Dna

DNA Analysis
Table of Contents
Genomic DNA Purification 2
Notebook
PCR Clean-Up
Overview Wizard SV Gel and PCR Clean-Up System Wizard SV 96 PCR Clean-Up System Wizard MagneSil PCR Clean-Up System Wizard PCR Preps DNA Purification System Ordering Information
28
Overview Wizard Genomic DNA Purification Kit Wizard SV and SV 96 Genomic DNA Purification Systems MagneSil Blood Genomic, Max Yield System MagneSil ONE, Fixed Yield Blood Genomic System MagneSil Genomic, Fixed Tissue System MagneSil KF, Genomic System Wizard Magnetic 96 DNA Plant System Ordering Information
Cloning PCR DNA

Overview Basic Subcloning Direct Mammalian Expression Direct Bacterial Expression PCR Cloning Techniques Ordering Information
34
Amplifying DNA
Overview Optimization of PCR Routine PCR Proofreading Polymerases Hot Start Methodology dNTPs Ordering Information
13
DNA Analysis Tools

Benchtop DNA Markers Ladders and Digest Markers
43
www.promega.com techserv@promega.com
Genomic DNA Purification

Promega has a variety of solutions for your genomic DNA (gDNA) purification needs. Promega has automated methods for blood, cultured cells, mammalian tissue and plant purifications. All systems produce high-quality DNA ready for amplification. Most automated systems use magnetic particle-based technologies. The Wizard SV technologies introduce membrane-based purification for manual or automated purifications. The Wizard Genomic DNA Purification Kit is a truly versatile solution-based system to manually isolate high molecular weight gDNA from a variety of starting materials. This gentle solution-based method produces gDNA suitable for amplification, Southern blotting and genomic cloning. Please note, in the flow charts that follow, Promega systems are listed by which protocols come in the Technical Literature sent with the system. Other applications to other gDNA sources may exist (e.g., Blood protocols for the Wizard SV Genomic System). Please contact Promega Technical Services if you have questions.
Look for these symbols to find the system right for your application.
Blood Cultured Cells Animal Tissue Plant Tissue Bacteria Yeast Fixed Tissue
NEW
Blood
techserv@promega.com
Buffy coat or white blood c ells? Use cu lt cells p ured rotocol s.

0.210ml
0.050.2ml
Requires automation, magnetics-based system. Specifically designed to capture just ~1g gDNA from 5060l of blood. Eliminates need to quantitate after purification.
Automated
Manual
Requires automat magneti cs-based ion, system. Will cap ture >1 _ 1g of gDNA f rom a 2 00l blood sa mple.
Designed for automation on the KingFisher mL. Handles up to 200l of blood. Will purify 4-6g of gDNA from 115 samples in 25 minutes.
lly ased, tota Solution-b em. Uses yst scalable s Can handle tion. centrifuga blood. Specific of any volume provided for protocols ml of ml and 10 300l, 3 ole blood. fresh wh
Promega DNA Analysis Notebook
3981MA02_3A
MagneSil ONE, Fixed Yield Blood Genomic System
MagneSil Blood Genomic, Max Yield System
MagneSil KF, Genomic System
Wizard Genomic DNA Purification Kit

Cultured Cells
Automated Manual
Wizard SV 96 Genomic DNA Purification System
Wizard SV Genomic DNA Purification System
y otall d, t e -bas Uses ution ol em. S syst uces Prod lable sca tion. t ifuga eigh r w entr c cula ble suita mole high DNA b) g k ion, (>50 licat p y ap and r an fo CR P ing ing . clud in blott hern Sout
Perform 96 gDNA preps at once. Requires a vacuum manifold. Can be used on benchtop or automated. Comprised of SV membranes arrayed in a 96-well format. Can handle up to 5 x 106 cells/well.
h a Use wit uge or ntrif microce nifold. Purify ma vacuum ady gDNA in PCR-re s after lysis. te 20 minu rocess up to p Can 6 cells/prep. 5 x 10
Yeast
3982MA02_3A
Bacteria
Manual
Manual
Human Mouse Rat Arabidopsis Tobacco Corn Wheat Yeast (S. cerevisiae) Bacteria (E. coli)
Genome Size 2.9Gb 2.7Gb 2.8Gb 3.0Gb 4.4Gb 2.5Gb 16.0Gb 13.5Mb 4.7Mb
Molecules/g 3.13 105 3.35 105 3.26 105 3.04 105 2.07 105 3.65 105 5.70 104 6.75 107 1.94 108
You supply lyticase and 50mM EDTA
Grampositive
Gramnegative
You supply lysozyme and/or lysostaphin
3985MA02_3A
Gb = Gigabases (1 109). Mb = Megabases (1 106).

Plant Tissue
, totally n-based Solutio h for fres system scalable ue. Uses leaf tiss plant es . Produc ifugation centr t r weigh molecula high itable DNA su 0kb) g (>5 n, applicatio for any d PCR an including g. n blottin Souther
Automated
Manual
Requires a 96-well grinding apparatus
Requires liquid nitrogen, mortar & pestle
Wizard Magnetic 96 DNA Plant System
Magnetic -based sy stem that be used in can manual or automated format. Pu rifies gDN A from seeds, lea f or tissu es for PC or other R amplificatio n based genotyping methods.
3984MA02_3A
Dont see your DNA sample type in these flowcharts? Contact Promega Technical Services for advice at: techserv@promega.com

Animal Tissue
Automated Manual
Perform s 96 g DNA preps a t once . Uses vacuum a manifol d. Can be use bencht d on the op or Compri automated. s membr ed of SV anes ar rayed a 96-w ell form in Proces at. ses up to 20m g tissue/w ell.
Overnight proteinase K digestion

(you supply the enzyme)
Overnight proteinase K digestion

(you supply the enzyme)
Wizard SV 96 Genomic DNA Purification System
Wizard SV Genomic DNA Purification System
Use with a microcentrifuge or vacuum manifold with vacuum adapters. Get PCR-ready gDNA in 20 minutes after lysis. Can process up to 20mg tissue/prep.
calable totally s based, on. Solution- es centrifugati Us eight system. cular w igh mole or any duces h Pro uitable f gDNA s R and 50kb) (> ding PC on, inclu ting . applicati ern blot South
ne No Xyle for required ation! araffiniz dep
Fixed Tissue
Manual
Overnight proteinase K
MagneSil Genomic, Fixed Tissue System
ks wor m syste tions. ased ec cs-b thin s qualified ti ne m Mag th 10 fication- ers as lim pli wi s am ing amp rks in ie Wo ns. Purif allow kb. A o gDN e as 1.8 plificati larg iplex am mult
3983MA02_3B
3983MA02_3A

Wizard Genomic DNA Purification Kit Cat.#: A1120 (100 isolations, 300l blood) A1125 (500 isolations, 300l blood) A1620 (100 isolations, 10ml blood) Protocol: www.promega.com/tbs/tm050/tm050.html Customizable Protocol: www.promega.com/tbscustom/tm050c/promega.asp Citations detailing use of this kit: www.promega.com/citations/ Need a versatile genomic DNA purification system? Get it all with the Wizard Genomic DNA Purification Kit. This solution-based system uses a simple, gentle salting out method to isolate genomic DNA from a wide variety of starting materials. The standard protocol allows isolation of gDNA from blood or cultured cells. Simple modifications to the protocol (involving the addition of reagents common to most molecular biology laboratories) allow you to isolate gDNA from bacteria, yeast, plant or animal tissues, including mouse tails. The system isolates high molecular weight DNA (>50kb) with an A260/A280 greater than 1.7. Protocols provided for: Whole Blood (300l, 3ml, 10ml, and 50l 96-wells) Cultured Cells Animal Tissue Plant Tissue Gram-Negative Bacteria Gram-Positive Bacteria Yeast
ut t 2c A DN ell ut DN A
DNA Yields from Various Starting Materials. Amount of Source Starting Material Whole Blood 300l 3ml 10ml 96-well plate, 50l/well Tissue Culture Cells 106107 cells Animal Tissue Mouse Liver 11mg Mouse Tail 0.51cm of tail Insect Cells 5 106 cells Plant Leaf Tissue 40mg Bacterial Culture* 1081010 cells Yeast* 1.9 108 cells
*Overnight culture.
Typical DNA Yield 515g 2550g 250500g 0.20.7g 530g 1520g 1030g 16g 712g 520g 4.56.5g
La
a bd
,u NA t Ra
nc b
A, DN in ra
un
cu
nc ,u
PC
m La
a bd
The Wizard Genomic DNA Purification Kit has been cited for purification of gDNA from the following bacterial sources: Bordetella, Borrelia, Campylobacter, Desulfovibrio, Escherichia, Flavobacterium, Haemophilus, Helicobacter, Leptospira, Methanococcus, Mycobacterium, Mycoplasma, Paracoccus, Prevotella, Proteus, Rickettsia, Salmonella, Serratia, Sphingomonas, Staphylococcus, Streptococcus, Treponema and Vibrio. Citations describing isolation from these and other sources, including yeast, fungi and virus-infected cells, are available online at: www.promega.com/citations/
Genomic DNA isolated using the Wizard Genomic DNA Purification Kit. Genomic DNA was isolated from fresh rat brain or PC12 cells according to the protocol provided in the Wizard Genomic DNA Purification Kit Technical Manual #TM050. DNA from the indicated sources (0.5g/lane) was separated on a 0.7% agarose gel.
c enomi rd G n Kit Wiza The Purificatio for the DNA protocols , manual es ed provid solution-bas NA from D easy, ation of g sources. c purifi different many
1010MA04_5B

Wizard SV and SV 96 Genomic DNA Purification Systems
M C +C
Sp in Sp Tai in l L Sp ive in r Sp Hea in rt Va Bra cu in Va um c u Ta Va um il c u Li v Va um er c u He um a r t Br ai n
Genomic DNA Purification from Mouse Tail Clipping or Tissue Sample Mouse tail clipping or tissue sample Proteinase K (Cat.# V3021)* digestion in Digestion Solution. Incubate at 55C overnight (1618 hours). Add Wizard SV Lysis Buffer. Add Wizard SV Lysis Buffer. Genomic DNA Purification from Tissue Culture Cells Wash tissue culture cells with 1X PBS. Transfer lystate to minicolumn. Centrifuge. Bind DNA. Wash, removing solution by centrifugation or vacuum. Transfer spin column to a 1.5ml microcentrifuge tube (not provided). Centrifuge. Elute genomic DNA.
3643MA02_2A
The Wizard SV and SV 96 Genomic DNA Purification Systems provide a fast, simple technique for the preparation of genomic DNA from cultured cells and tissue, including mouse tails. The SV system is designed for single-prep manual applications using either a microcentrifuge or vacuum manifold. Genomic DNA is obtained in 20 minutes after cell or tissue lysis. The SV 96 system was developed to meet highthroughput needs. You can use this system on the benchtop for manual 96-well purifications or automate on a liquid-handling platform like the Beckman Coulter Biomek FX or Biomek 2000 with a suitable vacuum manifold. Both systems provide similar yields of high quality, PCR-ready genomic DNA. Isolation of DNA from tissue requires the additional purchase of DNase-free Proteinase K (e.g., Promega Cat.# V3021). Wizard SV Genomic DNA Purification System Cat.#: A2360 (50 preps) A2361 (250 preps) Protocol: www.promega.com/tbs/tb302/tb302.html Want to use the SV Genomic Systems for manual gDNA purification from blood? Request Genomic DNA Purification from Blood: Wizard SV Genomic DNA Purification Systems. Application Note #AN101:
Amplification of genomic DNA isolated from various mouse tissue sources using the Wizard SV Genomic DNA Purification System. Genomic DNA was isolated from the tissues listed using either the vacuum or spin protocols provided in the Wizard SV Genomic DNA Purification System Technical Bulletin #TB302. One microliter of the eluate from the column was amplified for a mouse IL-1 (1.2kb) product. The positive control (+C) was Mouse Genomic DNA (Cat.# G3091) and the negative control (C) contained no DNA. Further details are provided in Grunst, T. and Worzella, T. (2002) Introducing the Wizard SV and SV 96 Genomic DNA Purification Systems. Promega Notes 81, 913.
Vacuum Adapter (Cat.# A1331)*
Vac-Man Laboratory Vacuum Manifold (Cat.# A7231)*
Overview of the Wizard SV Genomic DNA Purification System spin and vacuum protocols. *Vacuum Adaptor, Vacuum Manifold and Proteinase K must be purchased separately.
3710TA04_2A

Average Yield of Genomic DNA Purified from Various Sources Using the Wizard SV and SV 96 Genomic DNA Purification Systems. Sample Type Mouse Tail Clipping Mouse Liver Mouse Heart Mouse Brain CHO Cells NIH3T3 Cells 293 Cells Starting Amount 20mg 20mg 20mg 20mg 1 106 cells 1 106 cells 1 106 cells Average Yield 20g 15g 10g 6g 5g 9g 8g
Work wit h the ter minal 2cm mouse tail of s. Any hig her up on and you'll the tail get more connectiv cartilage e tissue, and bone than nucle This mate ated cells rial not on . ly clogs c but fewer olumns, cells mea ns less gD NA.
35
Average Yield (g)
30 25 20 15 10 5 0 SV 96 SV Vacuum SV Spin
A B C D E F G H
10 11 12
Mouse Tail Clippings Water Only

M C +C C4 C5 C6 C7 C8 D4 D5 D6 D7 D8 M E4 E5 E6 E7 E8
Method of Purification
Comparison of DNA yields using the Wizard SV and SV 96 Genomic DNA Purification Systems. Average yield of genomic DNA (g) purified from 20mg mouse tail clippings (1.2cm tail tip portions). Average A260/A280 ratios are: SV 96, 1.7 0.08; SV Vacuum, 1.7 0.14; and SV Spin, 1.7 0.14.
Wizard SV 96 Genomic DNA Purification System Cat.#: A2370 (1 96 preps) A2371 (4 96 preps) Protocol: www.promega.com/tbs/tb303/tb303.html The Wizard SV 96 Genomic System is suitable for manual DNA purification at the benchtop or can be easily automated on liquid handlers such as the Biomek FX, Biomek 2000, or MultiPROBE II HT/EX. For more information visit: www.promega.com/automethods/
Cross-contamination assay. Genomic DNA was purified from mouse tail clippings or water samples arrayed in adjacent wells of a 96-well plate using the Wizard SV 96 Genomic DNA Purification System. PCR products were amplified from 1l of purified sample from each well for mouse IL-1 (1.2kb). No product is expected from wells containing water. For further details, see Grunst, T. and Worzella, T. (2002) Introducing the Wizard SV and SV 96 Genomic DNA Purification Systems. Promega Notes 81, 913.
into turns Robot nomic a ge ication purif DNA hine! mac
3446CA06_1A
3712TA04_2A

