Vous êtes sur la page 1sur 273

/

:
Molecular Biology
.
BIOL 312
Molecular Biology

BIOL 312
: 3
: BI
: G29
: G29
: 11:40 01:20
: 11:40 01:20
: F 37
: 11:40 01:20
: 8:00 9:40

Exercises & Homework 5%
Essay / Report 10%
Participation 5%
Midterm 20%
Project / presentation 10%
Lab final 15%
Final Exam 40%
Molecular Biology
Molecular biology =

1. The branch of biology that deals with the formation,
structure, and function of macromolecules essential to life,
such as nucleic acids and proteins, and especially with
their role in cell replication and the transmission of genetic
information.
2. The branch of biology that deals with the manipulation
of DNA so that it can be sequenced or mutated. If
mutated, the DNA is often inserted into the genome of an
organism to study the biological effects of the mutation.

Genetic Engineering
1. Genetic Engineering = is the development and
application of scientific procedures and technologies
that permit direct manipulation of genetic material in
order to alter the hereditary traits of a cell, organism,
or population.

2. Genetic Engineering = is a technique producing
unlimited amounts of otherwise unavailable or scarce
biological products by introducing DNA from living
organisms into bacteria and then harvesting the product,
as human insulin produced in bacteria by the human
insulin gene. Also called biogenetics.
INTRODUCTION TO ORGANIC
COMPOUNDS
Lifes molecular diversity is based on the properties of
carbon
Diverse molecules found in cells are
composed of carbon bonded to
other carbons and
atoms of other elements.
Carbon-based molecules are called organic
compounds.
Lifes molecular diversity is based on the properties of
carbon
By sharing electrons, carbon can
bond to four other atoms and
branch in up to four directions.
Methane (CH
4
) is one of the simplest
organic compounds.
Four covalent bonds link four hydrogen atoms
to the carbon atom.
Each of the four lines in the formula for
methane represents a pair of shared electrons.
Lifes molecular diversity is based on the properties of
carbon
Methane and other compounds composed of
only carbon and hydrogen are called
hydrocarbons.
Carbon, with attached hydrogens, can bond
together in chains of various lengths.
Structural
formula
Ball-and-stick
model
Space-filling
model
The four single bonds of carbon point to the corners of a tetrahedron.
A carbon skeleton is a chain of carbon
atoms that can be
branched or
unbranched.
Compounds with the same formula but
different structural arrangements are call
isomers.
Lifes molecular diversity is based on the
properties of carbon
Animation: L-Dopa
Right click on animation / Click play
Animation: Carbon Skeletons
Right click on animation / Click play
Animation: Isomers
Right click on animation / Click play
Length. Carbon skeletons vary in length.
Ethane Propane
Butane Isobutane
Branching. Skeletons may be unbranched
or branched.
Double bonds. Skeletons may have double bonds.
1-Butene 2-Butene
Cyclohexane Benzene
Rings. Skeletons may be arranged in rings.
Length. Carbon skeletons vary in length.
Ethane Propane
Butane Isobutane
Branching.
Skeletons may be unbranched
or branched.
Double bonds.
1-Butene 2-Butene
Skeletons may have double bonds.
Cyclohexane
Benzene
Rings. Skeletons may be arranged in rings.
A few chemical groups are key to the functioning of
biological molecules
An organic compound has unique properties
that depend upon the
size and shape of the molecule and
groups of atoms (functional groups) attached to
it.
A functional group affects a biological
molecules function in a characteristic way.
Compounds containing functional groups are
hydrophilic (water-loving).
3.2 A few chemical groups are key to the functioning of
biological molecules
The functional groups are
hydroxyl groupconsists of a hydrogen bonded
to an oxygen,
carbonyl groupa carbon linked by a double
bond to an oxygen atom,
carboxyl groupconsists of a carbon double-
bonded to both an oxygen and a hydroxyl group,
amino groupcomposed of a nitrogen bonded to
two hydrogen atoms and the carbon skeleton, and
phosphate groupconsists of a phosphorus atom
bonded to four oxygen atoms.
A few chemical groups are key to the functioning of
biological molecules
An example of similar compounds that differ
only in functional groups is sex hormones.
Male and female sex hormones differ only in
functional groups.
The differences cause varied molecular actions.
The result is distinguishable features of males
and females.
Testosterone Estradiol
Testosterone Estradiol
Cells make a huge number of large molecules from a
limited set of small molecules
There are four classes of molecules important
to organisms:
carbohydrates,
proteins,
lipids, and
nucleic acids.
Cells make a huge number of large molecules from a
limited set of small molecules
The four classes of biological molecules contain
very large molecules.
They are often called macromolecules because of
their large size.
They are also called polymers because they are
made from identical building blocks strung together.
The building blocks of polymers are called
monomers.
Cells make a huge number of large molecules from a
limited set of small molecules
Monomers are linked together to form
polymers through dehydration reactions,
which remove water.
Polymers are broken apart by hydrolysis,
the addition of water.
All biological reactions of this sort are
mediated by enzymes, which speed up
chemical reactions in cells.
Animation: Polymers
Right click on animation / Click play
A cell makes a large number of polymers
from a small group of monomers. For
example,
proteins are made from only 20 different amino
acids and
DNA is built from just four kinds of nucleotides.
The monomers used to make polymers are
universal.
Cells make a huge number of large molecules from a
limited set of small molecules
Figure 3.3A_s1
Short polymer
Unlinked
monomer
Figure 3.3A_s2
Short polymer
Unlinked
monomer
Dehydration reaction
forms a new bond
Longer polymer
Figure 3.3B_s1
Figure 3.3B_s2
Hydrolysis
breaks a bond
CARBOHYDRATES
Monosaccharides are the simplest carbohydrates
Carbohydrates range from small sugar
molecules (monomers) to large polysaccharides.
Sugar monomers are monosaccharides, such
as those found in honey,
glucose, and
fructose.
Monosaccharides can be hooked together to
form
more complex sugars and
polysaccharides.
Monosaccharides are the simplest carbohydrates
The carbon skeletons of monosaccharides
vary in length.
Glucose and fructose are six carbons long.
Others have three to seven carbon atoms.
Monosaccharides are
the main fuels for cellular work and
used as raw materials to manufacture other
organic molecules.
Glucose
(an aldose)
Fructose
(a ketose)
Monosaccharides are the simplest carbohydrates
Many monosaccharides form rings.
Structural
formula
Abbreviated
structure
Simplified
structure
6
5
4
3 2
1
Two monosaccharides are linked to form a disaccharide
Two monosaccharides (monomers) can
bond to form a disaccharide in a
dehydration reaction.
The disaccharide sucrose is formed by
combining
a glucose monomer and
a fructose monomer.
The disaccharide maltose is formed from
two glucose monomers.
Animation: Disaccharides
Right click on animation / Click play
Glucose Glucose
Glucose Glucose
Maltose
Polysaccharides are long chains of sugar units
Polysaccharides are
macromolecules and
polymers composed of thousands of
monosaccharides.
Polysaccharides may function as
storage molecules or
structural compounds.
Polysaccharides are long chains of sugar units
Starch is
a polysaccharide,
composed of glucose monomers, and
used by plants for energy storage.
Glycogen is
a polysaccharide,
composed of glucose monomers, and
used by animals for energy storage.

