - UCA - CUU AAU-G

dltion

insertion

6.22. Codage des protines. a) Commenons par crire la squence fournie sous la forme d'ADN double brin: 5' TCGTTTACGATCCCCATTTCGTACTCGA 3' 3' AGCAAATGCTAGGGGTAAAGCATGAGCT 5' La squence du brin complmentaire est donc: 5' TCGAGTACGAAATGGGGATCGTAAACGA 3'

b) la squence en bases de l'ARN transcrit partir du brin fourni sera identique celle du brin complmentaire, l'exception prs de la prsence d'uracile la place de thymine: 5' UCGAGUACGAAAUGGGGAUCGUAAACGA 3'
65

c) La squence en acides amins est obtenue en sparant d'abord la squence de l'ARNm en codons: 5' UCG AGU ACG AAA UGG GGA UCG UAA ACG A 3' Ser-Ser-Thr-Lys-Trp-Gly-Ser-Stop

d) La dltion du second T de l'extrmit 3' du DNA nous donne la squence en nuclotides suivante: T 5' TCG TTT ACG ATC CCC ATT TCG ACT CGA 3'

La squence en ARNm nous donne: 5' UCG AGU CGA AAU GGG GAU CGU AAA CGA 3' Et la traduction de cette squence nous donne: Ser-Ser-Arg-Asn-Gly-Asp-Arg-Lys-Arg

6.23. Gnie gntique. Lenzyme EcoR I coupe uniquement de la manire suivante : GAATTC CTTAAG G CTTAA

AATTC G

Dans le fragment en question, il nexiste quun seul site de reconnaissance pour lenzyme EcoR I, ce qui donnera, suite la digestion avec cette enzyme, les fragments suivants :
5 3 5

ATGCTCGATCGATCG3 TACGAGCTAGCTAGCTTAA5

AATTCTATAGCCCGGGCTGGATCCAGGTACCAAGTTAAGCTTG3 3 GATATCGGGCCCCGACCTAGGTCCATGGTTCAATTCGAAC5

6.24. Gnie gntique. Lenzyme BamH I coupe uniquement de la manire suivante : GGATCC CCTAGG G CCTAG

GATCC G

Dans le fragment en question, il nexiste quun seul site de reconnaissance pour lenzyme BamH I, ce qui donnera, suite la digestion avec cette enzyme, les fragments suivants :
66

ATGCTCGATCGATCGAATTCTATAGCCCGGGGCTG3 3 TACGAGCTAGCTAGCTTAAGATATCGGGCCCCGACCTAG5

+
5 3

GATCCAGGTACCAAGTTAAGCTTG3 GTCCATGGTTCAATTCGAAC5

6.25. Gnie gntique. Lenzyme Sma I coupe uniquement de la manire suivante : CCCGGG GGGCCC CCC GGG

GGG CCC

Dans le fragment en question, il nexiste quun seul site de reconnaissance pour lenzyme Sma I, ce qui donnera, suite la digestion avec cette enzyme, les fragments suivants :
5

ATGCTCGATCGATCGAATTCTATAGCCC3 3 TACGAGCTAGCTAGCTTAAGATATCGGG5

+
5

GGGGCTGGATCCAGGTACCAAGTTAAGCTTG3 3 CCCCGACCTAGGTCCATGGTTCAATTCGAAC5 6.26. Gnie gntique. Lenzyme Kpn I coupe uniquement de la manire suivante : GGTACC CCATGG GGTAC C

C CATGG

Quant lenzyme Hind III, il ne coupe que de la faon suivante : AAGCTT TTCGAA A TTCGA AGCTT A

Dans le fragment en question, il nexiste quun seul site de reconnaissance pour chacun de ces enzymes, ce qui donnera les fragments suivants :
67

ATGCTCGATCGATCGAATTCTATAGCCCGGGGCTGGATCCAGGTAC3 3 TACGAGCTAGCTAGCTTAAGATATCGGGCCCCGACCTAGGTC5

+
5

CAAGTTA3 3 CATGGTTCAATTCG5

+
5 3

AGCTTG AC5

6.27. Gnie gntique. a) Afin de dterminer la longueur des fragments de restriction obtenus, nous devons tout dabord dessiner le graphe du log de la longueur des molcules standard en fonction de la distance migre. Ce graphe est donn ci-dessous.

4.5 4.3 4.1 3.9 Log longueur 3.7 3.5 3.3 3.1 2.9 2.7 2.5 3 3.5 4 4.5 5 5.5 Distance migre (cm) 6 6.5 7 y = -0.4529x + 5.8731

Ensuite, grce ce graphe, il est facile de dterminer, par la distance migre par les diffrents
68

fragments de restriction, quelle sera leur longueur. Les rsultats obtenus sont indiqus dans le tableau suivant :

Fragment 1 2 3 4 5 6

Apa I (pb) 48,500 10,085

Pvu I (pb) 48,500 35,790 26,250 11,930

BamH I (pb) 48,500 41,730 34,500 27,920 22,345 5,505

b) Comme une seule des extrmits 5 est marque radioactivement, la longueur des fragments de restriction visualiss en autoradiographie nous donne la distance entre lextrmit marque et le site de restriction. De plus, comme les conditions exprimentales rsultent en une digestion partielle de lADN, on obtiendra un mlange de fragments de longueur diffrente pour les enzymes coupant plus quune fois : la longueur de chaque fragment indiquera alors la position (toujours par rapport lextrmit 5 marque) dun des sites de restriction de lenzyme. Ainsi, pour lenzyme Apa I, lobtention de fragments de 10,085 pb et de 48,500 pb indique que Apa I ne coupe quune seule fois une distance de 10,085 pb en 3 de lextrmit marque. Grce ce raisonnement, on peut obtenir la carte de restriction suivante :

Bout marqu radioactivement


10085 11930 22345 26250 27920 34500 35970 41730 48500 5505

BamHI ApaI PvuI

BamHI PvuI BamHI BamHI PvuI

BamHI

69