Results

#1-Table: Bacterial Colony Growth Phenotypes This table expresses the colonies the group picked to experiment on since the bacterial colonies each had distinct phenotypes. MC 1 Large oval shaped colony Off-white MC 2 Circular shape colony Milky white middle and the rest is off-white and more translucent Jagged edges MC 3 Small round shaped colony White but slightly translucent

Smooth looking

Round smooth edges

The table describes the observations the group saw without the aid of a microscope on each of the bacterial colonies. These traits will make it easier to narrow down the identity of these bacterial colonies. From each sample, the group titled it MC and a number to keep track of the bacteria as we process further in the lab.

#2-Graph: Bacterial Growth Rate Comparison in Tubes The graph compares the bacterial growth when the group took the sample of each colony and let it grow overnight, after following the process.

Day 1 Day 2 Day 2 MC 1 Day 1 MC 2 MC 3

The graph illustrates the growth rate of the bacteria in the vial overnight in comparison with the other colonies. No specific measurements were taken, it was from observation the next day but MC 3 grew the most, while MC 1 grew less than either of the other bacteria. The little vials show the visible bacteria after a night of growth. *The growth has nothing in common with the size of the colony itself, but instead suggests at the rate the bacteria from each colony multiplies.*(analysis?)

#3-Table: Gram Staining Results The table shows the results from the gram-staining on each bacterial colony. MC 1 Gram-Positive MC 2 Gram-Positive MC 3 Gram-Negative

As the procedure describes, the group tests what gram-stain each sample is, since the gramstaining is a strategy to further narrow the identity of each colony sample. Both sample 1 and 2 resulted in gram-positive, while sample 3 resulted in gram-negative. With the colony phenotypes, the gram-staining makes it easier to find what bacteria is each sample.

#4-Graph: BLAST Chromatogram for MC 1 The graph portrays the DNA sequencing from the first bacterial colony sample.

GCTCTTATGAAGTTAGCGGCGGACGGGTGAGTAACACGTGGGTAACCTGCCCATAAGACTGGGATAACTCCGGGAAACCGGGGCTAATAC CGGATAACATTTTGAACCGCATGGTTCGAAATTGAAAGGCGGCTTCGGCTGTCACTTATGGATGGACCCGCGTCGCATTAGCTAGTTGGTG AGGTAACGGCTCACCAAGGCAACGATGCGTAGCCGACCTGAGAGGGTGATCGGCCACACTGGGACTGAGACACGGCCCAGACTCCTACG GGAGGCAGCAGTAGGGAATCTTCCGCAATGGACGAAAGTCTGACGGAGCAACGCCGCGTGAGTGATGAAGGCTTTCGGGTCGTAAAACT CTGTTGTTAGGGAAGAACAAGTGCTAGTTGAATAAGCTGGCACCTTGACGGTACCTAACCAGAAAGCCACGGCTAACT

This graph allows BLAST to take the DNA sequencing and compares it to numerous other bacteria they have, even though the sample given is not complete. The website quickly compares the data from this chromatograph and describes the highest matches with each sample.

#5-Graph: BLAST Chromatogram for MC 2 The graph portrays the DNA sequencing from the second bacterial colony sample.

TGCAGTCGAGCGGNNAGATGGGAGCTTGCTCCCTGATGTTAGCGGCGGACGGGTGAGTAACACGTGGGTAACCTGCCTGTAAGACTGGG ATAACTCCGGGAAACCGGGGCTAATACCGGATGCTTGTTTGAACCGCATGGTTCAAACATAAAAGGTGGCTTCGGCTACCACTTACAGATG GACCCGCGGCGCATTAGCTAGTTGGTGAGGTAACGGCTCACCAAGGCAACGATGCGTAGCCGACCTGAGAGGGTGATCGGCCACACTGG GACTGAGACACGGCCCAGACTCCTACGGGAGGCAGCAGTAGGGAATCTTCCGCAATGGACGAAAGTCTGACGGAGCAACGCCGCGTGAG TGATGAAGGTTTTCGGATCGTAAAGCTCTGTTGTTAGGGAAGAACAAGTACCGTTCGAATAGGGCGGTACCTTGACGGTACCTAACCAGAA AGCCACGGCTAACTA

This graph allows BLAST to take the DNA sequencing and compares it to numerous other bacteria they have, even though the sample given is not complete. The website quickly compares the data from this chromatograph and describes the highest matches with each sample.