Polysaccharides are long chains of sugar units
Cellulose
is a polymer of glucose and
forms plant cell walls.
Chitin is
a polysaccharide and
used by insects and crustaceans to build an
exoskeleton.
Starch granules
in potato tuber cells
Glycogen granules
in muscle
tissue
Glycogen
Glucose
monomer
Starch
Cellulose
Hydrogen bonds
Cellulose
molecules
Cellulose microfibrils
in a plant cell wall
LIPIDS
Fats are lipids that are mostly energy-storage molecules
Lipids
are water insoluble (hydrophobic, or water-
fearing) compounds,
are important in long-term energy storage,
contain twice as much energy as a
polysaccharide, and
consist mainly of carbon and hydrogen atoms
linked by nonpolar covalent bonds.
Fats are lipids that are mostly energy-storage molecules
Lipids differ from carbohydrates, proteins,
and nucleic acids in that they are
not huge molecules and
not built from monomers.
Lipids vary a great deal in
structure and
function.
Fats are lipids that are mostly energy-storage molecules
We will consider three types of lipids:
fats,
phospholipids, and
steroids.
A fat is a large lipid made from two kinds of
smaller molecules,
glycerol and
fatty acids.
Fats are lipids that are mostly energy-storage molecules
A fatty acid can link to glycerol by a
dehydration reaction.
A fat contains one glycerol linked to three
fatty acids.
Fats are often called triglycerides because of
their structure.
Animation: Fats
Right click on animation / Click play
Fatty acid
Glycerol
Fatty acids
Glycerol
Fats are lipids that are mostly energy-storage molecules
Some fatty acids contain one or more double
bonds, forming unsaturated fatty acids that
have one fewer hydrogen atom on each carbon
of the double bond,
cause kinks or bends in the carbon chain, and
prevent them from packing together tightly and
solidifying at room temperature.
Fats with the maximum number of
hydrogens are called saturated fatty acids.
Fats are lipids that are mostly energy-storage molecules
Unsaturated fats include corn and olive oils.
Most animal fats are saturated fats.
Hydrogenated vegetable oils are
unsaturated fats that have been converted to
saturated fats by adding hydrogen.
This hydrogenation creates trans fats
associated with health risks.
Phospholipids and steroids are important lipids with a
variety of functions
Phospholipids are
structurally similar to fats and
the major component of all cells.
Phospholipids are structurally similar to fats.
Fats contain three fatty acids attached to
glycerol.
Phospholipids contain two fatty acids attached
to glycerol.