MagneSil Blood Genomic, Max Yield & MagneSil ONE, Fixed Yield Blood Genomic
Promega has developed two genomic DNA isolation systems to streamline your blood-to-analysis pathway MagneSil Blood Genomic, Max Yield(a) and MagneSil ONE, Fixed Yield Blood Genomic(a). Both systems are designed for automated gDNA purification on liquidhandling workstations such as the Beckman Courlter Biomek FX. The Max Yield System purifies 4g of gDNA from 200l of whole blood. The MagneSil ONE System purifies 1g gDNA (50%) from 60l whole blood. Both systems produce gDNA that is ready for use in monoplex or multiplex PCR amplification reactions.
Fixed Yie ld quantitatio means no more n or norm alization! Optimize the volum e eluted D NA y ou n of e ed o n ce u s e t ha t s am e am o u n t e a ch time.
Analysis of DNA isolated using the MagneSil Blood Genomic, Max Yield System. DNA isolated from whole blood using the MagneSil Blood Genomic, Max Yield System was used with the PowerPlex 16 System (Cat.# DC6531), a multiplex STR amplification system for use in DNA typing. Results show successful coamplification and 3-color detection of the 16 loci (15 STR loci plus amelogenin) in the PowerPlex 16 System(b,c,d). Amplification products were separated on an ABI PRISM 310 Genetic Analyzer, and analyzed using GeneScan Software.
MagneSil Blood Genomic, Max Yield System Cat.#: MD1360 (1 96 preps) Protocol: www.promega.com/tbs/tb312/tb312.html For more information on automated methods visit: www.promega.com/automethods/
MagneSil ONE, Fixed Yield Blood Genomic System Cat.#: MD1370 (1 96 preps) Protocol: www.promega.com/tbs/tb313/tb313.html For more information on automated methods visit: www.promega.com/automethods/
rage of term sto Longe gDNA A? Elut gDN ion like fer solut in a buf r DNA buffer o TE n n Solutio hydratio Re . A7963) (Cat.# n torage i -term s Long lead to ater can w radation tic deg autoly DNA. f the g o
Purify u p to _ 4 > g gDNA f rom 20 0l whole b lood.
gDNA ify ~1g Pur 60l rom 50 f lood. whole b
DNA Yields (ng) From 60l Whole Blood Samples Using the MagneSil ONE, Fixed Yield Blood Genomic System. Sample 1 Sample 2 Sample 3 Sample 4 Sample 5 Sample 6 Mean SD Donor 1 Donor 2 Donor 3 Donor 4 Donor 5 1078 1078 1231 1451 1025 990 1092 1256 1078 998 970 1047 1315 990 994 1209 1294 1047 970 967 1105 1063 1388 1209 843 839 843 1296 1105 797 1032 1070 1256 1134 937 128 143 116 178 94
4031CA03_3A

MagneSil Genomic, Fixed Tissue System
Do you have archived samples of formalin-fixed, paraffin-embedded tissues that youd like to genotype? We have developed a system that extracts amplifiable gDNA from 10m sections without xylene extraction. The new MagneSil Genomic, Fixed Tissue System uses proteinase K digestion followed by a rapid one hour processing step to prepare samples for amplification. The purification process removes amplification inhibitors such as small DNAs, and isolates gDNA fragments large enough to allow amplification targets up to 1.8kb. The highly pure gDNA can be used in monoplex or multiplex amplification reactions. MagneSil Genomic, Fixed Tissue System Cat.#: MD1490 (100 samples) Protocol: www.promega.com/tbs/tb319/tb319.html
Use your Thermo Electron KingFisher mL to the fullest with the MagneSil KF, Genomic System. With this system, we provide optimized lysis and wash buffers to allow purification of high quality genomic DNA in the fixed number of steps required on the KingFisher instrument. The MagneSil KF, Genomic System purifies 26g DNA from 200l blood. The isolated DNA is ready for monoplex and multiplex analysis, STR analysis and SNP genotyping.
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17
NEW
Yield gel of gDNA isolated from 200l of liquid blood. A single run of 15 samples prified on the KingFisher mL using the MagneSil KF, Genomic System. The microliters of each eluate were loaded on the gel and visualized by ethidium bromide staining. Lanes 6 and 12 intentionally left blank.

A.
Cat.#: MD1460 (200 preps) Protocol: www.promega.com/tbs/tb322/tb322.html
NEW
B.
926 base Size Marker
972 base Amelogenin Fragment
Thermo Electron KingFisher mL tube strips

200l sample 200l MagneSil, KF PMPs
3931TC12_2A
C.
Size Markers
1,000l Salt Wash, Blood
1,000l Alcohol Wash, Blood
1,000l Alcohol Wash, Blood
200l NucleaseFree Water
APC 1.8Kb Fragment
800l Lysis Buffer, KF
lity -qua lex ultip om M A fr gDN issue t fixed
as large as 1.8Kb!
Amplify targets
25 m inutes from start to fin ish fo r 115 sample s
10
4106MA04_3A
4212TA06_3A

Wizard Magnetic 96 DNA Plant System
bp 1,500 M 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15
The Wizard Magnetic 96 DNA Plant System(a) is designed for manual or automated 96-well purification of genomic DNA from plant leaf and seed tissue. The system was initially validated with corn and tomato leaf as well as with canola and sunflower seeds. The DNA purified from these samples can be used in PCR as well as more demanding applications such as Rapid Amplification of Polymorphic DNA (RAPD) analysis. The Wizard Magnetic 96 DNA Plant System uses MagneSil Paramagnetic Particles(a) (PMPs), considered a mobile solid phase. The binding of nucleic acids to magnetic particles occurs in solution, resulting in increased binding kinetics and binding efficiency. Contact with the wash buffer is also enhanced, facilitating removal of contaminants and increasing nucleic acid purity. Automated methods for the Beckman Coulter Biomek 2000, Biomek FX and other robots are available.
Plant Sample Types Processed Using the Wizard Magnetic 96 DNA Plant System. Arapidopsis Cotton seed Soybean Cabbage seed Grass seed Squash Canola leaf Green pepper seed Squash seed Canola seed Lettuce Strawberry leaf* Carrot seed Milkweed leaf Sunflower seed Chicory leaf Potato tuber Tobacco seedling Chives Radish leaf Tomato leaf Corn leaf Rice leaf Tomato seed Cotton leaf* Sorghum Watermelon seed
*These samples require addition of polyvinylpolypyrrolidone (PVPP) to the lysis buffer to remove phenolic compounds that inhibit PCR.
500
100 1 2 3 4 5 6 7 8 Tobacco seedling Soybean Lettuce leaf Corn leaf Potato Arabidopsis leaf Cabbage seed Green pepper seed 9 10 11 12 13 14 15 Prairie grass, seed head Chives Tomato leaf Rice Canola seed Sunflower seed Carrot seed
The Wizard Magnetic 96 DNA Plant System produces PCR-quality DNA from a variety of plant species. One microliter of gDNA purified from the indicated materials was used as template in PCR using a universal primer pair specific for the intron of the TrnL chloroplast gene. One or more bands are produced depending on the plant species. For more information, please see Koller, S. et al. (2001) Automated genomic DNA purification using the Wizard Magnetic 96 DNA Plant System. Promega Notes 79, 2528.
Wizard Magnetic 96 DNA Plant System Cat.#: FF3760 (2 96 preps) FF3761 (4 96 preps) Protocol: www.promega.com/tbs/tb289/tb289.html For more information on automated methods visit: www.promega.com/automethods/ Want to use the Wizard Magnetic 96 DNA Plant System for high yield or fixed yield gDNA purification from plant tissue? Request Application Note #AN105
Typical DNA Yield from Plant Species Using the Wizard Magnetic 96 DNA Plant System. Arabidopsis tissue 10ng/mg Canola leaf punches* (12) 26ng/leaf punch Canola seeds (5) 343ng/seed Corn leaf punches* (12) 98ng/leaf punch Cotton seed (1) 29ng/seed Lettuce leaf punches* (8) 13ng/leaf punch Melon seed (1) 166ng/seed Radish leaf punches* (12) 89ng/leaf punch Soybean (10mg) 10ng/mg bean Squash seed (1) 279ng/seed Sunflower seed (1) 405ng/seed Tomato leaf punches* (12) 111ng/leaf punch
*Leaf punches 6mm in diameter.
3315TB03_1A
11

Genomic DNA Purification Systems and Accessories
Product
Wizard Genomic DNA Purification Kit 100 isolations (300l blood per isolation) 500 isolations (300l blood per isolation) 100 isolations (10ml blood per isolation)
Size
Cat.#
A1120 A1125 A1620
For Laboratory Use. Cat.# A1120 will give ~40 animal tissue preps, ~80 mouse tail preps, ~80 plant tissue preps, and ~80 cultured cell preps. Please see the Wizard Genomic DNA Purification Kit Technical Manual #TM050 for more details and additional supplies necessary for the various preps.
Product
Wizard SV Genomic DNA Purification System Vac-Man Laboratory Vacuum Manifold, 20-sample capacity Vacuum Adapters
50 preps (20mg tissue per prep) 250 preps (20mg tissue per prep) 1 each 20 each
Size
Cat.#
A2360 A2361 A7231 A1331
The Wizard SV Genomic DNA Purification System can be used in spin or vacuum format. The Vac-Man Laboratory Vacuum Manifold can be used to process up to 20 samples at once. The Vacuum Adapters are required when using the the Vac-Man Laboratory Vacuum Manifold with the Wizard SV Genomic DNA Purification System.
Product
Wizard SV 96 Genomic DNA Purification System Vac-Man 96 Vacuum Manifold
1 96 preps (20mg tissue per prep) 4 96 preps (20mg tissue per prep) 1 each
Size
Cat.#
A2370 A2371 A2291
The Vac-Man 96 Vacuum Manifold is required for use with the Wizard SV 96 Genomic DNA Purification System.
Product
MagneSil ONE, Fixed Yield Blood Genomic System(a)* MagneSil Blood Genomic, Max Yield System(a)* Deep Well MagnaBot 96 Magnetic Separation Device* MagnaBot Spacer, 1/8 inch
1 96 preps (5060l blood per prep) 1 96 preps (200l blood per prep) 1 each 1 each
Size
MD1370 MD1360 V3031 V8581
Cat.#
* For Laboratory Use. Both MagneSil Blood Genomic Systems require use of an automated liquid handler such as the Beckman Coulter Biomek FX. The Deep Well MagnaBot 96 Magnetic Separation Device and the MagnaBot Spacer, 1/8 inch, are also required for use with these systems.
Product
MagneSil Genomic, Fixed Tissue System MagneSphere Technology Magnetic Separation Stands
One time purchase of a magnetic stand required to use product.
100 samples 1.5ml (2 position) 1.5ml (12 position)
Size
MD1490 Z5332 Z5342
Cat.#
Product Product

Designed for use with the Thermo Electron KingFisher mL Instrument.
200 preps
Size Size
MD1460
Cat.# Cat.#
Wizard Magnetic 96 DNA Plant System(a) MagnaBot 96 Magnetic Separation Device MagnaBot Spacer
2 96 preps 4 96 preps 1 each 1 each
FF3760 FF3761 V8151 V8381
The Wizard Magnetic DNA Plant System requires use of the MagnaBot 96 Magnetic Separation Device and the MagnaBot Spacer for manual or automated DNA purification.
Related Products
Product
Proteinase K RNase A Solution, 4mg/ml
For Laboratory Use. Proteinase K is required for tissue preparations. RNase A is certified DNase-free and is used to remove RNA from gDNA preps.
100mg 1ml
Size
Cat.#
V3021 A7973
12
Amplifying DNA
Promega offers serveral options for routine, difficult and high-fidelity PCR.
Taq DNA Polymerase PCR Core Systems Standard Taq DNA Polymerase
Pfu DNA Polymerase Tli DNA Polymerase
Everyt hin includin g for PCR g Available dNT Ps. with c ontrols. Great for be ginners !
Routine Amplification
High-fidelity Amplifications
Difficult Amplification
Higher Performance Taq DNA Polymerase

4375MA11_3A
GoTaq DNA Polymerase
PCR Master Mix
Greater performan ce than stand ard Taq Polym erase with conv enience o f direct ge l loading .
r Greate ance perform ndard than sta erase aq Polym T nience s conve plu r mix. a maste of be Can also 4C. red at sto
13
Amplifying DNA
Overview
Typical Reaction with Taq DNA Polymerase. Nuclease-Free Water Reaction Buffer(10X or 5X) dNTPs Taq DNA Polymerase MgCl2* Downstream primer Upstream primer Template to 50l final 1X 0.2mM each 1.25u 0.54.0mM 1M (50pmol) 1M (50pmol) 104 copies
Denature Anneal Extend PCR amplification led to a revolution in molecular biology in the 1980s. PCR is a relatively simple technique by which a DNA or cDNA template is amplified many thousand- or millionfold quickly and reliably, generating sufficient material for subsequent analyses. The PCR process is exquisitely sensitive. While most biochemical analysesincluding nucleic acid detection with radioisotopesrequire the input of significant amounts of biological material, the PCR process requires very little starting material. This feature makes the technique extremely useful, not only in basic research, but also for applications such as genetic identity testing, forensic analysis, industrial quality control and in vitro diagnostics. The availability of such a powerful tool has led to significant developments in answering biological questions. Many adaptations of the original PCR method have been published, and numerous factors that are critical for accurate amplification have been identified. How Much Enzyme is Needed in a Reaction? Promega recommends using 1.25 units of thermostable DNA polymerase per 50l amplification reaction. For most applications, the enzyme will be in excess. The inclusion of more enzyme will not significantly increase yield. Increased amounts of enzyme and excessively long extension times will increase the likelihood of artifacts due to the intrinsic 53 exonuclease activity of Taq DNA Polymerase(e) and other non-proofreading DNA polymerases. Artifacts are generally seen as smeared bands in ethidium bromide-stained agarose gels. The most frequent cause of excessive enzyme levels is pipetting error. Accurate dispensing of submicroliter (<1l) volumes of enzyme solutions in 50% glycerol is nearly impossible. We strongly recommend making reaction master mixes sufficient for the number of reactions being performed. A master mix increases the volume of pipetted reagents and reduces pipetting errors.
*Some reaction buffers contain Mg2+, and additional MgCl2 may not be required. The optimal Mg2+ concentration depends on the template but is typically in the range 0.54mM. Assemble reactions on ice in the order listed. Be sure to vortex the MgCl2 solution, primers, dNTPs and Reaction Buffer prior to addition. When using a thermal cycler without a heated lid, overlay the reaction with 12 drops of mineral oil to prevent evaporation.
Proofreading enzymes like to digest free primers due to their 3'5' exonuclease activity. Always assemble the reaction on ice and add the proofreading polymerase last, just prior to placing the tubes in a preheated 9495C thermal cycler. See p. 23 for more information.
Setting up reactions with a proofreading polymerase?
14
For more information on reaction optimization, see pp. 1619.
ntaining gCl 2-co se! ll M ior to u Vortex a ughly pr thoro a solutions n form tions ca solu nt upon MgCl 2 n gradie x is a ratio concent to vorte Failure . failure! thawing of PCR source common
Amplifying DNA
Example Cycling Conditions for Taq DNA Polymerase. Step Initial Denaturation(a) Denaturation Annealing Extension Final Extension Soak
(a)
Temperature 95C 95C 4265C(b) 72C 72C 4C
Time (minutes) 2 0.51 0.51 1 min/kb(b,c) 5 indefinite
Want to explore the enzymology of Thermostable DNA Polymerases more thoroughly?

