Vous êtes sur la page 1sur 30

MASTER 1 Biologie Sant Immunopathologie - Syndromes Lymphoprolifratifs

Anne Universitaire 2010 - 2011


Facult de Mdecine Montpellier-Nmes
C. RENE
(Mise ligne 18/04/11 LIPCOM)
Syndromes
Lymphoprolifratifs
Syndromes
Lymphoprolifratifs
Dr Cline RENE Dr Cline RENE
Laboratoire dimmunologie
celine.rene@inserm.fr
Laboratoire dimmunologie
celine.rene@inserm.fr
PLAN PLAN
Gnr alit s Gnr alit s Gnr alit s
Out ils diagnost iques
Les dif f r ent es ent it s:
- leucmies aigues lymphoblast iques
L i l h id h i
Gnr alit s
Out ils diagnost iques
Les dif f r ent es ent it s:
- leucmies aigues lymphoblast iques
L i l h id h i - Leucmies lymphoides chr oniques
- Les lymphomes
- Les Mylomes
- Leucmies lymphoides chr oniques
- Les lymphomes
- Les Mylomes
Gnralits
Blood cell development
Polyglobulie
de Vaquez
Leucmie
Myloide Thrombocyt
opnie
essentielle
Syndromes
lymphoprolifratifs
MASTER 1 Biologie Sant Immunopathologie - Syndromes Lymphoprolifratifs
Anne Universitaire 2010 - 2011
Facult de Mdecine Montpellier-Nmes
C. RENE
(Mise ligne 18/04/11 LIPCOM)
Clone 2
Clonalit Clonalit -- Immunoglobuline Immunoglobuline
monoclonale monoclonale
Clonalit Clonalit -- Immunoglobuline Immunoglobuline
monoclonale monoclonale
Ag B
B
B Clone 1 Clone 3
Ag
Ac 1
Ac 2
Ac 3
" mult i-t apes " avec mut at ions successives de gnes de t ype
oncognes ou de gnes suppr esseur s de t umeur about issant une
t r ansf or mat ion cancr euses
" mult i-t apes " avec mut at ions successives de gnes de t ype
oncognes ou de gnes suppr esseur s de t umeur about issant une
t r ansf or mat ion cancr euses
PHYSI OPATHOLOGI E
Mcanismes molculair es en cause
act ivat ion t r ansr ipt ionnelle dun gne.
Cr at ion dun gne de f usion avec expr ession dun ARN et dune
pr ot ine de f usion ayant des pr opr it s leucmognes
Double mut at ion ou dlt ion dun gne suppr esseur de t umeur .
Consquences:
Mcanismes molculair es en cause
act ivat ion t r ansr ipt ionnelle dun gne.
Cr at ion dun gne de f usion avec expr ession dun ARN et dune
pr ot ine de f usion ayant des pr opr it s leucmognes
Double mut at ion ou dlt ion dun gne suppr esseur de t umeur .
Consquences: Consquences:
1- capacit de pr olif r at ion accr ue
2- per t e de capacit de dif f r enciat ion
3- avant age de sur vie li un chappement aux r gles de mor t
cellulair e pr ogr amme (apopt ose).
Consquences:
1- capacit de pr olif r at ion accr ue
2- per t e de capacit de dif f r enciat ion
3- avant age de sur vie li un chappement aux r gles de mor t
cellulair e pr ogr amme (apopt ose).
Outils diagnostiques
MASTER 1 Biologie Sant Immunopathologie - Syndromes Lymphoprolifratifs
Anne Universitaire 2010 - 2011
Facult de Mdecine Montpellier-Nmes
C. RENE
(Mise ligne 18/04/11 LIPCOM)
Clinique: AEG, infections
NFS: dsquilibre des lignes
Histologie: morphologie du tissu
Clinique: AEG, infections
NFS: dsquilibre des lignes
Histologie: morphologie du tissu
Cytologie: morphologie des cellules
Immunochimie: phnotypage des cellules
Cytomtrie en flux: phnotypage des cellules
C t ti li h i t/
Cytologie: morphologie des cellules
Immunochimie: phnotypage des cellules
Cytomtrie en flux: phnotypage des cellules
C t ti li h i t/ Cytogntique: anomalies chromosomiques et/ou
translocations
Immunogntique: rarrangements des gnes des
immunoglobulines
Cytogntique: anomalies chromosomiques et/ou
translocations
Immunogntique: rarrangements des gnes des
immunoglobulines
Histologie
QuickTime et un
dcompresseur TIFF (non compress)
Ganglion Normal
dcompresseur TIFF (non compress)
sont requis pour visionner cette image.
QuickTimeet un
dcompresseur TIFF (non compress)
sont requis pour visionner cette image.
QuickTime et un
dcompresseur TIFF (non compress)
sont requis pour visionner cette image.
Lymphome folliculaire Lymphome grande cellules
Cytologie Cytologie
Cellules de Szary Tricholeucocytes
Lymphome folliculaire:
centrocytes clives
IMMUNOPHENOTYPAGE IMMUNOPHENOTYPAGE
Examen essentiel pour le diagnostic prcis
dune hmopathie lymphode
Ag de membrane des leucocytes= selon leur
Examen essentiel pour le diagnostic prcis
dune hmopathie lymphode
Ag de membrane des leucocytes= selon leur Ag de membrane des leucocytes selon leur
ligne dorigine et leur degr de maturation.
Ag de membrane des leucocytes selon leur
ligne dorigine et leur degr de maturation.
MASTER 1 Biologie Sant Immunopathologie - Syndromes Lymphoprolifratifs
Anne Universitaire 2010 - 2011
Facult de Mdecine Montpellier-Nmes
C. RENE
(Mise ligne 18/04/11 LIPCOM)
Stratgie dimmunophnotypage Stratgie dimmunophnotypage
Ligne B Ligne T Ligne mylode
1- ident ifier la ligne en cause
Ligne B Ligne T Ligne mylode
2 pts CD79, c, cCD22 CD3, TCR MPO, lysozyme
1pt CD19,CD10,
CD20
CD5, CD2, CD8,
CD10
CD13, CD33,
CD65, CD117
0 5 pt TdT CD24 TdT CD7 CD1a CD14 CD15 0,5 pt TdT, CD24 TdT, CD7, CD1a CD14, CD15,
CD64
2- une fois la ligne dfinie, on identifie le stade de
maturation
Lymphoid malignancy B lineage T lineage Natural Killer
lineage
B, T, and NK lineage of lymphoid
malignancies
lineage
Acute lymphoblastic leukemia
children 82 86% 14 18% < 1%
adults 75 80% 20 25% < 1%
Chronic lymphocytic leukemias 95 97%3 5% 1 2%
Non-Hodgkin lymphomas g y p
nodal NHL 95 97% 3 5% < 2%
extranodal NHL 90 95% 5 10% < 2%
cutaneous NHL 30 40% 60 70% < 2%
Multiple myeloma 100% 0% 0%
Immunohistochimie Immunohistochimie
A i CD5 C l
Tissu fix coup
Anti Bcl-2 Coupl une enzyme
CD5
Bcl-2
Substrat 1
A i CD5 C l A i CD5 C l
Tissu fix coup
Anti Bcl-2 Coupl une enzyme
CD5
Bcl-2
Substrat 1
Tissu fix coup
Anti Bcl-2 Coupl une enzyme
CD5
Bcl-2
Substrat 1
Tissu fix coup
Anti Bcl-2 Coupl une enzyme
CD5
Bcl-2
CD5
Bcl-2
Substrat 1
Anti CD5 Coupl une enzyme
Substrat 2
CD5
Bcl-2
Tissu fix coup
Anti CD5 Coupl une enzyme
Substrat 2
CD5
Bcl-2
Anti CD5 Coupl une enzyme
Substrat 2
CD5
Bcl-2
CD5
Bcl-2
Tissu fix coup Tissu fix coup Tissu fix coup
Immunohistochimie Immunohistochimie
Lymphome folliculaire
QuickTimeet un
dcompresseur TIFF (non compress)
sont requis pour visionner cette image.
QuickTimeet un
dcompresseur TIFF (non compress)
sont requis pour visionner cette image.
QuickTime et un
dcompresseur TIFF (non compress)
sont requis pour visionner cette image.
QuickTime et un
dcompresseur TIFF (non compress)
sont requis pour visionner cette image.
CD20
CD3 Bcl-2
MASTER 1 Biologie Sant Immunopathologie - Syndromes Lymphoprolifratifs
Anne Universitaire 2010 - 2011
Facult de Mdecine Montpellier-Nmes
C. RENE
(Mise ligne 18/04/11 LIPCOM)
Phnotypage des cellules Phnotypage des cellules
Anti IgMFITC
Anti Ig PE
Anti CD19 APC
Anti CD10 PE Cy5
+
+
Lavages
Lecture au
Cytomtre de Flux
Marquage direct extracellulaire
CD5
IgM
IgD
CD19
HLA-DR
CD10 (CALLA)
CD38
Marquage direct intra et extracellulaire
Anti IgMFITC
Anti Ig PE
Anti CD19 APC
Anti CD10 PE Cy5
+
Anti IgMFITC
Anti Ig PE
Anti CD19 APC
Anti CD10 PE Cy5
+
+
Lavages
Lecture au
Cytomtre de Flux
+
Lavages
Lecture au
Cytomtre de Flux
Marquage direct extracellulaire
CD5
IgM
IgD
CD19
HLA-DR
CD10 (CALLA)
CD38
Marquage direct extracellulaire
CD5
IgM
IgD
CD19
HLA-DR
CD10 (CALLA)
CD38
CD5
IgM
IgD
CD19
HLA-DR
CD10 (CALLA)
CD38
Marquage direct intra et extracellulaire Marquage direct intra et extracellulaire Marquage direct intra et extracellulaire
Anti IgMFITC
Anti Ig PE
Anti CD19 APC
Anti CD10 PE Cy5
+
+
Lavages
Lecture au
Cytomtre de Flux
Marquage direct extracellulaire
CD5
IgM
IgD
CD19
HLA-DR
CD10 (CALLA)
CD38
Marquage direct intra et extracellulaire
Anti IgMFITC
Anti Ig PE
Anti CD19 APC
Anti CD10 PE Cy5
+
Anti IgMFITC
Anti Ig PE
Anti CD19 APC
Anti CD10 PE Cy5
+
+
Lavages
Lecture au
Cytomtre de Flux
+
Lavages
Lecture au
Cytomtre de Flux
Marquage direct extracellulaire
CD5
IgM
IgD
CD19
HLA-DR
CD10 (CALLA)
CD38
Marquage direct extracellulaire
CD5
IgM
IgD
CD19
HLA-DR
CD10 (CALLA)
CD38
CD5
IgM
IgD
CD19
HLA-DR
CD10 (CALLA)
CD38
Marquage direct intra et extracellulaire Marquage direct intra et extracellulaire Marquage direct intra et extracellulaire
Cytomtre de Flux
Permabilisation
la saponine
Anti IgMFITC
Anti Bcl-2 PE
Anti CD19 APC
Anti CD19 APC
+
Lavages
CD5
IgM
IgD
CD19
HLA-DR
CD10
CD38
Bcl-2
Marquage direct intra- et extracellulaire
Cytomtre de Flux Cytomtre de Flux
Permabilisation
la saponine
Permabilisation
la saponine
Anti IgMFITC
Anti Bcl-2 PE
Anti CD19 APC
Anti CD19 APC
+
Lavages
Anti IgMFITC
Anti Bcl-2 PE
Anti CD19 APC
Anti CD19 APC
+
Lavages
CD5
IgM
IgD
CD19
HLA-DR
CD10
CD38
Bcl-2
Marquage direct intra- et extracellulaire
CD5
IgM
IgD
CD19
HLA-DR
CD10
CD38
Bcl-2
Marquage direct intra- et extracellulaire
CD5
IgM
IgD
CD19
HLA-DR
CD10
CD38
Bcl-2
CD5
IgM
IgD
CD19
HLA-DR
CD10
CD38
Bcl-2
Marquage direct intra- et extracellulaire
Cytomtre de Flux
Permabilisation
la saponine
Anti IgMFITC
Anti Bcl-2 PE
Anti CD19 APC
Anti CD19 APC
+
Lavages
CD5
IgM
IgD
CD19
HLA-DR
CD10
CD38
Bcl-2
Marquage direct intra- et extracellulaire
Cytomtre de Flux Cytomtre de Flux
Permabilisation
la saponine
Permabilisation
la saponine
Anti IgMFITC
Anti Bcl-2 PE
Anti CD19 APC
Anti CD19 APC
+
Lavages
Anti IgMFITC
Anti Bcl-2 PE
Anti CD19 APC
Anti CD19 APC
+
Lavages
CD5
IgM
IgD
CD19
HLA-DR
CD10
CD38
Bcl-2
Marquage direct intra- et extracellulaire
CD5
IgM
IgD
CD19
HLA-DR
CD10
CD38
Bcl-2
Marquage direct intra- et extracellulaire
CD5
IgM
IgD
CD19
HLA-DR
CD10
CD38
Bcl-2
CD5
IgM
IgD
CD19
HLA-DR
CD10
CD38
Bcl-2
Marquage direct intra- et extracellulaire
Dtection de la lumire diffracte
90 = SSC, Side Scatter, granularit
Cytomtre en flux Cytomtre en flux
FL-4 APC
Dtection de la lumire diffracte et rfracte un
angle < 10=FSC, Forward Scatter, taille
cellulaire
Marquage dune cellule avec divers fluorochromes
FL-1 FITC
FL-2 PE
FL-3 PerCP, Cy5
Daprs Dr BENSA
EFS Grenoble
Polynuclaires
SSC
CMF : Analyse taille/granularit CMF : Analyse taille/granularit
Monocytes
Globules rouges et
dbris cellulaires
Lymphocytes
apoptotiques
FSC
Lymphocytes
Daprs Dr BENSA
EFS Grenoble
R1
CD3 CD19
Kappa
Lambda
CMF : Population lymphocytaire CMF : Population lymphocytaire
Sample ID: CD4/8/3
Gate: G1
Gated Events: 22363
Total Events: 28112
Quad Events % Gated
UL 0 0.00
UR 6961 31.13
LL 0 0.00
LR 15402 68.87
Sample ID: FMC7/23/19
Gate: G1
Gated Events: 83142
Total Events: 100000
Quad Events % Gated
UL 0 0.00
UR 56840 68.36
LL 0 0.00
LR 26302 31.64
Sample ID: KL CD19
Gate: G1
Gated Events: 42429
Total Events: 55236
Region Events % Gated
R1 42429 100.00
CD19+ 29936 70.56
