Yeast Diversity and Persistence in Botrytis-Affected Wine Fermentations

David A. Mills, Eric A. Johannsen and Luca Cocolin Appl. Environ. Microbiol. 2002, 68(10):4884. DOI: 10.1128/AEM.68.10.4884-4893.2002.

Updated information and services can be found at: http://aem.asm.org/content/68/10/4884 Downloaded from http://aem.asm.org/ on April 6, 2012 by guest These include:
REFERENCES

This article cites 31 articles, 9 of which can be accessed free at: http://aem.asm.org/content/68/10/4884#ref-list-1 Receive: RSS Feeds, eTOCs, free email alerts (when new articles cite this article), more

CONTENT ALERTS

Information about commercial reprint orders: http://aem.asm.org/site/misc/reprints.xhtml To subscribe to to another ASM Journal go to: http://journals.asm.org/site/subscriptions/

APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Oct. 2002, p. 48844893 0099-2240/02/$04.00 0 DOI: 10.1128/AEM.68.10.48844893.2002 Copyright 2002, American Society for Microbiology. All Rights Reserved.

Vol. 68, No. 10

Yeast Diversity and Persistence in Botrytis-Affected Wine Fermentations

David A. Mills,* Eric A. Johannsen, and Luca Cocolin
Department of Viticulture and Enology, University of California, Davis, California 95616-8749
Received 11 February 2002/Accepted 25 June 2002

Culture-dependent and -independent methods were used to examine the yeast diversity present in botrytisaffected (botrytized) wine fermentations carried out at high ( 30C) and ambient ( 20C) temperatures. Fermentations at both temperatures possessed similar populations of Saccharomyces, Hanseniaspora, Pichia, Metschnikowia, Kluyveromyces, and Candida species. However, higher populations of non-Saccharomyces yeasts persisted in ambient-temperature fermentations, with Candida and, to a lesser extent, Kluyveromyces species remaining long after the fermentation was dominated by Saccharomyces. In general, denaturing gradient gel electrophoresis proles of yeast ribosomal DNA or rRNA amplied from the fermentation samples correlated well with the plating data. The direct molecular methods also revealed a Hanseniaspora osmophila population not identied in the plating analysis. rRNA analysis also indicated a large population (>106 cells per ml) of a nonculturable Candida strain in the high-temperature fermentation. Monoculture analysis of the Candida isolate indicated an extreme fructophilic phenotype and correlated with an increased glucose/fructose ratio in fermentations containing higher populations of Candida. Analysis of wine fermentation microbial ecology by using both culture-dependent and -independent methods reveals the complexity of yeast interactions enriched during spontaneous fermentations. Numerous studies have examined the succession of yeasts and bacteria that occurs during the fermentation of nonsterile musts (15, 16). In general, yeasts predominate during the alcoholic fermentation, where the low pH and nutritional content of the juice select for yeast growth. Several aspects of the microbial ecology present in wine fermentations warrant investigation. Foremost is the fact that indigenous non-Saccharomyces yeasts and indigenous bacteria are potential causes of stuck and sluggish wine fermentations (3). Winemakers often increase this possibility by seeking to reduce the overall amount of the sulfur dioxide (SO2) used in winemaking, which is employed, in part, to eliminate indigenous microbial populations. In addition, there has been a renewed interest in dening the microbial dynamics of spontaneous (uninoculated) fermentations in order to better understand and control fermentation behavior and its subsequent impact on wine avor (13). Recently several groups have examined various non-Saccharomyces yeasts as potential adjuncts (or alternatives) to Saccharomyces cerevisiae in an effort to modify wine avor and improve product quality (23, 24, 36). A diverse population of yeasts, including species of Hanseniaspora (anamorph Kloeckera), Metschnikowia, Candida, Pichia, and Kluveromyces, are often present in the initial stages of most wine fermentations (16). These non-Saccharomyces yeasts typically grow for several days before the fermentation is dominated by one or more S. cerevisiae strains and a concurrent increase in ethanol concentration occurs (4). Candida and Hanseniaspora species have been shown to persist throughout
* Corresponding author. Mailing address: Department of Viticulture and Enology, University of California, Davis, One Shields Ave., Davis, CA 95616-8749. Phone: (530) 754-7821. Fax: (530) 752-0382. E-mail: damills@ucdavis.edu. Present address: Department of Food Science, University of Udine, 33100 Udine, Italy. 4884

Downloaded from http://aem.asm.org/ on April 6, 2012 by guest

wine fermentations, albeit at a lower level than S. cerevisiae strains (26, 27). Growth or persistence of individual yeast species within wine fermentations is most likely determined by differential sensitivities to temperature, ethanol, and sulfur dioxide as well as a number of other factors (15). Lower fermentation temperatures (between 10 and 20C) have been shown to encourage growth and/or persistence of Kloeckera and Candida species (25), most likely due to increased ethanol tolerance of these yeasts at lower temperatures (20). Recently, Kloeckera and Candida were shown to possess growth rates comparable to that of S. cerevisiae at lower temperatures (10C) (7). Sweet white wines are commonly made from grapes infected with Botrytis cinerea (noble rot). Infection of the grape with B. cinerea results in concentration of grape sugar, which gives must from botrytis-affected (botrytized) grapes a characteristically high initial sugar content. Relatively few studies have examined the microbial diversity within botrytis-affected wine fermentations. Most have noticed a signicant increase in weakly fermentative yeast (such as Kloeckera and Candida species) and acetic acid bacterial populations compared to those in fermentations of non-botrytis-affected musts (12, 18, 28). During the fermentation of botrytis-affected musts, the indigenous bacteria and non-Saccharomyces yeast populations decrease as Saccharomyces species dominate (18, 28). By their nature sweet wines possess residual sugar, and thus fermentations are prematurely stopped, often by judicious use of SO2. Recently the production of gluconic acid, 5-oxofructose, and dihydroxyacetone by the acetic acid bacteria in botrytis-affected musts was shown to reduce the effective concentration of SO2, making these wines more difcult to stabilize against further microbial growth (2). Relatively few studies have employed direct (culture-independent) methods for determination of viable yeast and bac-