Water
Hydrophobic tails
Water
Hydrophilic heads
Symbol for phospholipid
Phosphate
group
Glycerol
PROTEINS
Proteins are made from amino acids linked by peptide
bonds
Proteins are
involved in nearly every dynamic function in
your body and
very diverse, with tens of thousands of different
proteins, each with a specific structure and
function, in the human body.
Proteins are composed of differing
arrangements of a common set of just 20
amino acid monomers.

Proteins are made from amino acids linked by peptide
bonds
Amino acids have
an amino group and
a carboxyl group (which makes it an acid).
Also bonded to the central carbon is
a hydrogen atom and
a chemical group symbolized by R, which
determines the specific properties of each of the
20 amino acids used to make proteins.
Amino
group
Carboxyl
group
3.11 Proteins are made from amino acids linked by
peptide bonds
Amino acids are classified as either
hydrophobic or
hydrophilic.
Hydrophobic Hydrophilic
Aspartic acid (Asp) Serine (Ser) Leucine (Leu)
Proteins are made from amino acids linked by peptide
bonds
Amino acid monomers are linked together
in a dehydration reaction,
joining carboxyl group of one amino acid to the
amino group of the next amino acid, and
creating a peptide bond.
Additional amino acids can be added by the
same process to create a chain of amino
acids called a polypeptide.
Carboxyl
group
Amino
group
Amino acid Amino acid
Carboxyl
group
Amino
group
Amino acid Amino acid Dipeptide
Peptide
bond
Dehydration
reaction
A proteins specific shape determines its function
Probably the most important role for proteins
is as enzymes, proteins that
serve as metabolic catalysts and
regulate the chemical reactions within cells.

A proteins specific shape determines its function
Other proteins are also important.
Structural proteins provide associations between body parts.
Contractile proteins are found within muscle.
Defensive proteins include antibodies of the immune system.
Signal proteins are best exemplified by hormones and other
chemical messengers.
Receptor proteins transmit signals into cells.
Transport proteins carry oxygen.
Storage proteins serve as a source of amino acids for developing
embryos.
A proteins specific shape determines its function
If a proteins shape is altered, it can no
longer function.
In the process of denaturation, a
polypeptide chain
unravels,
loses its shape, and
loses its function.
Proteins can be denatured by changes in
salt concentration, pH, or by high heat.
NUCLEIC ACIDS
Avery, MacLeod and McCarty
1944 Avery, MacLeod and McCarty repeated
Griffiths 1928 experiment with modifications
designed to discover the transforming factor
Extracts from heat killed cells were digested
with hydrolytic enzymes specific for different
classes of macro molecules:
No Nuclease
Yes Protease
Yes Lippase
Transformation? Enzyme
Yes Saccharase
Transformation Of Bacteria
Two Strains Of Streptococcus
Capsules
Smooth Strain
(Virulent)
Rough Strain
(Harmless)
Experimental
Transformation Of Bacteria
The Griffith Experiment
- Control
+ Control
- Control
OUCH!
The Hershey-Chase Experiment
The Hershey-Chase experiment showed
definitively that DNA is the genetic material
Hershey and Chase took advantage of the fact
that T2 phage is made of only two classes of
macromolecules: Protein and DNA
H OH
P
O
OH
HO O
NH
2

Nucleotides contain
phosphorous, thus DNA contains
phosphorous, but not sulfur.
H
OH
O
H
2
N C C
CH
2

SH
H
OH
O
H
2
N C
CH
3

C
CH
2

CH
2

S Some amino acids
contain sulfur, thus
proteins contain sulfur,
but not phosphorous.
Cysteine Methionine
Using S
35

Bacteria grown in
normal non-
radioactive media
T2 grown in S
35

containing media
incorporate S
35

into their
proteins
Blending causes phage
protein coat to fall off
T2 attach to bacteria
and inject genetic
material
Is protein the genetic
material?
When centrifuged,
phage protein coats
remain in the
supernatant while
bacteria form a
pellet
The supernatant is
radioactive, but the
pellet is not.
Did protein enter the
bacteria?
Using P
32

Bacteria grown in
normal non-
radioactive media
T2 grown in P
32

containing media
incorporate P
32

into their DNA
Blending causes phage
protein coat to fall off
T2 attach to bacteria
and inject genetic
material
Is DNA the genetic material?
When centrifuged,
phage protein coats
remain in the
supernatant while
bacteria form a
pellet
The pellet is
radioactive, but the
supernatant is not.
Did DNA enter the bacteria?
DNA and RNA are the two types of nucleic acids
The amino acid sequence of a polypeptide is
programmed by a discrete unit of inheritance
known as a gene.
Genes consist of DNA(deoxyribonucleic
acid), a type of nucleic acid.
DNA is inherited from an organisms parents.
DNA provides directions for its own
replication.
DNA programs a cells activities by directing
the synthesis of proteins.
DNA and RNA are the two types of nucleic acids
DNA does not build proteins directly.
DNA works through an intermediary,
ribonucleic acid (RNA).
DNA is transcribed into RNA.
RNA is translated into proteins.


