WEFTEC.

06

The variation of nitrifying bacterial population sizes in a sequencing batch reactor (SBR) treating low/mid/high concentrated wastewater
Baikun Li* Shannon Irvin Katherine Baker Environmental Engineering Program Pennsylvania State University, Harrisburg Middletown, PA 17057 bxl28@psu.edu ABSTRACT The purpose of this study was to correlate the population size of ammonia-oxidizing bacteria (AOB) and nitrite oxidizing bacteria (NOB) with nitrification performance under various operational conditions (chemical oxygen demand (COD) concentration, dissolved oxygen (DO), and hydraulic retention time (HRT)) and influent allythiourea (ATU) shock. The AOB (genera Nitrosomonas and Nitrosospira) and NOB (genera Nitrobecter and Nitrspira) communities were analyzed using fluorescence in situ hybridization (FISH). AOB and NOB accounted for 6.20.9% and 2.50.3% in total biomass, respectively. The population sizes of AOB and NOB varied with different levels of COD, DO and HRT. Nitrosomonas and Nitrospira were dominant nitrifying bacteria under conditions favorable for nitrification, while Nitrosospira outcompeted Nitrosomonas under adverse conditions (low [NH4+], low DO, short HRT, and ATU shock), and Nitrobecter outcompeted Nitrospira at high substrate concentrations (COD and [NH4+]). Under ATU shock that inhibited the oxidation of NH4+ to NO2-, the AOB population was substantially reduced with the stepwise increase of ATU dosage, and led to a corresponding decrease of NOB population. There was a discrepancy between nitrifying bacterial populations and their functions. Although AOB outnumbered NOB in all tests and became more dominant at low DO and short HRT, NH4+ oxidation, instead of NO2- oxidation, was the rate-limiting reaction for nitrification and susceptible to the adverse conditions. The study demonstrated the importance of elucidating the shifts of nitrifying bacterial population in order to optimize process design and operation at different influent characteristics, aeration intensity, retention time, and potential influent toxic shock. KEYWORDS Fluorescent in situ hybridization (FISH), nitrification, nitrifying bacteria, sequencing batch reactor (SBR), dissolved oxygen (DO), hydraulic retention time (HRT), allythiourea (ATU) shock INTRODUCTION Biological nitrification and denitrification are key processes to remove nitrogen from wastewater and have become more important due to stringent regulation on discharge. Nitrification process has two steps carried out by distinct groups of bacteria: ammonium (NH4+) is first oxidized to nitrite (NO2-) by autotrophic ammonia oxidizing bacteria (AOB), then nitrite is oxidized to nitrate (NO3-) by autotrophic nitrite-oxidizing bacteria (NOB) (Reaction 1 and 2). In anoxic denitrification, nitrite/nitrate is reduced to nitrogen gas (N2) by heterotrophic denitrifiers with the presence of carbon source (e.g. methanol, acetic acid) as electron donor (Reaction 3).

Copyright 2006 Water Environment Foundation. All Rights Reserved

5008

WEFTEC.06

Ammonia oxidizing bacteria

2NH4 +3O2 2NO2- +O2

(AOB) Nitrite oxidizing bacteria (NOB) Anoxic denitrifiers

2NO2- + 4H+ +H2O 2NO34 N2 + 10 CO2+ 6H2O +8OH-

(1) (2) (3)

5CH3COOH +8 NO3-

Nitrification is difficult to maintain in municipal and industrial wastewater treatment plants, since autotrophic nitrifying bacteria have a slower growth rate and lower competitiveness for oxygen than aerobic heterotrophs at mid/high chemical oxygen demand (COD) concentrations (Cartstensen et al., 1995, Lee et al. 2001). In conventional activated sludge processes, long retention time, intense aeration, and low COD concentration are necessary to keep nitrifying bacteria active. Sequencing batch reactors (SBR) convert treatment processes from space-course to time-course, in which aerobic-anoxic phases are operated sequentially in a single reactor. Due to its space-saving and operation flexibility, SBRs have been widely used for nitrogen removal (Henze M. 1991, Demouline and Goronszy 1997, Obaja et al. 2003, Kim et al. 2004). Since microorganisms are critical in the nitrification process, many studies have investigated nitrifying bacterial species and activity. By using classical microbial screening techniques, Hall and Murphy (1980) and Painter (1986) found that Nitrosomonas europa and Nitrobacter winogradskyi are the main AOB and NOB, respectively. In contrast, studies using molecular biology-based techniques including 16S ribosomal RNA (rRNA)-targeted methods have shown a great diversity of nitrifiers in activated sludge. Nitrosospira and Nitrospira were found as main species of AOB and NOB in both bench scale systems (Burrell et al., 1998; Schramm et al., 1998, 1999, Rittmann et al.1999; Morgenroth et al., 2000, You et al., 2003, Gieseke et al., 2002) and wastewater treatment plants (Juretschko et al., 1998, Coskuner and Curtis 2002), while Nitrosomonas and Nitrobacter were still characterized as dominant nitrifying bacteria in some other studies using bench scale systems (Gieseke et al., 2001, Chen et al., 2003, Tsuneda et al., 2003) and wastewater treatment plants (Wagner et al., 1996, Daims et al., 2001, Dionisi et al., 2002, Coskuner and Curtis 2002, Hallin et al., 2005). In addition, although nitrifying bacterial populations (AOB+NOB) are generally supposed to be greater than 5-8% in biomass for good nitrification (Randall et al., 1992, Koch et al., 2001), a wide variation in the percentage of nitrifying bacteria in microbial community has been reported. It varied from 0.34% in activated sludge (Dionisi et al., 2002), to 6-18% in a combined activated sludge and rotating biological contactor process (You et al., 2003) and a sewage plant (Wagner et al, 1995), and to over 50% in a carbon-limited autotrophic nitrifying biofilm (Kindaichi et al., 2004) and a SBR system (Morgenroth et al., 2000). The discrepancy of these studies may reflect differences in AOB and NOB populations among treatment facilities and raise two questions: Does the dominance of specific nitrifying bacterial species vary with operational conditions and influent qualities? Whats the correlation between microbial population and operational conditions in the treatment systems? Understanding these fundamental mechanisms is essential to reliably establish an optimal condition for nitrifying bacteria and thus improve nitrification efficiency. Until now, most studied for nitrifying bacterial population have been conducted in either bench-scale systems (<20 L) fed with synthetic solution or wastewater treatment plants at stable operational

Copyright 2006 Water Environment Foundation. All Rights Reserved

5009

WEFTEC.06

status, there is a lack of information for the variation of AOB and NOB populations in a real SBR system under various operation conditions and influent toxic shock. With these questions in mind, this study comprehensively investigated the population dynamics of different nitrifying bacterial species under a series of operational conditions (low/mid/high COD, dissolved oxygen concentration, and retention time) in a single-family-size SBR system (total volume: 2.8 m3) using 16S rRNA-targeted fluorescent in situ hybridization (FISH). Moreover, the changes of nitrifying bacterial community was examined under allythiourea (ATU) shock, which inhibits the oxidization of NH4+ by chelating copper on ammonia monooxygenase active sites, but reportedly has no effect on the oxidization of NO2- (Bedard and Knowles. 1989, Gorska et al 1996, Ginestet et al., 1998). Our goal was to find out the response of nitrifying bacteria to different operational conditions, and to establish a correlation between microbial population and nitrogen removal efficiency. MATERIAL AND METHODS SBR system and synthetic wastewater A SBR system with an effective treatment capacity of 1.7 m3 was used for nitrogen removal. There are three stages in the SBR: fill, reaction, and settling, with the sequence being controlled by an auto-timer. Under standard (mid-level) operation, a cycle (4.75 hrs) consisted: 0.42 hrs aeration, 2.83 hrs anoxic mixing and 1.00 hr. settling. The changes of dissolved oxygen (DO) concentration were achieved by adjusting aeration/anoxic mixing duration. DO was maintained at 3.5-4.5 mg/L during aeration phase under mid-level operation. Synthetic wastewater simulating municipal sewage was prepared to obtain standard (mid-level) influent (COD: 700 mg/L, TKN 45 mg/L, [NH4+]: 35 mg/L, alkalinity: 200-230 mg/L as CaCO3). The constituents were (per liter): milk powder 0.53 g, K2HPO4 0.04 g, urea 0.04 g, (NH4)2SO4 0.05 g, and CH3COONa 0.02 g. The ratio of BOD5 to COD was 0.65-0.70 in influent throughout the experiment. The influent was pumped into the filling zone in the SBR system by a dosage pump. Activated sludge was inoculated from Middletown Municipal Wastewater Treatment Plant. Mixed liquor suspended solid (MLSS) was 1000-1300 mg/L in the SBR system under mid-level operation. Experiment set-up The standard status of SBR operation was referred as mid-level in this study, under which condition COD of 700 mg/L, NH4+ of 35 mg/L, DO concentration during aeration phase of 3.54.5 mg/L (aeration length: 0.42 hours), hydraulic retention time (HRT) of 3.6 days (flow rate: 0.47 m3/d). Influent COD concentration, DO during aeration phase, and retention time were adjusted to get low-, mid- and high- level conditions (Table 1). Only one parameter was changed each time with the other two remaining at mid-level. Thereby, the impact of each parameter on nitrifying bacterial population could be tested individually without interference from other parameters.