VOL. 68, 2002

YEAST ECOLOGY IN BOTRYTIZED WINE FERMENTATIONS

4885

terial populations. Most have developed PCR or probe techniques to directly assay wine samples for specic bacterial or yeast populations (21, 37, 38). Millet and Lonvaud-Funel (31) employed epiuorescence to directly identify viable but nonculturable bacterial populations in wine. Given that persistence of metabolically active but nonculturable populations of yeasts in wine fermentations may affect fermentation performance (as well as nal product avor), a better understanding of these populations is critical. We have previously developed methods for direct analysis of yeasts present in wine fermentations by using denaturing gradient gel electrophoresis (DGGE) of ribosomal DNA (rDNA) amplicons (10, 11). In this work both culture-dependent (plating) and culture-independent (PCRDGGE and reverse transcription-PCR [RT-PCR]DGGE) methods were employed in order to characterize the impact of temperature on the yeast diversity in commercial sweet white wine fermentations.
MATERIALS AND METHODS Wine fermentations. Dolce wine fermentations (Dolce Winery, Oakville, Calif.) were carried out with 1999 Napa Valley Semillon grape juice. Grapes were spray inoculated with a stock B. cinerea strain (anamorph of Botryotinia fuckeliana) approximately 35 days prior to harvest. Vino Super liquid pectinase (DSM Food Specialties, Delft, The Netherlands) at 34 ml/ton and Color Pre (Scott Labs, Petaluma, Calif.) at 73 ml/ton were added to the press pan. After pressing, the juice was claried with polyvinyl polypyrrolidone (International Specialty Products, Wayne, N.J.) at 0.25 lb/1,000 gal and Bentonite (Great Western Chemicals, Bakerseld, Calif.) at 8 lb/1,000 gal. The juice was treated with 300 mg of lysozyme (Scott Labs) per liter and potassium metabisulte to achieve 94 mg of SO2 per liter. A total of 3.3 g of tartaric acid per liter was added to adjust the pH. The pH and titratable acidity of the juice after pressing were 3.57 and 6.3 g/liter, respectively. Dolce fermentations were carried out by indigenous yeasts in four new French oak barrels (Seguin-Moreau Cooperage, Napa, Calif.). Two of the barrels were held at ambient cellar temperature (approximately 18C). Two barrels were radiantly heated until the temperature of the fermenting juice reached 28C. Samples were aseptically removed from each barrel immediately following batonage. One milliliter of each sample, in duplicate, was centrifuged at 2,000 g for 5 min, washed in 1 ml of 4C water, recentrifuged at 2,000 g for 5 min, and frozen at 50C for later PCR-DGGE analysis. Cell pellets used for RT-PCRDGGE analysis were immersed in 300 l of RNAlater (Ambion Inc., Austin, Tex.) prior to freezing. One milliliter of each sample was sterile ltered through a 0.45- m-pore-size Millex-HV lter (Millipore S.A., Molsheim, France) and frozen at 50C for later high-pressure liquid chromatography (HPLC) analysis. Aseptic measurements of wine temperature, air temperature, and densitometric soluble solids were performed daily on one barrel from each treatment. Monoculture fermentations of S. cerevisiae and Candida sp. strain EJ1 were carried out in 250 ml of Chardonnay juice which was sterile ltered through a 0.45- m-pore-size Millex-HV lter. Fermentations were initiated with a 0.1% inoculation. One-milliliter samples were removed daily, sterile ltered through a 0.45- m-pore-size Millex-HV lter, and frozen at 20C for later analysis. Microbiological characterization. Samples were plated in duplicate on Wallerstein laboratory nutrient agar (WLN) and lysine medium agar (LM) (Difco Laboratories, Detroit, Mich.). Colony morphotypes were differentiated visually as described previously (6) and counted. Several isolates (n 6 to 8) of each colony morphotype were saved at 4C for sequence analysis and to serve as DGGE controls. Nucleic acid extraction. For the DNA preparation, the cell pellet samples were resuspended in 1 ml of an 8-g/liter NaCl solution and transferred to a microcentrifuge tube containing 0.3 g of 0.5-mm-diameter glass beads (BioSpec Products Inc., Bartlesville, Okla.). The cell-bead mixture was centrifuged at 11,600 g for 10 min at 4C, and the supernatant was discarded. The cell-bead mixture was resuspended in 300 l of breaking buffer (2% Triton X-100, 1% sodium dodecyl sulfate, 100 mM NaCl, 10 mM Tris [pH 8], 1 mM EDTA [pH 8]) and 300 l of phenol-chloroform-isoamyl alcohol (50:48:2). The cells were then homogenized in a bead beater instrument (Fast Prep; Bio 101, Vista, Calif.) three times for 45 s each at a speed setting of 4.5. The mixture was then centrifuged at 11,600 g for 10 min at 4C, and the aqueous phase was removed to another micro-