Gene
DNA
Gene
DNA
Transcription
RNA
Nucleic acids
Gene
DNA
Transcription
RNA
Protein
Translation
Amino
acid
Nucleic acids
Nucleic acids are polymers of nucleotides
DNA (deoxyribonucleic acid) and RNA
(ribonucleic acid) are composed of
monomers called nucleotides.
Nucleotides have three parts:
a five-carbon sugar called ribose in RNA and
deoxyribose in DNA,
a phosphate group, and
a nitrogenous base.


Phosphate
group
Sugar
Nitrogenous
base
(adenine)
Nucleic acids are polymers of nucleotides
DNA nitrogenous bases are
adenine (A),
thymine (T),
cytosine (C), and
guanine (G).
RNA
also has A, C, and G,
but instead of T, it has uracil (U).
Pyrimidines
NH
2

O
N
N
NH
N
Guanine
N
N
Adenine
N
N
NH
2

N O
NH
2

N O
NH
2

N
Cytosine
Uracil
(RNA)
CH
3

N O N
O
NH
N O N
O
NH
Thymine
(DNA)
Purines
Nucleic acids are polymers of nucleotides
A nucleic acid polymer, a polynucleotide,
forms
from the nucleotide monomers,
when the phosphate of one nucleotide bonds to
the sugar of the next nucleotide,
by dehydration reactions, and
by producing a repeating sugar-phosphate
backbone with protruding nitrogenous bases.
A
T
C
G
T
Nucleotide
Sugar-phosphate
backbone
Nucleic acids are polymers of nucleotides
Two polynucleotide strands wrap around
each other to form a DNA double helix.
The two strands are associated because
particular bases always hydrogen bond to one
another.
A pairs with T, and C pairs with G, producing
base pairs.
RNA is usually a single polynucleotide
strand.
The Watson - Crick
Model Of DNA
3.4 nm
1 nm
0.34 nm
Major
groove
Minor
groove
A T
T A
G C
C G
C G
G C
T A
A T
G C
T A
A T
C G
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
Forms of the Double Helix
0.26 nm
2.8 nm
Minor
groove
Major
groove
1.2 nm
A DNA
1 nm
Major
groove
Minor
groove
A T
T A
G C
C G
C G
G C
T A
A T
G C
T A
A T
C G
0.34 nm
3.9 nm
B DNA
+34.7
o
Rotation/Bp
11 Bp/turn
-30.0
o
Rotation/Bp
12 Bp/turn
+34.6
o
Rotation/Bp
10.4 Bp/turn
0.57 nm
6.8 nm
0.9 nm
Z DNA
Question:



If you had 30% Adenine in a piece
of DNA, how much Guanine is
there?
H
P
O
-
O
O
O
CH
2

H OH
P
O
O
-
O
O
O
CH
2

H
P
O
O
-

-
O
O
O
CH
2

NH
2

N
N
N
N
O
O
NH
2

N
NH
N
N
N
O
NH
2

N
O
H
P
O
O
O
CH
2

H
P
O
-

O
O
CH
2

O
O
H OH
P
O
O
-

O
O
CH
2

O
-

O
-

Distribution Of Negative Charge Prevents
DNA Annealing
NaCl
H
P
O
-
O
O
O
CH
2

H OH
P
O
O
-
O
O
O
CH
2

H
P
O
O
-

-
O
O
O
CH
2

NH
2

N
N
N
N
O
O
NH
2

N
NH
N
N
N
O
NH
2

N
O
H
P
O
O
O
CH
2

H
P
O
-

O
O
CH
2

O
O
H OH
P
O
O
-

O
O
CH
2

O
-

O
-

Cl
-

Na
+

Salts Allow DNA Annealing
Cat ions can cancel
out the negative
charge carried on
the sugar
phosphate
backbone.
Na
+