Kappa 27376 64.52
Lambda 1287 3.03
MASTER 1 Biologie Sant Immunopathologie - Syndromes Lymphoprolifratifs
Anne Universitaire 2010 - 2011
Facult de Mdecine Montpellier-Nmes
C. RENE
(Mise ligne 18/04/11 LIPCOM)
1) Isolement des cellules du patient
2) Culture court terme
Analyses cytogntiques: Caryotype Analyses cytogntiques: Caryotype
)
3) Blocage des divisions en promtaphase ou
mtaphase par addition de colchicine
4) Choc hypo-osmotique: clatement des cellules
Dltion du 7q
Dltion du 20q
Caryotyp
e
Caryotyp
e
Chromosome Philadelphie (Ph1) : Translocation rciproque t (9;22) (portions distales
bras longs) et apparition chr 22 raccourci
Analyses cytogntiques: FISH Analyses cytogntiques: FISH
Addition de sondes spcifiques de gnes
pour la recherche de translocations
Addition de sondes spcifiques de gnes
pour la recherche de translocations
particulires particulires
Sondes de fusion FISH Sondes de fusion FISH
breakpoint
region
Gene A
Gene B
breakpoint
region
no translocation translocation
Disadvantages:
- translocations to alternative partner genes are missed
- high false-positivity rate (5-10%) caused by coincidental colocalisation
MASTER 1 Biologie Sant Immunopathologie - Syndromes Lymphoprolifratifs
Anne Universitaire 2010 - 2011
Facult de Mdecine Montpellier-Nmes
C. RENE
(Mise ligne 18/04/11 LIPCOM)
Sondes de point de cassures: FISH Sondes de point de cassures: FISH
breakpoint
Gene A
region
no translocation translocation
Advantages:
- detection of aberrations is independent of partner genes
- minimisation of false positivity
- identification of partner gene (or chromosome region), if metaphases are present
Valeur pronostique des aberrations chromosomiques
Chromosome Genes Effet Frquence Pronostic
aberration impliqus
t(1;19)(q23;p13) E2A-PBX1 fusion 30% pre-B-ALL intermdiaire
t(4;11)(q21;q23) MLL-AF4 fusion 40% infant ALL mauvais
t(9;22)(q34;q11) BCR-ABL fusion 35% adult ALL mauvais
t(12;21)(p13;q22) TEL-AML1 fusion 25% childhood ALL bon
del(1p32) SIL TAL1 TAL1 | 15% childhood T ALL intermdiaire del(1p32) SIL-TAL1 TAL1 | 15% childhood T-ALL intermdiaire
t(8;14)(q24;q32) IGH-MYC MYC | 90% Burkitts lymphoma bon
t(11;14)(q13;q32) BCL1-IGH Cyclin D1 | >90% MCL Mauvais
t(14;18)(q32;q21) BCL2-IGH BCL2 | >90% FCL intermdiaire
t(2;5)(p23;q35) NPM-ALK fusion 50% ALCL intermdiaire
Biologie molculaire Biologie molculaire
Suivi et diagnostic:
id tifi ti d t
Suivi et diagnostic:
id tifi ti d t - identification des rarrangements
(TCR/BCR) par PCR
- mutation dans oncognes et analyse
des gnes de fusion
Suivi de la maladie rsiduelle:
- identification des rarrangements
(TCR/BCR) par PCR
- mutation dans oncognes et analyse
des gnes de fusion
Suivi de la maladie rsiduelle: Suivi de la maladie rsiduelle:
- Squenage du clone: (Banque de
donnes): primers spcifiques de la
squence du clone
- PCR quantitative
Suivi de la maladie rsiduelle:
- Squenage du clone: (Banque de
donnes): primers spcifiques de la
squence du clone
- PCR quantitative
MASTER 1 Biologie Sant Immunopathologie - Syndromes Lymphoprolifratifs
Anne Universitaire 2010 - 2011
Facult de Mdecine Montpellier-Nmes
C. RENE
(Mise ligne 18/04/11 LIPCOM)
Les rarrangements
principe: principe:
- identifier une population drive dune seule cellule
en utilisant son rarrangement unique des gnes V-
(D)-J prsent au niveau des loci de son rcepteur
lAg
1 clone= 1 rcepteur lAg= correspond un
rarrangement des gnes codant pour ce rcepteur
5 3
ADN germinal
Vk=40 Jk Ck
Recombinaison V-J
Recombinaison locus k
ADN rarrang
ARN nuclaire
Transcription
Epissage
V J C
ARN messager
Chane k mature
Epissage
Traduction
120kb
2 J1
1 2 3 4 5P 6 7 8 A 9 10 B 11 5 JP1 JP J1 JP2 J2 C1 C2
3 5
V
Identification des rarrangements des gnes du TCR par PCR
PS CDR1 CDR2
RSS RSS
J1 TRGV2
FR1 FR2 FR3
Germinal
Forward Primer TCRGV Reverse Primer JG
Amplification
Polyclonale
PS CDR1 CDR2
FR1 FR2 FR3
Recombin
3
Forward Primer TCRGV Reverse Primer JG
Amplification monoclonale
Produit de PCR
PCR GeneScan analysis of IGH tube A: VH-JH
rearrangements
PCR GeneScan analysis of IGH tube A: VH-JH
rearrangements
DH JH
J primer H 6 V -FR1 primers
(V family primers)
H
H
VH
BIOMED-2 Concerted Action BMH4-CT98-3936: PCR-based clonality studies
*
CTGTGCAAGAG
CTGTGCAAGAGA
CTGTGCAAG
CTATGGTTCAGGGAGTTAT
ACAGTAACT
AGTATAGCAGCTCGT
AGCTCGTTT
GTGGGAGCTACTA
GTAGCTAAAC
CTACTACGGTATGGACGTCTGG
CTGTGCAAGAG CTACTACTACTACGGTATGGACGTCTGG
ACAACTGGTTCGACTCCTGG
CTGTGCAAGAGA TGCTTTTGATATCTGG
CTGTGCAAGAG CTACTGG
CTGTGCAAGAG CTTTGACTACTGG
CTGTGCAAGAG ATGCTTTTGATATCTGG
CTGTGCAAGAG GACTACTGG
CTTTGACTACTGG
CTGTGCAA CTACTTTGACTACTGG
CGGG GG
GACGAA GC
GAT
TCCGGGC
CCTCTCTCCACTGGGATGGGGGG
CAGCAGCTCGGCCCC
GACTTTGG
G
G
TAT
MASTER 1 Biologie Sant Immunopathologie - Syndromes Lymphoprolifratifs
Anne Universitaire 2010 - 2011
Facult de Mdecine Montpellier-Nmes
C. RENE
(Mise ligne 18/04/11 LIPCOM)
160 170 180 190 200 210 220 230 240
300
400
500
600
700
800
Cellules Produits de PCR
Analyse Genescan des produits de PCR
Genscan
L 1 2 3
0
100
200
300
0
600
1200
1800
2400
3000
3600
4200
4800
Tissu polyclonal
Expansion
Monoclonale dans
Tissu polyclonal
L 1 2 3
0
980
1920
2880
3840
4800
5760
6720
7680
Expansion
monoclonale
Junctional region diversity Junctional region diversity
VH3-21 JH4-1 C DH3-3
j ti l i
GTATTACGATTTTTGGAGTGGTTATTATACC
insertion insertion V 3-21 (germline) H
TGTATTACTGTGCGAGA
D 3-3 (germline) H J 4-1 (germline) H
ACTACTTTGACTACT
TGTATTACTGT
TGTATTACTGTGCG
TGTATTACTGTGC
TGTATTACTGTGCGAG
TGTATTACTG
TGTATTACTGTGCG
TGTATTACTGTGCGA
CGATTTTTGGAGTGGTTATTATA
TTACGATTTTTGGAGTGGTTATTATAC
TTTTGGAGTGGTTATTATACC
TATTACGATTTTTGGAGTGGTTAT
CGATTTTTGGAGTGGTTATTATA
TACGATTTTTGGAGTGGTTATTAT
TTACGATTTTTGGAGTGGTTATTATACC
TGACTACT
CTTTGACTACT
ACTACTTTGACTACT
TTTGACTACT
ACTTTGACTACT
TGACTACT
TACTTTGACTACT
AGGC
TATCCGGA
CCGGACTG
CTGAGTC
ACATCGA
CGT
CCGG
GTCCA
CGATCG
GGT
CGTAGCGTA
CGTAG
GGCTAAGG
CGGAGC
junctional region
Dept. of Immunology, ErasmusUniversityRotterdam.
TGTATTACT
TGTATTACTGTGCG
TGTATTACTGTGC
TGTATTACTGTGCGAGA
TGTATTACTGTG
TGTATTA
TGTATTACTGTGC
TGTATTACTGTGCGA
GATTTTTGGAGTGGT
ATTACGATTTTTGGAGTGGTTATTATA
TTTGGAGTGGTTATTATA
ATTACGATTTTTGGAGTGGTTATTATACC
TATTACGATTTTTGGAGTG
CGATTTTTGGAGTGGTTATTATA
ATTACGATTTTTGGAGTGG
GTATTACGATTTTTGGAGTGGTTATTATACC
ACTACTTTGACTACT
CTTTGACTACT
ACTTTGACTACT
GACTACT
CTACTTTGACTACT
ACT
TTTGACTACT
ACTTTGACTACT
GATG
TTCA
GGCTAG
GTCCAG
CCGGA
ACGC
CGTA
GGTTC
CGATCGA
CC
GTCG
CCGTAG
C
GTACG
GGCA
Translocations tudie par PCR ou RT-PCR
LNH B:
-BCL2-JH: t(14;18): 90% des lymphomes folliculaires
-BCL1-JH: t(11,14): lymphomes du manteau
-BCL6-Switch: t(3,14): Lymphomes grande cellules
LNH T:
- NPM-ALK: t(2;5): Lymphome T anaplasiques
MASTER 1 Biologie Sant Immunopathologie - Syndromes Lymphoprolifratifs
Anne Universitaire 2010 - 2011
Facult de Mdecine Montpellier-Nmes
C. RENE
(Mise ligne 18/04/11 LIPCOM)
Les diffrentes entits
Moelle osseuse Moelle osseuse
CS B B B B t
plasmocyt e
A. leucmies C. mylome
Moelle osseuse Moelle osseuse
CS B B B B t
plasmocyt e
A. leucmies C. mylome
Moelle osseuse Moelle osseuse
CS B B B B t
plasmocyt e
A. leucmies C. mylome
CS pr oB pr B B
immat ur e
B mat ur e
NAI F
B mmoir e
F lli l
B. lymphomes
CS pr oB pr B B
immat ur e
B mat ur e
NAI F
B mmoir e
F lli l
B. lymphomes
CS pr oB pr B B
immat ur e
B mat ur e
NAI F
B mmoir e
F lli l
B. lymphomes
Ganglion (ou r at e)
Follicule
lymphode
Swit ch
Mut at ions somat iques
Ganglion (ou r at e)
Follicule
lymphode
Swit ch
Mut at ions somat iques
Ganglion (ou r at e)
Follicule
lymphode
Swit ch
Mut at ions somat iques
HMOPATHIES LYMPHODES B
HMOPATHIES LYMPHODES PRCURSEURS B
Leucmie/lymphome lymphoblastique B
HMOPATHIES LYMPHODES B MATURES
Leucmie lymphode chronique/lymphome lymphocytique
Leucmie prolymphocytaire
Lymphome lymphoplasmocytaire/Waldenstrom
Lymphome B de la zone marginale
Extraganglionnaire de type MALT
HMOPATHIES LYMPHODES B
HMOPATHIES LYMPHODES PRCURSEURS B
Leucmie/lymphome lymphoblastique B
HMOPATHIES LYMPHODES B MATURES
Leucmie lymphode chronique/lymphome lymphocytique
Leucmie prolymphocytaire
Lymphome lymphoplasmocytaire/Waldenstrom
Lymphome B de la zone marginale
Extraganglionnaire de type MALT
HMOPATHIES LYMPHODES T
HMOPATHIES LYMPHODES PRCURSEURS T
Leucmie/lymphome lymphoblastique T
HMOPATHIES LYMPHODES T MATURES
Formes leucmiques ou dissmines
Leucmie/Lymphome prolymphocytaire T
Classification OMS (2000)
g g yp
Ganglionnaire, parfois monocytode
Splnique
Prolifrations plasmocytaires (mylome, plasmocytome)
Leucmie tricholeucocytes
Lymphomes folliculaires
Lymphomes cellules du manteau
Lymphomes diffus grandes cellules
Variantes :
Centroblastique
Immunoblastique
Riche en cellules T
Type granulomatose lymphomatode
Anaplasique
Plasmoblastique
g g yp
Ganglionnaire, parfois monocytode
Splnique
Prolifrations plasmocytaires (mylome, plasmocytome)
Leucmie tricholeucocytes
Lymphomes folliculaires
Lymphomes cellules du manteau
Lymphomes diffus grandes cellules
Variantes :
Centroblastique
Immunoblastique
Riche en cellules T
Type granulomatose lymphomatode
Anaplasique
Plasmoblastique
Leucmie/Lymphome prolymphocytaire T
Leucmie/Lymphome cellules grains (LGL)
Leucmie/Lymphome cellules NK
Leucmie/Lymphome T de l adulte (HTLV1+)
Extranodales
Lymphome extranodal T/NK
Lymphome T avec entropathie
Lymphome T hepatosplnique gamma-delta
Lymphome T sous-cutan de type panniculite
Lymphomes T cutans ( Mycosis fongode /
Syndrome de Szary)
Plasmoblastique
Du mdiastin
Primitif des sreuses
Intravasculaire
Lymphome de Burkitt / Leucmie cellules de Burkitt
Plasmoblastique
Du mdiastin
Primitif des sreuses
Intravasculaire
Lymphome de Burkitt / Leucmie cellules de Burkitt
Topographie ganglionnaire prdominante
Lymphome anaplasique grandes cellules
Lymphomes T priphriques
Lymphomes T angio-immunoblastiques
LYMPHOMES HODGKINIENS
A prdominance lymphocytaire nodulaire
Classique
HMOPATHIES LYMPHODES B
HMOPATHIES LYMPHODES PRCURSEURS B
Leucmie/lymphome lymphoblastique B
HMOPATHIES LYMPHODES B MATURES
Leucmie lymphode chronique/lymphome lymphocytique
Leucmie prolymphocytaire
Lymphome lymphoplasmocytaire/Waldenstrom
HMOPATHIES LYMPHODES B
HMOPATHIES LYMPHODES PRCURSEURS B
Leucmie/lymphome lymphoblastique B
HMOPATHIES LYMPHODES B MATURES
Leucmie lymphode chronique/lymphome lymphocytique
Leucmie prolymphocytaire
Lymphome lymphoplasmocytaire/Waldenstrom
HMOPATHIES LYMPHODES T
HMOPATHIES LYMPHODES PRCURSEURS T
