Gene expression

Gene expression is the process in which the inheritable information in a gene is made into a functional gene product, such as protein or RNA. Several steps in the gene expression process may be modulated, including the transcription step and the posttranslational modification of a protein.

Transcription = DNA RNA Translation = RNA protein "central dogma" of biology: DNA RNA protein.

Replication initiator proteins

DNA replication is initiated at particular points within the DNA, known as "origins", which are targeted by proteins that separate the two strands and initiate DNA synthesis. Origins contain DNA sequences recognized by replication initiator proteins (eg. dnaA in E coli' , Origin Recognition Complex in yeast and PCNA in human). These initiator proteins recruit other proteins to separate the two strands and initiate replication forks. PCNA protein is found in the nucleus and act as cofactor of human DNA polymerase.

 In bacteria, transcription begins with the

binding of RNA polymerase to the promoter in DNA. At the start of initiation, the core enzyme is associated with a sigma factor (number 70) that aids in finding the appropriate -35 and -10 basepairs downstream of

promoter sequences.

 In Eukaryotes, transcription initiation is

far more complex. A collection of proteins
called transcription factors mediate the

binding

of

RNA

polymerase

with

assistance of activators and enhancer

sequence.

Proteins
Proteins are composed of one or more polypeptides, plus (in some cases) additional small molecules (co-factors). Polypeptides are linear chains of amino acids. After synthesis, the new polypeptide folds spontaneously into its active configuration and combines with the other necessary subunits to form an active protein. Thus, all the information necessary to produce the protein is contained in the DNA base sequence that codes for the polypeptides. The sequence of amino acids in a polypeptide is known as its primary structure.

Initiation
The initiation process involves joining the first mRNA, the initiator methioninetRNA, and the small ribosomal subunit. Several initiation factors--additional proteins--are also involved. The large ribosomal subunit then joins the complex.

Initiation of Translation in prokaryotes and eukaryotes In prokaryotes, ribosomes bind to specific translation initiation sites. several different initiation There can be sites on a

messenger RNA: a prokaryotic mRNA can

code

for

several

different

proteins.

Translation begins at an AUG codon, or

sometimes a GUG.

The modified amino

acid N-formyl methionine is always the first amino acid of the new polypeptide.

Initiation of Translation in prokaryotes and eukaryotes In eukaryotes, ribosomes bind to the 5 cap, then move down the mRNA until they reach the first AUG, the codon for methionine. Translation starts from this point. Eukaryotic mRNAs code for only a single gene.
Note that translation does not start at the first base of the mRNA. There is an untranslated region at the beginning of the mRNA, the 5 untranslated region (5 UTR).

Elongation
The ribosome has 2 sites for tRNAs, called P and A. The initial tRNA with attached amino acid is in the P site. A new tRNA, corresponding to the next codon on the mRNA, binds to the A site. The ribosome catalyzes a transfer of the amino acid from the P site onto the amino acid at the A site, forming a new peptide bond. The ribosome then moves down one codon. The nowempty tRNA at the P site is displaced off the ribosome, and the tRNA that has the growing peptide chain on it is moved from the A site to the P site. The process is then repeated: the tRNA at the P site holds the peptide chain, and a new tRNA binds to the A site. the peptide chain is transferred onto the amino acid attached to the A site tRNA. the ribosome moves down one codon, displacing the empty P site tRNA and moving the tRNA with the peptide chain from the A site to the P site.

Termination
When the ribosome reaches a stop codon,

there is no tRNA that binds to it. Instead,

proteins called release factors bind,

and cause the ribosome, the mRNA, and

the new polypeptide to separate. The new

polypeptide is completed.

mRNA
5-UTR Coding sequence

3-UTR

CCGCUACCAACUAUGAUUUCGACGCGACCGUCACGCUAGCAAGGCC

ORF is the sequence starting from the first translation starting site AUG until the first stop codon that will give the polypeptide chain of the interest.

Post-Translational Modification continue New polypeptides usually fold themselves spontaneously into their active conformation. However, some proteins are helped and guided in the folding process by chaperone proteins The main organelle for protein folding is the endoplasmic reticulum. Misfolding or improper folding of proteins will lead to stress of endoplasmic reticulum.

Post-Translational Modification continue Many proteins are targeted to specific organelles within the cell. Targeting is accomplished through signal sequences on the polypeptide. In the case of proteins that go into the endoplasmic reticulum, the signal sequence is a group of amino acids at the N terminal of the polypeptide, which are removed from the final protein after translation (after translocation).

Termination
Bacteria use two different strategies for
transcription termination: in Rho-independent transcription termination, RNA transcription stops when the newly synthesized RNA molecule forms a hairpin loop, which makes it detach from the DNA template. In the "Rho-dependent" type of termination, a protein factor called "Rho" destabilizes the interaction between the template and the mRNA, thus releasing the newly synthesized mRNA from the elongation complex.

 Transcription termination in eukaryotes is less well understood.