Na
+

Na
+

Na
+

Na
+

Na
+

Na
+

H
P
O
-
O
O
O
CH
2

H OH
P
O
O
-
O
O
O
CH
2

H
P
O
O
-

-
O
O
O
CH
2

NH
2

N
N
N
N
O
O
NH
2

N
NH
N
N
N
O
NH
2

N
O
H
P
O
O
O
CH
2

H
P
O
-

O
O
CH
2

O
O
H OH
P
O
O
-

O
O
CH
2

O
-

O
-

Salts Allow DNA Annealing
Na
+

Na
+

Na
+

Na
+

Na
+

Na
+

O
H
P
O
O
O
CH
2

H
P
O
-

O
O
CH
2

O
O
H OH
P
O
O
-

O
O
CH
2

O
-

O
-

Salts Allow DNA Annealing
H
P
O
-
O
O
O
CH
2

H OH
P
O
O
-
O
O
O
CH
2

H
P
O
O
-

-
O
O
O
CH
2

NH
2

N
N
N
N
O
O
NH
2

N
NH
N
N
N
O
NH
2

N
Na
+

Na
+

Na
+

Na
+

Central Dogma of Molecular
Biology
DNA mRNA Protein
replication
transcription
translation
3` end
Sugar-phosphate
backbone
Base pair (joined by
hydrogen bonding)
Old strands
Nucleotide about to be
added to a new strand
A
3` end
3` end
5` end
New strands
3` end
5` end
5` end
C G
C G
A T
C G
A T
A
T
G C
A T
A T
T A
5` end
DNA Replication
Is DNA Replication Dispersive,
Conservative or Semiconservative?
All models fit
the Watson-
Crick model
of DNA
prediction:
exact
copying of
genetic
information.
Equilibrium
Density
Centrifugation in
DNA Analysis
M. Meselson
W. F. Stahl
January 2008
Semiconservative Replication of Density-Labeled DNA
Is DNA Replication Unidirectional
or Bidirectional?
(a). Linear DNA virus
(b). Some bacterial
plasmid
(c). Most organisms
Evidence for
Bidirectional
Replication
Replication begins at specific sites
where the two parental strands
separate and form replication
bubbles.
The bubbles expand laterally, as
DNA replication proceeds in both
directions.
Eventually, the replication
bubbles fuse, and synthesis of
the daughter strands is
complete.
1
2
3
Origin of replication
Bubble
Parental (template) strand
Daughter (new) strand
Replication fork
Two daughter DNA molecules
In eukaryotes, DNA replication begins at many sites along the giant DNA molecule of each
chromosome.
(a)
DNA Replication
DNA replicates, following the process of semi-conservative
replication.
Bacterial Replication and Cell division
No apparent chromosome
condensation
Origin used to separate chromosomes
Rate of DNA replication
E. coli
42 minutes
4,639,221 bp
1.4 mm
1000 bp/second/fork
Human
8 hours
3 x 10
9
bp
2 m
100 bp/second/fork
10,000 to 100,000 replicons
More than a dozen enzymes and other proteins participate in DNA replication

Much more is known about replication in bacteria than in eukaryotes
Each strand of the original molecule acts as a template for the synthesis
of a new complementary DNA molecule
DNA Replication Machinery
In E. coli, two different DNA polymerases are involved in replication: DNA
polymerase III and DNA polymerase I.
In eukaryotes, at least 11 different DNA polymerases have been identified
so far
DNA Replication Machinery
DNA Polymerase
Unable to separate the two strands of DNA
Only elongate a pre-existing DNA or RNA
(Primer)
Only add nucleotides to the 3-hyforxyl
group, i.e., only 5-3 synthesis
Genes and Proteins in DNA
Replication
Gene Protein
dnaA DnaA
dnaB DnaB or Helicase
dnaC DnaC
dnaG Primase
Initiation of DNA Replication
DnaA Protein Initiates Replication in E. coli
Initiation complex
Prepriming complex
Initiation of DNA Replication
DnaB is a helicase.
An enzyme moves
along DNA duplex
utilizing the energy of
ATP hydrolysis to
separate the strands.
5-3
Processive
SSB: single strand
binding protein.
The Role of RNA Primer
in DNA Replication
E. coli primase
catalyze the RNA
Primer for DNA
Synthesis
dnaG
Primosome:
primases+DnaB
Primer: <15 nts
DNA Pol III
600 kDa
Holoemzyme: 10
peptides
Core polymerase:
a: active site
: 3-5 exonuclease
: unkown
b-subunit dimer tethers the core of
E. coli DNA polymerase III to DNA
Rest of Pol III
distributive to
processive (5x10
5
nts)
b: clamp
b-subunit dimer tethers the core of
E. coli DNA polymerase III to DNA
Growing Fork
Leading
strand:
continuous
Lagging
strand:
discontinuous

Fidelity of DNA Replication
a subunit of Pol III error rate: 1 in 10
4

Observed mutation rate: 10
-9


3-5 proofreading exonuclease activity of DNA
polymerase
E. coli Pol I
E. coli Pol III subunit.
Mismatch repair system that distinguish newly
synthesized DNA from the old one.
Proofreading by 3 to 5
Exonuclease
Proofreading by 3 to 5
Exonuclease activity of DNA Pol
DNA Pol I Structure
A Summary of
DNA Replication
in Bacteria
A Summary of
DNA Replication
in Bacteria
E. coli replication proteins at a
growing fork
subunit
Holds two core
polymerase
Contacts DnaB
protein.
Properties of DNA Polymerase
E. coli Polymerase
I II III
Polymerization + + +
Exonuclease
3-5 + + +
5-3 + - -
Synthesis from
Intact DNA - - -
Primed Single Strand + - -
Primed Single Strand + - +
+SSB
Overwinding that occurs when
duplicating circular DNA.
Topoisomerase I
Nicking and then closing one strand of dsDNA
Topoisomerase II
Breaking and
rejoining double-
strand DNA
Topoisomerase II
separates chromosomes
at the end of DNA
replication.
Eukaryotic
Replication
Machinery
PCNA and b Clamp
Properties of DNA Polymerase
Mammalian Polymerase
a
b
g
d