Leucmie/lymphome lymphoblastique T
HMOPATHIES LYMPHODES T MATURES
Formes leucmiques ou dissmines
Leucmie/Lymphome prolymphocytaire T
Classification OMS (2000)
y p y p p y
Lymphome B de la zone marginale
Extraganglionnaire de type MALT
Ganglionnaire, parfois monocytode
Splnique
Prolifrations plasmocytaires (mylome, plasmocytome)
Leucmie tricholeucocytes
Lymphomes folliculaires
Lymphomes cellules du manteau
Lymphomes diffus grandes cellules
Variantes :
Centroblastique
Immunoblastique
Riche en cellules T
Type granulomatose lymphomatode
y p y p p y
Lymphome B de la zone marginale
Extraganglionnaire de type MALT
Ganglionnaire, parfois monocytode
Splnique
Prolifrations plasmocytaires (mylome, plasmocytome)
Leucmie tricholeucocytes
Lymphomes folliculaires
Lymphomes cellules du manteau
Lymphomes diffus grandes cellules
Variantes :
Centroblastique
Immunoblastique
Riche en cellules T
Type granulomatose lymphomatode
Leucmie/Lymphome prolymphocytaire T
Leucmie/Lymphome cellules grains (LGL)
Leucmie/Lymphome cellules NK
Leucmie/Lymphome T de l adulte (HTLV1+)
Extranodales
Lymphome extranodal T/NK
Lymphome T avec entropathie
Lymphome T hepatosplnique gamma-delta
Lymphome T sous-cutan de type panniculite
Lymphomes T cutans ( Mycosis fongode /
Syndrome de Szary)
Type granulomatose lymphomatode
Anaplasique
Plasmoblastique
Du mdiastin
Primitif des sreuses
Intravasculaire
Lymphome de Burkitt / Leucmie cellules de Burkitt
Type granulomatose lymphomatode
Anaplasique
Plasmoblastique
Du mdiastin
Primitif des sreuses
Intravasculaire
Lymphome de Burkitt / Leucmie cellules de Burkitt
Topographie ganglionnaire prdominante
Lymphome anaplasique grandes cellules
Lymphomes T priphriques
Lymphomes T angio-immunoblastiques
LYMPHOMES HODGKINIENS
A prdominance lymphocytaire nodulaire
Classique
MASTER 1 Biologie Sant Immunopathologie - Syndromes Lymphoprolifratifs
Anne Universitaire 2010 - 2011
Facult de Mdecine Montpellier-Nmes
C. RENE
(Mise ligne 18/04/11 LIPCOM)
LAL PrB
LAL B
Leucmies aigues lymphoblastiques
(LAL)
Leucmies aigues lymphoblastiques
(LAL)
LAL ProB
P it l h d
LAL commune
ProB
PrB
B immature
Progniteur lymphode commun
LAL T
communes
LAL T
immatures
ProT
Thymocyte
immature DN
LAL LAL
Dfinition
Prolifration clonale maligne de prcurseurs immatures des lignes
lymphodes
Blocage de la maturation
Dfinition
Prolifration clonale maligne de prcurseurs immatures des lignes
lymphodes
Blocage de la maturation Blocage de la maturation
Incidence
2 nouveaux cas pour 100 000 habitants
2 pics de frquence :
1) enfants Pic 2 5 ans
1/20 000 enfants (80% des LA de lenfant
et 80% LAL-B)
Blocage de la maturation
Incidence
2 nouveaux cas pour 100 000 habitants
2 pics de frquence :
1) enfants Pic 2 5 ans
1/20 000 enfants (80% des LA de lenfant
et 80% LAL-B)
2) adultes gs (>70 ans)
Survie
Enfants CR 65% puis >80%
Adultes CR 25 35%
2) adultes gs (>70 ans)
Survie
Enfants CR 65% puis >80%
Adultes CR 25 35%
Circonstances de dcouverte des LAL
Signes fonctionnels
Circonstances de dcouverte des LAL
Signes fonctionnels
LAL LAL
Signes fonctionnels
- Altration de ltat gnral
- Douleurs osseuses (20 40% des cas)
- Insuffisance mdullaire
- Pleur (anmie)
- Infections (neutropnie)
- Hmorragies cutanes et/ou muqueuses ( thrombopnie)
Signes fonctionnels
- Altration de ltat gnral
- Douleurs osseuses (20 40% des cas)
- Insuffisance mdullaire
- Pleur (anmie)
- Infections (neutropnie)
- Hmorragies cutanes et/ou muqueuses ( thrombopnie)
Manifestations tumorales
- Adnopathies - hpatomgalie - splnomgalie (75% des cas chez
l'enfant)
Mylogramme: - cellules blastiques >30%
Manifestations tumorales
- Adnopathies - hpatomgalie - splnomgalie (75% des cas chez
l'enfant)
Mylogramme: - cellules blastiques >30%
Description cytologique des blastes de LAL (FAB) Description cytologique des blastes de LAL (FAB)
Blastes de type 1
Population homogne
- Taille : deux fois la taille d'un lymphocyte.
- Noyau : rgulier, peu ou pas nuclol, chromatine fine
- Cytoplasme : couronne prinuclaire, discrtement basophile. R
N/C lev.
Blastes de type 1
Population homogne
- Taille : deux fois la taille d'un lymphocyte.
- Noyau : rgulier, peu ou pas nuclol, chromatine fine
- Cytoplasme : couronne prinuclaire, discrtement basophile. R
N/C lev.
Blastes de type 2
Population htrogne
- Taille: htrogne
- Noyaux : nuclols, parfois irrguliers.
- Cytoplasme plus tendu que dans la LAL 1. R N/C
moins lev
Blastes de type 3
Population homogne. Aspect caractristique de cellules de
Burkitt
- Taille: moyenne
- Noyau: rgulier rond ou ovale
- Cytoplasme : +++ basophilie, +++ vacuoles.
MASTER 1 Biologie Sant Immunopathologie - Syndromes Lymphoprolifratifs
Anne Universitaire 2010 - 2011
Facult de Mdecine Montpellier-Nmes
C. RENE
(Mise ligne 18/04/11 LIPCOM)
Classification des LAL Classification des LAL
Intrts de limmunophnotypage
identifier la ligne en cause
Intrts de limmunophnotypage
identifier la ligne en cause identifier la ligne en cause
identifier le stade de maturation
identifier la ligne en cause
identifier le stade de maturation
Ligne B Ligne T Ligne mylode
2 points CD79, c, cCD22 CD3, TCR MPO, lyzozyme
1 point CD19, CD10, CD20 CD2, CD5, CD8, CD10 CD13, CD33, CD65, CD117 p
0.5 point TdT, CD24 TdT, CD7, CD1a CD14, CD15, CD64
Affirmer lappartenance une ligne :
au moins un score de deux points dans une ligne (les scores doivent tre
infrieurs < 2 dans les autres lignes)
Classification des LAL-B Classification des LAL-B
Positivit d'au moins deux marqueurs B: CD19 / CD22 /
cCD79 est ncessaire pour la classification en ligne B
Ngativit dau moins trois des marqueurs T: CD3 CD2
Positivit d'au moins deux marqueurs B: CD19 / CD22 /
cCD79 est ncessaire pour la classification en ligne B
Ngativit dau moins trois des marqueurs T: CD3 CD2
CD19 + / CD22 + (s ou c) / cCD79 +
CD10
c
( intracyto)
slg (k ou )
(de surface)
Ngativit dau moins trois des marqueurs T: CD3, CD2,
CD5, CD7, CD8
Ngativit dau moins trois des marqueurs mylodes CD13,
CD33, CD117, MPO
Ngativit dau moins trois des marqueurs T: CD3, CD2,
CD5, CD7, CD8
Ngativit dau moins trois des marqueurs mylodes CD13,
CD33, CD117, MPO
( intracyto) (de surface)
B-I (Pro-B) - - -
B-II (LAL commune)
50%
+ - -
B-III (Pre-B) 15 20% +/- + -
B-IV (Mature B) +/- +/- +
Classification des LAL-T Classification des LAL-T
LAL T : - 20% des LAL de lenfant (+++ chez les
garons)
- 25% des LAL de ladulte
LAL T : - 20% des LAL de lenfant (+++ chez les
garons)
- 25% des LAL de ladulte
cCD3 CD7 CD2/CD5/CD8 CD1a+ sCD3+/CD1a-
T-I ou LAL pro-T
+ + - - -
Remarques : - LAL hyperleucocytaire
- atteinte thymique.
Remarques : - LAL hyperleucocytaire
- atteinte thymique.
T-II ou LAL pr-T
+ + + - -
T-III ou LAL -T corticale
+ + + + -
T-IV ou LAL-T mature
+ + + - +
LAL: cytogntique LAL: cytogntique
t(4;11)(q21;q23) :
- associe des B immatures (CD19+, CD10-, CD20-)
- +++ l'enfant trs jeune,
gne MLL en 11q23 et AF4 en 4q21
t(4;11)(q21;q23) :
- associe des B immatures (CD19+, CD10-, CD20-)
- +++ l'enfant trs jeune,
gne MLL en 11q23 et AF4 en 4q21
Fish : MLL (11q23)
- gne MLL en 11q23 et AF4 en 4q21,
- pronostic trs sombre
t (1;19)(q23;p13)
- associe un phnotype pr-B.
- +++ enfant
- gnes E2A en 19p13 et PBX1 en 1q23
t(9;22)(q34;q11) :
- gne MLL en 11q23 et AF4 en 4q21,
- pronostic trs sombre
t (1;19)(q23;p13)
- associe un phnotype pr-B.
- +++ enfant
- gnes E2A en 19p13 et PBX1 en 1q23
t(9;22)(q34;q11) :
Caryotype :
t (4;11)(q21;q23) Fish : AF4 (4q23)
- pronostic trs sombre,
- 30% des adultes surtout > 50 ans, 5% des enfants
- gnes ABL et BCR
t(12;21)(p12;q22) :
- LAL B CD10+ de l'enfant
- gnes ETV6 et AML1
- pronostic trs sombre,
- 30% des adultes surtout > 50 ans, 5% des enfants
- gnes ABL et BCR
t(12;21)(p12;q22) :
- LAL B CD10+ de l'enfant
- gnes ETV6 et AML1
Colocalisation
translocation
t (9;22)(q34;q11)
Caryotype :
t (9;22)(q34;q11)
MASTER 1 Biologie Sant Immunopathologie - Syndromes Lymphoprolifratifs
Anne Universitaire 2010 - 2011
Facult de Mdecine Montpellier-Nmes
C. RENE
(Mise ligne 18/04/11 LIPCOM)
t(9;22)(q34;q11)
Gne BCR (22q11.2)
Fonction:
- localisation cytoplasmique
m bcr
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23
Gne ABL1 (9q34.1)
localisation cytoplasmique
- Srine/thronine kinase possdant un
domaine doligomrisation
- activation cellulaire passant par les
protines Ras
m-bcr
T(9;22) P190 kDa
1a 2 3 4 5 6 7 8 9 10 11 1b
Fonction
localisation nuclaire et cytoplasmique
1- Nuclear c-ABL : rle majeur dans la rgulation
lapoptose aprs dommages de lADN.
2- Cytoplasmic c-ABL : Fonction possible dans les signaux
dadhsion cellulaire
Tyrosine kinase
Premier Intron
200Kb
T(9;22) P190
Rarrangements des gnes du
BCR et du TCR : Marqueurs de
clonalit
Rarrangements des gnes du
BCR et du TCR : Marqueurs de
clonalit
Marqueur clonal TCR
TCR Genes: codant pour le rcepteur des cellules T: o|
o
Marqueur clonal BCR
Gnes IGH : codant pour les chanes lourdes des Ig: Igh
LAL T
LAL B
LAL T
LAL B
Gnes Kappa : codant pour les chanes lgres des Ig : Igk
Gnes Lambda : codant pour les chanes lgres des Ig : Ig
Rarrangements des gnes du TCR Rarrangements des gnes du TCR
Rarrangements illgitimes
Une des mthodes de suivi des
LAL
Une des mthodes de suivi des
LAL
Quantification de la MRD par
RQ-PCR
Quantification de la MRD par
RQ-PCR
LAL LAL
Diversit jonctionnelle
Insertion
De nucleotides
Dletion de nuclotides
en 3 des gnes V
Dletion de nuclotides
En 5 des gnes J
1) Diversit du rpertoire
10
9
to 10
12
clones diffrents
Marqueur de clonalit
2) Identification de marqueur de clonalit
Gne V particulier Vg3
Gne J particulier
JP1
Time of diagnosis:
Blastes = 85 to 99%
PCR Multiplex
Un unique
produit de PCR
Squenage
Squence du marqueur
de clonalit
MASTER 1 Biologie Sant Immunopathologie - Syndromes Lymphoprolifratifs
Anne Universitaire 2010 - 2011
Facult de Mdecine Montpellier-Nmes
C. RENE
(Mise ligne 18/04/11 LIPCOM)
volution des leucmies au cours de la polychimiothrapie
Blastes
Normal cells
Polychimiothrapie
Cellules leucmiques rsiduelles
Phase aigu
Blastes: 90 to 99%
Bonne rponse
aux traitements
Rmission complte
Diagnostic:
Identification des
marqueurs clonaux
Traitement: Quantification de la maladie rsiduelle (MRD)
RQ-PCR avec sonde Taqman
Primer spcifique
jonctionnel
R Q
Sonde Taqman
Primer Consensus
1) Activit Polymrase
R Q
2) Activit Exonuclase
R
Q
Quantification de la maladie rsiduelle par RQ-PCR
1) Courbe talon
Diagnostic
Blastes = 85 99%
1/10

