Reglas Generales para el diseño de primers

2012 - 2

Reglas Generales para el Diseño de Primers
Parámetros
1. Secuencia única 2. G/C Clamp en el 3’

Valores Óptimos
Secuencia 3´es crítica para el anillaje. 1-2 G/C (S) nucleótidos

3. No ¨self-complementarity¨
4. No dímeros de primers 5. Composición en bases

< 3 bases contiguas
< 3 bases contiguas 45-55% del contenido G+C

6. Tamaño del primer
7. Tm

18-25 bases

8. Longitud y composición de la 100-600 pb de distancia secuencia a amplificar

Secuencia Única

La secuencia del primer debe ser única en el templado. No debe haber anillaje en posibles contaminantes.
AND Templado
5’...TCAACTTAGCATGATCGGGTA...GTAGCAGTTGACTGTACAACTCAGCAA...3’ A TGCT AGTTG CAGTCAACTGCTAC TGCTAAGTTG

Primer Candidato 1 5’-TGCTAAGTTG-3’ Primer Candidato 2 5’-CAGTCAACTGCTAC-3’

NO ES UNICO
UNICO

Secuencia Única
 

Secuencia 3´es crítica para el anillaje Secuencias 5’ puede ser ¨alterada¨ - por ejemplo para añadir sitios de restricción, codones de inicio, señales de secreción etc.-

3’
5’

3’

5’

Si

Dirección de la Síntesis
3’

5’

5’

3’

No

No ¨self-complementarity¨ 4. G/C Clamp en el 3’ Valores Óptimos Secuencia 3´es crítica para el anillaje. Tm 18-25 bases 8. Longitud y composición de la 100-600 pb de distancia secuencia a amplificar .Reglas Generales para el Diseño de Primers Parámetros 1. 1-2 G/C (S) nucleótidos 3. Composición en bases < 3 bases contiguas < 3 bases contiguas 45-55% del contenido G+C 6. Tamaño del primer 7. No dímeros de primers 5. Secuencia única 2.

Clam de G/C en el extremo 3’  El extremo 3’ debe tener G/C  Probabilidad del correcto anillamiento en el sitio en donde se añaden las bases Si hay 5 – 10 nucleótidos de complementariedad en el extremo 3’. usualmente servirán de primer  .

Secuencia única Valores Óptimos Secuencia 3´es crítica para el anillaje. Composición en bases 6. Tm 1-2 G/C (S) nucleótidos < 3 bases contiguas < 3 bases contiguas 45-55% del contenido G+C 18-25 bases 8. G/C Clamp en el 3’ 3. Longitud y composición de la 100-600 pb de distancia secuencia a amplificar Evitar la Formación de Estructuras Secundarias . 2. No ¨self-complementarity¨ 4.Reglas Generales para el Diseño de Primers Parámetros 1. No dímeros de primers 5. Tamaño del primer 7.

ibest.edu/~heckendo/CS504/Students/P/waltari.pdf .uidaho.Evitar la Formación de Estructuras Secundarias Hairpin Loops http://marvin.

Evitar la Formación de Estructuras Secundarias Self Dimers Cross Dimers .

Composición de los primers < 3 bases contiguas < 3 bases contiguas 45-55% del contenido G+C 6. No dímeros de primers 5. 1-2 G/C (S) nucleótidos 3. G/C Clamp en el 3’ Valores Óptimos Secuencia 3´es crítica para el anillaje.Reglas Generales para el Diseño de Primers Parámetros 1. Tamaño del primer 7. Secuencia única 2. Longitud y composición de la 100-600 pb de distancia secuencia a amplificar . No ¨self-complementarity¨ 4. Tm 18-25 bases 8.

Composición de los Primers Composición de bases:  % GC debe ser similar pues afecta:  Especificidad de Hibridación  Tm y T anillaje  Si tienen diferentes Tm no anillarán a la misma Tº. Máxima diferencia de 2 – 3ºC  Contenido en (G+C): 50-60% da buenas T de anillaje y estabilidad de hibridación. .

 . el extremo 3’ no anillará a la temperatura predicha.Reglas Generales para el Diseño de Primers Distribución aleatoria de los nucleótidos  Se prefiere una composición al azar de bases evitando regiones ricas en G/C o A/T Si todos los nucleótidos en el 5’ son G o C y en el 3’ A o T.

G/C Clamp en el 3’ Valores Óptimos Secuencia 3´es crítica para el anillaje. Tm 18-25 bases 8. Composición en bases < 3 bases contiguas < 3 bases contiguas 45-55% del contenido G+C 6. No dímeros de primers 5. 1-2 G/C (S) nucleótidos 3. Secuencia única 2. Longitud del primer 7. No ¨self-complementarity¨ 4. Longitud y composición de la 100-600 pb de distancia secuencia a amplificar .Reglas Generales para el Diseño de Primers Parámetros 1.