1
Cycles
Go to our online Polymerase Guide at: www.promega.com/guides/
2535 1 1
Reactions are placed in a thermal cycler that has been preheated to 95C. The thermal cycling protocol has an initial denaturation step where samples are heated at 95C for 2 minutes to ensure that the target DNA is completely denatured. Initial denaturation of longer than 2 minutes at 95C is usually unnecessary and may reduce yield. (Some hot start polymerases require pre-incubation at 95C to activate the polymerase prior to the 2-minute denaturation step.) (b) Annealing temperature should be optimized for each primer set based on the primer melting temperature (Tm). See section on primer design (p. 16). (c) The extension time should be at least 1 minute/kilobase of target. Typically, anything smaller than 1kb uses a 1-minute extension, 2 minutes for >1kb, 3 minutes for >2kb, 4 minutes for >3kb, etc.
eading a Proofr Using se? Polymera merases ding poly er Proofrea tle slow lit work a roofreading -p than non s. Be sure to se polymera he extension t increase least 2 at time to r kilobase. pe minutes eed u may n Also, yo s. re cycle 2-3 mo
Comparison of Properties for Some Commonly-Used Thermostable DNA Polymerases. Thermostable DNA Polymerase Taq/ AmpliTaq Gold Vent Characteristic AmpliTaq Platinum Taq Tfl Tth (Tli) >95% Resulting DNA ends 3 A 3 A 3 A 3 A Blunt 53 exonuclease activity Yes Yes Yes Yes No 35 exonuclease activity No No No No Yes
Deep Vent >95% Blunt No Yes
4431CA
Pfu Blunt No Yes
15
Amplifying DNA
Optimization of PCR
Magnesium Concentration
Magnesium concentration is an important factor to optimize when performing PCR. The optimal Mg2+ concentration varies depending on the primers, template, DNA polymerase, dNTP concentration and other factors. Taq DNA polymerase is the most common polymerase used for PCR. Taq has an optimal Mg2+ range of 14mM MgCl2. Other polymerases may have different optimal ranges. For example, Tth DNA polymerase has a narrower optimal range (1.52.5mM MgCl2), Tli DNA Polymerase displays optimal activity at 26mM MgCl2, and Pfu DNA Polymerase has an optimal range of 26mM MgSO4. Tfl DNA Polymerase has an optimal range of 14mM Mg2+ but performs better with MgSO4 than with MgCl2. When using a pair of PCR primers for the first time, it is advisable to perform a magnesium titration in 0.5 or 1.0mM increments to determine the optimal Mg2+ concentration. Some primers will amplify equally well at a number of Mg2+ concentrations, while others may have very specific Mg2+ concentration requirements. With too little Mg2+, the polymerase will have poor activity. With too much Mg2+, nonspecific amplification can become a problem. Nonspecific PCR products can appear as a smear on a gel or as distinct bands of inappropriate size. Too much Mg2+ can also reduce the fidelity of the DNA polymerase and lead to a higher error rate. Taq DNA polymerase is commonly supplied with buffers containing a fixed concentration of Mg2+ (giving a final concentration of 1.5mM in the final reaction). Most Taq DNA polymerase amplifications work well at this Mg2+ concentration, and the reaction can still be optimized by adding more Mg2+. Pfu DNA polymerase does not have as great a dependence upon Mg2+ and is most often supplied with a buffer containing a final concentration of 2mM Mg2+. However, this does not mean that optimization is unnecessary, and the final concentration of Mg2+ can be adjusted up to 6mM as needed.
Vortex all MgCl2-containing solutions thoroughly prior to use! MgCl2 solutions can form a concentration gradient upon thawing. Failure to vortex is a common source of PCR failure!
Primer Design
PCR primers generally range from 1530 bases long and are designed to flank the DNA region of interest. Primers should have 4060% GC content, and care should be taken to avoid sequences that might produce intermolecular or intramolecular secondary structure. To avoid the production of primer-dimers, the 3-ends of the primers should not be complementary. Primerdimers unnecessarily sequester primers away from the reaction and result in an unwanted polymerase reaction that competes with the desired PCR product. Avoid three G or C nucleotides in a row near the 3-end of the primer, as this may result in nonspecific primer annealing, increasing the synthesis of undesirable products. Ideally, both primers should have nearly identical melting temperatures (Tm), allowing both primers to anneal roughly at the same temperature. The annealing temperature of the reaction is dependent upon the primer with the lowest melting temperature. For assistance with calculating the Tm of any primer, a Tm calculator is provided on the Promega web site at: www.promega.com/biomath
mega /biomath o to Pro G ega.com om ul t s www.pr r n s re s
r Tm? late you calcu page at: Need to ioMath 's B
16
retu p ro g ram e diff e re n t The re f ro m t h m et h od s fo r Tm ct d se le p u b l is h e Yo u ca n al s o i n e io n . ex am cal cula t a p rim e r s to n e t h e Pro m eg a n d d ete r m i r s i n e t h e ir Tmy o u r ow n p rim f e r s . T m o f t re a ctio n buf n diff e re
Amplifying DNA
Optimization of PCR
Annealing Temperature
Annealing temperature is another factor that may need to be optimized in PCR. The melting temperature (Tm) of the PCR primers should be in the range 4265C, unless the primers fall into a special class, such as degenerate primers, which have lower Tm. Typically the optimal annealing temperature is 5C of the primer with the lowest Tm. Ideally the Tm of both primers will be similar so that the optimal annealing temperatures are close. If the melting temperatures are more than a few degrees apart, one primer may need to be redesigned so that the Tm is closer to that of the other primer. A good starting point is to set the annealing temperature equal to the Tm of the primers. If nonspecific amplification occurs, this is a good indication that the annealing temperature needs to be raised a few degrees. If the PCR reaction yields no product, this may indicate that the annealing temperature is too high and should be reduced by several degrees.
(continued)
annealing eaction should be R ture tempera f the T m of 5C o primer that R the PC lowest T m. has the
Template Quality
The purity and integrity of the DNA template can also be critical. Obviously there are numerous inhibitors that can interfere with amplification. These may be copurified from the original source of the nucleic acid (e.g., the tissue from which the DNA was isolated). Contaminants can also be introduced during the purification process. Examples of common contaminants that can inhibit PCR are phenol, ethanol, as little as 0.01% SDS or other detergents, heparin and salts. These contaminants can usually be removed by a simple phenol:chloroform extraction followed by ethanol precipitation, or by use of a PCR clean-up system (see Chapter 3). Some sample types, such as blood, soil, fungus, plants with high phenolic content, and fecal samples, are problematic because they contain strong PCR inhibitors that can be copurified with the DNA. An easy way to identify inhibitors in your template nucleic acid is to add an aliquot of template to the positive control reaction. If this spiked control reaction fails, the template needs to be further purified before amplification. Test template quality by adding a control template that you know amplifies easily and reliably. Combine your problematic template with 1001,000 copies of the control template, and amplify the control template. Perform the same amplification with the control template alone. If amplification of the control template fails only when the problematic template is present, inhibitors in the problematic template may be to blame.
Template Quantity
The amount of template required for successful amplification is dependent upon the complexity of the DNA sample. For example, in a 4kb plasmid containing a 1kb insert, 25% of the input DNA is the target of interest. Conversely, a 1kb gene in the human genome (3.3 109bp) represents approximately 0.00003% of the input DNA. Approximately 1,000,000-fold more human genomic DNA is required to maintain the same number of target copies per reaction. Two common mistakes are the use of too much plasmid DNA or too little genomic DNA. If possible, start with up to 104 copies of the target sequence to obtain a signal in 2530 cycles, but do not exceed 10ng/l (i.e., 500ng/50l reaction).
How M any DNA Te Molecules in Yo ur mplate? 1g of 1kb dsD NA = 9.12 x 1 11 1g of 0 mole pGEM cules Vector 2.85 x 1 DNA = 10 1 mo 1g of lecules lambda D NA = 1.9 x 10 10 1g of molecule E. coli s genomic DNA = 2 x 10 8 1g of molecule human g s enomic DNA = 3.04 x 10 www.promega.com techserv@promega.com 5 molecu les
17
Amplifying DNA
Optimization of PCR
PCR Enhancers
In some cases it may be helpful to add certain enhancing agents to a PCR, despite all other attempts to optimize conditions. Two good examples are the amplification of GC-rich templates and amplification of templates that form strong secondary structures, which can cause DNA polymerases to stall. GC-rich templates can be problematic due to inefficient separation of the two DNA strands or because of the tendency of GC-rich primers to form intermolecular and intramolecular secondary structures that compete with template annealing. There are many PCR-enhancing agents that act through a number of different mechanisms. PCR-enhancing reagents will not work with all reactions; the beneficial effects are often template- and primer-specific. Betaine, DMSO and formamide can be helpful when amplifying GC-rich templates. Betaine reduces the amount of energy required to separate the strands of a GC-rich DNA template (1). Dimethylsulfoxide (DMSO) and formamide are thought to aid in the amplification of GC-rich templates in a similar manner by interfering with the formation of hydrogen bonds between the two strands of DNA (2). Some reactions that amplify poorly in the absence of enhancers will give a strong PCR product when betaine (1M), DMSO (110%), or formamide (15%) are added to the reaction. DMSO concentrations greater than 10%, and formamide concentrations greater than 5% will cause inhibition of Taq DNA polymerase and, presumably, other DNA polymerases as well (3). In some cases, general stabilizing agents such as BSA (0.1mg/ml), gelatin (0.11.0%), and nonionic detergents (00.5%) can overcome failure to amplify a region of DNA. These additives can increase the stability of the DNA polymerase and may also coat the sides of the PCR tubes so that reagents are not lost through adsorption to the tube walls. BSA has also been shown to overcome the inhibitory effects of melanin on RT-PCR (4). Nonionic detergents, such as Tween-20, NP-40, and Triton X-100, have the additional benefit of being able to overcome the inhibitory effects of trace amounts of strong ionic detergents, such as 0.01% SDS (5).
betaine DMSO None
(continued)
Colorless GoTaq Buffer No template DMSO + betaine
Green GoTaq Buffer No template