1/10

1/10

1/10

Blastes = 85 99%
10
-2
10
-3
10
-4
10
-5 Mix ADN
polyclonal
10
-1
Log Ct
2) Quantification
10
-5
10
-4
10
-3
10
-2
10
-1
Quantit
Echantillon du patient
Jour = X
% de blastes = ?
X
Les facteurs de mauvais pronostic des LAL
a) Age: - Enfant < 12 mois et surtout 6 mois
> 10 ans et surtout 15 ans
- Adulte > 60 ans (chromosome Phi)
b) L f h l t i 50 Gi /l b) Les formes hyperleucocytaires: > 50 Giga/l
c) Le syndrome tumoral
d) Latteinte neurologique demble : latteinte du SNC au diagnostic est rare (1,5%)
e) Les critres immunologiques
- CD 10 ou CALLA ngatif
- LA biphnotypique (marqueurs mylodes et lymphodes)
- Les LAL-T considres historiquement plus dfavorables
f) Les critres cytogntiques ) y g q
- Hypoplodie
- t(9 ;22) ou chromosome Philadelphie
- t(4 ;11)
- t(1 ;19) chez ladulte
g) Les critres de rponse la thrapeutique
- corticorsistance et chimiorsistance initiales
- maladie rsiduelle importante lissue de linduction
MASTER 1 Biologie Sant Immunopathologie - Syndromes Lymphoprolifratifs
Anne Universitaire 2010 - 2011
Facult de Mdecine Montpellier-Nmes
C. RENE
(Mise ligne 18/04/11 LIPCOM)
Prise en charge thrapeutique durgence
LAL - Traitements LAL - Traitements
Les objectifs du traitement
1- Obtenir une rmission complte
2- Obtenir une gurison
Prcautions: Syndrome de lyse tumorale y y
- complications mtaboliques (forme
hyperleucocytaire) : libration massive de produits de lyse
cellulaire
Indication de greffe
allognique
Indication de greffe
allognique
Clignotants prcoces Clignotants prcoces Clignotants prcoces
GB initiaux > 30000/mm
3
(ou 30 G/l) si LAL de la ligne B
atteinte initiale du SNC, clinique ou cytologique (LCR)
t(4;11) et/ou MLL-AF4+
t(1;19) et/ou E2A-PBX1+
haplodie ou near-triplodie (DNA index)
corticorsistance ET/OU chimiorsistance initiale
Clignotants prcoces
GB initiaux > 30000/mm
3
(ou 30 G/l) si LAL de la ligne B
atteinte initiale du SNC, clinique ou cytologique (LCR)
t(4;11) et/ou MLL-AF4+
t(1;19) et/ou E2A-PBX1+
haplodie ou near-triplodie (DNA index)
corticorsistance ET/OU chimiorsistance initiale
Clignotants tardifs
non-RC en post-induction (ncessit dune cure de rattrapage)
niveau lev de maladie rsiduelle IgH-TCR ou transcrits de fusion ( 10
-2
) en fin dinduction (MRD-1)
niveau lev de maladie rsiduelle IgH-TCR ou transcrits de fusion ( 10
-2
) en milieu de consolidation
(MRD-2)
Clignotants tardifs
non-RC en post-induction (ncessit dune cure de rattrapage)
niveau lev de maladie rsiduelle IgH-TCR ou transcrits de fusion ( 10
-2
) en fin dinduction (MRD-1)
niveau lev de maladie rsiduelle IgH-TCR ou transcrits de fusion ( 10
-2
) en milieu de consolidation
(MRD-2)
HMOPATHIES LYMPHODES B
HMOPATHIES LYMPHODES PRCURSEURS B
Leucmie/lymphome lymphoblastique B
HMOPATHIES LYMPHODES B MATURES
Leucmie lymphode chronique/lymphome lymphocytique
Leucmie prolymphocytaire
Lymphome lymphoplasmocytaire/Waldenstrom
HMOPATHIES LYMPHODES B
HMOPATHIES LYMPHODES PRCURSEURS B
Leucmie/lymphome lymphoblastique B
HMOPATHIES LYMPHODES B MATURES
Leucmie lymphode chronique/lymphome lymphocytique
Leucmie prolymphocytaire
Lymphome lymphoplasmocytaire/Waldenstrom
HMOPATHIES LYMPHODES T
HMOPATHIES LYMPHODES PRCURSEURS T
Leucmie/lymphome lymphoblastique T
HMOPATHIES LYMPHODES T MATURES
Formes leucmiques ou dissmines
Leucmie/Lymphome prolymphocytaire T
Classification OMS (2000)
y p y p p y
Lymphome B de la zone marginale
Extraganglionnaire de type MALT
Ganglionnaire, parfois monocytode
Splnique
Prolifrations plasmocytaires (mylome, plasmocytome)
Leucmie tricholeucocytes
Lymphomes folliculaires
Lymphomes cellules du manteau
Lymphomes diffus grandes cellules
Variantes :
Centroblastique
Immunoblastique
Riche en cellules T
Type granulomatose lymphomatode
y p y p p y
Lymphome B de la zone marginale
Extraganglionnaire de type MALT
Ganglionnaire, parfois monocytode
Splnique
Prolifrations plasmocytaires (mylome, plasmocytome)
Leucmie tricholeucocytes
Lymphomes folliculaires
Lymphomes cellules du manteau
Lymphomes diffus grandes cellules
Variantes :
Centroblastique
Immunoblastique
Riche en cellules T
Type granulomatose lymphomatode
Leucmie/Lymphome prolymphocytaire T
Leucmie/Lymphome cellules grains (LGL)
Leucmie/Lymphome cellules NK
Leucmie/Lymphome T de l adulte (HTLV1+)
Extranodales
Lymphome extranodal T/NK
Lymphome T avec entropathie
Lymphome T hepatosplnique gamma-delta
Lymphome T sous-cutan de type panniculite
Lymphomes T cutans ( Mycosis fongode /
Syndrome de Szary)
Type granulomatose lymphomatode
Anaplasique
Plasmoblastique
Du mdiastin
Primitif des sreuses
Intravasculaire
Lymphome de Burkitt / Leucmie cellules de Burkitt
Type granulomatose lymphomatode
Anaplasique
Plasmoblastique
Du mdiastin
Primitif des sreuses
Intravasculaire
Lymphome de Burkitt / Leucmie cellules de Burkitt
Topographie ganglionnaire prdominante
Lymphome anaplasique grandes cellules
Lymphomes T priphriques
Lymphomes T angio-immunoblastiques
LYMPHOMES HODGKINIENS
A prdominance lymphocytaire nodulaire
Classique
Leucmies lymphodes Leucmies lymphodes Leucmies lymphodes
chroniques
Leucmies lymphodes
chroniques
MASTER 1 Biologie Sant Immunopathologie - Syndromes Lymphoprolifratifs
Anne Universitaire 2010 - 2011
Facult de Mdecine Montpellier-Nmes
C. RENE
(Mise ligne 18/04/11 LIPCOM)
Leucmie lymphode chronique
(LLC)
Leucmie lymphode chronique
(LLC)
Dfinition :
Accumulation clonale de lymphocytes matures B
Infiltration mylo-sanguine et ganglionnaire insuffisance mdullaire et
Dfinition :
Accumulation clonale de lymphocytes matures B
Infiltration mylo-sanguine et ganglionnaire insuffisance mdullaire et y g g g
syndrome tumoral.
Epidmiologie:
30% des leucmies de ladulte
Incidence : 20 / 100 000 habitants de plus de 60 ans
Survenue: ge > 60 ans (2/3 cas), ge moyen = 65 ans, homme : 61%
Exceptionnelle en Extrme-Orient et sa frquence reste faible
chez les Asiatiques migrs aux Etats-Unis.
y g g g
syndrome tumoral.
Epidmiologie:
30% des leucmies de ladulte
Incidence : 20 / 100 000 habitants de plus de 60 ans
Survenue: ge > 60 ans (2/3 cas), ge moyen = 65 ans, homme : 61%
Exceptionnelle en Extrme-Orient et sa frquence reste faible
chez les Asiatiques migrs aux Etats-Unis.
Particularits :
Morphologie normale de LB mature
CD5+ / CD19+
Evolution indolente / agressive
Dysfonctionnement des mcanismes rgulateurs de lapoptose
(surexpression de loncogne bcl-2 par anomalie de mthylation)
Particularits :
Morphologie normale de LB mature
CD5+ / CD19+
Evolution indolente / agressive
Dysfonctionnement des mcanismes rgulateurs de lapoptose
(surexpression de loncogne bcl-2 par anomalie de mthylation)
LLC : Immunophnotypage LLC : Immunophnotypage
LB CD19+ CD20+ CD5+
Faible intensit d expression des immunoglobulines de surface par
rapport aux lymphocytes B normaux
LB CD19+ CD20+ CD5+
Faible intensit d expression des immunoglobulines de surface par
rapport aux lymphocytes B normaux
1 point 0 point
sIg Faible Modr fort
rapport aux lymphocytes B normaux
Score de MATUTES
+++ diagnostic diffrentiel LLC-B/lymphomes en phase
leucmique
score 4 au
ic
de 90% des LLC-B typiques et 71% des LLC-B
atypiques
rapport aux lymphocytes B normaux
Score de MATUTES
+++ diagnostic diffrentiel LLC-B/lymphomes en phase
leucmique
score 4 au
ic
de 90% des LLC-B typiques et 71% des LLC-B
atypiques
CD5 + -
CD23 + -
FMC7 - +
CD22 Faible ou - Modr fort
CD38 +
LLC-B : Deux origines LLC-B : Deux origines
CD38
ZAP-70 +
CD38 - CD38
ZAP-70 -
Dtermination du statut mutationnel
Squenage des gnes VH des IGH
Multiplexe
Gel dhtroduplexe
Dcoupe bande
Simplexe
Squenage
MASTER 1 Biologie Sant Immunopathologie - Syndromes Lymphoprolifratifs
Anne Universitaire 2010 - 2011
Facult de Mdecine Montpellier-Nmes
C. RENE
(Mise ligne 18/04/11 LIPCOM)
Comparaison avec une squence de rfrence
Dtermination du taux de mutation
LLC-B: marqueurs pronostiques
% identit= 100- nb de mutation*100/taille rgion V squence
Si > 98%=> Bon pronostic
Statut mutationnel
Si > 98% => Bon pronostic
Si < 98% => Mauvais pronostic
Expression de ZAP70
Expression de CD38
Mauvais pronostic
Expression de CD38
survie mdiane
Dr Bensa
EFS Grenoble
LLC-B: marqueurs
pronostiques
LLC-B: marqueurs
pronostiques
Prsence de mutations somatiques VH/VL Prsence de mutations somatiques VH/VL
Mutations + 24 ans
Mutations - 6 8 ans
CD38- mdiane non atteinte
CD38+ 14 ans
ZAP-70 - mdiane non atteinte
ZAP-70 + 7,5 ans
Expression de CD38
Expression de ZAP-70
Expression de CD38
Expression de ZAP-70
Bonne corrlation mais non absolue entre
IgVH Mutations+, CD38 -, ZAP-70 - et bon pronostic
IgVH Mutations -, CD38 +, ZAP-70 + et mauvais pronostic
Les Lymphomes Les Lymphomes
MASTER 1 Biologie Sant Immunopathologie - Syndromes Lymphoprolifratifs
Anne Universitaire 2010 - 2011
Facult de Mdecine Montpellier-Nmes
C. RENE
(Mise ligne 18/04/11 LIPCOM)
Organes lymphodes Organes lymphodes
Lymphomes: dfinition Lymphomes: dfinition
Prolifrations malignes de prcurseurs Prolifrations malignes de prcurseurs Prolifrations malignes de prcurseurs
matures dans les tissus lymphodes
Tumeurs B ou T
Monoclonalit
Prolifrations malignes de prcurseurs
matures dans les tissus lymphodes
Tumeurs B ou T
Monoclonalit
Mmes dterminants antigniques et
molculaires pour TOUTES les cellules
tumorales clonales
Mmes dterminants antigniques et
molculaires pour TOUTES les cellules
tumorales clonales
Lymphomes : classification
OMS
Lymphomes : classification
OMS
Chaque entit dfinie par
le sige ganglionnaire ou extra-ganglionnaire et la
prsentation clinique
la morphologie des cellules (grandes/petites) et larchitecture
(diffus ou nodulaire)
l immunophnotype B/T
Chaque entit dfinie par
le sige ganglionnaire ou extra-ganglionnaire et la
prsentation clinique
la morphologie des cellules (grandes/petites) et larchitecture
(diffus ou nodulaire)
l immunophnotype B/T p yp
