Reglas Generales para el diseño de primers

2012 - 2

Reglas Generales para el Diseño de Primers
Parámetros
1. Secuencia única 2. G/C Clamp en el 3’

Valores Óptimos
Secuencia 3´es crítica para el anillaje. 1-2 G/C (S) nucleótidos

3. No ¨self-complementarity¨
4. No dímeros de primers 5. Composición en bases

< 3 bases contiguas
< 3 bases contiguas 45-55% del contenido G+C

6. Tamaño del primer
7. Tm

18-25 bases

8. Longitud y composición de la 100-600 pb de distancia secuencia a amplificar

Secuencia Única

La secuencia del primer debe ser única en el templado. No debe haber anillaje en posibles contaminantes.
AND Templado
5’...TCAACTTAGCATGATCGGGTA...GTAGCAGTTGACTGTACAACTCAGCAA...3’ A TGCT AGTTG CAGTCAACTGCTAC TGCTAAGTTG

Primer Candidato 1 5’-TGCTAAGTTG-3’ Primer Candidato 2 5’-CAGTCAACTGCTAC-3’

NO ES UNICO
UNICO

Secuencia Única
 

Secuencia 3´es crítica para el anillaje Secuencias 5’ puede ser ¨alterada¨ - por ejemplo para añadir sitios de restricción, codones de inicio, señales de secreción etc.-

3’
5’

3’

5’

Si

Dirección de la Síntesis
3’

5’

5’

3’

No

Tm 18-25 bases 8. 1-2 G/C (S) nucleótidos 3. Composición en bases < 3 bases contiguas < 3 bases contiguas 45-55% del contenido G+C 6. Longitud y composición de la 100-600 pb de distancia secuencia a amplificar . G/C Clamp en el 3’ Valores Óptimos Secuencia 3´es crítica para el anillaje. No dímeros de primers 5. Tamaño del primer 7. No ¨self-complementarity¨ 4. Secuencia única 2.Reglas Generales para el Diseño de Primers Parámetros 1.

Clam de G/C en el extremo 3’  El extremo 3’ debe tener G/C  Probabilidad del correcto anillamiento en el sitio en donde se añaden las bases Si hay 5 – 10 nucleótidos de complementariedad en el extremo 3’. usualmente servirán de primer  .

Secuencia única Valores Óptimos Secuencia 3´es crítica para el anillaje. Tamaño del primer 7. No dímeros de primers 5. No ¨self-complementarity¨ 4. Tm 1-2 G/C (S) nucleótidos < 3 bases contiguas < 3 bases contiguas 45-55% del contenido G+C 18-25 bases 8. Longitud y composición de la 100-600 pb de distancia secuencia a amplificar Evitar la Formación de Estructuras Secundarias . Composición en bases 6. G/C Clamp en el 3’ 3.Reglas Generales para el Diseño de Primers Parámetros 1. 2.

uidaho.ibest.edu/~heckendo/CS504/Students/P/waltari.pdf .Evitar la Formación de Estructuras Secundarias Hairpin Loops http://marvin.

Evitar la Formación de Estructuras Secundarias Self Dimers Cross Dimers .

Tamaño del primer 7.Reglas Generales para el Diseño de Primers Parámetros 1. No ¨self-complementarity¨ 4. Longitud y composición de la 100-600 pb de distancia secuencia a amplificar . 1-2 G/C (S) nucleótidos 3. Tm 18-25 bases 8. G/C Clamp en el 3’ Valores Óptimos Secuencia 3´es crítica para el anillaje. Composición de los primers < 3 bases contiguas < 3 bases contiguas 45-55% del contenido G+C 6. No dímeros de primers 5. Secuencia única 2.

Composición de los Primers Composición de bases:  % GC debe ser similar pues afecta:  Especificidad de Hibridación  Tm y T anillaje  Si tienen diferentes Tm no anillarán a la misma Tº. . Máxima diferencia de 2 – 3ºC  Contenido en (G+C): 50-60% da buenas T de anillaje y estabilidad de hibridación.

 .Reglas Generales para el Diseño de Primers Distribución aleatoria de los nucleótidos  Se prefiere una composición al azar de bases evitando regiones ricas en G/C o A/T Si todos los nucleótidos en el 5’ son G o C y en el 3’ A o T. el extremo 3’ no anillará a la temperatura predicha.

No dímeros de primers 5. G/C Clamp en el 3’ Valores Óptimos Secuencia 3´es crítica para el anillaje. No ¨self-complementarity¨ 4. Longitud del primer 7. Longitud y composición de la 100-600 pb de distancia secuencia a amplificar .Reglas Generales para el Diseño de Primers Parámetros 1. Composición en bases < 3 bases contiguas < 3 bases contiguas 45-55% del contenido G+C 6. Secuencia única 2. 1-2 G/C (S) nucleótidos 3. Tm 18-25 bases 8.