centrifuge tube. The DNA was then further puried by using the DNeasy Plant minikit (Qiagen, Valencia, Calif.) according to the manufacturers instructions. RNA was extracted by using the Concert Plant RNA reagent (Invitrogen, Carlsbad, Calif.). The cell pellet was resuspended in 500 l of the reagent and vortexed at maximum speed for 30 s. After 5 min at room temperature, the suspension was centrifuged at 11,600 g for 2 min and the supernatant was transferred to a new microcentrifuge tube. One hundred microliters of 5 M NaCl and 300 l of chloroform were added, vortexed, and centrifuged at 11,600 g for 10 min at 4C, and the aqueous phase was removed to another microcentrifuge tube. RNA was precipitated with 500 l of isopropanol and centrifugation at 11,600 g for 10 min at 4C. The RNA pellet was rinsed with 70% ice-cold ethanol, dried under vacuum at room temperature, and resuspended in 50 l of RNase-free water. RNA samples were treated with RNase-free DNase (Roche Diagnostics, Indianapolis, Ind.) at 37C for a minimum of 1 h to remove coextracted DNA. PCR amplication. For colony morphotype identication, the D1-D2 region of the 26S rRNA gene was amplied by PCR with primer NL1 (5 -CGCCCGC CGCGCGCGGCGGGCGGGGCGGGGGCCATATCAATAAGCGGAGGA AAAG-3 ) (the GC clamp sequence is underlined) and the reverse primer NL4 (5 -GGTCCGTGTTTCAAGACGG-3 ) (29). Colony PCR was performed in a nal volume of 100 l containing 10 l of 10 PCR buffer (Promega Corp., Madison, Wis.); 1.5 mM MgCl2; 0.1 mM (each) dATP, dCTP, dGTP, and dTTP; 0.1 mM primers; 1.25 U of Taq DNA polymerase (Promega); and approximately 1 mg of whole yeast cells. The reactions were run for 30 cycles; denaturation was at 95C for 60 s, annealing was at 52C for 45 s, and extension was at 72C for 60 s. An initial 5-min denaturation at 95C and a nal 7-min extension at 72C were used. For DGGE analysis of fermentation samples, primers NL1 and LS2 (5 -ATTCCCAAACAACTCGACTC-3 ) (10) were used for PCR amplication. PCR was performed in a nal volume of 50 l containing 5 l of PCR buffer; 2.0 mM MgCl2; 0.2 mM (each) dATP, dCTP, dGTP, and dTTP; 0.2 mM primers, 1.25 U of Taq DNA polymerase (Promega); and 2 l of the extracted DNA (approximately 20 ng). The reactions were run for 30 cycles; denaturation was at 95C for 60 s, annealing was at 52C for 45 s, and extension was at 72C for 60 s. An initial 5-min denaturation at 95C and a nal 7-min extension at 72C were used. RT-PCR was performed with RevertAid Moloney murine leukemia virus reverse transcriptase (Promega). One microliter of total RNA (approximately 0.1 g) was mixed in 10 l of DNase- and RNase-free sterile water containing 0.5 g of primer LS2 and incubated at 70C for 5 min. Immediately after chilling in ice, a mixture of 25 mM Tris-HCl (pH 8.3), 25 mM KCl, 2 mM MgCl2, 5 mM dithiothreitol, a 1 mM concentration of each deoxynucleoside triphosphate, and 20 U of RNase inhibitor (Roche) was transferred in the reaction tube. After 5 min at 37C, 1 l of reverse transcriptase was added, followed by incubation at 42C for 60 min and treatment at 70C for 10 min to stop the reaction. Three microliters of the synthesized cDNA was used for the PCR as described previously. Products were analyzed by standard agarose gel electrophoresis (1), stained with 0.5 g of ethidium bromide per ml, visualized under UV transillumination, and photographed with a Multimage light cabinet (Alpha Innotech Corporation, San Leandro, Calif.). DGGE analysis. The DCode universal mutation detection system (Bio-Rad, Hercules, Calif.) was used for sequence-specic separation of PCR products and for the comparison of migrations of isolate PCR products. PCR samples were applied directly onto 8% (wt/vol) polyacrylamide gels in a running buffer containing 40 mM Tris-acetate2 mM Na2EDTA H2O (pH 8.5) (TAE) and a denaturing gradient from 20 to 60% of urea and formamide. The electrophoresis was performed at a constant voltage of 120 V for 6 h with a constant temperature of 60C. After electrophoresis, the gels were stained in 1.25 TAE containing SYBR Gold (reconstituted according to the directions of the manufacturer [Molecular Probes, Eugene, Oreg.]) and photographed under UV transillumination. Bands of interest were excised directly from the gels by using a sterile blade, mixed with 40 l of water, and incubated overnight at 4C. Two microliters of this solution was used to reamplify the PCR product with the NL1-LS2 primer pair (11). RNA hybridization. A probe specic to Candida sp. strain EJ1 was generated by amplifying a portion of the D2 region of the 26S rDNA gene with the universal primer NL1 (29) and a primer, C1 (5 -TACCGCATTTATCTTCCCCC-3 ), internal to the 26S rRNA D1 loop of Candida sp. strain EJ1 (L. Cocolin and D. A. Mills, submitted for publication). DNA was amplied in a 50- l nal volume containing 10 mM Tris-HCl (pH 8), 50 mM KCl, 1.5 mM MgCl2, 0.2 mM deoxynucleoside triphosphates, 0.2 M primers, 1.25 U of Taq polymerase (Promega), and 5 l of extracted Candida sp. strain EJ1 DNA (about 10 to 50 ng of total DNA). The PCR cycle parameters were 30 cycles of denaturation at 95C for 1 min, annealing at 60C for 45 s, and extension at 72C for 1 min. An initial denaturation at 95C for 5 min and a nal extension at 72C for 7 min were also

Downloaded from http://aem.asm.org/ on April 6, 2012 by guest

4886

MILLS ET AL.

APPL. ENVIRON. MICROBIOL.

Downloaded from http://aem.asm.org/ on April 6, 2012 by guest

FIG. 1. Yeast, chemical, and temperature proles for the Dolce fermentation carried out at ambient temperature. Fermentations were carried out in duplicate barrels, and a representative data set is shown.

FIG. 2. Yeast, chemical, and temperature proles for the Dolce fermentation carried out at high temperature. Fermentations were carried out in duplicate barrels, and a representative data set is shown.

used. The amplied product (156 bp) was labeled by incorporating digoxigeninUTP (Roche) into the PCR mixture as described by the manufacturer. A total of 1 g of RNA puried from select fermentation samples was applied to Zeta-probe GT membranes (Bio-Rad) by using a BioDot slot blot apparatus (Bio-Rad) as indicated by the manufacturer. Hybridization and detection were performed by using a digoxigenin chemiluminescence kit (Roche) as indicated by the manufacturer. Control RNA samples were puried from active cultures of S. cerevisiae and Candida sp. strain EJ1. Sequence analysis. The PCR products from the colony PCR of the isolates were puried by using a Wizard PCR purication kit (Promega) and then sent to a commercial sequencing facility (Davis Sequencing, Davis, Calif.) for sequencing. Reamplied DGGE bands were similarly puried and sequenced. Sequence compilation and comparison were performed by use of Genetics Computer Group sequence analysis software with the BLAST program. HPLC analysis. The samples and standards were run on a Hewlett-Packard 1100 series instrument with a cation H guard column, two 30-cm Aminex HPX87H columns (Bio-Rad), and a Hewlett-Packard 1047A refractive index detector. The column was eluted with 1.5 mM sulfuric acid at a ow rate of 0.6 ml/min and a column temperature of 50C. An external standard solution at three dilution levels was used. The variabilities in the fructose and glucose assays were 2.1 and 2.2%, respectively. Nucleotide sequence accession number. The partial 26S rDNA sequence of Candida sp. strain EJ1 was deposited in GenBank under accession number AY078348.