la cytogntique
la biologie molculaire
p yp
la cytogntique
la biologie molculaire
LAL B
LAL commune
certaines LLC
Lymphomes malins non hodgkiniens B
Certaines LLC
Centroblaste Centrocyte Plasmocyte
PrB
B immature
LAL PrB
Mylome
Waldenstrm
B mature naf
Daprs Dr Bensa
EFS Grenoble
Progniteur lymphode commun
LAL T
immatures
LLC T, Mycosis
fungode, Szary
ProB
Thymocyte
immature DN
Thymocyte
LAL ProB
ProT
Thymocyte
L h t T CD4
Leucmie LGL
LAL T
communes
Lymphome
lymphoblastique
Lymphomes malins T
priphriques
Lymphome
angio centrique
Thymocyte
mature CD8 Lymphocyte T CD8
Lymphocyte NK
y y
commun DP
LAL T matures
Thymocyte
mature CD4
Lymphocyte T CD4
MASTER 1 Biologie Sant Immunopathologie - Syndromes Lymphoprolifratifs
Anne Universitaire 2010 - 2011
Facult de Mdecine Montpellier-Nmes
C. RENE
(Mise ligne 18/04/11 LIPCOM)
Rgions fonctionnelles des follicules lymphodes Rgions fonctionnelles des follicules lymphodes
Plasmocyte
IgM
Expansions clonales
Mutations somatiques
Slection
Commutation isotypique
Plasmocyte
IgM
Expansions clonales
Mutations somatiques
Expansions clonales
Mutations somatiques
Slection
Commutation isotypique
Slection
Commutation isotypique
Plasmocyte
IgM
Expansions clonales
Mutations somatiques
Slection
Commutation isotypique
Plasmocyte
IgM
Expansions clonales
Mutations somatiques
Expansions clonales
Mutations somatiques
Slection
Commutation isotypique
Slection
Commutation isotypique
Waldenst rm Waldenst rm
Zone
Sombre
Zone claire
Z
T
B
mergent
B
recirculant B-blaste
Cc
Cb
B
mmoire
Apoptose
CDF
m
DC
T
DC
Zone
Sombre
Zone claire
Z
T
B
mergent
B
recirculant B-blaste
Cc
Cb
B
mmoire
Apoptose
CDF
m
DC
T
DC
Zone
Sombre
Zone claire
Z
T
B
mergent
B
recirculant B-blaste
Cc
Cb
B
mmoire
Apoptose
CDF
m
DC
T
DC
Zone
Sombre
Zone claire
Z
T
B
mergent
B
recirculant B-blaste
Cc
Cb
B
mmoire
Apoptose
CDF
m
DC
T
DC
MMO MMO
Lymphome folliculaire Lymphome folliculaire
Manteau
Zone
marginale
Plasmocyte
IgG/IgA
Zone
Interfolliculaire
Follicule secondaire
IgD
IgM
IgG/A/E
CD23
CD10
CD38
CD138
Manteau
Zone
marginale
Plasmocyte
IgG/IgA
Zone
Interfolliculaire
Follicule secondaire
IgD
IgM
IgG/A/E
CD23
CD10
CD38
CD138
IgD
IgM
IgG/A/E
CD23
CD10
CD38
CD138
IgG/A/E
CD23
CD10
CD38
IgG/A/E
CD23
CD10
CD38
CD138
Manteau
Zone
marginale
Plasmocyte
IgG/IgA
Zone
Interfolliculaire
Follicule secondaire
IgD
IgM
IgG/A/E
CD23
CD10
CD38
CD138
Manteau
Zone
marginale
Plasmocyte
IgG/IgA
Zone
Interfolliculaire
Follicule secondaire
IgD
IgM
IgG/A/E
CD23
CD10
CD38
CD138
IgD
IgM
IgG/A/E
CD23
CD10
CD38
CD138
IgG/A/E
CD23
CD10
CD38
IgG/A/E
CD23
CD10
CD38
CD138
Lymphome du Lymphome du
mant eau mant eau
LLC LLC
HMOPATHIES LYMPHODES B
HMOPATHIES LYMPHODES PRCURSEURS B
Leucmie/lymphome lymphoblastique B
HMOPATHIES LYMPHODES B MATURES
Leucmie lymphode chronique/lymphome lymphocytique
Leucmie prolymphocytaire
Lymphome lymphoplasmocytaire/Waldenstrom
HMOPATHIES LYMPHODES B
HMOPATHIES LYMPHODES PRCURSEURS B
Leucmie/lymphome lymphoblastique B
HMOPATHIES LYMPHODES B MATURES
Leucmie lymphode chronique/lymphome lymphocytique
Leucmie prolymphocytaire
Lymphome lymphoplasmocytaire/Waldenstrom
HMOPATHIES LYMPHODES T
HMOPATHIES LYMPHODES PRCURSEURS T
Leucmie/lymphome lymphoblastique T
HMOPATHIES LYMPHODES T MATURES
Formes leucmiques ou dissmines
Leucmie/Lymphome prolymphocytaire T
Classification OMS (2000)
y p y p p y
Lymphome B de la zone marginale
Extraganglionnaire de type MALT
Ganglionnaire, parfois monocytode
Splnique
Prolifrations plasmocytaires (mylome, plasmocytome)
Leucmie tricholeucocytes
Lymphomes folliculaires
Lymphomes cellules du manteau
Lymphomes diffus grandes cellules
Variantes :
Centroblastique
Immunoblastique
Riche en cellules T
Type granulomatose lymphomatode
y p y p p y
Lymphome B de la zone marginale
Extraganglionnaire de type MALT
Ganglionnaire, parfois monocytode
Splnique
Prolifrations plasmocytaires (mylome, plasmocytome)
Leucmie tricholeucocytes
Lymphomes folliculaires
Lymphomes cellules du manteau
Lymphomes diffus grandes cellules
Variantes :
Centroblastique
Immunoblastique
Riche en cellules T
Type granulomatose lymphomatode
Leucmie/Lymphome prolymphocytaire T
Leucmie/Lymphome cellules grains (LGL)
Leucmie/Lymphome cellules NK
Leucmie/Lymphome T de l adulte (HTLV1+)
Extranodales
Lymphome extranodal T/NK
Lymphome T avec entropathie
Lymphome T hepatosplnique gamma-delta
Lymphome T sous-cutan de type panniculite
Lymphomes T cutans ( Mycosis fongode /
Syndrome de Szary)
Type granulomatose lymphomatode
Anaplasique
Plasmoblastique
Du mdiastin
Primitif des sreuses
Intravasculaire
Lymphome de Burkitt / Leucmie cellules de Burkitt
Type granulomatose lymphomatode
Anaplasique
Plasmoblastique
Du mdiastin
Primitif des sreuses
Intravasculaire
Lymphome de Burkitt / Leucmie cellules de Burkitt
Topographie ganglionnaire prdominante
Lymphome anaplasique grandes cellules
Lymphomes T priphriques
Lymphomes T angio-immunoblastiques
LYMPHOMES HODGKINIENS
A prdominance lymphocytaire nodulaire
Classique
Maladie de Hodgkin (MDH) Maladie de Hodgkin (MDH)
I filt t l h l h ti t hi ti t i I filt t l h l h ti t hi ti t i Infiltrat plomorphe lymphocytique et histiocytaire
Cellules de Reed-Sternberg: CD19-, CD20-, EBV+ (40%)
Important fond ractionnel
Clinique
5,5% des cancers pdiatriques
ADP +++
Infiltrat plomorphe lymphocytique et histiocytaire
Cellules de Reed-Sternberg: CD19-, CD20-, EBV+ (40%)
Important fond ractionnel
Clinique
5,5% des cancers pdiatriques
ADP +++ ADP +++
AEG, sueurs nocturnes
Anomalies molculaires: amplification gnique du gne codant
pour NF-kB
ADP +++
AEG, sueurs nocturnes
Anomalies molculaires: amplification gnique du gne codant
pour NF-kB
MDH
Cellules tumorales
Au sein dun infiltrat
MDH
Cellules tumorales
Au sein dun infiltrat
LMNH
Cellules tumorales+++
LMNH
Cellules tumorales+++
Au sein d un infiltrat
ractionnel
Au sein d un infiltrat
ractionnel
MASTER 1 Biologie Sant Immunopathologie - Syndromes Lymphoprolifratifs
Anne Universitaire 2010 - 2011
Facult de Mdecine Montpellier-Nmes
C. RENE
(Mise ligne 18/04/11 LIPCOM)
HMOPATHIES LYMPHODES B
HMOPATHIES LYMPHODES PRCURSEURS B
Leucmie/lymphome lymphoblastique B
HMOPATHIES LYMPHODES B MATURES
Leucmie lymphode chronique/lymphome lymphocytique
Leucmie prolymphocytaire
Lymphome lymphoplasmocytaire/Waldenstrom
HMOPATHIES LYMPHODES B
HMOPATHIES LYMPHODES PRCURSEURS B
Leucmie/lymphome lymphoblastique B
HMOPATHIES LYMPHODES B MATURES
Leucmie lymphode chronique/lymphome lymphocytique
Leucmie prolymphocytaire
Lymphome lymphoplasmocytaire/Waldenstrom
HMOPATHIES LYMPHODES T
HMOPATHIES LYMPHODES PRCURSEURS T
Leucmie/lymphome lymphoblastique T
HMOPATHIES LYMPHODES T MATURES
Formes leucmiques ou dissmines
Leucmie/Lymphome prolymphocytaire T
Classification OMS (2000)
y p y p p y
Lymphome B de la zone marginale
Extraganglionnaire de type MALT
Ganglionnaire, parfois monocytode
Splnique
Prolifrations plasmocytaires (mylome, plasmocytome)
Leucmie tricholeucocytes
Lymphomes folliculaires
Lymphomes cellules du manteau
Lymphomes diffus grandes cellules
Variantes :
Centroblastique
Immunoblastique
Riche en cellules T
Type granulomatose lymphomatode
y p y p p y
Lymphome B de la zone marginale
Extraganglionnaire de type MALT
Ganglionnaire, parfois monocytode
Splnique
Prolifrations plasmocytaires (mylome, plasmocytome)
Leucmie tricholeucocytes
Lymphomes folliculaires
Lymphomes cellules du manteau
Lymphomes diffus grandes cellules
Variantes :
Centroblastique
Immunoblastique
Riche en cellules T
Type granulomatose lymphomatode
Leucmie/Lymphome prolymphocytaire T
Leucmie/Lymphome cellules grains (LGL)
Leucmie/Lymphome cellules NK
Leucmie/Lymphome T de l adulte (HTLV1+)
Extranodales
Lymphome extranodal T/NK
Lymphome T avec entropathie
Lymphome T hepatosplnique gamma-delta
Lymphome T sous-cutan de type panniculite
Lymphomes T cutans ( Mycosis fongode /
Syndrome de Szary)
Type granulomatose lymphomatode
Anaplasique
Plasmoblastique
Du mdiastin
Primitif des sreuses
Intravasculaire
Lymphome de Burkitt / Leucmie cellules de Burkitt
Type granulomatose lymphomatode
Anaplasique
Plasmoblastique
Du mdiastin
Primitif des sreuses
Intravasculaire
Lymphome de Burkitt / Leucmie cellules de Burkitt
Topographie ganglionnaire prdominante
Lymphome anaplasique grandes cellules
Lymphomes T priphriques
Lymphomes T angio-immunoblastiques
LYMPHOMES HODGKINIENS
A prdominance lymphocytaire nodulaire
Classique
Dfinition Dfinition
Lymphomes malins non hodgkiniens Lymphomes malins non hodgkiniens
hmopathies lymphodes
infiltration ganglionnaire ou extra-gg
re
de cellules lymphodes
malignes monoclonales (B=70 % des cas)
Frquence: 10-15/100 000 habitants
Classification:
f ti d l l li ti
hmopathies lymphodes
infiltration ganglionnaire ou extra-gg
re
de cellules lymphodes
malignes monoclonales (B=70 % des cas)
Frquence: 10-15/100 000 habitants
Classification:
f ti d l l li ti en fonction de la localisation
en fonction de ltat de maturation
Type histologique selon morphologie cellulaire et architecture
en fonction de la localisation
en fonction de ltat de maturation
Type histologique selon morphologie cellulaire et architecture
Lymphome non hodgki ni en
Histologie
Lymphome non hodgki ni en
Forme diffuse
= LNH haut grade
Forme nodulaire
= LNH bas grade
LMNH LMNH
Centr oblaste
B
Lymphome diffus
gr andes cellules
IgM+ IgD+/-
CD5- CD19+ CD23-
Centr oblaste
B
Lymphome diffus
gr andes cellules
IgM+ IgD+/-
CD5- CD19+ CD23-
Centr oblaste
B
Lymphome diffus
gr andes cellules
IgM+ IgD+/-
CD5- CD19+ CD23-
Centr oblaste
B
Lymphome diffus
gr andes cellules
IgM+ IgD+/-
CD5- CD19+ CD23-
B
T Centr ocyte
CDF
ZONE SOMBRE
ZONE CLAIRE
Plasmocyte
IgMnon mut
CD5 CD19+ CD23
Lymphome
folliculair e
IgM+/- IgD+/-
CD5- CD19+ CD23-
Lymphome de Bur kitt
Lymphome
B
T Centr ocyte
CDF
ZONE SOMBRE
ZONE CLAIRE
Plasmocyte
IgMnon mut
CD5 CD19+ CD23
Lymphome