#6-Graph: BLAST Chromatogram MC 3 The graph portrays the DNA sequencing from the third bacterial colony sample.

GCAGTCGAGCGANCTGATTAGAAGCTTGCTTCTATGACGTTAGCGGCGGACGGGTGAGTAACACGTGGGCAACCTGCCTGTAAGACTGG GATAACTTCGGGAAACCGAAGCTAATACCGGATAGGATCTTCTCCTTCATGGGAGATGATTGAAAGATGGTTTCGGCTATCACTTACAGATG GGCCCGCGGTGCATTAGCTAGTTGGTGAGGTAACGGCTCACCAAGGCAACGATGCATAGCCGACCTGAGAGGGTGATCGGCCACACTGG GACTGAGACACGGCCCAGACTCCTACGGGAGGCAGCAGTAGGGAATCTTCCGCAATGGACGAAAGTCTGACGGAGCAACGCCGCGTGAG TGATGAAGGCTTTCGGGTCGTAAAACTCTGTTGTTAGGGAAGAACAAGTACAAGAGTAACTGCTTGTACCTTGACGGTACCTAACCAGAAA GCCACGGCTAACTACG

This graph allows BLAST to take the DNA sequencing and compares it to numerous other bacteria they have, even though the sample given is not complete. The website quickly compares the data from this chromatograph and describes the highest matches with each sample.

#7-Table: Bacterias Number of Characters vs. Max Score Found This table compares the number of characters in the sequence, with the max score.
MC1 MC2 MC3 Characters=437 464 466 max score=789 830 838 Max indent=100% 99% 99%

The tables results show that each colony sample was able to sequence different amounts of characters, and as the characters increase in the samples, so does the max score. The max score shows how specific one can find bacteria with a certain DNA sequence. Above 700 is very specific, so all the colony samples were read with good accuracy.

#8-Graph: Bacterias Number of Characters vs. Max Score Found This represents the last table as a graph, so it is easier to compare.
900 800 700 600 500 400 300 200 100 0 MC 1 MC 2 MC 3 characters max score

The graph makes it easier to spot the trend between the higher number of characters to sequence would mean the higher the max score becomes. The downside to the graph is that it is impossible to see the specific numbers within the y-axis.

#9-Table: BLAST DNA Sequence Results for Bacteria The table depicts the most likely bacteria matches with each sample from the DNA sequencing.

MC 1 Bacillus Thuringiensis Bacillus Subtilis Bacillus Anthracis Bacillus Cereus

MC 2 Bacillus Subtilis Bacillus Tequilensis Bacillus Amyloiquefaciens -----------

MC 3 Bacillus Megnaterium Pasteurella Pneumotropica Bacillus Thuringiensis Bacillus aryabhattai

This table does not show all the possible results for each sample, because there were too many, and many of them were different strains. The group picked only the bacteria that match a hundred percent of the DNA sequencing found from each colony.

#10-Table: Gram-Positive vs. Gram-Negative This table organizes the BLAST results into gram-positive or gram-negative. Gram-Positive Bacillus Thuringiensis Bacillus Subtilis Bacillus Anthracis Bacillus Cereus Bacillus Amyloiquefaciens Bacillus Megnaterium Bacillus Aryabhattai Gram-Negative Pasteurella Pneumotropica -------------------------------------------------------------------------------------------------------------------------------

The table illustrates where the top matching results fit with matching the bacteria based on the gram-staining results from earlier. It shows that only one of the top BLAST results is gramnegative, while all the Bacillus are positive. This narrows down the identification of the bacteria even further when looking through both the DNA sequencing website and the gram-staining.

#11-Image: Bacillus Cereus in Petri Dish This image shows the true picture of Bacillus Cereus in a petri dish.

Bacillus Cereus is bacteria that match with the colony description, the gram staining, and the DNA sequencing match of sample 1. It was the only clear image found that matches all the criterias necessary to be considered an option for sample 1.

#12-Image: Bacillus Subtilis in Petri Dish This image shows a true picture of Bacillus Subtilis in a petri dish.

Bacillus Subtilis is bacteria that match with the colony description, the gram staining, and the DNA sequencing match of sample 2. It was the only clear image found that matches all the criterias necessary to be considered an option for sample 2.