Vous êtes sur la page 1sur 48

Genes, peoples, and languages across the Western Mediterranean

David Comas Unitat de Biologia Evolutiva Universitat Pompeu Fabra Barcelona david.comas@upf.edu

Sahara Desert

Objectives
Elucidate the genetic structure of NW African and SW European populations Compare the genetic composition of both Mediterranean shores Compare the genetic composition of Berber and Arab populations in NW Africa Detect possible sub-Saharan Africa admixture in NW Africa

Genetic markers
Classical polymorphisms: proteins

Autosomal markers: STRs, Alu insertions

Uniparental markers: Y-chromosome and mtDNA


DNA markers

Classical genetic markers in Europe


First Principal Component (28.1%)

Cavalli-Sforza LL, Menozzi P, Piazza A (1994). The history and geography of human genes

Classical genetic markers in North Africa


First Principal Component (36.5%)

Bosch E, Calafell F, Prez-Lezaun A, Comas D, Mateu E, Bertranpetit J (1997) Population history of North Africa: evidence from classical genetic markers Hum Biol 69: 295-311

Classical genetic markers in the Mediterranean

Sharpest genetic boundaries

Simoni L, Gueresi P, Pettener D, Barbujani G (1999) Patterns of gene flow inferred from genetic distances in the Mediterranean region Hum Biol 71:399-415

Classical genetic markers: HLA evidence


A30-B18-DR3 A1-B8-DR3 A29-B44-DR7 A1-B57-DQ2 A11-B27-DR1 A30-B18-DR3 A33-B14-DR1 A1-B57-DQ2 A2-B35-DR11

A30-B18-DR3 A1-B8-DR3 A29-B44-DR7 A33-B14-DR1


From Arnaiz-Villena and Martnez-Laso (1997) Origen de ibricos, vascos y argelinos Investigacin y Ciencia

Classical genetic markers: HLA evidence


Neighbor-joining tree based on 7 HLA loci

35 91 41 78 80 90

66

Comas D, Mateu E, Calafell F, Prez-Lezaun A, Bosch E, Martnez-Arias R, Bertranpetit J (1998) HLA class I and class II DNA typing and the origin of Basques. Tissue Antigens 51: 30-40

Autosomal STRs (Short Tandem Repeats)


D3S1358 vWA* FGA D8S1179 D21S11 D18S51 D5S818* D13S317 D7S820* D11S2010 D13S767 D14S306 D18S848 D2S1328 D4S243 F13A1 FES / FPS D9S926 TH01 TPOX CSF1PO (TCTA)n (TCTA)n (CTTT)n (TCTA/G)n (TCTG/TA)n (AGAA)n (AGAT)n (GATA)n (GATA)n (GATA)n (GATA)n (GATA)n (GATA)n (GATA)n (AGAT)n (AAAG)n (ATTT)n (GATA)n (CATT)n (AATG)n (AGAT)n

BASQUES PORTUGUESE ANDALUSIANS CATALANS

ARABS

NC BERBERS SO BERBERS

MOZABITES

SAHARAWI

21STRs
AACTTGCTAAGATAGATAGATAGATAGCGCGCC
AACTTGCTAAGATAGATAGATAGATAGATAGCGCGCC

Autosomal STRs (Short Tandem Repeats)


40

30

MOZABITES
20

BASQUES ARABS SAHARAWI


-60 -40 -20
10

ITALIANS ANDALUSIANS
20 40 60

NC BERBERS 0 SO BERBERS
0

PORTUGUESE CATALANS

-10

EUROPEAN AMERICANS

AFRICAN AMERICANS

-20

75%
-30

Bosch E, Calafell F, Prez-Lezaun A, Clarimn J, Comas D, Mateu E, Martnez-Arias R, Morera B, Brakez Z, Akhayat O, Sefiani A, Hariti G, Cambon-Thomsen A, Bertranpetit J (2000) Genetic structure of north-west Africa revealed by STR analysis. Eur J Hum Genet 8: 360-366

Alu insertion polymorphisms


Alu element
BASQUES CATALANS ANDALUSIANS TUNISIANS W. MOROCCANS N. MOROCCANS ALGERIANS

Alu element

SE. MOROCCANS SAHARAWI

-/-

+/-

+/+

11 Alu insertion polymorphisms


A25 ACE APO B65 D1 FXIIIB PV92 TPA25 HS243 HS323 HS465

Alu insertion polymorphisms


100 90 80 70 60 50 40 30 20 10 0 Basque Catalan Andalusian Saharawi E.Moroccan W.Moroccan N.Moroccan Algerian Tunisian