folliculair e
IgM+/- IgD+/-
CD5- CD19+ CD23-
Lymphome de Bur kitt
Lymphome
B
T Centr ocyte
CDF
ZONE SOMBRE
ZONE CLAIRE
Plasmocyte
IgMnon mut
CD5 CD19+ CD23
Lymphome
folliculair e
IgM+/- IgD+/-
CD5- CD19+ CD23-
Lymphome de Bur kitt
Lymphome
B
T Centr ocyte
CDF
ZONE SOMBRE
ZONE CLAIRE
Plasmocyte
IgMnon mut
CD5 CD19+ CD23
Lymphome
folliculair e
IgM+/- IgD+/-
CD5- CD19+ CD23-
Lymphome de Bur kitt
Lymphome
B
CDF
Mmoir e
B Plasmocyte
mutations somatiques
MANTEAU
Naf
resting
Lymphome du manteau
IgM+ IgD+/-
CD5+ CD19+ CD23-
de la zone
mar ginale
(MALT,
splnique)
B
CDF
Mmoir e
B Plasmocyte
mutations somatiques
MANTEAU
Naf
resting
Lymphome du manteau
IgM+ IgD+/-
CD5+ CD19+ CD23-
de la zone
mar ginale
(MALT,
splnique)
B
CDF
Mmoir e
B Plasmocyte
mutations somatiques
MANTEAU
Naf
resting
Lymphome du manteau
IgM+ IgD+/-
CD5+ CD19+ CD23-
de la zone
mar ginale
(MALT,
splnique)
B
CDF
Mmoir e
B Plasmocyte
mutations somatiques
MANTEAU
Naf
resting
Lymphome du manteau
IgM+ IgD+/-
CD5+ CD19+ CD23-
de la zone
mar ginale
(MALT,
splnique)
MASTER 1 Biologie Sant Immunopathologie - Syndromes Lymphoprolifratifs
Anne Universitaire 2010 - 2011
Facult de Mdecine Montpellier-Nmes
C. RENE
(Mise ligne 18/04/11 LIPCOM)
Rpartition des LNH Rpartition des LNH
Zone Marginale
MALT
8%
Folliculaire
22%
SLL
8%
T priphriques
7%
Anaplasique
T/nul
2%
Autres
6%
Zone Marginale
3%
Manteau
Burkitt
1%
2%
Diffus Grandes
Cellules
35%
Manteau
6% Lymphoblastiques Lymphoblastiques
HMOPATHIES LYMPHODES B
HMOPATHIES LYMPHODES PRCURSEURS B
Leucmie/lymphome lymphoblastique B
HMOPATHIES LYMPHODES B MATURES
Leucmie lymphode chronique/lymphome lymphocytique
Leucmie prolymphocytaire
Lymphome lymphoplasmocytaire/Waldenstrom
HMOPATHIES LYMPHODES B
HMOPATHIES LYMPHODES PRCURSEURS B
Leucmie/lymphome lymphoblastique B
HMOPATHIES LYMPHODES B MATURES
Leucmie lymphode chronique/lymphome lymphocytique
Leucmie prolymphocytaire
Lymphome lymphoplasmocytaire/Waldenstrom
HMOPATHIES LYMPHODES T
HMOPATHIES LYMPHODES PRCURSEURS T
Leucmie/lymphome lymphoblastique T
HMOPATHIES LYMPHODES T MATURES
Formes leucmiques ou dissmines
Leucmie/Lymphome prolymphocytaire T
Classification OMS (2000)
y p y p p y
Lymphome B de la zone marginale
Extraganglionnaire de type MALT
Ganglionnaire, parfois monocytode
Splnique
Prolifrations plasmocytaires (mylome, plasmocytome)
Leucmie tricholeucocytes
Lymphomes folliculaires
Lymphomes cellules du manteau
Lymphomes diffus grandes cellules
Variantes :
Centroblastique
Immunoblastique
Riche en cellules T
Type granulomatose lymphomatode
y p y p p y
Lymphome B de la zone marginale
Extraganglionnaire de type MALT
Ganglionnaire, parfois monocytode
Splnique
Prolifrations plasmocytaires (mylome, plasmocytome)
Leucmie tricholeucocytes
Lymphomes folliculaires
Lymphomes cellules du manteau
Lymphomes diffus grandes cellules
Variantes :
Centroblastique
Immunoblastique
Riche en cellules T
Type granulomatose lymphomatode
Leucmie/Lymphome prolymphocytaire T
Leucmie/Lymphome cellules grains (LGL)
Leucmie/Lymphome cellules NK
Leucmie/Lymphome T de l adulte (HTLV1+)
Extranodales
Lymphome extranodal T/NK
Lymphome T avec entropathie
Lymphome T hepatosplnique gamma-delta
Lymphome T sous-cutan de type panniculite
Lymphomes T cutans ( Mycosis fongode /
Syndrome de Szary)
Type granulomatose lymphomatode
Anaplasique
Plasmoblastique
Du mdiastin
Primitif des sreuses
Intravasculaire
Lymphome de Burkitt / Leucmie cellules de Burkitt
Type granulomatose lymphomatode
Anaplasique
Plasmoblastique
Du mdiastin
Primitif des sreuses
Intravasculaire
Lymphome de Burkitt / Leucmie cellules de Burkitt
Topographie ganglionnaire prdominante
Lymphome anaplasique grandes cellules
Lymphomes T priphriques
Lymphomes T angio-immunoblastiques
LYMPHOMES HODGKINIENS
A prdominance lymphocytaire nodulaire
Classique
Lymphome diffus grandes cellules Lymphome diffus grandes cellules
Lymphome agressif
grandes cellules B
Drive des LB des centres germinatifs (centroblastes)
Lymphome agressif
grandes cellules B
Drive des LB des centres germinatifs (centroblastes) Drive des LB des centres germinatifs (centroblastes)
Frquent = 25 35% des LMNH
Adultes
tous ges
Immunodprims
Atteintes
Rvlation ggre
75 % des cas
Prolifration uniforme
Atteintes extraganglionnaires primitives 40%
Drive des LB des centres germinatifs (centroblastes)
Frquent = 25 35% des LMNH
Adultes
tous ges
Immunodprims
Atteintes
Rvlation ggre
75 % des cas
Prolifration uniforme
Atteintes extraganglionnaires primitives 40% Atteintes extraganglionnaires primitives 40%
tube digestif
aires lymphodes ORL
os
peau
Cytogntique
expression de BCL6
mutation de P53
t(14;18) ou t(8;14) ou t(3;14) dans 50% des cas
Atteintes extraganglionnaires primitives 40%
tube digestif
aires lymphodes ORL
os
peau
Cytogntique
expression de BCL6
mutation de P53
t(14;18) ou t(8;14) ou t(3;14) dans 50% des cas
Lymphome diffus grandes cellules Lymphome diffus grandes cellules
Cassure double brin de lADN
Expression et/ou Activation de P53
-
BCL6
Physiologique
BCL-6
IgH
Pathologique
+
Cassure double brin de lADN
Expression et/ou Activation de P53
Cassure double brin de lADN
Expression et/ou Activation de P53
-
BCL6
Physiologique
BCL-6
IgH
Pathologique
BCL-6
IgH
BCL-6
IgH
Pathologique
++
Cassure double brin de lADN
Expression et/ou Activation de P53
-
BCL6
Physiologique
BCL-6
IgH
Pathologique
+
Cassure double brin de lADN
Expression et/ou Activation de P53
Cassure double brin de lADN
Expression et/ou Activation de P53
-
BCL6
Physiologique
BCL-6
IgH
Pathologique
BCL-6
IgH
BCL-6
IgH
Pathologique
++
Apoptose de la cellule Apoptose de la cellule Apoptose de la cellule Apoptose de la cellule Apoptose de la cellule Apoptose de la cellule
MASTER 1 Biologie Sant Immunopathologie - Syndromes Lymphoprolifratifs
Anne Universitaire 2010 - 2011
Facult de Mdecine Montpellier-Nmes
C. RENE
(Mise ligne 18/04/11 LIPCOM)
Lymphome de Burkitt Lymphome de Burkitt
Drive des LB des centres germinatifs (petites cellules clives,
type centrocyte)
> 50% des lymphomes de lenfant
Drive des LB des centres germinatifs (petites cellules clives,
type centrocyte)
> 50% des lymphomes de lenfant > 50% des lymphomes de l enfant
Maladie endmique en Afrique
EBV+ 90%
Tumeur de la face
Les formes occidentales
EBV+ 15%
Abdomen
P ti i b
> 50% des lymphomes de l enfant
Maladie endmique en Afrique
EBV+ 90%
Tumeur de la face
Les formes occidentales
EBV+ 15%
Abdomen
P ti i b Pronostic moins bon
Lymphomes survenant chez les sujets immunodprims (SIDA)
Translocation t(8;14) (q24-q32)
c-myc juxtapos IGH
Pronostic moins bon
Lymphomes survenant chez les sujets immunodprims (SIDA)
Translocation t(8;14) (q24-q32)
c-myc juxtapos IGH
Lymphome folliculaire Lymphome folliculaire
Drive des LB des centres germinatifs Drive des LB des centres germinatifs Drive des LB des centres germinatifs
Centroblastes et centrocytes
Expression de Bcl-2 (anti-apoptose)
Localisation ganglionnaire multiple
Atteintes
MO
rate
Drive des LB des centres germinatifs
Centroblastes et centrocytes
Expression de Bcl-2 (anti-apoptose)
Localisation ganglionnaire multiple
Atteintes
MO
rate
foie
sphre ORL
Tumeurs de faible malignit
Frquentes : 1/3 des LMNH
foie
sphre ORL
Tumeurs de faible malignit
Frquentes : 1/3 des LMNH
CMF de certains SLP B CMF de certains SLP B
LLC-B LManteau LFolliculaire
CD19 + + +
CD5 + + - CD5
CD10 - -/+ +
CD20 +/- ++ +
CD22 Faible + +
CD23 +/- -/+ -/+
CD25 -/+ - -
FMC7 -/+ + +
CD43 ++ +/- +/-
CD79b Faible + +/++
- Faible + +/++
Chane H M, DM, D M, DM, G M, DM, G
Rpartition des LMNH selon lge Rpartition des LMNH selon lge
Daprs dAndon A. et al. I GR Paris
MASTER 1 Biologie Sant Immunopathologie - Syndromes Lymphoprolifratifs
Anne Universitaire 2010 - 2011
Facult de Mdecine Montpellier-Nmes
C. RENE
(Mise ligne 18/04/11 LIPCOM)
HMOPATHIES LYMPHODES B
HMOPATHIES LYMPHODES PRCURSEURS B
Leucmie/lymphome lymphoblastique B
HMOPATHIES LYMPHODES B MATURES
Leucmie lymphode chronique/lymphome lymphocytique
Leucmie prolymphocytaire
Lymphome lymphoplasmocytaire/Waldenstrom
HMOPATHIES LYMPHODES B
HMOPATHIES LYMPHODES PRCURSEURS B
Leucmie/lymphome lymphoblastique B
HMOPATHIES LYMPHODES B MATURES
Leucmie lymphode chronique/lymphome lymphocytique
Leucmie prolymphocytaire
Lymphome lymphoplasmocytaire/Waldenstrom
HMOPATHIES LYMPHODES T
HMOPATHIES LYMPHODES PRCURSEURS T
Leucmie/lymphome lymphoblastique T
HMOPATHIES LYMPHODES T MATURES
Formes leucmiques ou dissmines
Leucmie/Lymphome prolymphocytaire T
Classification OMS (2000)
y p y p p y
Lymphome B de la zone marginale
Extraganglionnaire de type MALT
Ganglionnaire, parfois monocytode
Splnique
Prolifrations plasmocytaires (mylome, plasmocytome)
Leucmie tricholeucocytes
Lymphomes folliculaires
Lymphomes cellules du manteau
Lymphomes diffus grandes cellules
Variantes :
Centroblastique
Immunoblastique
Riche en cellules T
Type granulomatose lymphomatode
y p y p p y
Lymphome B de la zone marginale
Extraganglionnaire de type MALT
Ganglionnaire, parfois monocytode
Splnique
Prolifrations plasmocytaires (mylome, plasmocytome)
Leucmie tricholeucocytes
Lymphomes folliculaires
Lymphomes cellules du manteau
Lymphomes diffus grandes cellules
Variantes :
Centroblastique
Immunoblastique
Riche en cellules T
Type granulomatose lymphomatode
Leucmie/Lymphome prolymphocytaire T
Leucmie/Lymphome cellules grains (LGL)
Leucmie/Lymphome cellules NK
Leucmie/Lymphome T de l adulte (HTLV1+)
Extranodales
Lymphome extranodal T/NK
Lymphome T avec entropathie
Lymphome T hepatosplnique gamma-delta
Lymphome T sous-cutan de type panniculite
Lymphomes T cutans ( Mycosis fongode /
Syndrome de Szary)
Type granulomatose lymphomatode
Anaplasique
Plasmoblastique
Du mdiastin
Primitif des sreuses
Intravasculaire
Lymphome de Burkitt / Leucmie cellules de Burkitt
Type granulomatose lymphomatode
Anaplasique
Plasmoblastique
Du mdiastin