RESULTS Fermentation characteristics. There were distinct differences in fermentation characteristics for the treatments at ambient and heated temperatures (Fig. 1 and 2, respectively). Day 0 represents the day that the wine was put into barrels. The

relatively small change in wine temperature (5C) in the ambient-temperature treatment throughout the fermentation contrasted with the large change in wine temperature (15C) in the heated treatment. The rates of sugar consumption, ethanol production, and glycerol production were higher in the heated fermentations than in the ambient-temperature fermentations (Fig. 1 and 2). The average maximum rate of glucose and fructose consumption was 41 g/liter/day for the heated treatment versus 21 g/liter/day for the ambient-temperature treatment. The average maximum rate of ethanol production in the heated treatment was 19 g/liter/day, versus 8 g/liter/day in the ambient-temperature treatment, and the average maximum production rate of glycerol was 2.6 g/liter/day in the heated treatment versus 0.7 g/liter/day in the ambient-temperature treatment. Minimal differences in acetic acid formation were noted between treatments. In contrast, the relative proportions of glucose and fructose varied between the ambient-temperature and heated fermentations. At the beginning of both fermentations, the glucose/fructose ratio was 0.92, and during the maximum rate of fermentation, it approached 1.00. After 21 days, the glucose/fructose ratio in the ambient-temperature barrels was an average of 0.91, while, in the heated barrels, it was 0.71. Yeast population dynamics. In both treatments, six distinguishable yeast isolates were identied on WLN medium (6). Partial 26S rDNA sequence analysis (29) of representative

VOL. 68, 2002

YEAST ECOLOGY IN BOTRYTIZED WINE FERMENTATIONS

4887

isolates indicates the six morphotypes to be S. cerevisiae, Hanseniaspora uvarum, Pichia kluyveri, Metschnikowia pulcherrima, Kluyveromyces thermotolerans, and a Candida strain (herein called Candida sp. strain EJ1) which could not be assigned to a known species. In the early stages of the fermentations WLN medium was used for enumeration of the six morphotypes. However, as the fermentation progressed, lower populations of non-Saccharomyces species became increasingly difcult to enumerate in the presence of a high population of Saccharomyces. Therefore, at later stages in the fermentation LM (30) was also employed, starting at day 12 in the ambient-temperature treatment and day 8 in the heated treatment. Only two colony morphotypes were observed on LM at these latter stages. Representative isolates were restreaked on WLN medium. The resultant morphologies on WLN medium were shown to be consistent with Candida sp. strain EJ1 and K. thermotolerans isolates. The CFU plating results indicate some common trends among the two treatments. In all four barrels only six prominent morphotypes were identied. Moreover, within each treatment the six morphotypes reached the same approximate maximum CFU population. Several prominent differences were also observed in the plating results obtained for the two treatments (Fig. 1 and 2). As expected, Saccharomyces populations reached a maximum density of 107 CFU per ml faster in the heated treatment (5 days) than in the ambient-temperature treatment (7 days). In addition, non-Saccharomyces yeasts persisted far longer in the ambient-temperature barrel fermentations than in the heated barrel fermentations. In the ambienttemperature treatment Candida populations remained quite high, around 107 CFU per ml, for much of the fermentation (21 days) and for nearly 18 days after establishment of an equal population of Saccharomyces. A signicant drop in the Candida sp. was observed only near the end of the ambient-temperature fermentation, as the ethanol concentration progressed above 100 g/liter. Like Candida, Kluyveromyces populations persisted throughout the ambient-temperature fermentation, although they did so at a lower level (fewer than 106 CFU/ml) and dropped consistently around 3 days after the establishment of a dominant Saccharomyces population and as the ethanol concentration progressed above 60 g/liter. Several other non-Saccharomyces yeasts present in the initial stages of the ambient-temperature fermentation did not persist throughout the fermentation, including Pichia (present for 6 days), Hanseniaspora (present for 8 days), and Metschnikowia (present for 10 days) spp. The heat treatment had a signicant impact on the nonSaccharomyces yeasts, with most populations becoming undetectable on plating medium earlier than in the ambient-temperature treatment. On WLN medium, the non-Saccharomyces yeasts ceased to appear after approximately 7 days with Pichia observed for only 2 days, Hanseniaspora for 5 days, Metschnikowia for 5 days, Candida for 6 days, and Kluyveromyces for 7 days. After day 7, signicantly lower populations of Kluyveromyces and Candida were detected on LM throughout the remainder of the fermentation. With the exception of Pichia, which was eliminated earlier, the non-Saccharomyces populations in the heated fermentation rapidly decreased once a peak temperature of 30C was achieved and the ethanol concentration progressed above 50 g/liter.