Copyright 2006 Water Environment Foundation. All Rights Reserved

5010

WEFTEC.06

Table 1 The levels of parameters changed in the SBR system in single parameter modification test (influent [NH4+]: 35 mg/L)
High COD-mid DO-mid HRT Mid COD-mid DO-mid HRT (mid-level) Low COD-mid DO-mid HRT Extremely low COD-mid DOmid HRT Mid-COD-high DO-mid HRT Mid-COD-low DO-mid HRT Mid COD-mid DO-long SRT Mid COD-mid DO-short SRT Influent COD (mg/L) 1400 700 240 88 700 700 700 700 DO During aeration (mg/L) 3.5-4.5 3.5-4.5 3.5-4.5 3.5-4.5 5.2-5.5 0.7-1.0 3.5-4.5 3.5-4.5 HRT (days) 3.6 3.6 3.6 3.6 3.6 3.6 9 2.0

In addition, three combinations of COD, NH4+ and DO concentrations were selected for the changes of nitrifying bacterial populations under adverse conditions (Table 2). High NH4+-high COD-high DO (abbreviated as high-high-high condition) tested whether long aeration could compensate high COD for nitrifying bacterial growth. High-high-low condition tested the nitrifying bacterial activity when treating high strength influent at insufficient aeration. Lowlow-low condition tested whether nitrification could still occur under low aeration when treating low organic concentrated wastewater. Mid-level was the steady condition for the SBR system, and used as the standard operation status. Table 2 The combination of the parameters in the SBR system for multiple parameter modification test
High-high-high High-high-low Mid-level (Standard status) Low-low-low NH4+ (mg/L) 95 95 35 20 COD (mg/L) 1400 1400 700 240 DO During aeration (mg/L) 5.2 1.0 4.5 1.0 HRT (days) 3.6

ATU shock test Nitrifying bacterial population was also examined under allythiourea (ATU) shock. Before ATU was added into SBR feeding solution, batch tests were conducted to determine the dosage of ATU. In batch tests, activated sludge suspension was taken from the SBR system and put into 500 mL bottles with different ATU concentrations. The bottles were shaken at 25 C for 2 hrs. [NH4+], [NO2-] and [NO3-] were then measured. ATU inhibited nitrification by 42% at the dosage of 1 mg/L, and completely inhibited nitrification at 10 mg/L. During the ATU shock tests in the SBR system, 1 mg ATU/L was used as low dosage and 10 mg ATU/L was used as high dosage.

Copyright 2006 Water Environment Foundation. All Rights Reserved

5011

WEFTEC.06

Chemical analysis Analysis of COD, MLSS, and total kjehldahl nitrogen (TKN) were performed following standard methods (APHA 1995). Ammonium and nitrate were measured by Orion ion selective membrane electrodes. Nitrite was measured by HACH colorimetric test kit. Dissolved oxygen (DO) was measured by an YSI oxygen meter equipped with an oxygen probe. Oligonucleotide Probes Five 16S rRNA-targeted oligonucleotide probes commonly used for studying nitrifying bacterial population were selected for FISH tests (Table 3). Three oligonucleotide probes target AOB groups, with Nso1225 specific for AOB in the beta subclass of Proteobacteria, Nsm156 and Nsv443 specific for two major subgroups of AOB: Nitrosomonas and Nitrosospira, respectively. Two probes target NOB, with NIT3 specific for Nitrobacter and Ntspa1026 for Nitrospira. Beside these five probes, a non-binding probe (Non338) was used as negative control. The cells hybridized with Non 338 indicate the nonspecific fluorescence since this probe is supposed to have no target in any organism. The probes were synthesized by Penn State Medical School DNA Center, diluted with T.E. buffer to 50 ng/L, and stored at 20oC until use. The probes were labeled with cyanine dye (Cy3). Sludge fixation and Dehydration After the SBR system was acclimatized to each operational condition (Tables 1 and 2), activated sludge samples were collected on three different days within a 10-day stable operation period. 20 ml of activated sludge taken during aeration phase was placed on each well of a hybridization slide, and dried at 40 C for 1 hour. Fixation was carried out by pipetting 100 ml of freshly prepared 4% (wt./vol.) paraformaldehyde (PFA) solution onto each well of the slide and incubating for 2 hrs at room temperature (Amann 1995). PFA solution contained 0.04 g paraformaldehyde per mL 3X phosphate buffer saline (PBS) (3x PBS: 130 mM NaCl and 10 mM sodium phosphate buffer, pH 7). Subsequently, 100 ml of 1:1 (ethanol:1xPBS) was pipetted to each well and allowed to stand for 2 minutes. The activated sludge sample was then dehydrated in 50%, 80%, and 100% ethanol for 1 minute each. In Situ Hybridization. 1 ml oligonucleotide probe and 9ml hybridization solution were mixed with activated sludge on each well individually. Hybridization solution contained 180 l 5M NaCl, 20 l 1M Tris-HCl, and 1 l 10% SDS per mL. Optimal hybridization stringency required the addition of formamide to final concentrations specific for each probe (Table 3). All hybridizations were perfomed at a temperature of 46 C for 2 hrs in a moisture chamber (Oerther et al., 2000). A stringent posthybridization washing step was performed at 48 C for 30 minutes in a buffer containing 20 mM Tris-HCl, 0.01% sodium dodecyl sulfate (SDS), and NaCl (Table 3). Each well was then counter-stained with 100 l ice-cold DAPI (46-diamidino-2-phenylindole dihydrochloride) solution (1 g/mL) for 1 min at room temperature, rinsed with deionized water, and dried.

Copyright 2006 Water Environment Foundation. All Rights Reserved

5012

WEFTEC.06

Table 3 Oligonucleotide probes targeting specific nitrifying bacteria

Probe Nso-1225 Specificity Ammonium -oxidizers (beta subclass of Proteobacteria) Nitrosomonas Nitrosospira Nitrite oxidizer: Nitrobacter spp. Formamide NaCl Concn %a (mM) b CGCCATTGTATTACGTGTGA 35 80 Sequence (5-3) of probe Reference Mobarry et al. (1996) Mobarry et al. (1996) Mobarry et al. (1996) Mobarry et al. (1996) Juretschko et al. (1998) Manz et al. (1992)

Nsm 156 Nsv443 NIT3 Ntspa 1026

TATTAGCACATCTTTCGAT CCGTGACCGTTTCGTTCCG CCTGTGCTCCATGCTCCG

5 30 40 20 20

636 112 56 225 225

Nitrite AGCACGCTGGTATTGCTA oxidizers: Nitrospira NON338 Non-binding CGACGGAGGGCATCCTCA control a: Formamide concentration in the hybridization buffer. b: Sodium chloride concentration in the washing buffer.