3825TA08_2A
bp 1,198 350 222
Amplification of a fragment of the human retinoblastoma gene using GoTaq DNA Polymerase with Colorless GoTaq Reaction Buffer or Green GoTaq Reaction Buffer with and without the addition of enhancing agents DMSO and betaine. Amplification reactions contained 500ng human genomic DNA, 0.8M of each primer and 1.25u GoTaq DNA Polymerase in a final volume of 50l. Reactions contained no additives, 5% DMSO, 1M betaine or 5% DMSO + 1M betaine as indicated. No-template control reactions were included. Amplification primers and cycling conditions are as published in Frackman, S. et al. (1998) Betaine and DMSO: Enhancing agents for PCR. Promega Notes 65, 2729.
Ammonium ions can make a PCR reaction more tolerant of nonoptimal conditions. For this reason, some PCR reagents include 1020mM (NH4)2SO4. Other PCR enhancers include glycerol (520%), polyethylene glycol (515%), and tetramethyl ammonium chloride (TMAC; 60mM). The effects of these enhancers are very template- and primer-specific. It may be easier to design new primers and determine the optimal conditions for the new primer pair than to do multiple experiments with some of these less useful enhancers.
References
1. Rees, W., Yager, T.D., Korte, J. and von Hippel, P.H. (1993) Betaine can eliminate the base pair composition dependence of DNA melting. Biochemistry 32,13744. 2. Geiduschek, E.P. and Herskovitz, T.T. (1961) Nonaqueous solutions of DNA. Reversible and irreversible denaturation in methanol. Arch. Biochem. Biophys. 95, 11429. 3. Varadaraj, K. and Skinner, D. (1994) Denaturants or cosolvents improve the specificity of PCR amplification of a GC-rich DNA using genetically engineered DNA polymerases. Gene 140, 15. 4. Giambernardi, T.A., Rodeck, U. and Klebe, R.J. (1998) Bovine serum albumin reverses inhibition of RT-PCR by melanin. BioTechniques 25, 56466. 5. Gelfand, D.H. and White, T.J. (1990) Thermostable DNA polymerase. In: PCR Protocols: A Guide to Methods and Applications. Innis, M.A., Gelfang, D.H., Sninsky, J.J., and T.J. White (eds.) Academic Press, San Diego, CA. pp. 12941.
18
DMSO + betaine
betaine
DMSO
None
Amplifying DNA
Optimization of PCR
Troubleshooting
Most troubleshooting of PCR involves evaluating the possible areas of optimization. Promega has an extensive PCR troubleshooting guide included in the PCR Core Systems Technical Bulletin #TB254.
(continued)
Need a guide to general PCR optimization and troubleshooting? Get PCR Core Systems Technical Bulletin #TB254 online at: www.promega.com/tbs/tb254/tb254.html or request a printed copy from your local Promega representative.
RT-PCR Looking for information, tips and techniques for RT-PCR? Request the free RNA Analysis Notebook. Ask for literature #BR120 from your local Promega distributor or Promega Representative. Also available online at: www.promega.com/guides/
estions? more qu Have Promega Contact l Services: a m Technic mega.co erv@pro techs g ts servin Scientis . s scientist
19
Amplifying DNA
Routine PCR
PCR Master Mix: Robust, Convenient Amplification
Promegas PCR Master Mix(f,g) is designed for the rapid and convenient amplification of many common genomic and cDNA templates (1). PCR Master Mix, formulated as a 2X solution, offers a single-tube format for PCR setup, reducing pipetting times, steps and errors as well as greatly reducing reagent waste. All necessary PCR components, except for primers and template DNA, are contained in the Master Mix. Stability is also a key feature of PCR Master Mix, which can be stored for up to 24 months at 4C or be put through as many as 20 freeze-thaw cycles without loss of performance. PCR Master Mix provides 1.25u of Taq DNA Polymerase, Reaction Buffer, 200M of each dNTP, and 1.5mM Mg2+ in the final reaction.
PCR Master Mix
Reaction Buffer dNTPs Taq DNA Polymerase Mg2+
Primer Template
Reference
Template Copies per Reaction M 0 2 10 100 1,000 M
1. Denhart, M. and Doraiswamy, V. (2001) Performance advantages designed into Promegas PCR Master Mix. Promega Notes 78, 912.
Typical Reaction Set-Up with PCR Master Mix. Template (up to 104 copies of target) Primers (50pmol each or 1M final conc.) Nuclease-Free Water (provided) PCR Master Mix* Total Volume
Xl Yl Zl 25l 50l
3986MA02_3A
* Provides dNTPs (200M each), Mg2+(1.5mM), and Taq DNA Polymerase (1.25u) at the final 1X concentration.
Detection of low copy number templates using PCR Master MIx. A 360bp portion of the single-copy 1-antitrypsin gene was amplified from the indicated amounts of Human Genomic DNA (Cat.# G3041). Lane M, 100bp DNA Ladder (Cat.# G2101).
10l M 10 100 10
25l 100 10
50l 100
3278TA03_1A
Scalability of PCR Master Mix. The 360bp 1-antitrypsin message was amplified from 10 or 100 copies of Human Genomic DNA (Cat.# G3041) in 10, 25 and 50l reaction volumes as indicated.
PCR Master Mix Cat.#: M7501 (10 reactions) M7502 (100 reactions) M7505 (1,000 reactions) Protocol: www.promega.com/tbs/9pim750/9pim750.html Citations detailing use of PCR Master Mix online at: www.promega.com/citations/
PCR Master Mix in two-step RT-PCR. Amplification of a 533bp portion of the caspase-3 cDNA from 20l reverse transcription reaction. Reverse transcription was performed using the ImProm-II Reverse Transcription System (Cat.# A3800) and the indicated amount of total RNA. The cDNA in the entire 20l reaction was amplified by adding 15l of PCR Master Mix, 2l of gene-specific primers and 13l of Nuclease-Free Water (Cat.# P1195). Further details of the experiment may be found in Miller, K., Moravec, R. and Riss, T. (2001) An integrated approach to studying apoptosis: From gene expression to cellular events. Cell Notes 2, 46.
20
www.promega.co m or upon request.
Cell Notes and Promega Notes are available on line at:
3441TA06_1B
360bp
0n 10 g ng 1n g 10 0p 10 g pg 1p g
Reaction Volume
10
3063TA09_0A
Amplifying DNA
Routine PCR
(continued)
GoTaq DNA Polymerase: Direct-to-Gel Amplification
GoTaq DNA Polymerase(e,g) contains native Taq DNA Polymerase in a proprietary formulation. The GoTaq enzyme is supplied with 5X Green and 5X Colorless GoTaq Reaction Buffers. The Green Reaction Buffer contains a compound that increases sample density so that samples sink easily into the wells of an agarose gel. The Green Reaction Buffer also contains two dyes (a blue dye and a yellow dye) that separate during electrophoresis and can be used to monitor migration progress. This allows reactions to be directly loaded onto agarose gels without the need for loading dye. The blue dye migrates at the same rate as 35kb DNA fragments in a 1% agarose gel. The yellow dye migrates at a rate faster than primers (<50bp) in a 1% agarose gel. The Colorless GoTaq Reaction Buffer has the same formulation as the Green Reaction Buffer but does not contain dyes. The Colorless Reaction Buffer is recommended for any application where absorbance or fluorescence measurements of the PCR amplimer are necessary before clean-up. Both 5X buffers are supplied at pH 8.5 and contain MgCl2 at a concentration of 7.5mM, giving a final concentration of 1.5mM in the reaction. GoTaq DNA Polymerase Cat.#: M3001 (100u; 80 reactions) M3005 (500u; 400 reactions) M3008 (2,500u; 2,000 reactions) Supplied with enzyme (5u/l), 5X Green GoTaq Reaction Buffer and 5X Colorless GoTaq Reaction Buffer. Sufficient to give the indicated number of 50l reactions using 1.25u of enzyme per reaction. Protocol: www.promega.com/tbs/9pim300/9pim300.html
Separation of the components of the GoTaq Green Reaction Buffer during electrophoresis. PCR samples amplified using GoTaq DNA Polymerase and GoTaq Green Reaction Buffer were loaded onto an agarose gel. Samples are shown before (A) and after (B) electrophoresis. Volumes indicate the amount of amplification reaction loaded on the gel.
360bp bp 4,000 3,000 2,000 1,500 1,000
3824TA08_2A
1.1kb
1.8kb
2.4kb
3.1kb
M 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 1718 19 20 M
500 250
Amplification of various templates with GoTaq DNA Polymerase and other Promega Taq DNA Polymerase formulations. The reactions for each template are loaded in this order: Taq DNA Polymerase in Storage Buffer B (Cat.# M1661); Taq DNA Polymerase in Storage Buffer A (Cat.# M1861); GoTaq DNA Polymerase in Colorless Reaction Buffer; GoTaq DNA Polymerase in Green Reaction Buffer. Reactions without the Green GoTaq Reaction Buffer require the addition of loading dye prior to electrophoresis.
Compatibility of GoTaq DNA Polymerase with Upstream and Downstream Applications. Product Cat.# Green Reaction Buffer Colorless Reaction Buffer T-Vector Cloning Yes Yes pGEM-T & pGEM-T Easy Systems(h,i) A1360, A1380, A3600, A3610 pTARGET Mammalian Expression Vector System(i,j) A1410 Yes Yes PCR Clean-Up A1930 Yes Yes Wizard MagneSil PCR Clean-Up System(a) A9340 Yes Yes Wizard SV 96 PCR Clean-Up System A9281 Yes Yes Wizard SV Gel and PCR Clean-Up System Wizard PCR Preps DNA Purification System(k) A7170 Yes Yes Two-Step RT-PCR A3500 Yes Yes Reverse Transcription System(l,m) ImProm-II Reverse Transcription System(l,m) A3800 Yes Yes Transcription/Translation TNT T7 Quick for PCR DNA(l,m,n) L5540 Yes Yes
21
Amplifying DNA
Routine PCR
(continued)
All components supplied in PCR Core Systems Taq DNA Polymerase dNTPs 10X Thermophilic Reaction Buffer
Taq DNA Polymerase & PCR Core Systems: Value and Quality
Promega is a premier supplier of native Taq DNA Polymerase. We offer many options for your needs. You can assemble your own reagents from separate Taq DNA Polymerase and dNTPs, or purchase the PCR Core Systems to get everything together in one package. The PCR Core Systems(f) are supplied with a Technical Bulletin that contains thorough coverage of considerations involved in routine PCR amplification and extensive troubleshooting information. Taq DNA Polymerase in Storage Buffer A Cat.#: M1861 (100u; 80 reactions) M1865 (500u; 400 reactions) M1868 (2,500u; 2,000 reactions) Supplied with Taq DNA Polymerase 10X Reaction Buffer, 25mM MgCl2. One reaction uses 1.25u of enzyme. Taq DNA Polymerase in Storage Buffer B Cat.#: M1661 (100u; 80 reactions) M1665 (500u; 400 reactions) M1668 (2,500u; 2,000 reactions) Supplied with Taq DNA Polymerase 10X Reaction Buffer, 25mM MgCl2. One reaction uses 1.25u of enzyme. Citations for use of Taq DNA Polymerase online at: www.promega.com/citations/
MgCl2
See
p. 25 for d NT Ps .
Primers Template
The PCR Syste Core ms ar e gre at for resea rcher s just learni ng PC R
See p. 14 for typical reaction set-up.
Taq DNA Polymerase in Storage Buffer A & B

Promega first offered Taq DNA Polymerase stabilized with Triton X-100 (Taq DNA Polymerase in Storage Buffer A). Later we developed Taq DNA Polymerase stabilized with Tween-20 and NP-40 (Taq DNA Polymerase in Storage Buffer B). In most cases there is no difference in performance. One key distinction between the two products is compatibility with other suppliers reaction buffers. Taq DNA Polymerase in Storage Buffer A must be used with the supplied Reaction Buffer, which contains 0.1% Triton X-100 at the 1X concentration. Taq DNA Polymerase in Storage Buffer B does not have this requirement and can be used either with the supplied Promega Reaction Buffer or with other Taq DNA polymerase reaction buffers. PCR Core System I Cat.#: M7660 (200 50l reactions; 1.25u Taq DNA Polymerase/reaction) Comes with 250u Taq DNA Polymerase in Storage Buffer B, Taq DNA Polymerase 10X Reaction Buffer without MgCl2, Taq DNA Polymerase 10X Reaction Buffer with MgCl2 (1.5mM at 1X), 25mM MgCl2, PCR Nucleotide Mix. PCR Core System II Cat.#: M7665 (200 reactions; 1.25u Taq Polymerase/50l reaction) Same components as M7660 plus Positive Control Plasmid DNA template and Upstream and Downstream Control Primers. Protocol: www.promega.com/tbs/tb254/tb254.html
22
3987MA02_3A
Amplifying DNA
Incorporation fidelity can be an important consideration for cloning projects. Thermostable enzymes with a 35 exonuclease activity, commonly known as proofreading activity, offer the highest fidelity in amplification reactions. Proofreading enzymes like Pfu and Tli DNA Polymerase(e) offer three- to sixfold higher fidelity than standard Taq DNA Polymerase. In general, proofreading enzymes extend primers a little slower than Taq DNA Polymerase and thus typically require longer extension times and a few more cycles. Assume 2 minutes per kilobase of amplimer, and add 23 cycles to your reaction when using a proofreading enzyme. With Pfu DNA Polymerase(e), it is important to use the Reaction Buffer supplied with the enzyme for maximum fidelity. Pfu Reaction Buffer is formulated to give maximum fidelity, not maximum yield. After all, you use Pfu for fidelity not yield. If you need greater yield, use more template DNA.
A.
bp 1,500 1,000 500
2355TA08_8A
Proofreading Polymerases
8 7
Accuracy 105
6 5 4 3 2 1 Pfu Tli
crease Hint: In sion Usage n tion exte amplifica ver standard X o times 2 olymerase P Taq DNA kb) in/ (e.g ., 2m 3 cycles. 2 and add
Taq
DNA Polymerase
Accuracy of thermostable polymerases. The accuracy of Pfu DNA Polymerase has been reported by Cline et al. as 7.7 105. Using the PCR-based forward mutation assay, they reported the accuracy of Pfu as approximately two-fold higher than Vent (Tli DNA Polymerase) and approximately sixfold higher than Taq DNA Polymerase (1).
Reference
1. Cline, J., Braman, J.C. and Hogrefe, H.H. (1996) PCR fidelity of Pfu DNA polymerase and other thermostable DNA polymerases. Nucl. Acids Res. 24, 354651.
Promega
30 3 0.3 0.03 0.0
B.
M 30
Supplier A
3 0.3 0.03 0.0 1.2kb product
100
Comparison of sources of native Pfu DNA Polymerase. A 1.2kb fragment of human 1-antitrypsin gene was amplified using Pfu DNA Polymerase from Promega (Panel A) and from another supplier (Panel B). The target was amplified from decreasing amounts of Human Genomic DNA (Cat.# G3041) as indicated. Lane M, 100bp DNA Ladder (Cat.# G2101).
Pfu DNA Polymerase Cat.#: M7741 (100u; 80 reactions) M7745 (500u; 400 reactions) Each provided with enzyme (5u/l), Pfu DNA Polymerase 10X Reaction Buffer (2mM MgSO4 @ 1X) sufficient to give the indicated number of 50l reactions using 1.25u of enzyme. Protocol: www.promega.com/tbs/9pim774/9pim774.html Citations for use of Pfu DNA Polymerase online at: www.promega.com/citations/
Not available in North America.
ve a 35 Proofreaders ha ing in ty that is lack onuclease activi ex ymes like Taq proofreading enz nones freading enzym Polymerase. Proo DNA the reaction is rade primers if can deg r to for too long prio allowed to sit ing up recommend sett plification. We am and adding the reactions on ice se just prior to eading polymera proofr eated tion into a preh placing the reac thermal cycler.
Tli DNA Polymerase Cat.#: M7101 (50u; 40 reactions) Supplied with enzyme (5u/l), Thermophilic DNA Polymerase 10X Reaction Buffer and 25mM MgCl2. Sufficient to give the indicated number of 50l reactions using 1.25u of enzyme/reaction. Citations for use of Tli DNA Polymerase online at: www.promega.com/citations/
3973MA02_3A
23
Amplifying DNA
Hot Start Methodology
Hot start PCR is a commonly used technique to reduce nonspecific amplification. One cause of nonspecific amplification is the assembly of PCR reactions at room temperature or on ice. Under these conditions, the PCR primers may be able to anneal to various noncomplementary positions on the template. Although activity of thermostable DNA polymerases at room temperature or 4C is usually less than 25%, they can extend nonspecifically annealed primers at these temperatures. Any newly synthesized product is completely complementary to the PCR primer, allowing the primer to anneal specifically to this region during PCR, resulting in an undesired amplification product. Hot start PCR can also reduce the amount of primerdimer formed. Primer-dimers result from complementarity between the 3 ends of the PCR primers. At room temperature or on ice, these complementary regions anneal and the polymerase extends the ends to produce a primer-dimer. Primer-dimers often appear as a diffuse band at ~50100bp on ethidium bromide-stained gels. Both nonspecific products and primer-dimers can compete with the desired amplification reaction for reagents. By avoiding the conditions that lead to nonspecific amplification, hot start PCR can improve the yield of the desired PCR product. There are several ways to perform hot start PCR. The reaction can be assembled on ice or at room temperature, omitting the DNA polymerase until the reaction has been placed in the thermal cycler and heated to 6065C. Once the reaction has reached 6065C the desired amount of polymerase can be added. This prevents the polymerase from extending primers until the higher temperature is reached and primer annealing is more specific. The method is quite effective but can be labor-intensive, particularly if dozens of amplification reactions are involved. Another approach to hot start PCR involves the use of wax to physically sequester one or more critical reaction Taq Bead Hot Start Polymerase Cat.#: M5661 (100 reactions) Supplied with 100 beads (1.25u Taq DNA Polymerase in Storage Buffer B/bead), Thermophilic DNA Polymerase 10X Reaction Buffer, and 25mM MgCl2. Protocol: www.promega.com/tbs/tb247/tb247.html Citations for use of Taq Bead Polymerase online at: www.promega.com/citations/ components until the appropriate temperature is reached. Wax beads can be added to a PCR before the addition of the DNA polymerase. Heating the PCR to 60C melts the wax, which forms a liquid layer over the surface of the reaction, eliminating the need for mineral oil. Upon cooling to 4C, the wax solidifies. The DNA polymerase is added onto this wax layer and, as the PCR is heated during the first denaturation step, the wax melts and the polymerase can access the other PCR reagents. This method is labor intensiverequiring an additional heating and cooling step to prepare the wax layer. Also, opening the PCR tube to add the polymerase increases the risk of contamination. Additionally, the solid wax layer that forms upon cooling to 4C will clog pipet tips when attempting to break through the wax to pipet the PCR. Thus, it is often necessary to use one pipet tip to puncture the wax layer and a second pipet tip to remove the PCR products.
Taq Bead Hot Start Polymerase