Primitif des sreuses
Intravasculaire
Lymphome de Burkitt / Leucmie cellules de Burkitt
Topographie ganglionnaire prdominante
Lymphome anaplasique grandes cellules
Lymphomes T priphriques
Lymphomes T angio-immunoblastiques
LYMPHOMES HODGKINIENS
A prdominance lymphocytaire nodulaire
Classique
Lymphomes T Lymphomes T
15% des lymphomes 15% des lymphomes y p
Surtout chez ladulte
Localisation cutane est caractristique
La cellule tumorale
y p
Surtout chez ladulte
Localisation cutane est caractristique
La cellule tumorale
cellules T diffrencies
cellules tumorales initialement localises dans le zone T du
ganglion
phnotype post thymique (CD1-, CD3+, CD4 ou CD8 simple
positif, expression du TCR)
cellules T diffrencies
cellules tumorales initialement localises dans le zone T du
ganglion
phnotype post thymique (CD1-, CD3+, CD4 ou CD8 simple
positif, expression du TCR)
Lymphomes cutans primitifs Lymphomes cutans primitifs
Lymphomes T Lymphomes T
Lymphomes T pidermotropes
envahissement de lpiderme par des LTCD4+
Mycosis Fongodes
Syndrome de Szary (5%)
Lymphomes grandes cellules CD30+
Lymphomes T de haut grade de malignit
Lymphomes B
10-20%des lymphomes cutans primitifs
Lymphomes T pidermotropes
envahissement de lpiderme par des LTCD4+
Mycosis Fongodes
Syndrome de Szary (5%)
Lymphomes grandes cellules CD30+
Lymphomes T de haut grade de malignit
Lymphomes B
10-20%des lymphomes cutans primitifs 10 20% des lymphomes cutans primitifs
Nodules ou tumeurs cutanes
Faible grade de malignit
10 20% des lymphomes cutans primitifs
Nodules ou tumeurs cutanes
Faible grade de malignit
HMOPATHIES LYMPHODES B
HMOPATHIES LYMPHODES PRCURSEURS B
Leucmie/lymphome lymphoblastique B
HMOPATHIES LYMPHODES B MATURES
Leucmie lymphode chronique/lymphome lymphocytique
Leucmie prolymphocytaire
Lymphome lymphoplasmocytaire/Waldenstrom
HMOPATHIES LYMPHODES B
HMOPATHIES LYMPHODES PRCURSEURS B
Leucmie/lymphome lymphoblastique B
HMOPATHIES LYMPHODES B MATURES
Leucmie lymphode chronique/lymphome lymphocytique
Leucmie prolymphocytaire
Lymphome lymphoplasmocytaire/Waldenstrom
HMOPATHIES LYMPHODES T
HMOPATHIES LYMPHODES PRCURSEURS T
Leucmie/lymphome lymphoblastique T
HMOPATHIES LYMPHODES T MATURES
Formes leucmiques ou dissmines
Leucmie/Lymphome prolymphocytaire T
Classification OMS (2000)
y p y p p y
Lymphome B de la zone marginale
Extraganglionnaire de type MALT
Ganglionnaire, parfois monocytode
Splnique
Prolifrations plasmocytaires (mylome, plasmocytome)
Leucmie tricholeucocytes
Lymphomes folliculaires
Lymphomes cellules du manteau
Lymphomes diffus grandes cellules
Variantes :
Centroblastique
Immunoblastique
Riche en cellules T
Type granulomatose lymphomatode
y p y p p y
Lymphome B de la zone marginale
Extraganglionnaire de type MALT
Ganglionnaire, parfois monocytode
Splnique
Prolifrations plasmocytaires (mylome, plasmocytome)
Leucmie tricholeucocytes
Lymphomes folliculaires
Lymphomes cellules du manteau
Lymphomes diffus grandes cellules
Variantes :
Centroblastique
Immunoblastique
Riche en cellules T
Type granulomatose lymphomatode
Leucmie/Lymphome prolymphocytaire T
Leucmie/Lymphome cellules grains (LGL)
Leucmie/Lymphome cellules NK
Leucmie/Lymphome T de l adulte (HTLV1+)
Extranodales
Lymphome extranodal T/NK
Lymphome T avec entropathie
Lymphome T hepatosplnique gamma-delta
Lymphome T sous-cutan de type panniculite
Lymphomes T cutans ( Mycosis fongode /
Syndrome de Szary)
Type granulomatose lymphomatode
Anaplasique
Plasmoblastique
Du mdiastin
Primitif des sreuses
Intravasculaire
Lymphome de Burkitt / Leucmie cellules de Burkitt
Type granulomatose lymphomatode
Anaplasique
Plasmoblastique
Du mdiastin
Primitif des sreuses
Intravasculaire
Lymphome de Burkitt / Leucmie cellules de Burkitt
Topographie ganglionnaire prdominante
Lymphome anaplasique grandes cellules
Lymphomes T priphriques
Lymphomes T angio-immunoblastiques
LYMPHOMES HODGKINIENS
A prdominance lymphocytaire nodulaire
Classique
MASTER 1 Biologie Sant Immunopathologie - Syndromes Lymphoprolifratifs
Anne Universitaire 2010 - 2011
Facult de Mdecine Montpellier-Nmes
C. RENE
(Mise ligne 18/04/11 LIPCOM)
Mylome multiple
et gammapathies monoclonales de
signification indtermine (MGUS)
Mylome multiple
et gammapathies monoclonales de
signification indtermine (MGUS) g ( ) g ( )
Plasmocytes courte
dure de vie
IgM
IgG A E D
Ganglion
Lymphoplasmocyte
(cellules B mmoire)
Centre germinatif
Waldenstrm
Plasmocytes courte
dure de vie
IgM IgM
IgG A E D
Ganglion
Lymphoplasmocyte
(cellules B mmoire)
Centre germinatif
Waldenstrm
Plasmocytes courte
dure de vie
IgM
IgG A E D
Ganglion
Lymphoplasmocyte
(cellules B mmoire)
Centre germinatif
Waldenstrm
Plasmocytes courte
dure de vie
IgM IgM
IgG A E D
Ganglion
Lymphoplasmocyte
(cellules B mmoire)
Centre germinatif
Waldenstrm
Cellule B nave
Lymphoblastes
IgG, A, E, D
Plasmablaste
Hypermutation
somatique
IgG,A,E,D
Stimulation Ag
Cellule B nave
Lymphoblastes
IgG, A, E, D
Plasmablaste
Hypermutation
somatique
IgG,A,E,D
Stimulation Ag
Cellule B nave
Lymphoblastes
IgG, A, E, D
Plasmablaste
Hypermutation
somatique
IgG,A,E,D
Stimulation Ag
Cellule B nave
Lymphoblastes
IgG, A, E, D
Plasmablaste
Hypermutation
somatique
IgG,A,E,D
Stimulation Ag
Cellule Pre-B
Plasmocyte longue
dure de vie
Moelle osseuse
(Mylome)
(LAL)
Cellule Pre-B
Plasmocyte longue
dure de vie
Moelle osseuse
(Mylome)
(LAL)
Cellule Pre-B
Plasmocyte longue
dure de vie
Moelle osseuse
(Mylome)
(LAL)
Cellule Pre-B
Plasmocyte longue
dure de vie
Moelle osseuse
(Mylome)
(LAL)
Daprs Multiple Myeloma: Increasing Evidence for a Multistep Transformation Process
Michael Hallek, and coll. Blood, Jan 1998; 91: 3 - 21.
Explorations des protines Explorations des protines
Sparation par Electrophorse
Dtection et identification de protines anormales
Immunolectrophorse
Sparation par Electrophorse
Dtection et identification de protines anormales
Immunolectrophorse Immunolectrophorse
Immunofixation
Dosages spcifiques de certaines protines
Ractions immunologiques : reconnaissance slective dun antigne par son
anticorps
Mthodes de prcipitation directe en solution
Turbidimtrie: mesure de lintensit de la lumire transmise aprs passage dans un
milieu trouble
Nphlmtrie: mesure de la diffusion de la lumire sur des particules en milieu trouble
Immunolectrophorse
Immunofixation
Dosages spcifiques de certaines protines
Ractions immunologiques : reconnaissance slective dun antigne par son
anticorps
Mthodes de prcipitation directe en solution
Turbidimtrie: mesure de lintensit de la lumire transmise aprs passage dans un
milieu trouble
Nphlmtrie: mesure de la diffusion de la lumire sur des particules en milieu trouble
Lumire diffuse Lumire diffuse
Lumire t ransmise Lumire t ransmise
Lumire diffuse Lumire diffuse
Mise en vidence dune Ig monoclonale Mise en vidence dune Ig monoclonale
ELECTROPHORESE DES PROTEINES SERIQUES
- lectrophorse sur couche mince dagarose ou electrophorse
capillaire
Sparation des protines selon leur charge par application dun
ELECTROPHORESE DES PROTEINES SERIQUES
- lectrophorse sur couche mince dagarose ou electrophorse
capillaire
Sparation des protines selon leur charge par application dun - Sparation des protines selon leur charge par application d un
champs lectrique
- Seuil de dtection 0.5 g/L
- Quantification du pic par densitomtrie
- Sparation des protines selon leur charge par application d un
champs lectrique
- Seuil de dtection 0.5 g/L
- Quantification du pic par densitomtrie
5 ( 6) fract ions: anode cat hode
MASTER 1 Biologie Sant Immunopathologie - Syndromes Lymphoprolifratifs
Anne Universitaire 2010 - 2011
Facult de Mdecine Montpellier-Nmes
C. RENE
(Mise ligne 18/04/11 LIPCOM)
Profil Normal
Causes derreurs Causes derreurs
IMMUNOFIXATION IMMUNOFIXATION
Mise en vidence du caractre monoclonal
- Permet la caractrisation isotypique: Technique qualitative
- fractionnement des constituants du srum lectrophorse sur gel
dagarose puis fixation d antisrums monospcifiques
(G,A,M,L,K)
- Prcipitation in situ des Ig
- Permet la caractrisation isotypique: Technique qualitative
- fractionnement des constituants du srum lectrophorse sur gel
dagarose puis fixation d antisrums monospcifiques
(G,A,M,L,K)
- Prcipitation in situ des Ig
- Lavage et rvlation par colorant (violet fuschine)
- Seuil de dtection : 250mg/L
- Lavage et rvlation par colorant (violet fuschine)
- Seuil de dtection : 250mg/L
MASTER 1 Biologie Sant Immunopathologie - Syndromes Lymphoprolifratifs
Anne Universitaire 2010 - 2011
Facult de Mdecine Montpellier-Nmes
C. RENE
(Mise ligne 18/04/11 LIPCOM)
Immunofixation Immunofixation
G = 10 8
ELP G A M K L
G = 10,8
A = 1.8
M = 0.6
G = 2.9
A = 20.9
M = 0.17
ELP G A M K L
Sang
G = 77.1
A = 0,24
M < 0,1
ELP G A M K L ELP Tri k kl l
urines
Technique de sparation lectrocintique Technique de sparation lectrocintique
Electrophorse capillaire Electrophorse capillaire
Technique de sparation lectrocintique
- immunosoustraction: mise en contact des protines et Ac
spcifiques fixs sur billes de spharose
- Puit de rfrence
- 5 autres puits: 1 antisrum = par puit
- Sdimentation des complexes Ag-Ac
Technique de sparation lectrocintique
- immunosoustraction: mise en contact des protines et Ac
spcifiques fixs sur billes de spharose
- Puit de rfrence
- 5 autres puits: 1 antisrum = par puit
- Sdimentation des complexes Ag-Ac p g
- Sparation lectrophortique
p g
- Sparation lectrophortique
Electrophorse capillaire Electrophorse capillaire
Ant i-I gG Ant i-I gG
Ant i-I gA
Ant i-I gM
I mmunosoust ract ion
Ant i-Kappa
Ant i-Lambda
Gammapathies monoclonales Gammapathies monoclonales
Anomalie de des Anomalie de des Anomalie de des
Ig
Pic homogne
-
Voire en 2
Anomalie de des
Ig
Pic homogne
-
Voire en 2
Albumine
o2
|
Albumine
o2
|
Albumine
o2
|
Albumine
o2
| Voire en 2 Voire en 2
o1
o2
|
o1
o2
|
o1
o2
|
o1
o2
|

