Vous êtes sur la page 1sur 44

PCR

Aplicaciones

Polymerase Chain Reaction (PCR):


Desarrollada por Kary Mullis en 1980. Revolucion la genetica molecular.

PCR produce enorme numero de copias de una secuencia especifica de DNA


Descubrimiento de Taq DNA polimerasa permite automatizar la PCR

Elementos bsicos de una reaccin de PCR Muestra (que contiene ADN)!! Buffer de reaccin dNTPs Primers!! Enzimas agua

Cual es nuestra muestra?


Un trozo de rgano Un hisopado Secreciones Sangre etc

Como tratar la muestra para obtener el acido nucleico?


Materiales para la extraccin de ac. nucleico de la muestra Pipetas Buffers de lisis para extraccion de ac. nucleico Tubos eppendorf, Kit de PCR

Componentes de la reaccin
Puesta a punto de la reaccin Muestra de ADN 101 106 molculas Buffer 10x suministrado con el kit Cl2 Mg 1.5 mM dNTPs 50uM c/u (2uM-50uM) Primer 20pmol c/u Taq 0.5-2 Unidades

Muestra de ADN (molde)


Debe calcularse cuidadosamente la concentracin inicial de ADN molde aadido a la reaccin. El exceso de ADN reduce el rendimiento de la PCR (inhibicin por sustrato) y puede aumentar la cantidad de productos inespecficos. Como regla general se debe utilizar entre 102 y 104 copias del molde. El rango de concentraciones debe estar entre: 0.01 -1 ng para ADN viral 0.1 -1 g para ADN genmico. En un volumen total de reaccin de 100 l.

Muestra de ADN
Se pueden utilizar la mayora de mtodos habituales de purificacin para la obtencin de ADN molde. Cantidades mnimas, incluso traza, de los reactivos de purificacin (por ejemplo, fenol) inhiben la actividad de la DNA polimerasa. La precipitacin con etanol y lavados con etanol al 70 % suele ser eficaz en la eliminacin de estos inhibidores. Los kits comerciales permiten la purificacin de altas cantidades de ADN, con un alto grado de pureza y libre de inhibidores.

Muestra de ADN
La cantidad por reaccin deber ser 101 106
molculas 1ug ADN humano 1 ul sangre humana 30ul semen 10ng levadura 1ng E. Coli ADN 1.5 x

1 x 105 molculas 7.5 x 104 molculas 3 x 105 molculas 3 x 105 molculas 105 molculas

Muestra de ADN
Muy poco

Demasiado

Concentracin de Magnesio
El Mg+2 es necesario para catalizar la elongacin de las DNA polimerasas. Una concentracin baja de iones Mg+2 disminuye el rendimiento de amplificacin. Una concentracin excesiva de iones Mg+2 puede causar la obtencin de productos inespecficos y disminuir la fidelidad del producto de PCR. Por tanto, debe calcularse la concentracin ptima de MgCl2 para cada PCR.

Concentracin de Magnesio
El Mg+2 forma complejos con los cidos nucleicos (molde, producto y primers) disminuyendo la eficiencia.
La presencia de agentes quelantes en la solucin de ADN molde (ej. EDTA) disminuye la concentracin de MgCl2. Los dNTPs tambin quelan el MgCl2, ya que forman complejos solubles con los iones Mg+2.

En el caso que las concentraciones recomendadas de MgCl2 no den un rendimiento ptimo, se debe optimizar la concentracin de forma emprica:
Comenzando desde 1 mM, y subiendo en pasos de 0.2 mM, hasta obtener un resultado satisfactorio.

Concentracin de Magnesio

Concentracin de Magnesio
PCR deber contener entre 0.5 y 2.5 mM de

Cl2 Mg La concentracin de Mg puede influenciar en: ADN target Annealing Especificidad y cantidad del producto Incremento de la sensibilidad Actividad de la enzima

Deoxinucleotido trifosfatos (dNTPs)


Habitualmente se emplea una concentracin final de 200 M de la mezcla de los dNTPs.
La concentracin de dNTPs depende indirectamente de la concentracin de MgCl2. Es fundamental tener una concentracin equimolar de los 4 dNTPs. El desequilibrio en la concentraciones disminuye el rendimiento y favorece la incorporacin errnea.