Longitud del Primer   Suficiente para asegurar que la secuencia a la que se anilla en el templado sea ÚNICA Pero no tan largo que afecte el Tm y el anillaje de forma radical Longitud probabilidad de ser único Tm y Ta más altas   Tamaño mínimo: 15 bases Tamaño optimo: 18-25 bases .

Secuencia única 2. Tamaño del primer 7. 1-2 G/C (S) nucleótidos 3. Tm 18-25 bases 8. No dímeros de primers 5.Reglas Generales para el Diseño de Primers Parámetros 1. Longitud y composición de la 100-600 pb de distancia secuencia a amplificar . G/C Clamp en el 3’ Valores Óptimos Secuencia 3´es crítica para el anillaje. Composición en bases < 3 bases contiguas < 3 bases contiguas 45-55% del contenido G+C 6. No ¨self-complementarity¨ 4.

Melting Temperature Tm  50% de la cadena forma una doble hélice estable y el otro 50 % está como cadena sencilla Depende    Longitud molécula Secuencia nts La temperatura a la cual la mitad de las hebras de ADN son doble cadena y la mitad cadena sencilla Tm depende de la fuerza iónica de la solución y del tamaño y composición del primer Tm = 4(G + C) + 2(A + T)oC .

Temperatura de Anillaje Ta Es la temperatura a la cual los primers se anillan con el ADN templado Ta = Tm_primer – 5C La Ta de ambos primers debe ser similar .

No dímeros de primers 5. Longitud y composición de la 100-600 pb secuencia a amplificar . Secuencia única 2. Composición en bases < 3 bases contiguas < 3 bases contiguas 45-55% del contenido G+C 6. Tamaño del primer 7. No ¨self-complementarity¨ 4. Tm 18-25 bases 8. 1-2 G/C (S) nucleótidos 3.Reglas Generales para el Diseño de Primers Parámetros 1. G/C Clamp en el 3’ Valores Óptimos Secuencia 3´es crítica para el anillaje.

Depende del grado de procesividad de la Taq polimerasa – diferentes tamaños óptimos  .Tamaño del fragmento a amplificar  Los mejores resultados se obtienen cuando el producto es de 100 – 600 pares de bases.

¿Cuándo un primer es un primer? 5’ 5’ 3’ 3’ 5’ 3’ 3’ 5’ .

evite regiones largas ricas en (A+T) y (G+C). Diferencia de Tm entre primers  2 – 3 C. Composición de bases  promedio de contenido en (G+C) 50-60%. Melting Tm  entre 55-80 C. Minimizar estructuras secundarias internas  hairpins y dímeros.En Resumen  Únicos  asegura alta especificidad y reproducibilidad   Tamaño  15-25 bases.    .

Programas para el Diseño de Primers .

blocks.se/primerdesign/) Web Primer (http://genome-www2.mit.cybergene.cgi CODEHOP (http://www.       Gene Fisher (http://bibiserv.com/netprimer/netprlaunch/net prlaunch.wi.cgi) Primer3Plus http://www.de/genefisher/) GeneWalker (http://www.premierbiosoft.edu/cgibin/primer/primer3_www.nl/cgibin/primer3plus/primer3plus.stanford.techfak.bioinformatics.fhcrc.org/codehop.html ) .edu/cgibin/SGD/web-primer) Primer 3 (http://www-genome.html) Net Primer (http://www.unibielefeld.

.

.

Ejercicio Diseñar un par de primers para la secuencia de ERG11 de C. albicans que codifica para un gen de resistencia. Tener en cuenta que el fragmento amplificado no sea mayor de 600pb .

.

.

.

.

.

Accesión : AY942646 CDS: 518-2014 .Candida tropicalis erg11 no.

F´GATCCCATGGTTTGGTTCTG R´CCATGGTCTCTTTCCTTGGT .

F´CCCAAACTTGCCATTACCTC R´TTGGGACTCTCAATGGGTTC .

.

C. C.03.0 OC PCR ITS`s • 1. glabrata ATCC 15120 • 2.2 OC • 6. E = 58.0 OC • 8. F = 57.albicans Gradiente temperatura (-) MP A B C D E F G H (-) 1 2 3 • 1.0 OC • 3. A= 65. MP • 2. H= 55.7 OC • 7. C= 63.19.8 OC • 9.1 OC • 5. G= 55.3 OC • 4. D= 61.2010 PCR ERG 11-A C . C. gullermondii ATCC 6261 • 3. B= 64. kruseii .

03. E = 58.A= 65. F = 57. G= 55.8 OC 9.3 OC 4. D= 61.0 OC 8.1 OC 5. MP 2.0 OC 3. C= 63.7 OC 7. B= 64.2 OC 6.2010 PCR ERG 11-B C .19.0 OC .albicans Gradiente temperatura (-) H MP A B C D E F G • • • • • • • • • 1. H= 55.

gov/ .nih.nlm. http://www.Probar un par de primers….ncbi.

Sign up to vote on this title
UsefulNot useful