Enter Promegas TaqBead Hot Start Polymerase(f). By impregnating a wax bead with Taq DNA Polymerase, the additional heating and cooling steps to form the wax layer are eliminated. A single bead is added to each 50l reaction, and as the reaction is heated, the wax melts and releases the polymerase. The molten wax rises to the surface of the PCR where it forms an incomplete barrier. In thermal cyclers with heated lids, a hole remains above the reaction to ease pipetting. To prevent evaporation in thermal cyclers without heated lids, we recommend adding mineral oil to each PCR. The molten wax and mineral oil will mix during the thermal cycling to form a single layer, which solidifies when the reaction is cooled to 4C and can clog pipet tips.
Taq Cold Start
M bp 2,645 1,605 1,198 676 517 396
1586TA09_6A
TaqBead Hot Start

10 1 0.1 pg of target
10
0.1
1.8kb
primerdimer
24
Hot start amplification reduces the yield of nonspecific amplification products. Aliquots of 10, 1 or 0.1pg pGEM-luc Vector(h,o) (Cat.# E1541) were diluted in 30ng of Human Genomic DNA (Cat.# G3041). A 1.8kb luciferase gene product was amplified by PCR using Taq DNA Polymerase (Storage Buffer B) or TaqBead Hot Start Polymerase in Promega Reaction Buffer supplemented with 2mM MgCl2. Details are provided in Miller, K., Smith, R. and Storts, D. (1996) Improved PCR amplification using TaqBead Hot Start Polymerase. Promega Notes 60, 26.
Amplifying DNA
dNTPs
1 2 3 4 5 6 7 Promega is a premier supplier of high-quality dNTPs(f) in bulk form or premixed in the PCR Nucleotide Mix(f). Promegas dNTPs are >99% triphosphate with verified concentrations. All dNTPs, whether bulk or premixed, are DNase- and RNase-free, and are functionally tested in amplification reactions. The PCR Nucleotide Mix is also functionally tested in RT-PCR. Set of dATP, dCTP, dGTP and dTTP Cat.#: U1330 (10mol each; 1,000 reactions) U1420 (25mol each; 2,500 reactions) U1240 (40mol each; 4,000 reactions) U1410 (200mol each; 20,000 reactions) Set of dUTP, dATP, dCTP and dGTP Cat.#: U1335 (10mol each; 1,000 reactions) U1245 (40mol each; 4,000 reactions) Each dNTP is supplied at 100mM. Reaction size is considered to be 200M each dNTP in a 50l PCR reaction. Custom and bulk dNTP sizes are available.
RT-PCR functional assay using PCR Nucleotide Mix. The dNTPs were used following 50 freeze-thaw cycles. Amounts of template RNA: lane 1, 25fmol; lane 2, 2.5fmol; lane 3, 250amol; lane 4, 25amol; lane 5, 2.5amol; lane 6, 250zmol; lane 7, no template control.
PCR Nucleotide Mix Cat.#: C1141 (200l; 200 reactions) C1145 (1,000l; 1,000 reactions) The PCR Nucleotide Mix supplies a single solution containing each dNTP (dATP, dTTP, dGTP, dCTP) at 10mM. Reaction size is considered to be 200M of each dNTP in a 50l reaction. Each reaction uses 1l of PCR Nucleotide Mix. Custom and bulk PCR Nucleotide Mix sizes are available. Protocol: www.promega.com/tbs/9pic114/9pic114.html
bp 1,500 1,000
500
Stability of dNTPs. The integrity of the RT-PCR products on the gel demonstrates the stability of the dNTPs after storage under the conditions listed. The dNTPs used in each RT-PCR were stored as follows prior to use: Lane 2, 1 freeze-thaw cycle; lane 3, 50 freezethaw cycles; lane 4, 1 year at 20C; lane 5, negative PCR control; lanes 1 and 6, 100bp DNA Ladder (Cat.# G2101).
Ps and as dNT Promeg de Mix Nucleoti st PCR h at lea o throug can g thaws. freeze/ 50
3527TA08_1A
3528TA08_1A
25
Amplifying DNA
Routine PCR
Product
PCR Master Mix(f,g)
For Laboratory Use. A reaction consists of 25l of the 2X PCR Master Mix in a 50l total volume. Supplied with Nuclease-Free Water.
100 reactions 1,000 reactions
Size
Cat.#
M7502 M7505
Product
GoTaq DNA Polymerase(e,g)
100u 500u 2,500u
Size
Cat.#
M3001 M3005 M3008
For Laboratory Use. Supplied with 5X Green GoTaq Reaction Buffer and 5X Colorless GoTaq Reaction Buffer. Both buffers contain 1.5mM Mg2+ at the 1X concentration.
Product
PCR Core System I(f) PCR Core System II(f)
200 reactions 200 reactions
Size
Cat.#
M7660 M7665
For Laboratory Use. PCR Core Systems provide Taq DNA Polymerase in Storage Buffer B, PCR Nucleotide Mix, Taq DNA Polymerase 10X Reaction Buffers with and without MgCl2, and 25mM MgCl2 sufficient for 200 50l reactions containing 1.25u of Taq DNA Polymerase. PCR Core System II also contains Positive Control Plasmid DNA template, and Upstream and Downstream Control Primers.
Product
Taq DNA Polymerase in Storage Buffer A(e)

(Supplied with Taq DNA Polymerase 10X Reaction Buffer without MgCl2, and 25mM MgCl2.)
Taq DNA Polymerase in Storage Buffer A(e)

(Supplied with Taq DNA Polymerase 10X Reaction Buffer with MgCl2, giving 1.5mM Mg2+ at the 1X concentration.)
Taq DNA Polymerase in Storage Buffer B(e)

(Supplied with Taq DNA Polymerase 10X Reaction Buffer without MgCl2, and 25mM MgCl2 Solution.)
Taq DNA Polymerase in Storage Buffer B(e)

(Supplied with Taq DNA Polymerase 10X Reaction Buffer with MgCl2, giving 1.5mM Mg2+ at the 1X concentration.) For Laboratory Use.
100u 500u 2,500u 100u 500u 2,500u 100u 500u 2,500u 100u 500u 2,500u
Size
Cat.#
M1861 M1865 M1868 M2861 M2865 M2868 M1661 M1665 M1668 M2661 M2665 M2668
Proofreading Polymerases
Product
Pfu DNA Polymerase(e)*
(Supplied with Pfu DNA Polymerase 10X Reaction Buffer with MgSO4, giving 2mM Mg2+ at the 1X concentration.)
Size
100u 500u 50u
Cat.#
M7741 M7745 M7101
Tli DNA Polymerase(e)**

(Supplied with Thermophilic DNA Polymerase 10X Reaction Buffer and 25mM MgCl2.) *Not Available in North America. **For Laboratory Use.
26
Amplifying DNA
Hot Start Polymerase
Product
TaqBead Hot Start Polymerase(f)
(Supplied with Thermophilic DNA Polymerase 10X Reaction Buffer and 25mM MgCl2.) For Laboratory Use. One bead per reaction; 1.25u Taq DNA Polymerase per bead.
Size
100 reactions
Cat.#
M5661
dNTPs
Product
PCR Nucleotide Mix(f)
(Contains 10mM each dNTP; use 1l per 50l reaction.)
Set of dATP, dCTP, dGTP, and dTTP(f)

(100mM each dNTP. Individual tubes available.)
Set of dUTP, dCTP, dGTP, and dATP(f,p)

(100mM each dNTP.) For Laboratory Use.
200l 1,000l 10mol 25mol 40mol 200mol 10mol 40mol
Size
Cat.#
C1141 C1145 U1330 U1420 U1240 U1410 U1335 U1245
Accessories
Product
Promega 10 Barrier Tips, 960/pk Promega 10E Barrier Tips, 960/pk Promega 10F Barrier Tips, 960/pk Promega 20 Barrier Tips, 960/pk Promega 100 Barrier Tips, 960/pk Promega 200 Barrier Tips, 960/pk Promega 1000 Barrier Tips, 480/pk Mineral Oil* Nuclease-Free Water*
*For Laboratory Use.
0.510l 0.510l 0.510l 220l 10100l 50200l 1001,000l 12ml 150ml
Size
A1491 A1501 A1511 A1521 A1541 A1551 A1561 DY1151 P1195
Cat.#
Tip and Pipette Compatibility Guide

Promega 10 Promega 10E Promega 10F Promega 20 Promega 100 Promega 200 Promega 1000 0.510l 0.510l 0.510l 220l 10100l 50200l 1001,000l
Size
Pipetman
P-2; P-10 P-2; P-10 P-20 P-100 P-200 P-1000
Eppendorf
0.510l 220l 10100l EDP250l
Oxford Benchmate
0.510l 0.510l
0.510l Digital 0.510l
Finnpipette
1050l 40200l 2001,000l
540l 40200l 2001,000l
27
PCR Clean-Up
Overview
Direct Isolation
Many downstream applications such as DNA sequencing and single nucleotide polymorphism (SNP) analysis require that salts, dNTPs, proteins and primers be removed from the amplification product as they can interfere with further enzymatic reactions. Many researchers use a simple ethanol precipitation prior to sequencing. This removes most dNTPs and salts but leaves behind protein and may also leave primers. Phenol:chloroform extraction can remove protein contaminants but recovery rates can be low, and the use of organics is undesirable. Use of silica technology simplifies the whole process. The amplification reaction products are bound to silica in the presence of a chaotrope like guanidine. Salts, dNTPs and primers pass by the silica. Primer-dimers and nonspecific amplimers smaller than 70bp are not bound efficiently. A simple alcohol wash removes the guanidine and protein while material >70bp is retained. The purified DNA is eluted in water or another low-ionic strength solution. The success of the downstream application is dependent upon the specificity of the amplification reaction, as any nonspecific amplimers will be copurified with the specific product of interest. Downstream applications such as T-Vector cloning, restriction digestion and direct sequencing benefit from clean-up of PCR amplimers. T-vector cloning has a tremendous dependence upon PCR product purity. Although unpurified amplification reactions can be used for T-vector cloning, more screening of the resulting colonies is generally necessary to find the specific clone of interest. This is because unpurified PCR amplification reactions can contain primer-dimers and nonspecific amplimers in much higher molar quantities than the PCR product of interest. These nonspecific products compete for ligation with the amplimer of interest. Typically, an experiment with unpurified products will produce a large number of colonies, many of which contain small, nonspecific PCR products as inserts. Thus, the efficiency of the cloning experiment is reduced. In one case the percentage of colonies containing the correct insert was 67% using unpurified PCR products. In contrast, when purified PCR products were used >90% of colonies contained the correct insert (1).
Gel Isolation
Gel isolation is the most effective way to isolate the PCR product you need for your downstream applications. Agarose gel electophoresis allows you to separate the desired amplimer from any nonspecific bands, primers and primer-dimers. You visualize your gel quickly on a UV lightbox, using 10mg wavelength UV light, cut out the band of interest and then purify the product. Gel isolation is typically used if the downstream application is cloning and additional bands, representing nonspecific amplimers or primer-dimer, are present on the gel. The agarose is melted and combined with a chaotrope like guanidine, and the DNA is then bound to silica. Agarose and guanidine are quickly and efficiently removed by an alcohol wash, and the purified DNA is eluted in water.
Reference
1. Buros, M. and Betz, N. (2002) Removal of ethidium bromide and calf intestinal alkaline phosphatase using the Wizard SV Gel and PCR Clean-Up System. eNotes: www.promega.com/enotes/applications/ap0045_tabs.htm
PCR Reaction
Gel Purification
Direct Purification
Wizard SV Gel & PCR Clean-Up System Wizard PCR Preps DNA Purification System Wizard SV 96 PCR Clean-Up System
4020MA03_3A
Wizard MagneSil PCR Clean-Up System
28
PCR Clean-Up
Wizard SV Gel and PCR Clean-Up System
100bp U P P P U 200bp P P P U 500bp P P P
Wizard SV Gel and PCR Clean-Up System Cat.#: A9281 (50 preps) A9282 (250 preps)
10
15
25
50
75
100
Elution Volume (l)