PCR and RT-PCRDGGE proles. The results obtained from DGGE analysis of the ambient- and high-temperature fermentations are shown in Fig. 3 and 4, respectively. Both the RT-PCR and PCR-DGGE proles of the yeast populations roughly mirror the CFU data. DGGE bands were identied by comigration with PCR products generated from isolated strains and by direct DNA sequencing of DGGE bands. Several common trends were observed in the DGGE proles. First, the DGGE patterns clearly demonstrate the longer persistence of non-Saccharomyces yeasts in the ambient-temperature fermentation than in the heated fermentation. Second, as yeast populations fell below 104 CFU/ml, the cognate DGGE bands became faint or disappeared. This threshold is likely the result of a larger quantity of Saccharomyces DNA in these samples outcompeting the smaller amounts of template from the non-Saccharomyces yeasts for amplication of the rDNA (14). Several populations of yeasts were readily observed in the DGGE proles from day 1, including H. uvarum, Hanseniaspora osmophila, Candida sp. strain EJ1, and K. thermotolerans. A band corresponding to M. pulcherrima was not seen in DGGE gels even though the population was above 105 CFU/ ml. This is likely due to poor amplication of M. pulcherrima DNA with the NL1-LS2 primer set (data not shown). In addition, no DGGE bands corresponding to Pichia species were revealed, most likely due to the relatively low number of CFU present. A band corresponding to H. osmophila was identied even though H. osmophila was not revealed in the plating analysis. Thus, the DGGE results indicated a mixed Hanseniaspora population consisting of a minimum of two species that were not differentiated on the WLN medium. As the fermentations progressed, a band corresponding to S. cerevisiae became visible at day 3 of the heated-fermentation prole (Fig. 4) and day 5 (Fig. 3) of the ambient-temperature prole, corresponding to populations of Saccharomyces in each fermentation of between 104 and 105 CFU/ml. PCR-DGGE and RT-PCRDGGE proles clearly show Candida species persisting throughout both fermentations. Candida populations identied within previous Dolce vintages appear as a characteristic DGGE doublet (11). It remains to be determined if this doublet is the result of a PCR artifact or indicates the presence of more than one strain of Candida within Dolce fermentations. Unlike the situation with other non-Saccharomyces yeasts, Candida bands were visible in both RT-PCR and PCR-DGGE proles after CFU population levels had dropped below 104 CFU/ml. This was particularly obvious in the heated trial, where CFU populations of 102 to 103 CFU/ml resulted in clear DGGE bands. Both PCR-DGGE and RT-PCRDGGE proles indicate K. thermotolerans populations persisting throughout the ambienttemperature fermentation and nearly disappearing as the population fell below 104 CFU/ml. The cognate K. thermotolerans DGGE bands in the heated fermentation disappeared rapidly after the fermentation temperature reached 30C and after the population fell below 104 CFU/ml. Surprisingly, the PCR and RT-PCRDGGE results differed in persistence of Hanseniaspora bands. In the ambient-temperature fermentation (Fig. 3), H. osmophila bands were present in the RT-PCRDGGE sample for 21 days, while the PCR-DGGE prole indicated

Downloaded from http://aem.asm.org/ on April 6, 2012 by guest

4888

MILLS ET AL.

APPL. ENVIRON. MICROBIOL.

Downloaded from http://aem.asm.org/ on April 6, 2012 by guest

FIG. 3. DGGE analysis of 26S rDNA (PCR) or rRNA (RT-PCR) products obtained directly from the samples taken from the Dolce fermentation carried out at ambient temperature. Lane designations indicate the time of fermentation sampling (days). Bands marked with an asterisk were excised, reamplied, sequenced, and identied by sequence analysis. Abbreviations: H.u., H. uvarum; H.o., H. osmophila; K.t., K. thermotolerans; C., Candida sp. strain EJ1; S.c., S. cerevisiae.

only an H. osmophila band for 11 days. Similarly, in the hightemperature fermentation (Fig. 4), the RT-PCR results failed to reveal an H. uvarum population in the rst 4 days of the fermentation, whereas the PCR-DGGE prole clearly demonstrated an H. uvarum presence. A viable but nonculturable Candida population? One explanation for the persistence of a visible DGGE band emanating from a Candida population of below 104 CFU/ml was that a higher population of viable but nonculturable cells existed. To examine this, a specic probe was designed to the Candida sp. strain EJ1 26S rDNA sequence and used semiquantitatively in rRNA slot blot analysis. As seen in Fig. 5, RNA puried from heated fermentation samples taken on days 12, 14, 15, and 45 revealed a strong presence of Candida sp. strain EJ1 rRNA at a level higher than predicted by the CFU analysis. As a comparison, RNA isolated from 106 Candida sp. strain EJ1 cells

(determined by number of CFU) was probed, resulting in a less intense signal. These results suggest that a metabolically active population of Candida sp. strain EJ1 persists throughout the Dolce fermentation at a substantially higher level than can be revealed by plating analysis. Candida sp. strain EJ1 is extremely fructophilic. Examination of the nal fructose concentrations present in the heated and ambient-temperature fermentations suggested that the persistence of non-Saccharomyces yeasts, particularly a high population of Candida sp. strain EJ1, resulted in a lowering of the nal fructose concentration and a higher glucose/fructose ratio. Separate monoculture fermentations of the Candida sp. strain EJ1 in sterile Chardonnay juice revealed an extremely fructophilic phenotype (Fig. 6), in which no glucose was consumed even after the fructose was completely exhausted. In contrast, monoculture fermentations of the S. cerevisiae strain

VOL. 68, 2002

YEAST ECOLOGY IN BOTRYTIZED WINE FERMENTATIONS

4889

Downloaded from http://aem.asm.org/ on April 6, 2012 by guest

FIG. 4. DGGE analysis of 26S rDNA (PCR) or rRNA (RT-PCR) products obtained directly from the samples taken from the Dolce fermentation carried out at high temperature. Lane designations indicate the time of fermentation sampling (days). Bands marked with an asterisk were excised, reamplied, sequenced, and identied by sequence analysis. Abbreviations: H.u., H. uvarum; H.o., H. osmophila; K.t., K. thermotolerans; C., Candida sp. strain EJ1; S.c., S. cerevisiae.

isolated from the Dolce fermentations exhibited a clear glucophilic phenotype. Yeast diversity in inoculated Dolce fermentations. Dolce fermentations are also carried out with an S. cerevisiae starter culture inoculum. Given the strong presence of non-Saccharomyces yeasts in the uninoculated fermentations carried out at ambient temperatures, we predicted that a similar persistence of non-Saccharomyces yeasts would exist in the inoculated fermentations. Figure 7 shows a PCR-DGGE prole of select samples taken from an inoculated barrel during the 1999 Dolce fermentation. A strong DGGE band corresponding to Saccharomyces is visible early in the fermentation, as would be expected given the inoculation. DGGE bands corresponding to Hanseniaspora, Kluveromyces, and Candida populations are also observed until day 5, day 7, and day 12, respectively. The

persistence of Candida and Kluveromyces populations in inoculated Dolce fermentations mirrors the situation in uninoculated fermentations, suggesting that a large initial population of Saccharomyces does not dramatically alter the fundamental yeast dynamics present within these fermentations. DISCUSSION The presence of non-Saccharomyces yeasts in wine fermentations has been documented extensively (15, 35). The nonSaccharomyces yeasts most often associated with wine fermentations are Hanseniaspora and Candida species and, to a lesser extent, Pichia, Kluveromyces, and Metschnikowia species, among others (17). These yeasts may affect wine fermentations both directly, through production of off-avors, and indirectly

4890

MILLS ET AL.