Deoxinucleotido fosfatos (dNTPs)


Cuando se requiere mxima fidelidad de copia, la concentracin final de dNTPs debe estar en el rango de 10-50 M. Tambin debe utilizarse enzimas con actividad exo 3'5' (proof-reading).

Bajas cantidades de dNTPs incrementan la


especificidad y fidelidad de la PCR

Deoxinucleotido fosfatos (dNTPs)

Qu son los primers?


Son oligonucletidos de entre 18 y 24 bases complementarios a los extremos del ADN a amplificar

PRIMERS INS1:5CGTGAGGGCATCGAGGTGGC INS2: 5 GCGTAGGCGTCGGTGACAAA

La eleccin de primers normalmente es el factor ms crtico a la hora de disear una PCR. Los primers suelen tener un tamao de 18 a 25 nt (aunque pueden llegar a los 40 nt). El contenido en GC debe estar alrededor del 40-60 % y distribuido de forma regular. Al menos 3 nucletidos conservados en el extremo 3'

Es beneficioso tener zonas ricas en GC localizadas en el extremo 3'.


La temperatura de annealing del par de primers debe ser similar (con un mximo de 5 C de diferencia).

Primers
La concentracin de primers deber ser de entre 0.1 y
0.5 uM. Concentraciones mayores favorecen el mispriming.. en los extremos 3: evitar complementariedad (primerdimer) y tambin 3 o ms Cs o Gs juntas producen mispriming en regiones ricas en GC Evitar secuencias palindrmicas

Primers
Se pueden disear primers para que los extremos

5 pueden contener: Sitios nicos para enzimas de restriccin CCATGG para incrementar la traduccin Secuencias promotoras o mismatches internos para estudios de mutagnesis

Annealing del Primer


Temp de annealing se selecciona por 4-5 C
debajo de la verdadera TM Para mejores resultados usar un rango de entre 55-72C El annealing requiere solo unos pocos segundos cuando se utilizan adecuada concentracin de primers y T Exigente T de annealing aumenta la especificidad y reduce la misextension

Extensin del Primer


La extensin del amplicn depende de el largo

de la secuencia blanco y de la T de la reaccin T cercanas a los 72 son las ptimas para la mayora de las polimerasas % de incorporacin: 35-100 nuc/seg 1min/72= 2Kb Un ltimo ciclo largo para asegurar que todos los amplicones tienen el tamao adecuado

ADN polimerasa Termoestable


Llevan a cabo la sntesis de ADN dependiente del templado. Las ms comunmente usadas son: Taq (Thermus aquaticus) Pfu (Pyrococcus furiosus) Tli (Thermococcus littoralis) Tfl (Thermus flavis) Tth (Thermus thermophilus) Estabilidad Taq: 9 min at 97C, Pwo >2 hr a 100C Fidelidad Taq: baja, Pfu: alta Algunas presentan actividad transferasa terminal en el extremo 3(Pwo y Tli generan extremos romos)

ADN polimerasa Termoestable


Concentracin recomendada: 0.5-2 Unidades Poca enzima resulta en poco o insuficiente

producto. Mucha enzima resulta en producto no especfico Sin embargo, si hay inhibidores presentes en la mezcla de reaccin puede ser necesario utilizar hasta 4-5 unidades de enzima.

ADN polimerasa Termoestable


La BSA en concentraciones por encima de 0.8 g/l incrementa la eficiencia de la PCR (captura iones que pueden ser inhibidores de la polimerasa). Glicerol: Aumenta estabilidad trmica de la Taq pero disminuye la TM. DMSO: Disminuye la TM y la estabilidad trmica de la Taq.

La fidelidad de la Taq es influenciada por mltiples factores incluyendo la tendencia de la polimerasa a insertar nucletidos equivocados debido a la falta de actividad de exonucleasa 3- 5

Nmero de ciclos
Normalmente 25-35 ciclos son suficientes en

una reaccin tpica Desnaturalizacin: 94 C 20 seg (para ADN genmico un poco mas larga) Primer annealing: 55 C 20 seg Primer extensin: 72 C 1min Extensin final 72 5 min Demasiados ciclos incrementan el background no especfico

Tiempo y T de desnaturalizacin

94 C por 20 seg o 97 C por 15 seg Largo de fragmento/tiempo de elongacin 6Kb/4min, 10Kb/8min, 20Kb/15min Regiones ricas en GC requieren T + altas pues la desnaturalizacin incompleta permite que el ADN se vuelva a cerrar Vida media de la Taq: 72hs a 92 C, 40 min a 95 C y 5 min a 97 C

