REGULATION OF PLANT GENE EXPRESSION

Multigene families Many plant genes isolated so far are members of multigene families, eg; storage protein, rbcS, leghemoglobin etc. Evolution from single ancestral gene by duplication and amplification through unequal crossing over and chromosomal mutations. Plants tolerant to the accumulation mutations in genes, especially when multiple copies are present. High incidence of polyploidy leads to natural increase in gene or allele number . Gene clusters and the dispersed genes may be physically linked on the same chromosome or reside in different chromosome

Natural consequence of multigene families and their genomic organisation and mode of evolution underlies the phenomenon of differential gene expression where members of the same family are expressed in the same tissue to different degrees or in different tissues.

Individual genes accumulate mutations in their 5 and 3 which affect specific cis acting seq required for normal regulation of expression. Degree of homology of flanking regions vary at sequence level both in the no: and size of point mutations.

Dispersed genes by how they have arisen (translocations introgressions from other species integration as pseudogenes) may be located in the areas of genome with varying activity where expression is expediated or depressed from normal levels. Nothing much is known about the mode of action ,stability or availability of trans acting factors in the nucleus.

Classical genetic studies have identified a no: of loci which regulate storage protein expression on chromosomes than those on which are located the zein strl genes which they affect. If the products of these regulatory loci are not available to the promoters of structural genes on a regular basis, because of chromosomal organisation within the nucleus or uneven diffusion in the nuclear matrix, different structural gene loci may be expressed in different levels.

Accumulation of mutated or truncated genes which though nonfunctional are observed as hybridizing seq in Southern analysis. Eg: one of the maize zein genes, base substitution changes the ATG to CTG so, mRNA is not translated. In others, stop codon in coding region, so transcription normal but translated as truncated polypeptides Processed pseudogenes where reverse transcripts of the mRNA are incorporated in to the genome are seen in potato actin gene

STORAGE PROTEIN GENES

Expressed in a tissue specific manner Expressed at high levels in a coordinated fashion,have conserved DNA motifs at 5region Eg:prolamin box (-300 box) found in maize, barley, wheat etc. Legumin box: TCCATAGCCATGCATGCTGAAGAATGTC Vicillin box:GCCACCTCaattt Zein:CACATGTGTAAAGGT Anaerobic response: CGGTTT---TGGTTT

LIGHT REGULATED GENE S

cab genes, rbcS gene families Mediated by light receptors like the phytochrome and recognition of the light quality and quantity First element upstream TATA box, the iind Light responsive element(LRE) between the first and 410 nt upstream of trans start site LRE reacts with other 5 reg seq.

Some genes contain multiple TATA boxes, where as there are others(house keeping genes gen) which lack TATA. Other motifs compensate for the lack of TATA box.(nuc genes inv in photosynthesis) Core or minimal promoters. : do not initiate transcription by themselves, instead, contribute to the binding of RNA pol to the promoter.

REGULATION DIFFERENT LEVELS

Chromatin conformation Gene transcription Nuclear RNA modification, splicing, turn over, transport, Cytoplasmic RNA turnover Translation Post translational modification Protein localization Protein turnover

Accessibility of DNA in the nucleosome to RNA polymerase is regulated by the acetylation of lysine residues in the core histones. Methylation blocks transciption by alterring the chromatin conformation. Post transcriptional regulation

ALTERNATIVE SPLICING

Important control mechanism in higher organisms. eg: Rubisco activase,FCA genes Ribulose 1,5-bisphosphatecarboxylase/oxygenase activase Nuclear encoded gene for a chloroplast protein that regulates Rubisco activity in response to light induced changes in the redox potential and changes in the ADP/ATP ratio

2 isoforms are formed, the larger one having more aminoacids in the C terminus, sensitive to ADP inhibition, redox regulated. The smaller one can also regulate Rubisco activity. The sensitivity to ADP in the larger isoform depends on the presence of 2 cysteine residues in the C terminus, which disulphide bonds is involved in the redox regulation of Rubisco. Larger one influences the activity of the smaller one.

Alternative splicing was first observed in 1977 in adenoviruses. Adenoviruses produce two different primary transcripts, one early in the life cycle and one later, after DNA replication. Researchers found that the primary RNA transcript produced by adenovirus type 2 in the late phase was spliced in different ways, resulting in mRNAs encoding different viral proteins. Both 5 and 3 splice sites varied, and in addition, the transcript contained multiple poly A sites, giving different 3 ends for the processed mRNAs.

Five basic modes of alternative splicing are generally recognized. Exon skipping or cassette exon: in this case, an exon may be spliced out of the primary transcript or retained. This is the most common mode in mammalian premRNAs. Mutually exclusive exons: One of two exons is retained in mRNAs after splicing, but not both. Alternative donor site: An alternative 5' splice junction (donor site) is used, changing the 3' boundary of the upstream exon. Alternative acceptor site: An alternative 3' splice junction (acceptor site) is used, changing the 5' boundary of the downstream exon.

Intron retention: A sequence may be spliced out as an intron or simply retained. This is distinguished from exon skipping because the retained sequence is not flanked by introns. If the retained intron is in the coding region, the intron must encode amino acids in frame with the neighboring exons, or a stop codon or a shift in the reading frame will cause the protein to be nonfunctional. This is the rarest mode in mammals.

In addition to these primary modes of alternative splicing, there are two other main mechanisms by which different mRNAs may be generated from the same gene; multiple promoters and multiple polyadenylation sites. Use of multiple promoters is properly described as transcriptional regulation mechanism rather than alternative splicing. By starting transcription at different points, transcripts with different 5'most exons can be generated. At the other end, multiple polyadenylation sites provide different 3' end points for the transcript. Both of these mechanisms are found in combination with alternative splicing and provide additional variety in mRNAs derived from a gene.

Splicing is regulated by trans acting proteins (repressors and activators), corresponding cis -acting regulatory sites (silencers and enhancers) on the RNA, and other RNA features that influence how splicing will occur, such as secondary structures. Together, these elements form a "splicing code" that governs how splicing will occur under different cellular conditions

There are two major types of cis acting RNA sequence elements present in pre-mRNAs and they have corresponding trans acting RNA binding proteins. Splicing silencers are sites to which splicing repressor proteins bind, reducing the probability that a nearby site will be used as a splice junction. These can be located in the intron itself (intronic splicing silencers, ISS) or in a neighboring exon (exonic splicing silencers, ESS). Vary in sequence, as well as in the types of proteins that bind to them. The majority of splicing repressors are heterogenous nuclear ribonuclear proteins (hnRNPs) such as hnRNPA1 and polypyrimidine tract binding protein (PTB).