M 3,000bp 1,000bp
3789TA07_2A
100bp U P
500bp U P
1,000bp U P
3,199bp U P
Elution volume versus recovery for a 700bp PCR product purified directly from an amplification reaction using the Wizard SV Gel and PCR Clean-Up System. One hundred percent represents recovery with 50l elution volume. Adapted from Table 4 in Betz, N. and Strader, T. (2002) Clean up with Wizard SV for Gel and PCR. Promega Notes 82, 25.
U: Unpurified
P: Purified
Gel analysis of PCR products before and after gel extraction using the Wizard SV Gel and PCR Clean-Up System. Recovery of various sizes of unpurified (U) and purified (P) PCR products. Purified products were extracted from a 1% agarose gel run with TAE buffer. Lane M, 1kb DNA Ladder (Cat.# G5711).
ig as b NA e ar D an b Line kb c 0 p to as 1 th u i ed w very. urifi p reco 95%

Effect of Various PCR Additives on Recovery of a 1,000bp PCR Product Using the Wizard SV Gel and PCR Clean-Up System Direct Purification Method. Percent Recovery PCR Additive Relative to No Additive No Additive 100% 1M Betaine 94% 1M Q-Solution 97% 0.1% Triton X-100 92% 0.1% Tween 20 87% 0.1% NP-40 82% 5% Glycerol 87% 5% Formamide 90% 5% DMSO 87% 0.5M Tetramethylene Sulfoxide 94% 0.4M Sulfolane 94% 0.4M 2-Pyrolidene 95% 1mM Tartrazine 100% 1% Ficoll-400 100%
3972MA02_3A
Protocol: www.promega.com/tbs/tb308/tb308.html
Percent Recovery
The Wizard SV Gel and PCR Clean-Up System is designed to extract and purify DNA fragments directly from PCR reactions or from agarose gels. Fragments of 100bp10kb can be recovered from standard or lowmelt agarose gels in either Tris acetate (TAE) or Tris borate (TBE) buffer. Up to 95% recovery is achieved, depending upon the DNA fragment size. This membrane-based system, which can bind up to 40g of DNA, allows recovery of isolated DNA fragments or PCR products in as little as 15 minutes, depending on the number of samples processed and the protocol used. Samples can be eluted in as little as 15l of NucleaseFree Water. The purified DNA can be used for automated fluorescent sequencing, cloning, labeling, restriction enzyme digestion or in vitro transcription/translation without further manipulation.
1,000bp U P P P U
1,500bp P P P
3790TB08_2A
Gel analysis of PCR products before and after direct purification using the Wizard SV Gel and PCR Clean-Up System. DNA fragments of the sizes indicated were analyzed before (U) and after (P) direct purification from amplification reactions.
100 90 80 70 60 50 40 30 20 10 0
29
PCR Clean-Up
Wizard SV 96 PCR Clean-Up System
The Wizard SV 96 PCR Clean-Up System provides a fast, simple technique for the efficient isolation of purified DNA fragments generated by PCR amplification. Walkaway automation is easily achieved on any 96-well liquid handling workstation equipped with a gripper and vacuum apparatus. Double-stranded DNA fragments can be purified from 96 samples in less than 20 minutes. Purification is achieved without phenol:choroform extraction or ethanol precipitation. Optimized methods are available for the Beckman Coulter Biomek 2000 and FX instruments.
If it work s in itll SV, work in S V9 6.
Manu al or a 96-w utomated ell P purific CR ation.
Recommended automated system for reactions prepared in the presence of PCR enhancers like betaine, DMSO, etc. Just like the SV system, SV 96 works with a wide variety of PCR additives.
Standard PCR
Wizard SV 96 PCR Clean-Up System Cat.#: A9340 (1 96 preps) A9341 (4 96 preps) A9342 (8 96 preps) Protocol: www.promega.com/tbs/tb311/tb311.html For information on automated methods, visit: www.promega.com/automethods/ Want to do 96-well agarose gel isolations? Request Application Note #AN096.
1M Betaine
Microarray of purified PCR products. Representative microarray blocks of PCR product purified using the Wizard SV 96 PCR Clean-Up System and hybridized to complementary Cy3-labeled cDNA. PCR DNA was isolated from a standard amplification reaction or from a reaction containing 1M betaine. No effect of betaine is observed.
100bp M P U
200bp P U
300bp P U
500bp P U
1,000bp P U
3796TB09_2A
30
Agarose gel analysis of PCR fragments purified on the Beckman Coulter Biomek 2000 liquid handler. PCR fragments of 100, 200, 300, 500 and 1,000bp were purified using the Wizard SV 96 PCR Clean-Up System on the Beckman Coulter Biomek 2000 robotic workstation. Both purified (P) and unpurified (U) fragments were separated on an ethidium bromide-stained 2% agarose gel. Percent recovery ranged from 71 3% for the 100bp fragment to 100 1% for the 1,000bp fragment. Lane M, 100bp DNA Ladder (Cat.# G2101).
3801TA08_2A
3445CA06_1A
PCR Clean-Up
Wizard MagneSil PCR Clean-Up System
Wizard MagneSil PCR Clean-Up System Cat.#: A1930 (4 96 preps) A1931 (8 96 preps) A1935 (100 96 preps) Protocols: Automated 96-well plate protocol www.promega.com/tbs/tb290/tb290.html Automated 384-well plate protocol www.promega.com/tbs/ep009/ep009.html For information on automated methods visit: www.promega.com/automethods/
100 80
The Wizard MagneSil PCR Clean-Up System(a) removes impurities from PCR reactions, giving high quality and yield of double-stranded amplicons. The system removes excess nucleotides, primers and small amplification products such as primer-dimers from PCR reactions. The system is designed for automation on laboratory robotic systems for unattended 96- to 384-well purification. PCR clean-up is performed using Promegas unique MagneSil Paramagnetic Particles(a) and the MagnaBot 96 Magnetic Separation Device (Cat.# V8151) fitted with a 3/16" MagnaBot Spacer (Cat.# V8381). The MagnaBot 96 Magnetic Separation Device is designed to work with most robotic platforms. A MagnaBot 384 Magnetic Separation Device is also available (Cat.# V8241). The MagneSil PCR Clean-Up procedure is fast and reliable. PCR products bind to MagneSil particles in the presence of guanidine hydrochloride and remain tightly bound during washing. Purified DNA is eluted in water and may be used for automated fluorescent sequencing and microarray spotting. The MagneSil PCR Clean-Up System is ideally suited for reactions prepared using PCR Master Mix and GoTaq DNA Polymerase. It also works well with reactions prepared using AmpliTaq and AmpliTaq Gold DNA Polymerase.
E. coli Control Array
% Recovery
60
PCR Master Mix

40 20 0
AmpliTaq DNA Polymerase
200
400
600
800 1,000
PCR Product Size (bp)
Percent recovery of PCR products purified using the Wizard MagneSil PCR Clean-Up System. PCR amplimers were purified from standard amplification reactions performed using either PCR Master Mix or AmpliTaq DNA Polymerase.
Cy3
Cy5
Array images after hybridization with Cy3 and Cy5 fluorescent control E. coli targets. E. coli genomic DNA was amplified using 96 unique primer pairs. The Wizard MagneSil PCR Clean-Up System-purified PCR products were printed onto a poly-L-lysine-coated slide and hybridized to Cy3- or Cy5-labeled E. coli cDNA. For further details, see Splinter BonDurant, S. et al. (2002) MagneSil Paramagnetic Particles: A high-throughput PCR purification system for microarrays. Promega Notes 80, 1416.
3578TA11_1A
Quality tested for success in fluorescent BigDye Sequencing with >98% accuracy over 600 bases read.
is stem sy This pable of ca -well 384 ations. ic purif
3289MA03_1A
31
PCR Clean-Up
Wizard PCR Preps DNA Purification System
Resin/DNA mix
The Wizard PCR Preps DNA Purification System(k) provides a simple, reliable way to purify double-stranded, PCR-amplified DNA. PCR products are effectively separated from contaminants, including primer-dimers and amplification primers. This system can also be used to purify DNA fragments from agarose gels. The DNA can be eluted from the Wizard PCR Preps DNA Purification Resin in water or TE buffer, with little salt or macromolecular contamination. A unique feature of this resin-based method is its size cutoff capability. The resin does not appreciably bind double-stranded DNA smaller than 200bp, virtually assuring the removal of primerdimers from the reaction. Multiple PCR preps can be easily processed at one time using the Vac-Man Laboratory Vacuum Manifold (Cat.# A7231).
Before Purification
M bp M
Add resin/DNA mix to syringe barrel and apply vacuum.
Add isopropanol, removing solution by vacuum.
After Purification
Transfer Minicolumn to microcentrifuge tube.
0935TA11_4A
1,000 500 200 50

Recovery of PCR products using the Wizard PCR Preps DNA Purification System. Equivalent amounts of a PCR reaction taken before and after purification were separated on a 1% agarose gel and stained with ethidium bromide.
Centrifuge.
Transfer Minicolumn to new tube. Add water.
Centrifuge to elute DNA.
Overview of PCR product purification using the Wizard PCR Preps DNA Purification System and the Vac-Man Laboratory Vacuum Manifold.
0348TA08_3A
Wizard PCR Preps DNA Purification System Cat.#: A7170 (50 preps) A2180 (250 preps) Protocol: www.promega.com/tbs/tb118/tb118.html Citations for use available at: www.promega.com/citations/
Purification and analysis of PCR products from low-melting agarose using the Wizard PCR Preps System. Reactions are shown before (lanes 2 and 4) and after (lanes 3 and 5) purification.
32
ol d protoc ge-base Syrin (where provided also ed). is requir m no vacuu
2819MB04_1A
PCR Clean-Up
PCR Clean-Up Systems and Accessories
Product
Wizard SV Gel and PCR Clean-Up System(k)
For Laboratory Use. Manual spin-basket system for direct PCR purification and gel isolation from standard agarose gels.
50 preps 250 preps
Size
Cat.#
A9281 A9282
Product
Wizard SV 96 PCR Clean-Up System*
Vac-Man 96 Vacuum Manifold
1 96 preps 4 96 preps 8 96 preps 1 each
Size
Cat.#
A9340 A9341 A9342 A2291
* For Laboratory Use. The Wizard SV 96 PCR Clean-Up System provides a manual or automated system for 96-well direct PCR purification by vacuum. Compatible with a wide variety of PCR additives and all Promega amplification reaction buffers.
Product
Wizard MagneSil PCR Clean-Up System(a)* Wizard MagneSil PCR Clean-Up System, HTP1(a)* MagnaBot 96 Magnetic Separation Device MagnaBot 384 Magnetic Separation Device MagnaBot Spacer (3/16) 384-Well Plate, Flat
4 96 preps 8 96 preps 100 96 preps 1 each 1 each 1 each 10 pack
Size
Cat.#
A1930 A1931 A1935 V8151 V8241 V8381 V5291
* For Laboratory Use. The Wizard MagneSil PCR Clean-Up System provides an automated 96- or 384-well system for direct purification of PCR products. Compatible with standard reactions using Promega's PCR Master Mix or GoTaq DNA Polymerase.
Product
Wizard PCR Preps DNA Purification System(k)* Vac-Man Laboratory Vacuum Manifold, 20-sample capacity
50 preps 250 preps 1 each
Size
Cat.#
A7170 A2180 A7231
* For Laboratory Use. The Wizard PCR Preps DNA Purification System is a manual, resin-based vacuum system for direct purification or isolation from agarose gels.
Related Products
Product
Agarose, LE, Analytical Grade Agarose, Low Melting Point, Analytical Grade Blue/Orange Loading Dye, 6X* TAE Buffer, 10X TAE Buffer, 40X TBE Buffer, 10X
100g 500g 25g 3ml (3 1ml) 1,000ml 1,000ml 1,000ml
Size
Cat.#
V3121 V3125 V2111 G1881 V4271 V4281 V4251
33
Cloning PCR DNA

Overview
Cloning PCR products into plasmid vectors is a common downstream application of PCR. When PCR was in its infancy, researchers found that it was not easy to clone PCR products by simple blunt-end ligation into blunt-ended plasmid vectors because some thermostable DNA polymerases, including Taq DNA Polymerase, add a single nucleotide base extension to the 3-end of blunt DNA in a template-independent fashion (1,2). Most commonly the base added is adenine, leaving what is called an A overhang. To overcome this, researchers had to treat PCR products to blunt-end the PCR fragments prior to cloning. Such experiments often suffered from low cloning efficiencies. Another commonly used strategy for PCR cloning is to add restriction enzyme recognition sites to the ends of PCR primers (3). The PCR product is then digested and cloned into the desired vector. When using this method, care must be exercised in primer design because not all enzymes cleave efficiently at the ends of DNA fragments, and you may not be able to use every enzyme you desire (4,5). Some enzymes require extra bases outside the restriction enzyme recognition site, adding further expense to the PCR primers as well as increasing the risk of annealing to unrelated sequences in the genome. The fact that amplicons generated with Taq DNA Polymerase typically have A overhangs led to the method referred to as T-vector cloning. In essence, the plasmid cloning vector is engineered to contain 3-T overhangs that match the 3-A overhang of the amplicon (6). The A-tailed amplicon is directly ligated to the Ttailed plasmid vector, and there is no need for further enzymatic treatment of the amplicon other than the action of T4 DNA Ligase. Promega has systems based on this technology for routine subcloning and direct mammalian expression.
References
1. Clark, J.M. (1988) Novel non-template nucleotide addition reactions catalyzed by procaryotic and eucaryotic DNA polymerases. Nucl. Acids Res. 16, 967786. 2. Mole, S.E., Iggo, R.D. and Lane, D.P. (1989) Using the polymerase chain reaction to modify expression plasmids for epitope mapping. Nucl. Acids Res. 17, 3319. 3. Scharf, S.J., Horn, G.T. and Erlich, H.A. (1986) Direct cloning and sequence analysis of enzymatically amplified genomic sequences. Science 233, 107678. 4. Kaufman, D.L. and Evans, G.A. (1990) Restriction endonuclease cleavage at the termini of PCR products. BioTechniques 9, 3046. 5. Digestion of restriction sites close to the end of linear DNA. In: Restriction Enzyme Resource Guide. Promega Corporation. www.promega.com/guides/re_guide/chaptwo/2_6.htm 6. Mezei, L.M. and Storts, D.R. (1994) Cloning PCR Products. In: PCR Technology Current Innovations. Griffin, H.G. and Griffin, A.M. (eds). CRC Press, pp. 217.
For cloning PCR products, the choice is yours