January 2008
Replication of Circular DNA
The End-
Replication
Problem
The
Extension of
Telomeres by
Telomerase
Summary of DNA Replication
General Features
Semiconservative
Bidirectional
Replication origin
DNA replication machinery
Initiation proteins
Helicase
Primase
Polymerases
Leading and lagging strands
Telomerase
Topoisomerases in DNA replication
Overview

The information content of DNA is in the form of specific
sequences of nucleotides along the DNA strands.

The DNA inherited by an organism leads to specific traits
by dictating the synthesis of proteins.

Gene expression, the process by which DNA directs
protein synthesis, includes two stages called transcription
and translation.


Proteins are the links between genotype and phenotype.
Gene Expression
Transcription: synthesis of complementary RNA from
coding strand of DNA.
this RNA molecule is called a messenger RNA
(mRNA)

mRNA is synthesized by RNA polymerase.
Transcription
mRNA and DNA have same language (i.e. code).
Question:

If you have the following DNA sequence on a
template strand
3` ATG GGC CAC GTC AGA ACG GAA TAA CAT 5`
What would be the mRNA transcript?
3` ATG GGC CAC GTC AGA ACG GAA TAA CAT 5`
Template
5` TAC CCG GTG CAG TCT TGC CTT ATT GTA 3`
Coding
mRNA
5` UAC CCG GUG CAG UCU UGC CUU AUU GUA 3`
Transcription occurs in 3 stages:
1. RNA Pol binding and initiation
of transcription
Promoter

Transcription factors
2. Elongation of RNA strand
3. Termination of transcription
Transcription
Regulation of Gene
Expression
Control of Enzyme Synthesis
Cells can turn the synthesis of enzymes on
and off- usually based on environmental
clues.
Control is at the level of the DNA
May be slow to react- maybe hour to make
new one or longer to remove one.
Substrate or product of reaction usually the
regulatory compound- lactose most studied.
Operons Are Groups Of Genes
Expressed By Prokaryotes
Bacterial genes grouped in an operon are all
needed to complete a given task
Each operon is controlled by a single control
sequence in the DNA
Because the genes are grouped together, they
can be transcribed together then translated
together
The Lac Operon
Genes in the lac operon allow E. coli bacteria to
metabolize lactose
E. coli is unlikely to encounter lactose, so it would
be wasteful to produce the proteins needed to
metabolize it unless necessary
Metabolizing lactose for energy only makes sense
when two criteria are met:
Other more readily metabolized sugar (glucose) is
unavailable
Lactose is available
The Lac Operon - Parts
The lac operon is made up of a control region and
four genes:
1 LacZ - b-galactosidase - An enzyme that hydrolizes
the bond between galactose and glucose
2 LacY - Codes for a permease that lets lactose across
the cell membrane
3 LacA - Transacetylase - An enzyme whose function
in lactose metabolism is uncertain
4 Repressor - A constitutively expressed protein that
works with the control region to modulate
expression
b-Galactosidease
Lac Z
gene product
Lactose and b-Galactosidease
OH
O
OH
H
2
COH
HO
Glucose
O
O
OH
HOCH
2