APO

ACE

FXIIIB

B65

A25

D1

PV92

TPA25

HS243

HS323

Comas D, Calafell F, Benchemsi N, Helal A, Lefranc G, Stoneking M, Batzer MA, Bertranpetit J, Sajantila A (2000). Alu insertion polymorphisms in NW Africa and the Iberian Peninsula: evidence for a strong genetic boundary through the Gibraltar Straits. Hum Genet 107:312-319

HS465

Alu insertion polymorphisms

Basque Andalusian
60.4

Catalan

Neighbor-joining tree of populations 11 Alu insertion loci

98.7

Northern Moroccan
NW Africans Iberians
1,000 bootstrap iterations

Western Moroccan
60.4 28.9 46.3 85.7

S. Eastern Moroccan

Tunisian Algerian

Saharawi

Alu insertion polymorphisms


Principal component analysis of the Alu insertion frequencies
S.Eastern Moroccan Second PC (20.8%) Saharawi Catalan Basque

Andalusian

Western Moroccan
Tunisian

Northern Moroccan

Algerian

First PC (48.0%)

Alu insertion polymorphisms


Neighbor-joining tree of populations 11 Alu insertion loci Algerians Nguni
82.9
96.9

85.8

Saharawi SEMoroccans

!Kung

Bantu Sub-Saharans NW Africans Europeans

1,000 bootstrap iterations

Alu insertion polymorphisms


Principal component analysis of the Alu insertion frequencies

Sub-Saharans NW Africans Europeans


First PC (44.9%)

Second PC (24.2%)

Alu insertion polymorphisms

Larger Alu insertion in PV92 locus


3 individuals: 2 Basques and 1 Northern Moroccan

Alu insertion polymorphisms

Larger Alu insertion in PV92 locus


Alu element Alu element

Alu element

Comas D, Plaza S, Calafell F, Sajantila A, Bertranpetit J. (2001) Recent insertion of an Alu element within a polymorphic human-specific Alu insertion. Mol Biol Evol 18:85-88

Alu insertion polymorphisms

Larger Alu insertion in PV92 locus

3 individuals: 2 Basques and 1 Northern Moroccan

Uniparental markers: Y-chromosome and mtDNA

mtDNA

Y chromosome

autosomes

Uniparental markers: Y-chromosome and mtDNA Five generations

MALE FEMALE

Mother 4 Grandparents 16 Great-great grandparents

Father 8 GreatgrandParents

Son

32 Great great-great grandparents

Uniparental markers: Y-chromosome and mtDNA Y Adam and mtDNA Eve


MRCA
1 2

3
4 5 6 7 8

generations

Uniparental markers: Y-chromosome and mtDNA Y-chromosome phylogeny mtDNA phylogeny

Uniparental markers: Y-chromosome and mtDNA Phylogeography: ex. Y-chromosome

Uniparental markers: Y-chromosome and mtDNA Gender specific behaviours

Patrilocality: females are more likely to move from their birthplace upon marriage than males Polygyny: certain men father a disproportionately large number of children compared to other men

Y-chromosome lineages

BASQUES CATALANS ANDALUSIANS

ARABS

NC BERBERS SO BERBERS

SAHARAWI

44 binary + 8 STRs

DYS388 DYS19 DYS390 DYS391 DYS392 DYS393 DYS389I DYS389II


Bosch E, Calafell F, Comas D,Oefner PJ, Underhill P, Bertranpetit J (2001) High-resolution analysis of human Y-chromosome variation shows a sharp discontinuity and limited gene flow between Northwestern Africa and the Iberian Peninsula Am J Hum Genet 68: 1019-1029

Y-chromosome lineages

E3a*

Y-chromosome lineages

E3b2

Y-chromosome lineages

F*

Y-chromosome lineages

R1*

Y-chromosome lineages

Y-chromosome lineages
European Paleolithic substrate 78.4% North African genetic flow 5.2% Neolithic contribution 16.4%

Iberian Peninsula
Neolithic contribution 13.6%

Iberian genetic flow 2.8%

Sub-Saharan genetic flow 8%

North African Paleolithic substrate 75%

NW Africa

Mitochondrial lineages
Galicians Basques NPortuguese CPortuguese Portuguese SPortuguese Tuscans Catalans CItalians Central Spain SItalians Andalusians