A A
G reat for D sequ rop enci out ng! inser singl t w e B ith st Z I dig est
T T T
pGEM-T Vector
pGEM-T Easy Vector
pTARGET Mammalian Expression Vector
Great for sequencing! Drop out insert with single Eco R I, Not I or Bst Z I digest
romoter CMV p or R gene f Neo lection 418 Se Gh sert wit op out in Dr I digest le Eco R sing
34
3779MA07_2A
Basic Subcloning
Basic Subcloning
Direct Mammalian Expression
Cloning PCR DNA

Basic Subcloning
pGEM-T and pGEM-T Easy Vector Systems
The most basic need in PCR cloning is for simple, general cloning vectors. The pGEM-T and pGEM-T Easy Vector Systems(h,i) were designed for just that purpose. The vectors are based on the pGEM-5Zf(+) Vector(h) backbone. The pGEM-T and -T Easy Vectors provide convenient T7 and SP6 promoters that serve as sequencing primer binding sites and also allow in vitro transcription of either strand of the insert with the appropriate RNA polymerase. The vectors also have the lacZ coding region, allowing easy blue/white screening of recombinants. The pGEM-T and -T Easy Vectors are provided with 2X Rapid Ligation Buffer, which allows efficient ligation in just 1 hour with the supplied T4 DNA Ligase. You can either supply your own favorite E. coli competent cells or purchase the system with Promegas high-efficiency JM109 Competent Cells. The choice is yours. pGEM-T Vector System I (you supply the competent cells) Cat.#: A3600 (20 reactions) pGEM-T Vector System II (supplied with High Efficiency JM109 Competent Cells) Cat.#: A3610 (20 reactions) Protocol: www.promega.com/tbs/tm042/tm042.html Citations for use of the pGEM-T System online at: www.promega.com/citations/
Xmn I 1994 Sca I 1875 f1 ori Nae I 2692
T7
Amp r
pGEM-T Vector
(3000bp)
lacZ
Apa I Aat II Sph I BstZ I Nco I Sac II Spe I Not I BstZ I Pst I Sal I Nde I Sac I Bst X I Nsi I
1 start 14 20 26 31 37 46 55 62 62 73 75 82 94 103 112 126
blue/white selection.
SP6
What is Blue/White Selection? The enzyme -galactosidase, the product of the bacterial lacZ gene, can be separated into two domainsthe -fragment and the -fragment. The two fragments interact to form a functional -galactosidase. For blue/white selection, the -fragment is expressed by the E. coli host strain, and the -fragment is provided by the cloning vector. An intact, in-frame -fragment will interact with the host strain -fragment, creating functional -galactosidase. This is known as -complementation. Bacteria capable of producing functional -galactosidase will cleave the substrate X-Gal (5-bromo-4-chloro-3-indolyl--Dgalactopyranoside), creating blue colonies when grown on indicator plates containing IPTG and X-Gal (see recipe on p. 40). Blue/white-capable cloning vectors have a multiple cloning site within the -fragment coding sequence. When your sequence of interest is inserted within this region, the -fragment is disrupted, -complementation does not occur, and the colony is white. E. coli (e.g., JM109, DH5 or XL1-Blue) transformed with an insert-containing plasmid produce white colonies, while those containing empty or religated vector produce blue colonies.
Drop out your insert with a single Bst Z I digest.
with: erts ns nce i rimer Seque ter P r Promo SP6 Prime oter rimer Prom ard P T7 r Forw Prime /M13 pUC verse e 13 R UC/M p
Need sequencing-grade plasmid DNA? Promega has the system. Wizard Plus SV Minipreps DNA Purification System(q,r) Simple spin preps for plasmid DNA. Guaranteed for fluorescent sequencing. Cat.#: A1330 (50 preps) Cat.#: A1460 (250 preps) Protocol: www.promega.com/tbs/tb225/tb225.html
0356VA04_3A
Select recombinants by
ori
35
Cloning PCR DNA

Xmn I 2009 Sca I 1890 f1 ori Amp r Nae I 2707
pGEM-T Easy Vector

(3015bp)
lacZ
T
T7 1 start Apa I 14 Aat II 20 Sph I 26 BstZ I 31 Nco I 37 BstZ I 43 Not I 43 Sac II 49 EcoR I 64 Spe I 70 EcoR I 77 Not I 77 BstZ I 88 Pst I 90 Sal I 97 Nde I 109 Sac I Bst X I 118 127 Nsi I 141 SP6
pGEM-T Easy Vector System I (you supply the competent cells) Cat.#: A1360 (20 reactions) pGEM-T Easy Vector System II (supplied with High Efficiency JM109 Competent Cells) Cat.#: A1380 (20 reactions) Protocol: www.promega.com/tbs/tm042/tm042.html Citations for use of the pGEM-T Easy System online at: www.promega.com/citations/ For maximum subcloning efficiency, purify the PCR product before subcloning. The presence of PCR primers and primer-dimers can reduce subcloning efficiency. See Chapter 3 for more information. If you do not purify your PCR product, at least make the amplification as specific as possible. The cleaner the product, the better the ligation efficiency. Try to avoid production of primer-dimers by optimizing the amplification reaction conditions. See Chapter 2 for more information on optimizing PCR.
1473VA05_6A
ori
Drop out your insert with a single Bst Z I,
Eco R I or Not I digest.
Sequence inserts with: SP6 Promoter Primer T7 Promoter Primer pUC/M13 Forward Primer pUC/M13 Reverse Primer
450 400 350
Number of White Colonies
300 250 200 150 100 50

4019MA03_3A
For maximum efficiency, use competent cells capable of at least 1 x 108cfu/g DNA.
Example of Transformation Efficiency Calculation: After 100l competent cells are transformed with 0.1ng uncut plasmid DNA, the transformation reaction is added to 900l of SOC medium (0.1ng DNA/ml). A 1:10 dilution with SOC medium (0.01ng DNA/ml) is made, and 100l is plated on each of two plates (0.001ng DNA/100l). If 200 colonies are obtained (average of two plates), what is the transformation efficiency? 200cfu 1ng = 2 108 cfu/g DNA 0.001ng 103g
0 0 2 4 6 8 10 12 14 16
Hours
Relationship between incubation time and cloning efficiency using the 2X Rapid Ligation Buffer and the pGEM-T Easy Vector. The Control Insert DNA supplied with the pGEM-T Easy Vector was ligated into the vector using a 1:1 vector:insert molar ratio. The Rapid Ligation Buffer and T4 DNA Ligase were used in ligation reactions, which were set up at room temperature (24C) and allowed to proceed from 0.25 to 16 hours. Number of white colonies (transformants) versus time of ligation are shown. This graph was adapted from Table 2 in Frackman, S. and Kephart, D. (1999) Rapid Ligation for the pGEM-T and pGEM-T Easy Vector Systems. Promega Notes 71, 810.
36
Cloning PCR DNA

pTARGET Mammalian Expression Vector System
The pTARGET Mammalian Expression Vector(i,j) is designed to streamline your experiments, allowing you to go from PCR and T-vector cloning directly to expression analysis in a mammalian system. The pTARGET Vector is based on the popular pCI-neo Vector(h,j) (Cat.# E1841) and delivers powerful mammalian expression through the CMV promoter. The vector also has the neomycin resistance necessary for G-418 Sulfate selection of stable transformants. The pTARGET Vector is the only mammalian expression T-vector offering blue/white selection of recombinants. The vector contains the lacZ -peptide fragment to complement the -fragment of lacZ that is expressed in common E. coli strains like JM109, DH5 and XL-1 Blue. See page 35 for more explanation of blue/white selection. pTARGET Mammalian Expression Vector System Cat.#: A1410 (20 reactions and 20 transformations with high-efficiency JM109 Competent Cells) Protocol: www.promega.com/tbs/tm044/tm044.html Citations for use of the pTARGET System online at: www.promega.com/citations/
malian only mam The r T-vecto ression exp white of blue/ capable g. screenin
Bgl II 5665
ori CMV Enhancer/Promoter Ampr
Sgf I 664 I-Ppo I 851
lacZ T7
Neo
lacZ
pTARGET Mammalian Expression Vector has been used for transient expression in many cell lines including: COS-1 SV40-transformed monkey kidney COS-7 SV40-transformed monkey kidney H9c2 rat myoblast McA-RH7777 rat hepatoma Primary human melanoma The pTARGET Mammalian Expression Vector has been used to create stable transfectants by G-418 Sulfate selection in many cell lines including: 1376 TCC human bladder transitional cell carcinoma 293 human embryonic kidney cell A549 human adenocarcinoma CHO Chinese hamster ovary NIH/3T3 mouse fibroblast J82 human bladder transitional cell carcinoma PS120 Chinese hamster lung fibroblast RAW264.7 mouse monocyte/macrophage cell line T24 human bladder transitional cell carcinoma U937 human leukemic cells See Promegas online citation database for further examples and details: www.promega.com/citations/
Drop out your insert
Eco R I digest.
with a single
The pTARGET Vector contains the simian virus 40 (SV40) enhancer and early promoter region upstream of the neomycin phosphotransferase gene. The SV40 early promoter contains the SV40 origin of replication, which will induce transient, episomal replication of the pTARGET Vector in cells expressing the SV40 large T antigen such as COS-1 or COS-7 cells (1). Consequently, the copy number of the vector will increase in these SV40-transformed cell lines and give higher transient expression than in other cell types.
1. Gluzman, Y. (1981) SV40-transformed simian cells support the replication of early SV40 mutants. Cell 23, 17582.
1505VA07_6A
rts with: ence inse Sequ Primer Promoter T7 pTARGET g Primer Sequencin
Intron
T
pTARGET Vector
(5670bp) SV40 Late poly (A)
EcoR I BamH I Nhe I Xho I Mlu I Sma I Kpn I Sal I Acc I Not I EcoR I
T overhangs 1293 1301 1303 1304 1311 1318
1250 1256 1264 1270 1276
Synthetic poly(A)
fl ori SV40 Enhancer/ EarlyPromoter
37
Cloning PCR DNA

A. Renilla Luciferase Activity (T.U./plate 106)
8 7 6 5 4 3 2 1 0 HeLa NIH3T3 pCI-neo pTARGET
(continued)
C.
pTARGET Mammalian Expression Vector System

B.
Human Growth Hormone Activity (ng/ml cond. medium)
140 120 100 80 60 40 20 0 HeLa NIH3T3 pCI-neo pTARGET 40 35 30 25 20 15 10 5 0 pCI-neo pTARGET
CAT Activity (CPM/plate 106)
HeLa
NIH3T3
Cells Transfected D. Firefly Luciferase Activity (T.U./plate 106)

3.5 3 2 1 0 2.5 1.5 0.5 HeLa NIH3T3 pCI-neo pTARGET
Cells Transfected E.
60 pCI-neo pTARGET
Cells Transfected
-galactosidase Activity (units/plate 10-3)
50 40 30 20 10 0
Experimental details available at: www.promega.com/pnotes/ 58/5189a/5189a.html

NIH3T3
1539MA07_6A
HeLa
Cells Transfected
Cells Transfected
Expression of various reporter proteins using either the pTARGET Mammalian Expression Vector or the pCI-neo Mammalian Expression Vector. The pTARGET Vector was designed from the pCI-neo Vector (Cat.# E1841). Vector sequences for blue/white selection do not interfere with expression. T.U. = Turner light units. Details of this experiment may be found in Brondyk, B. (1996) pTARGET Vector: A new mammalian expression T-Vector. Promega Notes 58, 27.
For expression in mammalian systems, your amplicon should contain an initiation AUG codon and a stop codon. Ideally the AUG codon is in the context of a Kozak consensus sequence: (A or G)CCAUGG (1). Be sure the initiation codon is the first AUG codon encountered in the sequence.
1. Kozak, M. (1987) At least six nucleotides preceding the AUG initiator codon enhance translation in mammalian cells. J. Mol. Biol. 196, 94750.
Learn about transfection and tools available from Promega in the Transfection Guide available online at: www.promega.com/guides/, or request literature #BR041 from your local Promega representative.
Need transfection grade plasmid DNA? Promega has the system. Wizard MagneSil Tfx System(s) For automated 96-well transfection-grade plasmid DNA purification. Cat.#: A2380 (4 96 preps) A2381 (8 96 preps) Protocol: www.promega.com/tbs/tb314/tb314.html For information on automated methods visit: www.promega.com/automethods/
4432CA
38
Cloning PCR DNA

PCR Cloning Techniques
Rapid PCR-Based Screen for Orientation of Insert
All Promega PCR cloning vectors have some unique landmarks, including RNA promoter primer binding sites allowing easy sequencing of inserts. The primer binding sites can also be used to rapidly screen for insert orientation. For example, we cloned a 1.8kb insert into the pGEM-T Easy Vector System (1). The insert could be oriented in one of two waystoward the T7 promoter or toward the SP6 promoter:
T7 Orientation T7 Primer
T7 Forward Primer 1.8kb fragment
Giving Blunt-Ended DNA an A-Tail for T-Vector Subcloning

PCR amplicons generated with proofreading polymerases like Pfu or Tli DNA Polymerase are bluntended. Promega has developed an easy method to add an A-tail to PCR products generated using these polymerases so that they will become suitable substrates for T-vector cloning. Full details of the protocol are available in the pGEM-T and pGEM-T Easy Vector Systems Technical Manual #TM042.
Start with 17l of purified PCR fragment generated by a proofreading polymerase (e.g., Pfu DNA Polymerase). Add 1l Taq DNA Polymerase 10X Reaction Buffer with MgCl2.
SP6
SP6 Orientation T7 Primer Reverse Primer