Microscopy AOB and NOB were observed by a Leica DM RXA2 upright fluorescence microscope equipped with two filter sets: 360 nm (adsorption)/460 nm (emission) and 514 nm (adsorption)/566 nm (emission) 360nm/460nm was used for microorganisms in activated sludge stained by DAPI, and 514 nm/566 nm for nitrifiers hybridized with Cy3 labeled gene probes. With ten (10) views being obtained on each well (that is, each gene probe), 7 wells (6 probes plus DAPI) for each sample, and 3 samples being collected under each operational condition, 30 views were observed for each well and totally 210 views (10 views/well/sample X 3 samples X 7 wells) were obtained for each operational condition. With 11 operational conditions tested in this study (Tables 1 and 2) plus 5 tests under ATU toxic shock, there were totally 3360 views (210 view/condition X 16 conditions) obtained in this study. Images were captured with a Retiga Exi high-speed charge couple device (CCD) camera and saved in QED software. Image Analysis to Determine Nitrifier Biomass The captured digital images were first processed using Microsoft Photoshop, in which the blur (or out-of-focus) areas were removed. The processed images were then imported to Image J software (http://rsb.info.nih.gov/ij/). The pixel areas of red region conferred by CY3 labeled gene probe and blue region conferred by DAPI were counted separately for each image. Based on the quantification of pixel areas of total 3360 images, the percentage of probe-targeted

Copyright 2006 Water Environment Foundation. All Rights Reserved

5013

WEFTEC.06

nitrifying bacteria in activated sludge under each operational condition was calculated as follows.
Percentage Nitrifier in Biomass = Pixel Area of Red Image (Cy3) Pixel Area of Blue Image (DAPI)

Pixel areas of nitrifying bacteria and biomass were calculated as the average values of 30 views per gene probe or DAPI under each operational condition. Before the calculation, the pixel areas were subtracted by the areas of non-bind probe (Non338) to remove autofluorescence and background interference. In this study, the total amount of AOB was assumed as the images conferred by oligonucleotide probe Nso1225, and the total amount of NOB was the sum of the images conferred by probes NIT3 and Ntspa1026. RESULTS Nitrifying bacterial population at activated sludge at mid-level operation status Under mid-level operation status, the removal efficiency of COD and N achieved 99% with COD lower than 20 mg/L and [NH4+] and [NO3-] lower than 0.5 mg/L in effluent (Figure 1a). Nso1225 (target most of AOB) had the highest population among nitrifying bacterial groups with 6.2%0.9 in total biomass (Table 4.1). Nitrosomonas (targeted by Nsm156) and Nitrosospira (targeted by Nsv443) accounted for 3.5%0.6 and 2.0%0.5 of total biomass, respectively. These two subgroups composed 81% of AOB, indicating there were low portions of AOB species other than Nitrosomonas and Nitrosospira present in activated sludge. Schramm et al. (2000) detected low amount of Nitrosococcus (<5% in AOB) by NmV gene probes in nitrifying biofilm. NOB were less abundant than AOB with Nitrobacter (targeted by NIT3) and Nitrospira (targeted by Ntspa 1026) presenting 1.0%0.2 and 1.5%0.4 in total biomass, respectively, adding up to the total population of NOB as 2.5%0.3 (Table 4.1). Because NOB was less diverse and phylogenetically distinct than AOB (Dionisi et al., 2002), and Nitrobecter and Nitrospira have been found as two most dominant NOB species in many studies (Burrell et al., 1998, Schramm et al., 1998, 1999, Morgenroth et al., 2000, Daims et al., 2001, Gieseke et al., 2002, You et al., 2003), it was thereby assumed in this study that there was no other major NOB species in activated sludge.

Copyright 2006 Water Environment Foundation. All Rights Reserved

5014

WEFTEC.06

Effluent concentration (mg/L)

30 25 20 15 10 5 0 88

(a)

(b)

Influent COD (mg/L)

242

700

1317

35

(c)

Effluent concentration (mg/L)

30 25 20 15 10 5 0 1 3.5-4.5 5.0-5.5

DO during aeration phase (mg/L)

50

Effluent concentration (mg/L)

45 40 35 30 25 20 15 10 5 0 2 3.6 9

COD

NH4+ HRT (days)NO3-

TKN

Figure 1 COD and nitrogen removal in the SBR system at different COD, DO concentrations and HRTs ([NO2-] was below detection level in effluent)

Copyright 2006 Water Environment Foundation. All Rights Reserved

5015

WEFTEC.06

(a)

(b)

(c)

(d)

(e)

Figure 2. FISH images of five groups of nitrifying bacteria in activated sludge in the SBR under mid level operation. (a) Nso-1225 (target most of AOB), (b) Nsv443 (target Nitrosospira ) (c) Nsm 156 (target Nitrosomonas), (d) NIT 3 (target Nitrobacter), (e). Ntspa 1026 (target Nitrospira)

Copyright 2006 Water Environment Foundation. All Rights Reserved

5016

WEFTEC.06

The changes of nitrifying bacterial population in single parameter modification tests The changes of nitrifying bacterial populations under specific operational condition (COD, DO, or retention time) were studied in eight single parameter tests (Table 1). Nitrifying bacterial populations were then compared with FISH results at mid-level operation status. Table 4 The percentages of nitrifying bacteria in biomass in the SBR system at low-mid-high influent COD, DO concentrations and HRT during single parameter modification tests (Each data and standard deviation were calculated based on 30 vies for each gene probe under each operation condition) 4.1. The impact of influent COD on AOB and NOB populations
Nso-1225 (AOB) COD: 88 mg/L COD: 242 mg/L COD (mid): 700 mg/L COD: 1317 mg/L 6.8%0.7 6.6%0.6 6.2%0.9 5.3%0.9 Nsm-156 (Nitrosomonas) 3.1%0.4 3.1%0.6 3.5%0.6 3.6%0.3 Nsv-443 (Nitrosospira) 2.1%0.3 2.4%0.5 2.0%0.5 1.1%0.3 NIT3 (Nitrobecter) 1.1%0.3 1.1%0.3 1.0%0.2 1.6%0.3 Ntspa 1026 (Nitrospira) 1.7%0.2 1.8%0.3 1.5%0.4 0.5%0.3 Total NOB 2.9%0.2 2.9%0.3 2.5%0.3 2.1%0.3 Total Nitrifier (AOB+NOB) 9.7%0.5 9.5%0.4 8.7%0.6 7.4%0.5 AOB/NOB 2.30.4 2.30.2 2.50.5 2.50.2

4.2. The impact of DO during aeration on AOB and NOB populations

Nso-1225 (AOB) DO: 1.0 mg/L DO (mid): 3.5-4.5mg/L DO: 5.0-5.5mg/L 2.8%0.7 6.2%0.9 6.1%0.5 Nsm-156 (Nitrosomonas) 0.7%0.4 3.5%0.6 3.6%0.7 Nsv-443 (Nitrosospira) 1.2%0.5 2.0%0.5 2.8%0.4 NIT3 (Nitrobecter) 0.3%0.2 1.0%0.2 1.2%0.3 Ntspa 1026 (Nitrospira) 0.4%0.2 1.5%0.4 1.5%0.5 Total NOB 0.7%0.2 2.5%0.3 2.7%0.4 Total Nitrifier (AOB+NOB) 3.6%0.4 8.7%0.6 8.6%0.4 AOB/ NOB 4.1% 0.4 2.5% 0.5 2.3% 0.4

4.3.The impact of HRT on AOB and NOB populations

Nso-1225 (AOB) HRT: 2 days HRT (mid): 3.6 days HRT: 9 days HRT 2days (DO: 5.05.5 mg/L) 1.9%0.6 6.2%0.9 6.5%0.9 6.3%0.9 Nsm-156 (Nitrosomonas) 0.7%0.2 3.5%0.6 3.8%0.4 3.1%0.3 Nsv-443 (Nitrosospira) 1.1%0.2 2.0%0.5 2.3%0.4 2.0%0.4 NIT3 (Nitrobecter) 0.1%0.1 1.0%0.2 1.2%0.3 1.1%0.3 Ntspa 1026 (Nitrospira) 0.2%0.1 1.5%0.4 1.6%0.5 1.5%0.5 Total NOB 0.3%0.1 2.8%0.3 2.8%0.3 2.6%0.4 Total Nitrifier (AOB+NOB) 2.2%0.4 8.7%0.6 9.3%0.5 8.9%0.6 AOB/NOB 6.3%0.4 2.5%0.5 2.7%0.6 2.5%0.7