MASTER 1 Biologie Sant Immunopathologie - Syndromes Lymphoprolifratifs


Anne Universitaire 2010 - 2011
Facult de Mdecine Montpellier-Nmes
C. RENE
(Mise ligne 18/04/11 LIPCOM)
MGUS MGUS
Dcouverte fortuite Dcouverte fortuite Dcouverte fortuite
> 50% des sujets de plus de 70 ans
Absence de protinurie de Bence Jones
Taux normal des autres Ig sriques
Plasmocytes mdullaires normaux
Dcouverte fortuite
> 50% des sujets de plus de 70 ans
Absence de protinurie de Bence Jones
Taux normal des autres Ig sriques
Plasmocytes mdullaires normaux y
Taux sriques de lIg monoclonale
IgG <20 g/l
IgA <10 g/l
y
Taux sriques de lIg monoclonale
IgG <20 g/l
IgA <10 g/l
Stratification selon le risque Stratification selon le risque
3 facteurs de risque :
Protine monoclonale > 15 g/l
Non IgG
3 facteurs de risque :
Protine monoclonale > 15 g/l
Non IgG
Nombre de facteurs :
Si 3 : haut risque
Si 2 : risque intermdiaire haut
Nombre de facteurs :
Si 3 : haut risque
Si 2 : risque intermdiaire haut
Non IgG
Ratio k/ anormal
Non IgG
Ratio k/ anormal
Si 2 : risque intermdiaire haut
Si 1 : risque intermdiaire bas
Si 0 : risque bas
Si 2 : risque intermdiaire haut
Si 1 : risque intermdiaire bas
Si 0 : risque bas
Ig monoclonales et SLP Ig monoclonales et SLP
LLC
Amylose I
ive
LMNH
LLC
Waldenst rm
MGUS
MMO
Mylome multiple des Os (MMO) Mylome multiple des Os (MMO)
Cellule tumorale = plasmocyte Cellule tumorale = plasmocyte p y
Localisation mdullaire
Production dIg par les plasmocytes tumoraux
Quantit plus faible quun plasmocyte normal (blocage dans la
diffrenciation)
C ll l d t i dI G I A I D
p y
Localisation mdullaire
Production dIg par les plasmocytes tumoraux
Quantit plus faible quun plasmocyte normal (blocage dans la
diffrenciation)
C ll l d t i dI G I A I D Cellules productrices dIgG +++, IgA, IgD
origine post-ganglionnaire
Cellules productrices dIgG +++, IgA, IgD
origine post-ganglionnaire
MASTER 1 Biologie Sant Immunopathologie - Syndromes Lymphoprolifratifs
Anne Universitaire 2010 - 2011
Facult de Mdecine Montpellier-Nmes
C. RENE
(Mise ligne 18/04/11 LIPCOM)
Rle central de LIl6 Rle central de LIl6
Diffrenciation plasmocytaire in vitro
Croissance des cellules mylomateuses ex vivo
Inhibition par anti-Il6
Synthse et expression de Il6-R par les cellules mylomateuses
Diffrenciation plasmocytaire in vitro
Croissance des cellules mylomateuses ex vivo
Inhibition par anti-Il6
Synthse et expression de Il6-R par les cellules mylomateuses
Plasmocytes tumoraux
Cellules stromales
Scrtion de cytokines
Il-6 MIP1o RANK ligand
Ostoclastes
Hyperrsorption osseuse
Lsions ostolytiques Hypercalcmie
Clinique du MMO Clinique du MMO
Terrain
Sujet g
10-15% des hmopathies malignes
Maladie incurable
Terrain
Sujet g
10-15% des hmopathies malignes
Maladie incurable Maladie incurable
Signes cliniques lis la prolifration plasmocytaire
Maladie incurable
Signes cliniques lis la prolifration plasmocytaire
AEG,
infections rptes et graves,
Syndrome anmique,
Syndrome d hyperviscosit
AEG,
infections rptes et graves,
Syndrome anmique,
Syndrome d hyperviscosit Syndrome d hyperviscosit,
complications,
Syndrome osseux+++(douleurs)
Pas de Syndrome tumoral
Syndrome d hyperviscosit,
complications,
Syndrome osseux+++(douleurs)
Pas de Syndrome tumoral
Electrophorse des protines
sriques et Immunofixation
Electrophorse des protines
sriques et Immunofixation
Electrophorse des protines sriques Electrophorse des protines sriques Electrophorse des protines sriques Electrophorse des protines sriques
Protidmie 100-120 g/l Protidmie 100-120 g/l
Albumine
o1
o2
|

Albumine
o1
o2
|

Albumine
o1
o2
|

Albumine
o1
o2
|

Albumine
o1
o2
|

Albumine
o1
o2
|

Protidmie 100 120 g/l


Ig monoclonale dans
80% des cas de MMO
IgG: 52%
IgA: 21%
IgD: 2%
Protidmie 100 120 g/l
Ig monoclonale dans
80% des cas de MMO
IgG: 52%
IgA: 21%
IgD: 2%
ELP G A M K L
IgG chane lgre
Immunofixation
ELP G A M K L ELP G A M K L
IgG chane lgre
Immunofixation
ELP G A M K L
IgG chane lgre
Immunofixation
ELP G A M K L ELP G A M K L
IgG chane lgre
Immunofixation IgE <0.01% IgE <0.01%
Signes radiologiques du MMO Signes radiologiques du MMO
MASTER 1 Biologie Sant Immunopathologie - Syndromes Lymphoprolifratifs
Anne Universitaire 2010 - 2011
Facult de Mdecine Montpellier-Nmes
C. RENE
(Mise ligne 18/04/11 LIPCOM)
Mylogramme (MGG) Mylogramme (MGG)
Cytogntique et MMO Cytogntique et MMO
Cytogntique Cytogntique
Translocations primaires = vnements prcoces voire initiateurs
Translocation IgH + cycline D1, cycline D2, FGFR3 principalement se
produisant suite des erreurs commutations au cours du dveloppement des
cellules B dans les centres germinatifs
Trisomie (3,5,7,9,11,15,19,21)
Translocations primaires = vnements prcoces voire initiateurs
Translocation IgH + cycline D1, cycline D2, FGFR3 principalement se
produisant suite des erreurs commutations au cours du dveloppement des
cellules B dans les centres germinatifs
Trisomie (3,5,7,9,11,15,19,21)
Translocations secondaires
Instabilit chromosomique
Origine ou rsultat de la progression de la maladie
Translocations secondaires
Instabilit chromosomique
Origine ou rsultat de la progression de la maladie
Non
hyper
diplodie
Cellules B du
centre germinatif
MGUS
Tx Primaire
IgH
11q13 (bcl-1)
6p21 (bcl-3)
16q23 (cmaf)
20 11 ( f B)
Mylome
intramdullaire
Mylome
Extramdullaire
Non
hyper
diplodie
Non
hyper
diplodie
Cellules B du
centre germinatif
MGUS MGUS
Tx Primaire
IgH
11q13 (bcl-1)
6p21 (bcl-3)
16q23 (cmaf)
20 11 ( f B)
Tx Primaire
IgH
11q13 (bcl-1)
6p21 (bcl-3)
16q23 (cmaf)
20 11 ( f B)
Mylome
intramdullaire
Mylome
intramdullaire
Mylome
intramdullaire
Mylome
Extramdullaire
Mylome
Extramdullaire
Non
hyper
diplodie
Cellules B du
centre germinatif
MGUS
Tx Primaire
IgH
11q13 (bcl-1)
6p21 (bcl-3)
16q23 (cmaf)
20 11 ( f B)
Mylome
intramdullaire
Mylome
Extramdullaire
Non
hyper
diplodie
Non
hyper
diplodie
Cellules B du
centre germinatif
MGUS MGUS
Tx Primaire
IgH
11q13 (bcl-1)
6p21 (bcl-3)
16q23 (cmaf)
20 11 ( f B)
Tx Primaire
IgH
11q13 (bcl-1)
6p21 (bcl-3)
16q23 (cmaf)
20 11 ( f B)
Mylome
intramdullaire
Mylome
intramdullaire
Mylome
intramdullaire
Mylome
Extramdullaire
Mylome
Extramdullaire
Del 13
P16 m
hyper
diplodie
IgH
20q11 (maf-B)
4p16 (FGF3)
autres
Trisomie
3,5,7,9,
11,15,19,21
N, K-RAS
FGFR3
P18
C-myc
p53
Del 13
P16 m
hyper
diplodie
Del 13
P16 m
hyper
diplodie
Del 13
P16 m
hyper
diplodie
IgH
20q11 (maf-B)
4p16 (FGF3)
autres
Trisomie
3,5,7,9,
11,15,19,21
IgH
20q11 (maf-B)
4p16 (FGF3)
autres
Trisomie
3,5,7,9,
11,15,19,21
N, K-RAS
FGFR3
N, K-RAS
FGFR3
P18
C-myc
p53
P18
C-myc
p53
Del 13
P16 m
hyper
diplodie
IgH
20q11 (maf-B)
4p16 (FGF3)
autres
Trisomie
3,5,7,9,
11,15,19,21
N, K-RAS
FGFR3
P18
C-myc
p53
Del 13
P16 m
hyper
diplodie
Del 13
P16 m
hyper
diplodie
Del 13
P16 m
hyper
diplodie
IgH
20q11 (maf-B)
4p16 (FGF3)
autres
Trisomie
3,5,7,9,
11,15,19,21
IgH
20q11 (maf-B)
4p16 (FGF3)
autres
Trisomie
3,5,7,9,
11,15,19,21
N, K-RAS
FGFR3
N, K-RAS
FGFR3
P18
C-myc
p53
P18
C-myc
p53
Diffrents types de MMO Diffrents types de MMO
Classique: Ig monoclonale scrte Classique: Ig monoclonale scrte Classique: Ig monoclonale scrte
IgG > IgA, (IgD, IgE)
Scrtion chane lgre monoclonale
Protinurie abondante
10 20%
Classique: Ig monoclonale scrte
IgG > IgA, (IgD, IgE)
Scrtion chane lgre monoclonale
Protinurie abondante
10 20%
Mylome non scrtant
+++ Ig anormale
Ig dgrade
Mylome non scrtant
+++ Ig anormale
Ig dgrade
MASTER 1 Biologie Sant Immunopathologie - Syndromes Lymphoprolifratifs
Anne Universitaire 2010 - 2011
Facult de Mdecine Montpellier-Nmes
C. RENE
(Mise ligne 18/04/11 LIPCOM)
Waldenstrm Waldenstrm
Prolifration monoclonale lymphoplasmocytaire
Aspect cytologique polymorphe
Pas de commutation isotypique: Ig M
Malades plutt gs et de sexe masculin
Anmies hmolytiques auto-immunes +++(activit Ac de
lIg:anti-plaquettes)
Absence datteinte osseuse et rnale
Prolifration monoclonale lymphoplasmocytaire
Aspect cytologique polymorphe
Pas de commutation isotypique: Ig M
Malades plutt gs et de sexe masculin
Anmies hmolytiques auto-immunes +++(activit Ac de
lIg:anti-plaquettes)
Absence datteinte osseuse et rnale Absence d atteinte osseuse et rnale
Frquente organomgalie
Syndrome dhyperviscosit +++
Absence d atteinte osseuse et rnale
Frquente organomgalie
Syndrome dhyperviscosit +++
Autres SLP (1) Autres SLP (1)
SLP auto-immun SLP auto-immun SLP auto immun
Apoptose lymphocytaire
+++ Mutation du gne codant Fas
Autoimmunit
Ac anti-hmaties, anti-PNN et anti-plaquettes
AHAI, neutropnie AI, PTAI
ADP, SMG
SLP auto immun
Apoptose lymphocytaire
+++ Mutation du gne codant Fas
Autoimmunit
Ac anti-hmaties, anti-PNN et anti-plaquettes
AHAI, neutropnie AI, PTAI
ADP, SMG ,
Lymphoprolifration
TCR/+, CD4-, CD8-
souvent bnigne
MAIS risque LHodgkinien ou LMNH
,
Lymphoprolifration
TCR/+, CD4-, CD8-
souvent bnigne
MAIS risque LHodgkinien ou LMNH
Maladie lymphoprolifrative lie lX Maladie lymphoprolifrative lie lX
Autres SLP (2) Autres SLP (2)
Maladie lymphoprolifrative lie l X
Rponse inapproprie EBV
MNI fulminante
Syndrome dactivation macrophagique =
Lymphohistiocytose hmophagocytique
hypogammaglobulinmie
lymphomes
Prvalence = 1/1 000 000
Maladie lymphoprolifrative lie l X
Rponse inapproprie EBV
MNI fulminante
Syndrome dactivation macrophagique =
Lymphohistiocytose hmophagocytique
hypogammaglobulinmie
lymphomes
Prvalence = 1/1 000 000
Mutation rcessive du gne codant SAP qui
rgule lactivation des T = 60% des cas
Peu de cellules NKT
Seul ttt curatif = allogreffe de CSH
Mutation rcessive du gne codant SAP qui
rgule lactivation des T = 60% des cas
Peu de cellules NKT
Seul ttt curatif = allogreffe de CSH
Autres SLP (3) Autres SLP (3)
Maladie lymphoprolifrative post-transplantation Maladie lymphoprolifrative post-transplantation y p p p p
Immunosuppression
Groupe htrogne
Prolifration B polyclonale bnigne
jusquaux Lymphomes malins
Prvalence = 26,2/100 000
selon type dorgane transplant et immunosuppression utilise
Pathogense lie EBV
y p p p p
Immunosuppression
Groupe htrogne
Prolifration B polyclonale bnigne
jusquaux Lymphomes malins
Prvalence = 26,2/100 000
selon type dorgane transplant et immunosuppression utilise
Pathogense lie EBV