T7 1.8kb fragment
Reverse Primer SP6 Primer
Add dATP to a final concentration of 0.2mM. Add 5 units of Taq DNA Polymerase. Add deionized water to a final reaction volume of 10l. Incubate at 70C for 1530 minutes. Use 12l in a ligation reaction with Promegas pGEM-T and pGEM-T Easy Vector.
An A-tailing procedure for blunt-ended PCR fragments.
2357MA02_9A
SP6
Forward Primer
SP6 Primer
To check for orientation, we performed colony PCR with the T7 Promoter Primer and either the gene-specific forward PCR primer or reverse PCR primer. Eight white colonies with inserts were chosen from the cloning experiment for orientation analysis. Clones with the T7 orientation will produce the fragment with only the reverse PCR primer, and clones in the opposite (SP6) orientation will only produce a product with the forward PCR primer as illustrated below.
T7 + For.
bp M 1 2 3 4
2574MB02_9A
T7 + Rev.
1 2 3 4
2,645 1,605 1,198 676 517 222

2575TA02_9A
Ends Left by Various Thermostable Polymerases. Taq DNA Polymerase 3A overhang* GoTaq DNA Polymerase 3A overhang* Tfl DNA Polymerase 3A overhang* Tth DNA Polymerase 3A overhang* Pfu DNA Polymerase Blunt Tli DNA Polymerase Blunt Long PCR mixes Blunt Proofreading Polymerases Blunt
* All bases may be found at 3 overhang. A tends to occur most often.
Colony PCR. Colonies were suspended in 50l sterile water, boiled for 10 minutes, centrifuged at 16,000 g for 5 minutes, and 5l of the supernatant was used in each amplification. The DNA was amplified by PCR in 50l volumes with 50pmol of each primer and 1.25 units of Promegas Taq DNA Polymerase (Cat.# M1661). After an initial denaturation of 2 minutes at 94C, the amplification profile was 35 cycles of denaturation (94C for 30 seconds), annealing (55C for 1 minute) and extension (72C for 2.5 minutes); PCR was concluded with 1 cycle of 72C for 10 minutes. Amplification products (8l) were analyzed on a 1% agarose gel containing ethidium bromide.
For more information and techniques Promega's Frequently Asked Questions on the T-vector cloning systems at: www.promega.com/faq/ for cloning PCR DNA, check out
Reference
1. Knoche, K. and Kephart, D. (1999) Cloning blunt-end Pfu DNA polymerasegenerated PCR fragments into pGEM-T Vector Systems. Promega Notes 71, 1013.
39
Cloning PCR DNA

PCR Cloning Techniques
(continued) Interpreting Results
Results with the experimental insert look like those with the Control Insert in terms of efficiency and % white colonies. Successful experiment. Greater than 80% of the white colonies should contain inserts. Results with the experimental insert and Control Insert look like the negative control. Ligation has failed. Avoid multiple freeze/thaws of the ligation buffer. Ligase buffer contains ATP and could be damaged by freeze-thaws. You may need to aliquot the ligase buffer into useful portions for your experimental needs. Few/No colonies with experimental insert, Control Insert or negative control. Transformation has failed. Reassess the competent cells with an intact, supercoiled plasmid and determine the transformation efficiency. Use cells >1 108cfu/g to insure >100 colonies from the Control Insert ligation. Experimental insert gives more blue colonies than the Control Insert or negative control and less white colonies than the Control Insert. In-frame insertion with no interruption of the -fragment. Although the pGEM-T Vector Control Insert will produce recombinants that generate white colonies, the insertion of other DNA fragments into the lacZ coding sequence may not result in white colonies unless the fragments disrupt the lacZ reading frame. Although this tends to occur most frequently with PCR products of 500bp or less, inserts of up to 2kb have been reported to result in blue colonies. Moreover, some insert DNAs can also give pale blue colonies or bulls eye colonies that have a blue center and a white perimeter. In one case, we found that a 1.8kb insert produced white colonies when oriented in one direction and bulls eye colonies when oriented in the opposite direction (1).
1. Knoche, K. and Kephart, D. (1999) Cloning blunt-end Pfu DNA polymerase-generated PCR fragments into pGEM-T Vector Systems. Promega Notes 71, 1013.
What PCR Cloning Controls Can Do For You

Each Promega PCR cloning system is provided with a Control Insert. The ligation and subsequent transformation of the Control Insert can give you a lot of information about your ligation and transformation reactions. The total number of blue colonies in Control Insert and no-insert controls should be approximately equal. The negative control may have some white colonies. Typical PCR Cloning Results Using pGEM-T Easy Vector and JM109 Competent Cells (1.5 108 cfu/ng DNA). Efficiency % White (cfu/ng DNA) Colonies Control Insert 1,110 92% Control Insert 1,125 92% No insert 92 0% No insert 109 0%
Ligations performed at room temperature for 1 hour.
Bacterial Plates for Blue/White Selection

LB medium (per liter) 10g Bacto-tryptone 5g Bacto-yeast extract 5g NaCl Adjust pH to 7.0 with NaOH. Ampicillin Stock Solution Dissolve at 50mg/ml in water. Filter sterilize. Store in aliquots at 20C IPTG stock solution (0.1M) 1.2g IPTG (Cat.# V3951) Add water to 50ml final volume. Filter-sterilize and store at 4C. X-Gal (2ml) 100mg X-Gal (Cat.# V3941) Dissolve in 2ml N,N-dimethyl-formamide. Cover with aluminum foil and store at 20C. LB plates with ampicillin/IPTG/X-Gal Add 15g agar to 1 liter of LB medium. Autoclave. Allow the medium to cool to 50C before adding ampicillin to a final concentration of 100g/ml, then supplement with 0.5mM IPTG and 80g/ml X-Gal and pour the plates. Pour 3035ml of medium into 85mm petri dishes. Let the agar harden. Store at 4C for up to 1 month or at room temperature for up to 1 week.
40
Cloning PCR DNA

Basic Subcloning
Product
pGEM-T Vector System I(h,i) pGEM-T Vector System II(h,i) pGEM-T Easy Vector System I(h,i) pGEM-T Easy Vector System II(h,i)
For Laboratory Use. pGEM-T and pGEM-T Easy Vector Systems I do not include competent cells. With System II, competent cells are provided.
20 reactions 20 reactions 20 reactions 20 reactions
Size
Cat.#
A3600 A3610 A1360 A1380

Product
pTARGET Mammalian Expression Vector System(i,j)
Competent Cells provided.
20 reactions
Size
Cat.#
A1410
Primers
Product
T7 Promoter Primer (10g/ml)[5-d(TAATACGACTCACTATAGGG)-3] SP6 Promoter Primer (10g/ml) [5-d(TATTTAGGTGACACTATAG)-3] pUC/M13 Forward Primer (10g/ml) [5-d(CGCCAGGGTTTTCCCAGTCACGAC)-3] pUC/M13 Reverse Primer (10g/ml) [5-d(TCACACAGGAAACAGCTATGAC)-3] pTARGET Sequencing Primer (10g/ml) [5-d(TTACGCCAAGTTATTTAGGTGACA)-3] PinPoint Vector Sequencing Primer [5-d(CGTGACGCGGTGCAGGGCG)-3]
Size
2g 2g 2g 2g 2g 2g
Cat.#
Q5021 Q5011 Q5601 Q5421 Q4461 V4211
DNA Purification Systems

Product
Wizard Plus SV Minipreps DNA Purification System(q,r)* Wizard MagneSil Tfx System(s)
(Automated transfection-grade plasmid purification.) *For Laboratory Use.
50 preps 250 preps 4 96 preps 8 96 preps
Size
Cat.#
A1330 A1460 A2380 A2381
41
Cloning PCR DNA

Accessory Products
Product
Select96 Competent Cells (Single aliquot competent cells, use 1 to 96 at a time, >1 108 cfu/g DNA) 1 96 preps JM109 High Efficiency Competent Cells (108cfu/g)* (Packaged 5 200l; use 50l per transformation >1 108 cfu/g DNA) 1ml IPTG, Dioxane-Free 5g 50g X-Gal (50mg/ml) 100mg Antibiotic G-418 Sulfate (potency >500g/mg) 100mg 1g 5g Antibiotic G-418 Sulfate Solution (potency 4060mg/ml) 20ml
Size
Cat.#
L3300 L2001 V3951 V3953 V3941 V7981 V7982 V7983 V8091
Transfection Reagents
Product
TransFast Transfection Reagent(t) Tfx-10 Reagent(u) Tfx-20 Reagent(u) Tfx-50 Reagent(u) 1.2mg 9.3mg 4.8mg 2.1mg
Size
Cat.#
E2431 E2381 E2391 E1811
42
DNA Analysis Tools

Benchtop DNA Markers
Ready-to-load markers premixed with Promegas Blue/Orange Loading Dye. The markers are stable at room temperature so you can store them on your bench top!
bp 2,645 bp 1,353 1,078 872 603 676 517 460 396 350 222 179 126 75/65 [51,36] 1,605 1,198 bp 10,000 8,000 6,000 5,000 4,000 3,000 2,500 2,000 1,500 1,000 750 500 250,253 bp
1,000 750 500 300 150 50
Read y-toload mark ers y ou sto on yo re ur be nch t op
310 281/271 234 194 118 72
2% agarose
2% agarose
2% agarose
0.7% agarose
BenchTop X174 DNA/Hae III Markers Cat.# G7511 Load 5l/lane
BenchTop DNA Markers Cat.# G7521 Load 5l/lane
pGEM
BenchTop PCR Markers Cat.# G7531 Load 6l/lane
BenchTop 1kb DNA Ladder Cat.# G7541 Load 6l/lane
Ladders and Digest Markers
Promegas ladders and digest markers allow you to choose the markers you want, mix and load as much as you wish. Each marker comes with a tube of Blue/Orange Loading Dye, 6X for both the marker and your samples.
bp bp 1,353 1,500 1,000 900 800 700 600 800 750 700 650 600 550 500 450 400 350 300 250 200 150 100 50 100
2054TA02_8A 2053TA02_8A 0973TC03_5A
1,078 872 bp bp 23,130 9,416 10,000 8,000 6,000 5,000 4,000 3,000 2,500 2,000 1,500 1,000 750 500 250,253
1258TB09_5A 1238TA09_5A
bp bp
603
500 400 300
300 275 250 225 200 175 150 125 100 75 50 25
6,557 4,361 310 281 271
200
2,322 2,027 [564, 125]
234 194
118 [72]
2% agarose/TAE
2% agarose/TAE
2% agarose
0.7% agarose
0.7% agarose
8% acrylamide
25bp DNA Step Ladder Cat.# G4511 Load 5l/lane
50bp DNA Step Ladder Cat.# G4521 Load 5l/lane
100bp DNA Ladder Cat.# G2101 Load 5l/lane
1kb DNA Ladder Cat.# G5711 Load 5l/lane
Lambda DNA/ Hind III Markers Cat.# G1711 Load 1l/lane
X174 DNA/Hae III Markers Cat.# G1761 Load 1l/lane
43

Dna

Transféré par

Informations du document

Description originale:

Copyright

Formats disponibles

Partager ce document

Partager ou intégrer le document

Options de partage

Avez-vous trouvé ce document utile ?

Ce contenu est-il inapproprié ?

Droits d'auteur :

Formats disponibles

Dna

Transféré par

Droits d'auteur :

Formats disponibles

DNA Analysis

Cloning PCR DNA

DNA Analysis Tools

Genomic DNA Purification

Buffy coat or white blood c ells? Use cu lt cells p ured rotocol s.

Promega DNA Analysis Notebook

MagneSil ONE, Fixed Yield Blood Genomic System

MagneSil Blood Genomic, Max Yield System

MagneSil KF, Genomic System

Wizard Genomic DNA Purification Kit

Genomic DNA Purification

Wizard SV 96 Genomic DNA Purification System

Wizard SV Genomic DNA Purification System

Wizard Genomic DNA Purification Kit

You supply lyticase and 50mM EDTA

You supply lysozyme and/or lysostaphin

Gb = Gigabases (1 109). Mb = Megabases (1 106).

Wizard Genomic DNA Purification Kit

Genomic DNA Purification

Requires a 96-well grinding apparatus

Requires liquid nitrogen, mortar & pestle

Wizard Magnetic 96 DNA Plant System

Wizard Genomic DNA Purification Kit

Promega DNA Analysis Notebook

Genomic DNA Purification

Overnight proteinase K digestion

Overnight proteinase K digestion

Wizard SV 96 Genomic DNA Purification System

Wizard SV Genomic DNA Purification System

Wizard Genomic DNA Purification Kit

ne No Xyle for required ation! araffiniz dep

MagneSil Genomic, Fixed Tissue System

Genomic DNA Purification

Promega DNA Analysis Notebook

Genomic DNA Purification

Vacuum Adapter (Cat.# A1331)*

Vac-Man Laboratory Vacuum Manifold (Cat.# A7231)*

Genomic DNA Purification

Average Yield (g)

Mouse Tail Clippings Water Only

into turns Robot nomic a ge ication purif DNA hine! mac

Promega DNA Analysis Notebook

Genomic DNA Purification

Purify u p to _ 4 > g gDNA f rom 20 0l whole b lood.

gDNA ify ~1g Pur 60l rom 50 f lood. whole b

Genomic DNA Purification

MagneSil KF, Genomic System

MagneSil KF, Genomic System

Cat.#: MD1460 (200 preps) Protocol: www.promega.com/tbs/tb322/tb322.html

926 base Size Marker

972 base Amelogenin Fragment

Thermo Electron KingFisher mL tube strips

1,000l Salt Wash, Blood

1,000l Alcohol Wash, Blood

1,000l Alcohol Wash, Blood

200l NucleaseFree Water

APC 1.8Kb Fragment

800l Lysis Buffer, KF

lity -qua lex ultip om M A fr gDN issue t fixed

25 m inutes from start to fin ish fo r 115 sample s

Promega DNA Analysis Notebook

Genomic DNA Purification

Genomic DNA Purification