APPL. ENVIRON. MICROBIOL.

FIG. 5. RNA slot blot with a Candida sp. strain EJ1-specic probe. (A) RNA samples extracted directly from samples taken from the Dolce fermentation carried out at high temperature. Lane designations indicate the day of fermentation sampling and the S. cerevisiae RNA and blank controls. One microgram of total RNA was blotted onto the membrane. (B) Serial dilutions of Candida sp. strain EJ1 RNA. Lane designations indicate the amount of total RNA blotted onto the membrane. (C) Total RNA puried from serial dilutions of active Candida sp. strain EJ1 cells. Lane designations indicate the total number of cells from which RNA was extracted.

Downloaded from http://aem.asm.org/ on April 6, 2012 by guest

by modulating the growth or metabolism of the dominant Saccharomyces population (4). Signicant growth of non-Saccharomyces yeasts early in fermentations has been associated with off-character production in wines and/or stuck and sluggish fermentations (3). Previous analysis of Dolce fermentations indicated a rich diversity of yeasts present in the initial stages of the fermentations (A. Heisey, personal communication). Prior PCRDGGE analysis revealed the persistence of a Candida population throughout the fermentations (11). In this work both direct molecular and indirect plating methods were employed to characterize the diversity within ambient-temperature ( 20C) and transiently heated ( 30C) Dolce fermentations. In both trials similar arrays of yeast genera were observed. Saccharomyces, Hanseniaspora, Pichia, Metschnikowia, Kluyveromyces, and Candida species were present at similar levels in the initial stages of both fermentations. While the initial population size of Candida was high (106 to 107 CFU/

ml) for both fermentations, it was similar to those of nonSaccharomyces yeast populations observed in other botrytisaffected wine fermentations (18). As expected, Saccharomyces dominated both ambient-temperature and heated fermentations. Moreover, Candida and Kluyveromyces populations grew slightly and persisted at detectable levels throughout both fermentations. C. stellata and K. thermotolerans have been ob-

FIG. 6. Glucose and fructose consumption curves for fermentations of S. cerevisiae and Candida sp. strain EJ1 in sterile Chardonnay juice.

FIG. 7. DGGE analysis of 26S rDNA (PCR) products obtained directly from the samples taken from the Dolce fermentation inoculated with an S. cerevisiae starter culture. Lane designations indicate the time of fermentation sampling (days). Abbreviations: H.u., H. uvarum; K.t., K. thermotolerans; C., Candida sp. strain EJ1; S.c., S. cerevisiae.

VOL. 68, 2002

YEAST ECOLOGY IN BOTRYTIZED WINE FERMENTATIONS

4891

served to persist in a similar fashion in some Majorcan wine fermentations (32). Given the strong persistence of the nonSaccharomyces yeasts in the uninoculated Dolce fermentation, it is not surprising to nd a similar persistence within inoculated fermentations (Fig. 7). This work clearly demonstrates the impact that fermentation temperature has on growth of non-Saccharomyces yeasts. In the heated fermentations, most non-Saccharomyces populations disappeared dramatically as assessed by both direct molecular and CFU plating analyses. The most obvious explanation for the decrease in non-Saccharomyces yeasts in the heated trials is the combination of higher temperatures and ethanol (5). Alternatively, the non-Saccharomyces yeasts might not have been able to adapt as quickly to the more rapid increase in ethanol concentration in the heated fermentations compared to a more gradual ethanol production witnessed in the ambient-temperature trial. Regardless, the detrimental effect of temperature and ethanol is illustrated by a comparison of the persistence of Candida populations in both trials. In the heated barrels the Candida CFU population decreased dramatically as the temperature of the fermenting juice reached 30C and as the ethanol concentration rose above 50 g/liter. In the ambient-temperature trial, a high Candida CFU population persisted for 21 days, during which the juice temperature never rose signicantly above 20C. In that fermentation, Candida species survived ethanol concentrations of approximately 100 g/liter before a signicant decline in the number of CFU occurred. This result agrees with previous studies that demonstrated an increased tolerance of ethanol by Candida strains at lower fermentation temperatures (20). Other studies on temperature effects on non-Saccharomyces yeasts demonstrated no signicant growth rate differences between various strains of Kloeckera (Hanseniaspora), Candida, and Saccharomyces species (7). However, during the Dolce fermentations, none of the non-Saccharomyces yeast populations, in either trial, increased in population size by more than an order of magnitude (as determined by CFU per milliliter). Thus, a transient temperature increase in the heated fermentations may have affected non-Saccharomyces yeast persistence rather than growth. The extremely fructophilic nature of Candida sp. strain EJ1 suggests an additional rationale for copersistence of a Candida population with a larger Saccharomyces population in Dolce fermentations. A fructophilic Candida population would not have an impact on glucose levels consumed by a glucophilic S. cerevisiae population and therefore would not compete for substrate. An expected outcome of this apparent neutralism is a greater total consumption of fructose. This is evident in the ambient-temperature Dolce fermentation, where persistence of a higher Candida population correlated with consumption of additional fructose compared to those in the heated fermentation (Fig. 1 and 2). As the heated fermentation reached ethanol concentrations of 100 g/liter, the glucose/fructose ratio was approximately 0.71, while, at the same ethanol concentration, the ambienttemperature fermentations exhibited a much closer glucose/ fructose ratio ( 0.9). Ciani and Ferraro (8) demonstrated that mixed fermentations containing C. stellata and Saccha-