Optimizar el nmero de ciclos de PCR es la mejor forma de evitar la amplificacin inespecfica de productos, ya que las bajas concentraciones de productos cortos e inespecficos en los primeros ciclos competir preferencialmente con el producto deseado

Misincorporacin, background y poca cantidad de producto



La misincorporacin es promovida por: Baja concentracin de dNTPs Concentracin desbalanceada de dNTPs Alta concentracin de dNTPs Background Mucho primer Mucha enzima Baja T de annealing

Baja cantidad de producto T de annealing incorrecta Tiempo de extensin muy corto Cantidad limitada de enzima Inadecuada [Cl2 Mg]

Fidelidad de la Taq Tasa de error de la Taq es de 1 error en


400 bases luego de 25 ciclos

Reaccin bsica
Reactivo Concentracin final

Buffer enzima 10X 10 mM dNTP Mix Primer 1 Primer 2 DNA Polimerasa 50 mM MgCl2 DNA molde Agua bidestilada estril

1X 0.2 mM 10 pmol 10 pmol 1U 1-4 mM 10 pg - 1 g c.s.p. 50ml

Una vez preparada la mezcla se recomienda agitarla y centrifugarla. Para termocicladores sin tapa calefactora, se debe aadir una gota de aceite mineral o parafina.

Desnaturalizacin
Como el ADN sintetizado de novo es habitualmente de menor tamao que el ADN molde, es suficiente con 30 seg-2 min a 94-95 C de desnaturalizacin. Para productos con alto contenido en GC, el tiempo de desnaturalizacin puede ser de hasta 3-4 min.

La desnaturalizacin se puede favorecer agregando: Glicerol (hasta 10-15 % volumen) DMSO (hasta el 10 %) Formamida (hasta 5 %).
Pero, estos aditivos modifican la temperatura de annealing (debe ser optimizada nuevamente). El DMSO y la formamida pueden llegar a inhibir la enzima en un 50 %.

El Ciclador
El Termociclador es programable. Existen varios modelos El nmero de ciclos vara entre 30 y 40

Pasos de la PCR:

Before cycles cycle 5 Before cycle 43

Antes del ciclo 30

Visualizacin del Producto


Consta de dos procedimientos: Electroforesis en geles de Agarosa Fotografiado o captura digital

Fotografiado
Pelcula Polaroid o
Captura digital de Imgen

Interpretacin
Lnea 1: Marcador Lnea 2: Control (-) Lnea 3: Control (+) Lnea 4 ,5, 6 y 7 Muestra 1, 2, 3 y 4. Lnea 8: Marcador 1 2 3 4 5 6 7 8

Verificacin de la especificidad del producto de PCR por medio de electroforsis en gel de Agarosa

Otros:
RFLP Sonda

Diferentes tecnicas de PCR : Standard PCR RT-PCR. Transcriptasa Reversa: amplificacion de RNA

Nested PCR : Amplifica un segmento usando dos pares de primers (externos e internos).
Long template PCR: Amplifica segmentos largos de DNA. Usa una mezcla de Taq y Pwo DNA polimerasa Hot start PCR: Reduce la amplificacion no especifica desactivando la enzima. PCR Cuantitativa : monitoreo de la reaccion en tiempo real-Real-time

Aplicaciones de la PCR : Detectar infeccin viral o bacteriana: FMD, HIV, tuberculosis...

Secuenciar DNA (Human Genome Project) Estudios de evolucin: PCR puede analizar genes de DNA Monitoreo de terapia del cancer : PCR puede detectar 1 celula cancerosa en 10e+6 celulas normales Detectar mutaciones: mutacion en oncogen RAS para detectar cancer
Determinar el Sexo en celulas pre-natales : machos poseen secuencia unica en el cromosoma Y

Aplicaciones de la PCR : Medicina forense: Criminologia Identif Cuerpo. test de Paternidad

Aplicaciones de la PCR : Secuenciacion de DNA :

Sanger descubre un metodo basado en dideoxy (ddNTP), falta un atomo de O requerido para extender la cadena de DNA.
Metodos de Deteccion : Metodo de Sanger ddNTPs marcados Radioactiva// ddNTPs marcados fluorescente//