Copyright 2006 Water Environment Foundation. All Rights Reserved

5017

WEFTEC.06

COD had the least impact on nitrifying bacterial population and nitrogen removal performance. AOB and NOB still accounted for 5.3%0.9 and 2.1%0.3 in biomass, respectively, at high influent COD concentration (1317 mg/L) (Table 4.1). Nitrification proceeded well with effluent [NH4+] lower than 0.5 mg/L (Figure 1a). The main reasons for good nitrification were a long HRT (3.6 days) in the SBR system compared with 5-7 hours in normal wastewater treatment processes, and a high amount of easily biodegradable compounds in synthetic wastewater. At this long HRT, influent COD was quickly reduced to about 20-30 mg/L in the SBR system, and thus did not inhibit nitrification. In addition, the percentages of AOB+NOB in biomass decreased at high influent COD (Table5), caused by the competition from heterotrophic microorganisms. But the nitrifying biomass remained almost same throughout the COD range, which could also explain the good nitrification at high influent COD. Table 5 The percentage of nitrifying bacteria (AOB+NOB) in total biomass in the SBR system under different COD concentrations and retention times (HRT)
COD (mg/L) 88 242 700 (Mid-level) 1317 700 (Mid-level) MLSS (mg/L) 1050 1100 1350 1750 1200 Nitrifying bacteria in biomass (%) 9.7 0.5 9.5 0.4 8.7 0.6 7.4 0.5 2.2 0.4 Nitrifying bacteria conc. (mg/L) 1025 1054 1188 1308 265 HRT (days) 3.6 3.6 3.6 3.6 2.0

Several studies assumed that Nitrosomonas and Nitrobecter were r-strategists (low affinity for substrate, high growth rate, and compete successfully at high substrate concentration), while Nitrosospira and Nitrospira were k-strategists (high affinity for substrate, low growth rate, and thrive at low substrate concentration) (Manz et al., 1996, Shramm et al., 1998, 2000, Nogueria et al., 2002). Our results of the shift of nitrifying bacterial species confirmed this assumption. Nitrosomonas population (3.1-3.6%) was greater than Nitrosospia (1.1-2.4%) throughout the COD tests under which conditions there were sufficient nitrogen source (influent [NH4+]: 35 mg/L) and oxygen (DO: 3.5-4.5 mg/L) in the SBR. The population size of Nitrospira (1.7%0.2) was greater than Nitrobecter (1.1%0.3) at low COD (<242 mg/L). [NO2-] was below the detection level in this study (data not shown), indicating NO2- generated by AOB quickly oxidized to NO3- by NOB. Nitrospira outcompeted Nitrobecter at this very low [NO2-]. However, Nitrobecter took over Nitrospira at high COD (1317 mg/L) with 1.6%0.3 in the biomass, which could be the result of their unique ability to live heterotrophically, while most of Nitrospina, Nitrococcus, Nitrospira are unable to grow heterotrophically (Ehrich et al., 1995, Burrell et al., 1998). AOB and NOB populations decreased to 2.8%0.7 and 0.7%0.2 at low DO concentration (DO< 1.0 mg/L) (Table 4.2) under which condition nitrification became incomplete with effluent [NH4+] higher than 12 mg/L (Figure 1b). AOB exhibited a higher resistance to low DO concentration than NOB. AOB at low DO was 45% (=2.8%/6.2%) of the population at midlevel operation, while NOB was 28% (=0.7%/2.5%) of mid-level operation. This difference can be explained by the lower competitiveness of NOB for oxygen than AOB. The Km value for
Copyright 2006 Water Environment Foundation. All Rights Reserved

5018

WEFTEC.06

oxygen, representing the affinity for oxygen, reported for Nitrobacter winogradskyi is 62 M whereas the Km value reported for Nitrosomonas europa is 16 M (Schramm et al. 1999, 2000). AOBs greater affinity to oxygen made them more adaptable to low-level oxygen and exhibited greater predominance over NOB than at mid-level DO. Both AOB and NOB populations remained same at both mid- and high-level DO concentrations, indicating once there was sufficient oxygen in the system, further increasing aeration would not improve nitrifying bacterial population or nitrifying performance. There was a shift of AOB community during the DO tests. Nitrosospira outnumbered Nitrosomonas at low DO, while Nitrosomonas regained the dominance at mid/high DO concentrations. This shift was the result of Nitrosospiras k strategy of having a higher affinity of oxygen, which gave them a better survival ability at deficient oxygen concentration. Nitrobecter were less than Nitrospira at all DO concentrations in this study. Okabe et al., (1999) also found that Nitrospira outnumbered Nitrobacter throughout a nitrifying biofilm, although Nitrospira grow significantly slowly in pure culture (doubling time [td] 23-90 hrs) than Nitrobacter grow (td, 8-14h) (Watson et al., 1989). However, Shramm et al. (2000) observed that Nitrobacter outcompeted Nitrospira at high DO in a biofilm system, due to Nitrobacters r strategy of thriving at high oxygen concentration. We speculate that [NO2-] rather than DO concentration might be the critical factor for the dominant NOB species in this study. Because of low [NO2-] in the SBR system, Nitrospira (k strategists) outcompeted Nitrobecter (r strategists) in most cases, even at high DO concentration. Both AOB and NOB populations substantially reduced at short retention time (2 days), accounting for only 1.9%0.6 and 0.3%0.1 in biomass (Table 4.3). Minimal nitrification occurred with effluent [NH4+] almost equal to influent (35 mg/L) (Figure 1c). Effluent COD was as high as 42 mg/L. Several studies have reported that SBR systems still had good nitrification performance at short HRTs (5 hrs-24 hrs) (Kos 1998, Beun et al., 1999, Peng et al., 2001, Lai et al., 2004). The failure of nitrification at HRT of 2 days was caused by a relatively long HRT (3.6 days) being used as the normal status in the SBR system, and the types of microorganism selected by this long SRT were unable to adapt to short HRT (2 days) within 10-day test period. FISH results showed that Nitrosospira presented at a higher population than Nitrosomonas at short HRT. This stronger resistance to short HRT might be the result of Nitrosospiras k-strategy of having a higher affinity of substrate concentration under adverse condition. Nitrosomonas outnumbered Nitrosospira at normal HRT (3.6 days) and long HRT (9 days). Similar to DO and low COD tests, Nitrospira population was higher than Nitrobecter under all HRTs, which was supposed to be the result of the k living strategy of Nitrospira (thrive at low [NO2-]). The failure of nitrification at short HRT in the single parameter modification tests (DO during aeration phase was kept at mid-level: 3.5-4.5 mg/) (Table 1) raised a question: can higher DO concentration compensate for short HRT in terms of nitrifying bacterial population? In the next experiment, nitrifying bacterial population was examined at short HRT and high DO (5.0-5.5 mg/L with aeration phase of 1.5 hrs). AOB and NOB recovered to 6.3%0.9 and 2.6%0.4 (Table 4.3), respectively. Effluent COD reduced to 20 mg/L and effluent [NH4+] was 0.4 mg/L (Figure 1c). Nitrosomonas outcompeted Nitrosospira at high DO/short HRT, indicating Nitrosomonas were the dominant AOB at good nitrification.