romyces exhibited more complete utilization of sugars and postulated that the cause was the preferential utilization of fructose by highly fructophilic C. stellata species. Maintenance of an optimum glucose/fructose ratio has been suggested as a cause of reduced fermentative activity in Saccharomyces (19). By selectively consuming fructose in the Dolce fermentation, the Candida population may act in a commensal fashion, aiding the overall fermentative capacity of S. cerevisiae by increasing the glucose/fructose ratio. Whether or not this potential commensalism exists, the differences in sugar utilization between Candida and Saccharomyces species illustrate a complementing aspect of indigenous yeasts that are enriched to populate uninoculated wine fermentations. Several groups have examined Candida species as potential adjuncts for avor modication of wine (8, 36). Others have noted signicant glycerol and acetic acid production by C. stellata when examined in monoculture (9, 36). In this work, the persistence of Candida populations in the ambient-temperature fermentations did not coincide with increased glycerol concentrations (Fig. 2 and 3). As both heated and ambienttemperature fermentations reached ethanol concentrations of 100 g/liter, the glycerol concentration was around 16 g/liter. Glycerol was produced more rapidly in heated fermentations; however, that increase coincided with a similarly rapid production of ethanol, suggesting that Saccharomyces was the producing microorganism. Neither heated nor ambient-temperature fermentations exhibited a dramatic difference in acetic acid concentrations. Direct molecular methods are now a commonly used tool for ecological analysis, revealing the tremendous diversity of uncultured microorganisms in various habitats (33). To date, however, relatively few studies have employed such methods to characterize the microbial ecology of food and wine fermentations (22). In this study, the use of PCRDGGE in combination with plating analysis revealed the strengths and weaknesses of the two approaches. For example, PCR-DGGE analysis revealed an additional Hanseniaspora population, H. osmophila, in the Dolce fermentations which went unnoticed in the CFU analysis. This omission was likely due to a color morphology similar to that of H. uvarum on WLN medium (both have green colonies). Interestingly, RT-PCRDGGE analysis suggests that an active H. osmophila population of greater than 104 cells per ml (the approximate PCR-DGGE detection limit in the presence of a higher Saccharomyces population [10]) was present throughout most of the ambient-temperature fermentation. RT-PCRDGGE analysis did not detect an H. uvarum population, although a slight band could be detected in the PCR-DGGE analysis. The lack of an observable H. uvarum band in the RT-PCRDGGE gel may be a result of a copy number effect, whereby the increased amount of competing yeast template rRNA in the RNA samples effectively masked an observable H. uvarum band. Neither Hanseniaspora population (H. osmophila or H. uvarum) was detected by CFU analysis in the later stages of either the ambienttemperature or heated fermentations, although a lower H. osmophila population may have been obscured in the CFU and DGGE analysis by the higher Candida population.

Downloaded from http://aem.asm.org/ on April 6, 2012 by guest

4892

MILLS ET AL.

APPL. ENVIRON. MICROBIOL.

8. Ciani, M., and L. Ferraro. 1998. Combined use of immobilized Candida stellata cells and Saccharomyces cerevisiae to improve the quality of wines. J. Appl. Microbiol. 85:247254. 9. Ciani, M., L. Ferraro, and F. Fatichenti. 2000. Inuence of glycerol production on the aerobic and anaerobic growth of the wine yeast Candida stellata. Enzyme Microb. Technol. 27:698703. 10. Cocolin, L., L. F. Bisson, and D. A. Mills. 2000. Direct proling of the yeast dynamics in wine fermentations. FEMS Microbiol. Lett. 189:8187. 11. Cocolin, L., A. Heisey, and D. A. Mills. 2001. Direct identication of the indigenous yeasts in commercial wine fermentations. Am. J. Enol. Vitic. 52:4953. 12. Doneche, B. J. 1993. Botrytized wines, p. 327351. In G. H. Fleet (ed.), Wine microbiology and biotechnology. Harwood Academic Publishers, Philadelphia, Pa. 13. Egli, C. M., W. D. Edinger, C. M. Mitrakul, and T. Henick-Kling. 1998. Dynamics of indigenous and inoculated yeast populations and their effect on the sensory character of Riesling and Chardonnay wines. J. Appl. Microbiol. 85:779789. 14. Felske, A., A. D. L. Akkermans, and W. M. DeVos. 1998. Quantication of 16S rRNAs in complex bacterial communities by multiple competitive reverse transcription-PCR in temperature gradient gel electrophoresis ngerprints. Appl. Environ. Microbiol. 64:45814587. 15. Fleet, G. H. 1997. Food fermentationswine, p. 671694. In M. P. Doyle, L. R. Beuchat, and T. J. Montville (ed.), Food microbiology: fundamentals and frontiers. ASM Press, Washington, D.C. 16. Fleet, G. H. 1998. The microbiology of alcoholic beverages, p. 217262. In B. J. B. Wood (ed.), Microbiology of fermented foods, 2nd ed., vol. 1. Blackie Academic & Professional, New York, N.Y. 17. Fleet, G. H., and G. M. Heard. 1993. Yeastsgrowth during fermentation, p. 2754. In G. H. Fleet (ed.), Wine microbiology and biotechnology. Harwood Academic Publishers, Philadelphia, Pa. 18. Fleet, G. H., S. Lafon-Lafourcade, and P. Ribereau-Gayon. 1984. Evolution of yeasts and lactic acid bacteria during fermentation and storage of Bordeaux wines. Appl. Environ. Microbiol. 48:10341038. 19. Gafner, J., and M. Schultz. 1996. Impact of glucose-fructose ratio on stuck fermentations: practical experiences to restart stuck fermentations. Vitic. Enol. Sci. 51:214218. 20. Gao, C., and G. H. Fleet. 1988. The effects of temperature and pH on the ethanol tolerance of the wine yeasts, Saccharomyces cerevisiae, Candida stellata and Kloeckera apiculata. J. Appl. Bacteriol. 65:405410. 21. Gindreau, E., E. Walling, and A. Lonvaud-Funel. 2001. Direct polymerase chain reaction detection of ropy Pediococcus damnosus strains in wine. J. Appl. Microbiol. 90:535542. 22. Giraffa, G., and E. Neviani. 2001. DNA-based, culture-independent strategies for evaluating microbial communities in food-associated ecosystems. Int. J. Food Microbiol. 67:1934. 23. Hansen, E. H., P. Nissen, P. Sommer, J. C. Nielsen, and N. Arneborg. 2001. The effect of oxygen on the survival of non-Saccharomyces yeasts during mixed culture fermentations of grape juice with Saccharomyces cerevisiae. J. Appl. Microbiol. 91:541547. 24. Heard, G. 1999. Novel yeasts in winemakinglooking to the future. Food Aust. 51:347352. 25. Heard, G. M., and G. H. Fleet. 1988. The effects of temperature and pH on the growth of yeast species during the fermentation of grape juice. J. Appl. Bacteriol. 65:2328. 26. Heard, G. M., and G. H. Fleet. 1985. Growth of natural yeast ora during fermentation of inoculated wines. Appl. Environ. Microbiol. 50:727728. 27. Heard, G. M., and G. H. Fleet. 1986. Occurrence and growth of yeast species during the fermentation of some Australian wines. Food Technol. Aust. 38:2225. 28. Joyeux, A., S. Lafon-Lafourcade, and P. Ribereau-Gayon. 1984. Evolution of acetic acid bacteria during fermentation and storage of wine. Appl. Environ. Microbiol. 48:153156. 29. Kurtzman, C. P., and C. J. Robnett. 1998. Identication and phylogeny of ascomycetous yeasts from analysis of nuclear large subunit (26S) ribosomal DNA partial sequences. Antonie Leeuwenhoek 73:331371. 30. Martin, C., and K. Siebert. 1992. Evaluation of multinitrogen source media for wild yeast detection in brewing culture yeast. Am. Soc. Brewing Chem. J. 50:134138. 31. Millet, V., and A. Lonvaud-Funel. 2000. The viable but non-culturable state of wine micro-organisms during storage. Lett. Appl. Microbiol. 30:136141. 32. Mora, J., J. I. Barbas, and A. Mulet. 1990. Growth of yeast microora during the early stages of the fermentation in inoculated Majorcan musts. Microbiologia 6:6570. 33. Pace, N. R. 1997. A molecular view of microbial diversity and the biosphere. Science 276:734740. 34. Pallman, C., J. B. Brown, T. L. Olineka, L. Cocolin, D. A. Mills, and L. F. Bisson. 2001. Use of WL medium to prole native ora fermentations. Am. J. Vitic. Enol. 52:198203. 35. Pretorius, I. S., T. J. van der Westhuizen, and O. P. H. Augustyn. 1999. Yeast