Valencians

Sardinians Sicilians Tunisians

Algerians NBerbers MArabs Mozabites SBerbers 12705 12308

Saharawis

HVS I Control Region + 4 SNPs Coding Region

10873 10400

Mauritanians

Plaza S, Calafell F, Helal A, Bouzerna, Lefranc G, Bertranpetit J, Comas D (2003) Joining the Pillars of Hercules: mtDNA sequences show multidirectional gene flow in the Western Mediterranean Ann Hum Genet 67: 312-328

Mitochondrial lineages
mtDNA haplogroups defined by control region sequences and coding polymorphisms

Mitochondrial lineages
Plot of the two principal co-ordinate scores based on genetic distances
.8

Mozabites
.6

Second principal co-ordinate (12.7%)

.4

Portuguese
.2

Catalans Galicians Sic

North Portuguese

-.0

-.2

M Berbers Saharawi CS CI SPort And SBerbers M Arabs Basques Tus Valencians Central Portuguese South Italians Tunisians Mauritanians

Sard

-.4

Algerians
-.6 -.4 -.2 0 .2 .4 .6 .8

First principal co-ordinate (55.4%)

Mitochondrial lineages Haplogroup L

L1 L2 L3

Mitochondrial lineages
Italians Iberians North Africans

Haplogroup U/K
182

359
111 172 311 293 180 297 192

311

355 145

239 222

235 271 278 311

189 180 311 278 051 290

261 174

163 164 188

U/K
U6

U6b

129

Mitochondrial lineages Haplogroup H and V


261 039 169 240 124 242 075 319

259

265 172 129 086 129344 264 037 311 339 240 093 298 153 362 140 216 254 291 189 189 153 259

256 249

304

H V
235

Italians Iberians North Africans

183

HV

Mitochondrial lineages Haplogroup M

M1 M5

Mitochondrial lineages

Sened Matmata Chenini-Douiret

Mitochondrial lineages
3,0
J/T

2,0
1,0 0,0

mtDNA haplogroup Arab Berber

C.Moroccan1
Mozabites C.Moroccan2
U6 V U H J X M1 T N K

Mauritanians

S.Moroccan Moroccan Saharawi

-1,0
Tuareg

L1 L3
L2

Algerian Egyptians Matmata Tunisian Sened


Other I

Chenini-Douiret
HV

-2,0

-3,0
-2,0 -1,0 0,0 1,0 2,0

Correspondence analysis based on haplogroup frequencies


Fadhlaoui-Zid K, Plaza S, Calafell F, Ben Amor M, Comas D, Bennamar El Gaaied A (2004) Mitochondrial heterogeneity in Tunisian Berbers. Ann Hum Genet 68: 222-233

Mitochondrial lineages Analysis of the molecular variance (AMOVA)


Groups
All populations Arabs Berbers Arabs-Berbers
ns not significat ** p < 0.01

Among groups

Among populations
4.14** 1.54** 6.24**

Within populations
95.86 98.46 93.76 95.95

-0.21 ns

4.25**

Fadhlaoui-Zid K, Plaza S, Calafell F, Ben Amor M, Comas D, Bennamar El Gaaied A (2004) Mitochondrial heterogeneity in Tunisian Berbers. Ann Hum Genet 68: 222-233

Western Mediterranean populations: Conclusions 1) Clear genetic difference between NW Africa and SW Europe

The Palaeolithic and Neolithic may have run in parallel along the two shores Gibraltar Straits may have acted as a geographical barrier

Little genetic impact in Iberia of Arab occupation

Western Mediterranean populations: Conclusions 2) Sub-Saharan flow detected in some NW African samples

Continuous gene flow through the Sahara desert South-north gradient of sub-Saharan admixture

Western Mediterranean populations: Conclusions 3) No differences between Berber and Arab samples

Arabisation in the Maghreb (7th and 11th C A.D.):


Cultural replacement with little demographic impact

Western Mediterranean populations: Conclusions 4) Greater heterogeneity in NW Africa

Genetic drift in isolated populations Differential genetic admixture Population sampling bias ?

Genes, peoples, and languages across the Western Mediterranean

David Comas Unitat de Biologia Evolutiva Universitat Pompeu Fabra Barcelona david.comas@upf.edu