Copyright 2006 Water Environment Foundation. All Rights Reserved

5019

WEFTEC.06

The changes of nitrifying bacterial population in multiple parameter modification tests Multiple parameter modification tests were conducted at mid-HRT (3.6 days) (Table 2). Nitrification still proceeded well under high-high-high condition (Table 6), similar to high COD at mid-level aeration (Figure 1a). This was the result of long retention time for COD removal and nitrification in the SBR system. The populations of AOB and NOB under high-high-high condition were similar to that under mid-level conditions with AOB and NOB presenting 6.2%0.8 and 2.2%0.4 of total biomass, respectively (Table 6). Low oxygen was a limiting factor for nitrification under high-high-low condition with effluent [NH4+] of 23.2 mg/L, but not a limiting factor under low-low-low condition with effluent [NH4+] of 0.3 mg/L (Table 5). FISH results showed a substantially low population of AOB and NOB under high-high-low condition (2.0%0.4 and 0.8%0.1, respectively), but a normal population under low-low-low condition (6.2%0.9 and 1.9%0.4, respectively) (Table 7). Table 6 Effluent COD, NH4+ and NO3- concentrations at multiple parameter modification tests (HRT: 3.6 days) ([NO2-] was below detection level in effluent)
High-high-high High-high-low Mid-level (Standard status) Low-low-low COD (mg/L) 175 216 195 163 NH4+ (mg/L) 0.50.3 23.26 0.60.4 0.30.2 NO3- (mg/L) 1.00.4 0.80.6 0.30.2 4.11.8

Table 7. The percentages of nitrifying bacteria in biomass in the SBR system at multiple parameter modification tests (HRT 3.6 days) (High/high/high: high COD/high NH4+/high DO, high/high/low: high COD/high NH4+/low DO, mid-level: mid COD/mid NH4+/mid DO, low/low/low: low COD/low NH4+/low DO)
Nso1225 (AOB) 6.2%0.8 2.0%0.4 6.2%0.9 6.2%0.9 Nsm-156 (Nitrosomonas) 3.0%0.7 0.9%0.5 3.5%0.6 2.3%0.2 Nsv-443 (Nitrosospira) 2.6%0.4 0.4%0.2 2.0%0.5 2.9%0.3 NIT3 (Nitrobecter) 1.5%0.6 0.5%0.2 1.0%0.2 0.3%0.3 Ntspa 1026 (Nitrospira) 0.7%0.2 0.3%0.1 1.5%0.4 1.6%0.5 Total NOB 2.2%0.4 0.8%0.1 2.5%0.3 1.9%0.4 Total Nitrifier (AOB+NOB) 8.4%0.5 2.8%0.2 8.7%0.6 8.1%0.6 AOB/NOB 2.8%0.6 3.7%0.4 2.5%0.5 3.5%0.7

High/high/high High/high/low Mid-level Low/low/low

The population of Nitrosomonas was greater than Nitrosospira at sufficient NH4+ source (high/high/high and high/high/low), but became lower than Nitrosospira at deficient NH4+ and oxygen (low/low/low). Previous studies (Shramm et al., 1998, Okabe et al., 2004) found that Nitrosospira formed bigger and looser clusters in close association with clusters of NOB. This cluster formation could be disadvantageous due to the longer diffusion paths of substrate, but since nitrifying bacteria rely on CO2 fixation by ribulose bisphosphate carboxylase (RubisCO), it might be a mechanism for increasing the efficacy of CO2 fixation by lowering the O2 in the

Copyright 2006 Water Environment Foundation. All Rights Reserved

5020

WEFTEC.06

clusters. We assumed that cluster formation protected Nitrosospira from starving at low substrate concentration, but failed to provide more advantages at sufficient substrate concentration. Nitrobecter competed over Nitrospira at high COD and high [NH4+], due to its unique ability of heterotrophic growth (Tsuneda et al., 2003) and its r strategy of living at high nitrogen loading (Shramm et al., 1999, Nogueria et al., 2002). Nitrospira became dominant NOB under low/low/low condition, because of their k living strategy of thriving at low substrate concentration. The response of nitrifying bacterial population to ATU shock The response of nitrifying bacteria to influent toxic shock was tested at two ATU dosages: low ATU (1 mg/L) and high ATU (10 mg/L). The SBR system was set at mid-level for shock tests. The recovery of nitrification after influent shocks was also evaluated to check the time necessary for the microbial community returning to the steady status. Once the SBR system was under shock (first at low ATU dosage for 7 days, and then at high ATU dosage for 7 days), 10-30% nitrification was inhibited with effluent [NH4+] increase to 10 mg/L. At high ATU dosage, 50%-70% nitrification was inhibited with effluent [NH4+] of 20 mg/L (Figure 3). The SBR system exhibited a better tolerance to ATU shock than batch tests, in which nitrification was 100% inhibited at ATU of 10 mg/L. Although SBR systems are operated at fill-draw mode, the feeding of fresh influent and the discharge of treated wastewater (including metabolic byproducts) in each cycle keeps a continuous update of nutrient in systems, which provides SBR systems a stronger resistance to ATU shock than batch bottles. FISH results confirmed the advantage of SBR systems over batch systems in terms of the survival of nitrifying bacteria under influent shock. AOB population decreased to 4.0%0.8 at ATU of 1 mg/L, and further reduced to 2.0%0.4 at ATU of 10 mg/L in the SBR system (Table 8), while AOB decreased from 2.9%0.5 at ATU of 1 mg/L to 0.9%0.4 at ATU of 10 mg/L in batch tests. Nitrosospira population was always higher than Nitrosomonas under ATU shock, as the result of a better survival strategy under adverse condition. The SBR system started recovery after ATU shock period (15th day), with effluent [NH4+] gradually decreasing from 20 mg/L to 0.2 mg/L at 23rd day. AOB population was back to 6.1% one week after ATU dose was ended, with Nitrosomonas regaining the dominance over Nitrosospira. These results confirmed that although Nitrosospira possessed a stronger resistance to adverse conditions (low DO, low nitrogen loading, short HRT, and toxic shock), Nitrosomonas dominated at stable operational status. In addition, although ATU only inhibited NH4+ oxidization instead of NO2- oxidization (Bedard and Knowles 1989, Gorska et al., 1996, Ginestet et al., 1998) and both [NO2-] and [NO\3-] were less than 0.1 mg/L during ATU shock tests, NOB population steadily decreased with ATU dosage. This was caused by less amount of NO2- produced from the inhibited NH4+ oxidization, indicating that NOB population size was directly affected by the activity of AOB.

Copyright 2006 Water Environment Foundation. All Rights Reserved

5021

WEFTEC.06

Influent NH4+

Effluent NH4+
Recovery

60
NH4+ concentration (mg/L)

ATU (1 mg/L)

ATU (10 mg/L)

50 40 30 20 10 0
0 5 10 15 ATU shock date (day) 20 25

Figure 3. Nitrification in the SBR system at low ATU dosage (1 mg/L), high ATU dosage (10 mg/L) and recovery period ([NO2-] and [NO3-] were less than 0.1 mg/L in the SBR system)

Table 8. The percentage of nitrifying bacteria in biomass in the SBR system at ATU shock tests
Nso-1225 (AOB) ATU (1 mg/L) Batch ATU (10 mg/L) Batch ATU (1 mg/L) SBR ATU (10 mg/L) SBR Recover from ATU 2.9%0.5 0.9%0.4 4.0%0.8 2.0%0.4 6.1%0.5 Nsm-156 (Nitrosomonas) 1.1%0.4 0.2%0.2 1.2%0.4 0.3%0.2 3.0%0.7 Nsv-443 (Nitrosospira) 1.5%0.2 0.4%0.2 1.6%0.4 0.8%0.3 2.2%0.5 NIT3 (Nitrobecter) 0.3%0.1 0.1%0.1 0.4%0.2 0.3%0.2 1.1%0.2 Ntspa 1026 (Nitrospira) 0.6%0.2 0.4%0.2 0.9%0.3 0.8%0.2 1.4%0.3 Total NOB 0.9%0.2 0.5%0.2 1.3%0.3 1.1%0.2 2.5%0.3 Total Nitrifier (AOB+NOB) 3.9%0.3 1.4%0.3 5.4%0.5 3.3%0.3 8.7%0.4 AOB/NOB 3.5%0.5 2.1%0.4 3.2%0.8 2.1%0.4 2.7%0.6