HO
HO
Galactose
Lactose
O-b-D-galactopyranosyl-(1->4)-b-D-glucopyranose
H
2
O
b-Galactosidease
Lac Z
gene product
Lactose and b-Galactosidease
Glucose Galactose
The Lac Operon - Control
The control region is made up of two parts:
1 Promoter
Promoters are specific DNA sequences to which RNA
Polymerase binds so that transcription can occur
The lac operon promoter also has a binding site for
protein called Catabolite Activator Protein (CAP)
2 Operator
The binding site of the repressor protein
The operator is located down stream (in the 3
direction) from the promoter so that if repressor is
bound RNA Polymerase cant transcribe
The Lac Operon:
When Glucose Is Present But Not Lactose
Repressor Promoter
LacY LacA LacZ
Operator
CAP
Binding
RNA
Pol.
Repressor
Repressor
Repressor
mRNA
Hey man, Im
constitutive
Come on,
let me through
The Lac Operon:
When Glucose And Lactose Are Present
Repressor Promoter
LacY LacA LacZ
Operator
CAP
Binding
Repressor
Repressor
mRNA
Hey man, Im
constitutive
Repressor
Repressor
X
RNA
Pol.
RNA
Pol.
Great, I can
transcribe!
This lactose has
bent me
out of shape
We need CAP binding to the
promoter
But I need
cAMP/CAP
The Lac Operon:
When Lactose Is Present But Not Glucose
Repressor Promoter
LacY LacA LacZ
Operator
CAP
Binding
CAP
cAMP
Repressor
Repressor
mRNA
Hey man, Im
constitutive
Repressor
Repressor
X
This lactose has
bent me
out of shape
CAP
cAMP
Bind to me
Polymerase
RNA
Pol.
Yipee!
CAP
cAMP
RNA
Pol.
At last we meet
CAP my love
Genes in the operon are efficiently transcribed
Hey CAP,
lets get together
The Lac Operon:
When Neither Lactose Nor Glucose Is Present
Repressor Promoter
LacY LacA LacZ
Operator
CAP
Binding
CAP
cAMP
CAP
cAMP
CAP
cAMP
Bind to me
Polymerase
RNA
Pol.
Repressor
Repressor
mRNA
Hey man, Im
constitutive
Repressor
STOP
Right there
Polymerase
Alright, Im off to
the races . . .
Come on, let
me through!
Translation: synthesis of polypeptide under direction of
mRNA.
- involves a change from DNA language into protein
language.
- involves mRNA, ribosomes, transfer RNA (tRNA)
Translation
TRANSLATION
TRANSCRIPTION
DNA
mRNA
Ribosome
Polypeptide
Prokaryotic cell. In a cell lacking a nucleus, mRNA
produced by transcription is immediately translated
without additional processing.
(a)
TRANSCRIPTION
RNA PROCESSING
TRANSLATION
mRNA
DNA
Pre-mRNA
Polypeptide
Ribosome
Nuclear
envelope
Eukaryotic cell. The nucleus
provides a separate
compartment for transcription.
The original RNA
transcript, called pre-mRNA, is
processed in various
ways before leaving the
nucleus as mRNA.
(b)
Synthesis of polypeptide under the direction of mRNA

The message in mRNA is translated (interpreted) into protein
Translation process involves:
- Change from DNA language into protein language.
- mRNA, ribosomes, transfer RNA (tRNA)
Ability to extract intended message from written language
depends on reading the symbols in the correct sequence of
groupings. This ordering is called the reading frame.
DNA mRNA Protein
replication
transcription
translation
Translation
The Genetic Code
Triplet code
Codon = 3 nucleotides (bases)
Three consecutive bases specify an amino acid, creating
4
3
(64) possible code words.
Since there are 64 possible code words, and only 20 amino
acids, some amino acids are encoded by more than one code
word. Thus the genetic code is redundant
The genetic instructions for a polypeptide chain are written
in the DNA as a series of three-nucleotide words.
The Genetic Code
H
P
O
O
HO
O
O
CH
2

NH
2

N
NH
N
N
H OH
P
O
O
HO
O
O
CH
2

NH
2

N
N
N
N
H
P
O
OH
HO
O
O
CH
2

NH
2

N
N
N
N
O
A Codon
Guanine
Adenine
Adenine
Arginine
How Codons Work:
tRNA the Translators
tRNA - Transfer RNA
Relatively small RNA molecules that
fold in a complex way to produce a 3
dimensional shape with a specific
amino acid on one end and an
anticodon on another part
Associate a given amino acid with the
codon on the mRNA that codes for it
Methionine
Met-tRNA
U
*