Longitud del Primer   Suficiente para asegurar que la secuencia a la que se anilla en el templado sea ÚNICA Pero no tan largo que afecte el Tm y el anillaje de forma radical Longitud probabilidad de ser único Tm y Ta más altas   Tamaño mínimo: 15 bases Tamaño optimo: 18-25 bases .

Reglas Generales para el Diseño de Primers Parámetros 1. Tamaño del primer 7. G/C Clamp en el 3’ Valores Óptimos Secuencia 3´es crítica para el anillaje. Longitud y composición de la 100-600 pb de distancia secuencia a amplificar . No ¨self-complementarity¨ 4. No dímeros de primers 5. Tm 18-25 bases 8. Composición en bases < 3 bases contiguas < 3 bases contiguas 45-55% del contenido G+C 6. 1-2 G/C (S) nucleótidos 3. Secuencia única 2.

Melting Temperature Tm  50% de la cadena forma una doble hélice estable y el otro 50 % está como cadena sencilla Depende    Longitud molécula Secuencia nts La temperatura a la cual la mitad de las hebras de ADN son doble cadena y la mitad cadena sencilla Tm depende de la fuerza iónica de la solución y del tamaño y composición del primer Tm = 4(G + C) + 2(A + T)oC .

Temperatura de Anillaje Ta Es la temperatura a la cual los primers se anillan con el ADN templado Ta = Tm_primer – 5C La Ta de ambos primers debe ser similar .

1-2 G/C (S) nucleótidos 3. Longitud y composición de la 100-600 pb secuencia a amplificar . Secuencia única 2.Reglas Generales para el Diseño de Primers Parámetros 1. Tm 18-25 bases 8. Composición en bases < 3 bases contiguas < 3 bases contiguas 45-55% del contenido G+C 6. No dímeros de primers 5. No ¨self-complementarity¨ 4. Tamaño del primer 7. G/C Clamp en el 3’ Valores Óptimos Secuencia 3´es crítica para el anillaje.

Tamaño del fragmento a amplificar  Los mejores resultados se obtienen cuando el producto es de 100 – 600 pares de bases. Depende del grado de procesividad de la Taq polimerasa – diferentes tamaños óptimos  .

¿Cuándo un primer es un primer? 5’ 5’ 3’ 3’ 5’ 3’ 3’ 5’ .

Melting Tm  entre 55-80 C.En Resumen  Únicos  asegura alta especificidad y reproducibilidad   Tamaño  15-25 bases.    . Minimizar estructuras secundarias internas  hairpins y dímeros. Composición de bases  promedio de contenido en (G+C) 50-60%. evite regiones largas ricas en (A+T) y (G+C). Diferencia de Tm entre primers  2 – 3 C.

Programas para el Diseño de Primers .

cgi) Primer3Plus http://www.de/genefisher/) GeneWalker (http://www.cybergene.html ) .se/primerdesign/) Web Primer (http://genome-www2.techfak.org/codehop.bioinformatics.com/netprimer/netprlaunch/net prlaunch.wi.stanford.edu/cgibin/primer/primer3_www.unibielefeld.fhcrc.cgi CODEHOP (http://www.html) Net Primer (http://www.nl/cgibin/primer3plus/primer3plus.mit.premierbiosoft.       Gene Fisher (http://bibiserv.edu/cgibin/SGD/web-primer) Primer 3 (http://www-genome.blocks.

.

.

Ejercicio Diseñar un par de primers para la secuencia de ERG11 de C. Tener en cuenta que el fragmento amplificado no sea mayor de 600pb . albicans que codifica para un gen de resistencia.

.

.

.

.

.

Accesión : AY942646 CDS: 518-2014 .Candida tropicalis erg11 no.

F´GATCCCATGGTTTGGTTCTG R´CCATGGTCTCTTTCCTTGGT .

F´CCCAAACTTGCCATTACCTC R´TTGGGACTCTCAATGGGTTC .

.

7 OC • 7. MP • 2.8 OC • 9. D= 61.03. gullermondii ATCC 6261 • 3.3 OC • 4. C= 63.2010 PCR ERG 11-A C . kruseii . H= 55. glabrata ATCC 15120 • 2. C. F = 57. A= 65.0 OC • 3.albicans Gradiente temperatura (-) MP A B C D E F G H (-) 1 2 3 • 1.2 OC • 6.0 OC PCR ITS`s • 1. C. G= 55. E = 58.19. C.0 OC • 8. B= 64.1 OC • 5.

3 OC 4. C= 63. MP 2.A= 65.0 OC 3. F = 57. D= 61.2010 PCR ERG 11-B C . G= 55.19. H= 55. B= 64.03.0 OC 8.0 OC .albicans Gradiente temperatura (-) H MP A B C D E F G • • • • • • • • • 1. E = 58.2 OC 6.1 OC 5.8 OC 9.7 OC 7.

http://www.nlm.Probar un par de primers….gov/ .nih.ncbi.

Sign up to vote on this title
UsefulNot useful