Copyright 2006 Water Environment Foundation. All Rights Reserved

5022

WEFTEC.06

A discrepancy between nitrifying bacterial population and nitrification efficiency under adverse condition was observed in this study. ATU of 10 mg/L inhibited 100% of ammonium oxidization in batch bottles, but low AOB population (0.9%0.4 in biomass) was still detected in FISH tests (Table 8). In addition, low amount of AOB and NOB (2.5%0.4 in biomass) was observed at short HRT (2.0 days) (Table 4.3), under which condition nitrification failed (Figure 1c). Schramm et al (1999) and Morgenroth et al. (2000) also detected FISH signal of nitrifying bacteria (including Nitrosomonas species) under adverse conditions. These findings revealed that autotrophic nitrifying bacteria possess an inhibition-survival strategy to maintain population by keeping the cellular ribosome level under adverse environment, even though they can not carry out proper function (Jones and Morita 1985). DISCUSSION The total population of AOB and NOB in the SBR system. Our results showed that the sum of AOB and NOB was 8.5-9.7% at good nitrification, dropped to 3.6% at low DO concentration, and was only 2.2% at short retention time. The result was similar to the study of Juretschko et al. (1998) (10-15% in nitrifying biomass), but lower than the studies of Morgenroth et al. (2000) and Kindaichi et al. (2004) (more than 30% in nitrifying activated sludge/biofilm), and higher than Dionis et al. (2002) (0.34% in nitrifying activated sludge). This discrepancy in nitrifying bacterial population was more likely to be related to the difference in methodology (counting pixel areas of FISH images or PCR-based quantification). In Morgenroth et al. (2000) study, the FISH signals of nitrifiers were compared to a general bacterial probe EUB 338, which expectedly hybridized all bacteria in activated sludge. EUB338 probe was initially tried in our study, but it did not pick up as many cells as expected. Sometimes, this probe detected only a few more cells than Nso1225 probe. Coskuner and Curtis (2002) also came across the same problem, and they thought the possible causes might be the poor permeabilization of many bacterial cell walls by the paraformaldehyde fixation protocol, or the low rRNA content, or the low signal intensities related with the accessibility of EUB 338 16S rRNA target sites (Focht et al., 1998). EUB338 was later replaced by DAPI, which stained nucleoid of all biomass in activated sludge. Because bacteria only accounted for 50-70% of biomass in activated sludge, the percentage of AOB and NOB in biomass obtained in our study was lower than the percentage of AOB and NOB in bacteria in the study of Morgenroth et al. (2000). On the other hand, by using competitive PCR (cPCR), which is supposedly more sensitive and precise than FISH, especially in the case of the low percentage of nitrifying bacteria in activate sludge, Dionis et al. (2002) found the sum of AOB and NOB was only 0.34% in nitrifying activated sludge. Currently, counting FISH image areas is the prevailing approach to quantify nitrifying bacterial populations, more effort might need to apply cPCR approach, since it will be valuable for engineering design and operation if nitrification can proceed well at this small amount of autotrophic biomass in activated sludge or biofilm.

Copyright 2006 Water Environment Foundation. All Rights Reserved

5023

WEFTEC.06

The ratio of AOB to NOB in the SBR system. The ratio of AOB to NOB was 2.2-2.7 at good nitrification in both single and multiple tests, similar to the ratio (2.0-3.5) reported in the studies of Copp et al. (1995) and You et al. (2003). There were two reasons for high AOB population. First, NOB have inherent lower growth rate than AOB, even without any inhibitor present (Schramm et al. 1999). Second, energy generated in two steps of nitrification was different (Reaction 1 and 2). The oxidization of NH4+ to NO2generated 66-84 kcal/mol NH4+, while the oxidization of NO2- to NO3- generated 17.5 kcal/mol NO2- (You et al. 2003). AOB obtained more energy for cell growth and maintenance. Furthermore, due to AOBs higher affinity of DO and better survival ability than NOB, the ratio increased to 3.5-4.1 at low DO (Table 4.2, and 7) and to 6.3 at short HRT (Table 4.3), indicating AOB became more dominant at these adverse condition. However, the accumulation of NH4+, instead of NO2-, at low DO and short HRT revealed that NH4+ oxidation was the rate-liming reaction in nitrification. The complete oxidation of NO2- by the low amount of NOB was a strong evidence for their fast reaction rate. It has been reported that the NO3- production rate of Nitrobacter (5.1-42 fmol/cell/h) was superior to the NO2- production rate of Nitrosomonas (0.920fmol/cell/h) (Prosser 1989, Tsuneda et al., 2003). Another explanation was that AOB can maintain ribosome content under adverse conditions, and inactive AOB were still detected in high abundance by FISH targeting rRNA (Wagner et al., 1995, Okabe et a., 2004). This discrepancy between bacterial populations and their functions poses a requirement for the information of the gene expression or the realization of the genetic material (e.g. mRNA) (Logan and Rittmann, 1998). However, several studies revealed that the population of AOB was lower than NOB. Shramm et al. (1999) found NOB (Nitrospira) was more than 30 times over AOB (Nitrosospira) in a wastewater treatment plant, and Gieseke et al. (2001) found that NOB population (Nitrospira) was 85 times as AOB (Nitrosomonas) in a bench-scale biofilm system. By assuming 2 copies of amoA gene per AOB cell, and 1 copy of 16S rDNA gene per NOB cell, Dionisi et al. (2002) estimated that NOB population (Nitrospira) was 190 times greater than AOB (Nitrosomonas) in a wastewater treatment plant. In this study, the pixel area of hybridization was counted for the population size of each nitrifying bacteria species. Because the size of NOB cells was smaller than that of AOB (Altmann et al., 2003) and existed in smaller colonies (Schramm et al., 1996, Juretschko et al., 1998), this approach of comparing pixel areas of FISH images might underestimate the actual population of NOB. The shift of dominant species of AOB and NOB There have been conflicted findings of the dominant species of AOB and NOB in nitrification processes. Nitrosomonas were dominant AOB in both wastewater treatment plants (Wagner et al., 1996, Juretschko et al., 1998, Dionisi et al., 2002, Hallin et al., 2005) and bench-scale systems (Okabe et al., 1999, Bouchez et al., 2000, Ballinger et al., 2002, Nogueira et al., 2002, Tsuneda et al., 2003), while Nitrosospira were dominant mainly in bench scale systems (Schramm et al., 1998, 1999, You et al., 2003). Nitrobecter were found as dominant NOB only in a few studies (Coskuner et al., 2002, Chen et al., 2003, Tsuneda et al., 2003), while Nitrospira were dominant NOB in both wastewater treatment plants (Juretschko et al., 1998, Daims et al., 2001, Dionisi et al., 2002) and bench-scale systems (Burrell et al., 1998, Shramm et al., 1998,