Direct analysis also demonstrated the persistence of a Candida population in the heated fermentation even though CFU analysis indicated a population level below the PCRDGGE detection threshold. This contrasted with the situation with the Kluveromyces population, which disappeared from the DGGE analysis at approximately the same time that the population fell below 104 CFU per ml (compare Fig. 2 and 4). Specic detection of the Candida population by RNA hybridization conrmed the existence of a Candida population of greater than 106 cells per ml. Previously, Millet and Lonvaud-Funel used direct epiuorescence microscopy on aging wines and observed a dramatically higher bacterial population than was revealed by plating analysis (31). This work suggests a similar situation with indigenous yeasts in the Dolce fermentation. However, it remains to be determined if the direct RNA analysis has revealed a metabolically active Candida population or a metabolically inactive Candida population in which the cellular RNA was protected from degradation (or both). Certain deciencies with PCR-DGGE methodology were also revealed in this work. Detection of a Metschnikowia population was not possible even though the CFU population determined in the initial stages of either fermentation appeared to be above the detection threshold for PCRDGGE. Amplication of the 26S rDNAs from Metschnikowia isolates obtained in this study often resulted in poor yields (data not shown), which could have resulted in an omission of Metschnikowia in DGGE proles of fermentation samples. Previous analysis of an M. pulcherrima isolate by DGGE indicated a single resolved band (10). However, recent work by Pallman et al. (34) demonstrated a diverse number of M. pulcherrima biotypes within a single commercial wine fermentation. Thus, variability within the 26S rRNA D1-D2 region may result in poor amplication of Metschnikowia rDNA by the NL1-LS2 primer pair used in this study.
ACKNOWLEDGMENTS We acknowledge Julie Schrieber for assistance with the HPLC analysis and Dirk Hampson and Ashley Heisey for assistance with the fermentations. This work was funded in part by Dolce Winery, the American Vineyard Foundation, and the California Competitive Grants Program for Research in Enology and Viticulture.
REFERENCES 1. Ausubel, F. M., R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith, and K. Struhl. 1995. Current protocols in molecular biology. Wiley, New York, N.Y. 2. Barbe, J. C., G. de Revel, A. Joyeux, A. Bertrand, and A. Lonvaud-Funel. 2001. Role of botrytized grape micro-organisms in SO2 binding phenomena. J. Appl. Microbiol. 90:3442. 3. Bisson, L. F. 1999. Stuck and sluggish fermentations. Am. J. Enol. Vitic. 50:107119. 4. Bisson, L. F., and R. E. Kunkee. 1993. Microbial interactions during wine production, p. 3768. In J. G. Zeikus and E. A. Johnson (ed.), Mixed cultures in biotechnology. McGraw-Hill, New York, N.Y. 5. Casey, G. P., and W. M. Ingledew. 1986. Ethanol tolerance in yeasts. Crit. Rev. Microbiol. 13:219280. 6. Cavazza, A., M. S. Grando, and C. Zini. 1992. Rilevazione della ora microbica di mosti e vini. Vignevini 9:1720. 7. Charoenchai, C., G. H. Fleet, and P. A. Henschke. 1998. Effects of temperature, pH, and sugar concentration on the growth rates and cell biomass of wine yeasts. Am. J. Enol. Vitic. 49:283288.

Downloaded from http://aem.asm.org/ on April 6, 2012 by guest

VOL. 68, 2002

YEAST ECOLOGY IN BOTRYTIZED WINE FERMENTATIONS

4893

biodiversity in vineyards and wineries and its importance to the South African wine industry. S. Afr. J. Enol. Vitic. 20:6174. 36. Soden, A., I. L. Francis, H. Oakey, and P. A. Henschke. 2000. Effects of co-fermentation with Candida stellata and Saccharomyces cerevisiae on the aroma and composition of Chardonnay wine. Aust. J. Grape Wine Res. 6:2130. 37. Sohier, D., and A. Lonvaud-Funel. 1998. Rapid and sensitive in situ hybrid-

ization method for detecting and identifying lactic acid bacteria in wine. Food Microbiol. 15:391397. 38. Stender, H., C. Kurtzman, J. J. Hyldig-Nielsen, D. Sorensen, A. Broomer, K. Oliveira, H. Perry-OKeefe, A. Sage, B. Young, and J. Coull. 2001. Identication of Dekkera bruxellensis (Brettanomyces) from wine by uorescence in situ hybridization using peptide nucleic acid probes. Appl. Environ. Microbiol. 67:938941.

Downloaded from http://aem.asm.org/ on April 6, 2012 by guest