Copyright 2006 Water Environment Foundation. All Rights Reserved

5024

WEFTEC.06

1999, Bouchez et al., 2000, Morngenroth et al., 2000, Gieseke et al., 2001, 2002, Nogueira et al., 2002, Satoh et al., 2003, Okabe et al., 2003, You et al., 2003). Two reasons could explain this discrepancy. First, real wastewater treatment plants and bench scale systems are significantly different in configuration, treatment capacity, wastewater characteristics, oxygen concentration, mixing mode and flow dynamics, which might make some conclusions of microbial community drew from bench-scale studies not valid for typical municipal wastewater treatment plants. Second, these nitrifying bacteria have different living strategies with Nitrosomonas and Nitrobacter as r strategists, and Nitrosospira and Nitrospira as k strategists (Prosser 1989, Schramm et al., 1999). By using a family-size SBR system fed with synthetic wastewater, we found that Nitrosomonas and Nitrospira were dominant nitrifying bacteria at good nitrification, while Nitrosospira outnumbered Nitrosomonas under adverse conditions (e.g. low [NH4+], low DO, short HRT and influent ATU shock), and Nitrobecter outnumbered Nitrospira at high COD and high [NH4+]. The reaction kinetics, activity and growth rate of specific dominant nitrifying bacteria directly affected nitrification efficiency in the treatment systems. The value of our study is that a clear shift of nitrifying bacterial community was revealed in a SBR system under different operational conditions. In order to optimize process design, improve treatment efficiency, and assess alternative process control strategies, the information about the quantities and activities of dominant AOB and NOB population in wastewater treatment systems is required for different influent characteristics, aeration intensity, retention time, and potential toxic shock. CONCLUSION The variation of nitrifying bacterial community in a SBR system under different operational conditions (COD, DO, HRT and influent ATU shock) was investigated in this study. The main conclusions are summarized as follows: 1. Nitrifying bacterial population tested by FISH had a good correlation with nitrogen removal efficiency. The sum of AOB and NOB was 8.5-9.7% in biomass at good nitrification, and dropped to 2.2-3.6% when nitrification failed at low DO concentration, short HRT and high COD/high N/ low DO condition. 2. Due to different living strategies of nitrifying bacteria, a shift of AOB and NOB community was observed at different conditions. Nitrosomonas dominated as AOB and Nitrospira dominated as NOB at good nitrification, while Nitrosospira outnumbered Nitrosomonas under adverse conditions, and Nitrobecter outnumbered Nitrospira at high substrate concentrations. Elucidation of nitrifying bacterial population shift is valuable to optimize design and operation for different influent characteristics, aeration intensity, retention time, and potential influent toxic shock. 3. The ratio of AOB to NOB was 2.2-2.7 at good nitrification and increased to 3.5-6.3 at low DO and short HRT, although NH4+, instead of NO2-, accumulation occurred under adverse conditions. It was derived from AOB/NOB population and activities that NOB had a faster reaction rate than AOB. 4. There were discrepancies when the nitrifying bacterial population size and the dominance of AOB and NOB species were compared with other studies. It was assumed that these discrepancies were associated with the characteristics of wastewater treatment systems and the methodology used in the quantification of microbial community.

Copyright 2006 Water Environment Foundation. All Rights Reserved

5025

WEFTEC.06

ACKNOWLEDGEMENT The project was funded by Pennsylvania Water Resource Center, and Pennsylvania State University at Harrisburg Research Council Grant. During the experiment, Dr. Charles Cole and Mr. J. Mitch Spear provided cooperation. Dr. Alistair Barber, Ms. Rhona Ellis and Mr. Roland Myers of the Microscopy Imaging Core Facility of the Section of Research Resources at Penn State College of Medicine facilitated the fluorescent microscopic observation. REFERENCES Altmann D., Stief P., Amann, R., de Beer D., and Schramm A., (2003). In situ distribution and activity of nitrifying bacteira in freshwater sediment. Environ. Microbio. 5 (9): 798-803. Amann, R.I. (1995). In situ identification of micro-organisms by whole cell hybridization with rRNA-targeted nucleic acid probes, p. 1-15. Molecular microbial ecology manual, vol. 3.3.6. Kluwer Academic Publishers, Dordrecht, The Netherlands. American public health association (APHA). (1995) Standard methods for the examination for water and wastewater. 19th edition. Ballinger, S.I., Head, I.M., Curtis, T.P., and Godley, A.R. (2002) The effect of C/N ratio on ammonia oxidizing bateria community structure in a laboratory nitrification-denitrification reactor. Wat. Sci. Tech. 46 (1-2): 543-550. Bedard C., and R. Knowles. (1989) Physiology, biochemistry and specific inhibitors of CH4, NH4+ and CO oxidation by methanotrophs and nitrifers. Microbiol. Rev. 53, 68-84. Beun, J.J., Hendriks A., van Loosdrecht M.C.M., Morgenroth E., Wilderer P.A., and Heijnen J.J. (1999). Aerobic granulation in a sequencing batch reactor. Wat. Res. 33 (10): 2283-2290. Bouchez T., Patureau D., Dabert P., Wagner M., Delgenes J., and Moletta (2000) Successful and unsuccessful bioaugmentation experiments monitored by fluorescent in situ hybridization. Wat. Sci. Tech. 41, (12): 61-58. Burrell, P. C., Keller, J., and Blackall, L. L. (1998) Microbiology of a Nitrite-oxidizing Bioreactor. Appl. Environ. Microbiol., 64, 1878-1883. Cartstensen J., Haremors P., and Madsen H., (1995) Statistical identification of Monod-kinetic parameters from on-line measurements. Wat. Sci. Tech. 31 (2), 125-133. Chen G.H., Wong, M.T., Okabe, S., Watanabe, Y. (2003). Dynamic response of nitrifying activated sludge batch culture to increased chloride concentration. Wat. Res. 3125-3135. Copp J.B., and Murphy K.L. (1995) Estimation of the active nitrifying biomass in activated sludge. Wat. Res. 29 (8). 1855-1861. Coskuner, G., and Curtis, T.P. (2002) In Situ characterization of nitrifers in an activated sludge: detection of Nitrobecter Spp. J. Appl. Microbio. 93: 431-437. Daims, H., Nielsen, J. L., Nielsen, P. H., Schleifer, K. H., and Wagner, M. (2001) In Situ Characterization of Nitrospira-like Oxidizing Bacteria Active in Wastewater Treatment Plants. Appl. Environ. Microbiol., 67, 5273-5284. Demouline, G., and Goronszy, M. 1997. Co-current nitrification denitrification and biological Premoval in cycle activated sludge plants by redox controlled cycle operation. Wat. Sci. Tech. 35 (1): 215-224. Dionisi, H.M., Layton, A.C., Harms, G., Gregory, I., Robison, K., Sayler, G. (2002) Quantificaiton of nitrosomonas ologotropha-like ammonia-oxidizing bacteria and nitrospira spp. from fulll-scale wastewater treatment plant. App. Env. Microbio. 245-253.

Copyright 2006 Water Environment Foundation. All Rights Reserved

5026

WEFTEC.06

Ehrich, S., Behrens, E., Lebedeva W., Ludwig W., and Bock E. (1995). A new obligatately chemolithotrophic, nitrite-oxidizing bacterium, Nitrospira moscoviensis sp nov. And its phylogenetic relationship. Arch. Microbiol. 164. 16-23. Focht D.D., and Verstraete. (1977) Biochemical ecology of nitrification and denitrification. Adv. Microb. Ecol. 1, 135-214. Gieseke, A., Purkhold, U., Wagner, M., Amann, R., and Schramm, A. (2001) Community structure and activity dynamics of nitrifying bacteria in a phosphate-removing biofilm. Appl. Environ. Microbiol. 67, 1351-1362. Gieskeke A., Arns, P., Amann, R., Scgrann, A. (2002) Simultaneous P and N removal in a sequencing batch biofilm reactor: insights from reactor-and microscale investigations. Wat. Res. 36: 501-509. Ginestet P., Audic J., Urbain V., and Block J. (1998) Estimation of nitrifying bacterial activities by measuring oxygen uptake in the presence of the metabolic inhibitors allythiourea and azide. App Environ Microbio. 65 (6), 2266-2268. Gorska J., Gernaey K., Demuynck C., Vanrolleghem P., and Verstraete W., (1996) Nitrification monitoring in activated sludge by oxygen uptake rate (OUR) measurements. Wat. Res. 30, 1228-1236. Hall, E. R., and Murphy, K. L. (1980) Estimation of Nitrifying Biomass and Kinetics in Wastewater. Water Res., 14, 297-304. Hallin, S., Lydmark, Hokalj, Hermansson, Sorensson, F., Jarvis, A., and Kindgren, P. (2005). Community survey of ammonia-oxidizing bacteria in full-scale activated sludge processes with different solids retention time. J. Appl. Microbio. 99, 629-640. Henze, M. 1991. Capabilities of biological nitrogen removal processes from wastewater. Wat. Sci.Tech. 23: 669-679. Jones R.D. and Morita R.Y. 1985 Survival of a marine ammonium-oxidizer under energy source deprivation. Mar.Ecol. Prog. Ser. 26, 175-179. Juretschko, S., Timmermann, G., Schmid, M., Schleifer, K., Roser, P. A., Koops, H., and Wagner, M. (1998) Combined Molecular and Conventional Analyses of Nitrifying Bacterium Diversity in Activated Sludge: Nitrososcoccus mobilis and Nitrospira-like Bacteria as Dominant Populations. Appl. Environ. Microbiol., 64 (8), 3042-3051. Kim, J., Chen, M., Kishida, N., and Sudo, R. 2004. Integrated real-time control strategy for nitrogen removal in swine wastewater treatment using sequencing batch reactors. Water Res. 38: 3340-3348. Kindaichi T., Ito T., and Okabe S. (2004) Ecophysiological interaction between nitrifying bacteria and heterotrophic bacteira in autotrophic nitrifying biofilms as determined by microautoradiography-fluorescence in situ hybridization. App. Environ. Microbio. 70 (3), 1641-1650. Koch, G., Kuhni, M. and Siegrist, H. (2001) Calibration and validation of an ASM3-based steady-state model for activated sludge systems. Part 1. Prediction of nitrogen removal and sludge production. Water Res 35, 22352245. Kos P. (1998) Short SRT (solids retention time) nitrification process/flowsheet Wat. Sci. & Tech. 38 (1), 23-29 Lai, E.; Senkpiel, S.; Solley, D.; Keller, J. (2004). Nitrogen removal of high strength wastewater via nitritation/denitritation using a sequencing batch reactor. Wat. Sci. & Tech. 50(10):27-33, 2004.

Copyright 2006 Water Environment Foundation. All Rights Reserved

5027

WEFTEC.06

Lee D., Joen C., and Park J.M., (2001) Biological nitrogen removal with enhanced phosphate uptake in a sequencing batch reactor using single sludge system. Wat. Res. 35, 3968-3976. Logan, B.E., and Rittmann, B.E. (1998). Finding solutions for tough environmental problems. Env. Sci.&Tech. 11: 502-507. Manz W., Amman R., Ludwig W., Wagner, M., and Schleifer, K. H. (1992). Phylogenetic oligodeoxynucleotide probes for the major subclasses of proteobacteria: problems and solutions. Syst.Appl. Microbiol. 15: 593-600. Manz W., Amman R., Ludwig W., Vancanneyt M., Schleifer K.H. A. (1996). Application of a suite of 16S rRNA-specific oligonucleotide probes designed to investigate bacteria of the phylum Cytophage-Flavobacter-Bacteroides in the natural environment. Microbiol. 142: 1097-1106. Mobarry, B. K., Wagner, M., Urbain, V., Rittmann, B. E., and Stahl, D. A. (1996) Phylogenetic Probes for Analyzing Abundance and Spatial Organization of Nitrifying Bacteria. Appl. Environ. Microbiol., 62 (6), 2156-2162. Morgenroth, E., Obermayer, A., Arnold, E., Bruhl, A., Wagner, M., and Wilderer, P. A. (2000) Effect of Long-Term Idle Periods on the Performance of Sequencing Batch Reactors. Wat. Sci. Technol., 41, 105-113 Nogueira R., Melo L., Purkhold U., Wuertz S., and Wagner, M. (2002). Nitrifying and heterotrophic population dynamics in biofilm reactors: effects of hydraulic retention time and the presence of organic carbon. Wat. Res. 469-481. Obaja, D., Mace, S., Costa, J., Sans, C., and Mata-alvarez, J. 2003. Nitrification, denitrification and biological phosphorus removal in piggery wastewater using a sequencing batch reactor. Bioresource Technology 87: 103-111. Oerther, D. B., Pernthaler, J., Schramm, A., Amann, R., and Raskin, L. (2000) Monitoring Precursor 16S rRNA of Acinetobacter spp. in Activated Sludge Wastewater Treatment Systems. Appl. Environ. Microbiol., 60 (5), 2154-2165. Okabe S., Kindaichi T., Ito T., and Satoh H. (2004) Analysis of size distribution and areal cell density of ammonia-oxidizing bacterial microcolonies in relation to substrate microprofiles in biofilms. Biotech and Bioeng. 85 (1), 86-95. Painter, H. A. (1986) Nitrification in the Treatment of Sewage and Wastewater, in Nitrification (ed. J.I. Prosser), IRL Press, Aberdeen, pp. 185-211. Peng, D., Bernet N., Delgenes, J., Moletta. (2001). Simultaneous organic carbon and nitrogen removal in an SBR controlled at low dissolved oxygen concentration. J. Chem. Tech. &Biotech. 76 (6): 553-558. Prosser J.I. (1989) Autotrophic nitrification in bacteria. Adv. Microb. Physiol. 30: 125-181. Randall, C.W., Barnard, J.L. and Stensel, H.D (1992) Design and Retrofit of Wastewater Treatment Plants for Biological Nutrient Removal. Lancaster, PA: Technomic Publishing Co. Inc. Rittmann, B. E., Laspidou, C. S., Flax, J., Stahl, D. A., Urbain, V. Harduin, H. Waard, J. Geurkink, B. Henssen, M. J. Brouwer, H. Klapwijk, A. and Wetterauw, M. (1999) Molecular and Modeling Analyses of the Structure and Function of Nitrifying Activated Sludge. Water Sci. Tech., 39 (1), 51-59. Satoh, H., Okabe, S., Yamaguchi, Y., Watanabe, Y. (2003) Evaluation of the impact of bioaugmentation and biostimulation by in situ hybridization and microelectrode. Wat. Res. 2206-2216.

Copyright 2006 Water Environment Foundation. All Rights Reserved

5028

WEFTEC.06

Schramm, A. Larsen, L. H. Revsbech, P. N. Ramsing, B. N. Amann, R. and Schleifer, H. K. (1996) Structure and Function of a Nitrifying Biofilm as Determined by In Situ Hybridization and the use of Microelectrodes. Appl. Environ. Microbiol., 62, 4641-4647. Schramm, A. De Beer, D. Wagner, M. and Amann, R. (1998) Identification and Activity In Situ of Nitrosospira and Nitrospira spp. as Dominant Populations in a Nitrifying Fluidized Bed Reactor. Appl. Environ. Microbiol., 64, 3480. Schramm, A. De Beer, D. Heuvel, J.C. Ottengraf, S. and Amann, R. (1999) Microscale Distribution of Populations and Activities of Nitrosospira and Nitrospira spp. Along a Macroscale Gradient in a Nitrifying Bioreactor: Quantification by In Situ Hybridization and the use of Microsensors. Appl. Environ. Microbiol., 65 (8), 3690-3696. Schramm, A. De Beer, D. Gieseke, A. and Amann, R. (2000) Microenvironments and Distribution of Nitrifying Bacteria in a Membrane-bound Biofilm. Environ. Microbiol., 2, 680-686. Tsuneda, S., Nagano, T., Hoshino T., Ejiri Y., Noda, N., Hirata A. (2003). Characterization of nitrifying granules produced in an aerobic upflow fluidized bed reactor. Wat. Res. 37, 49654973. Wagner, M. Rath, G. Amann, R. Koops, H. P. And Schleifer, H. K. (1995). In Situ Identification of Nitrifying Ammonia-oxidizing Bacteria. Syst. Appl. Microbiol., 18, 251-264. Wagner, M. Rath, G. Koops, P.H. Flood, J. and Amann, R. (1996) In situ Analysis of Nitrifying Bacteria in Sewage Treatment Plants. Water Sci. Tech., 34 (1-2), 237-244 Watson, S.W., Bock, E., Harms, H., Koops, H.P., Hooper, A.B. (1989) Nitrifying bacteria . 1808-1834. in Bergeys manual of systematic bacteriology, vol. 3. Williams and Wilkins, Baltimore, Md. You S.J. Hsu C.L. Chuang S.H. and Ouyang C.F. (2003) Nitrification efficiency and nitrifyin bacteria abundance in combined AS-RBC and A2O systems. Wat. Res. 2281-2290.

Copyright 2006 Water Environment Foundation. All Rights Reserved

5029