9
26
22 23 Pu
16
12 Py 10
25
20:1
G
*

17:1
Pu
A
20:2
17
13
20
G
A
50 51
65 64 63
G
62
52
C
Pu
59
y
A
*

C
Py
T
49
39
41
42
31
29
28
Pu
*

43 1 27
U
35
38
36
Py
*

34
40 30
47:1
47:15
46
Py
47:16
45
44
47
73
C
C
A
70
71
72
66
67
68
69
3
2
1
7
6
5
4
A
C
U
Anticodon
A
E
Large
subunit
P
Small
subunit
Translation - Initiation
fMet
UAC
GAG...CU-AUG--UUC--CUU--AGU--GGU--AGA--GCU--GUA--UGA-AT GCA...TAAAAAA
5
mRNA
3
A
E
Ribosome
P
Arg
Aminoacyl tRNA
Phe
Leu
Met
Ser
Gly
Polypeptide
CCA
Translation - Elongation
GAG...CU-AUG--UUC--CUU--AGU--GGU--AGA--GCU--GUA--UGA-AT GCA...TAAAAAA
5
mRNA
3
A
E
Ribosome
P
Phe
Leu
Met
Ser
Gly
Polypeptide
Arg
Aminoacyl tRNA
UCU CCA
Translation - Elongation
GAG...CU-AUG--UUC--CUU--AGU--GGU--AGA--GCU--GUA--UGA-AT GCA...TAAAAAA
5
mRNA
3
ANYTHING
ACID
AMINE
Protein Synthesis
C
O
OH C N
H
H
H
C
HO H
C
H
O
C N
H
H
H
C
H H
C
H
O
OH C N
H
H
H
C
HO H
Serine
C
H
O
OH C N
H
H
H
C
H H
Alanine
H
C
O
OH C
R
N
H
H
Amino Acid
H
2
O
A
E
Ribosome
P
CCA
Arg
UCU
Phe
Leu
Met
Ser
Gly
Polypeptide
Translation - Elongation
GAG...CU-AUG--UUC--CUU--AGU--GGU--AGA--GCU--GUA--UGA-AT GCA...TAAAAAA
5
mRNA
3
A
E
Ribosome
P
Translation - Elongation
Aminoacyl tRNA
Ala
CCA
Arg
UCU
Phe
Leu
Met
Ser
Gly
Polypeptide
GAG...CU-AUG--UUC--CUU--AGU--GGU--AGA--GCU--GUA--UGA-AT GCA...TAAAAAA
5
mRNA
3
A
E
Ribosome
P
Translation - Elongation
Arg
UCU
Phe
Leu
Met
Ser
Gly
Polypeptide
CGA
Ala
GAG...CU-AUG--UUC--CUU--AGU--GGU--AGA--GCU--GUA--UGA-AT GCA...TAAAAAA
5
mRNA
3
Restriction Enzyme
Digestion
Cutting DNA molecules at specific locations.
Enzymes are the Tools of DNA
Technology
The tools of DNA technology are the same enzymes used
by cells to modify their own DNA:
DNA Polymerases
DNA Ligase
One special class of enzyme is pivotal to the cloning of
DNA and many other techniques used in DNA
Technology
These enzymes are the restriction endonucleases
Restriction - Because for the way they work, they restrict
bacteriophages to only one host bacterial strain. They are also
restricted to acting on only specific DNA sequences
Endonuclease - They cut nucleic acids in the middle not just
the ends
What is a Palindrome?
A palindrome is anything that reads the same
forwards and backwards:
English palindromes:
Mom
Dad
Tarzan raised Desi Arnaz rat.
Able was I ere I saw Elba (supposedly said by
Napoleon)
Doc note I dissent, a fast never prevents a fatness,
I diet on cod.
DNA Palindromes
Because DNA is double stranded and the strands
run antiparallel, palindromes are defined as any
double stranded DNA in which reading 5 to 3
both are the same
Some examples:
The EcoRI cutting site:
5'-GAATTC-3'
3'-CTTAAG-5'
The HindIII cutting site:
5'-AAGCTT-3'
3'-TTCGAA-5'
Type II restriction enzyme
nomenclature
EcoRI Escherichia coli strain R, 1
st
enzyme
BamHI Bacillus amyloliquefaciens strain H, 1
st
enzyme
DpnI Diplococcus pneumoniae, 1
st
enzyme
HindIII Haemophilus influenzae, strain D, 3
rd
enzyme
BglII Bacillus globigii, 2
nd
enzyme
PstI Providencia stuartii 164, 1
st
enzyme
Sau3AI Staphylococcus aureus strain 3A, 1
st
enzyme
KpnI Klebsiella pneumoniae, 1
st
enzyme
Joining linear DNA fragments together with covalent bonds
is called ligation. More specifically, DNA ligation involves
creating a phosphodiester bond between the 3' hydroxyl of
one nucleotide and the 5' phosphate of another.

The enzyme used to ligate DNA fragments is T4 DNA
ligase, which originates from the T4 bacteriophage.
Ligation
DNA cloning requires restriction
enzymes and DNA ligase
Consider a plasmid with a unique EcoRI
site:

5' NNNNGAATTCNNNN 3'
3 NNNNCTTAAGNNNN 5'

An EcoRI restriction fragment of foreign DNA can be
inserted into a plasmid having an EcoRI cloning site by:
a) cutting the plasmid at this site with EcoRI,
b) annealing the linearized plasmid with the EcoRI foreign
DNA fragment, and,
c) sealing the nicks with DNA ligase.

5' NNNNGAATTCNNNN 3'
3' NNNNCTTAAGNNNN 5

This results in a recombinant DNA molecule.
Gel Electrophoresis
Wells
Gel Electrophoresis
Wells
Gel Electrophoresis
+
-
Direction
of
DNA
Travel
Wells
Small
Large
gelelectrophoresis.exe
Restriction fragment analysis detects DNA differences that
affect restriction sites.
Restriction fragment length polymorphism
(RFLP)
Does a particular gene differ from person to person?
Are certain alleles associated with a hereditary disorder?
Where in the body and when during development is a gene
expressed?
What is the location of a gene in the genome?
Is expression of a particular gene related to expression of
other genes?
Restriction fragment analysis is sensitive enough to distinguish
between two alleles of a gene that differ by only one base pair
in a restriction site.
Genetic Engineering
Cloning Vectors
Plasmids are circular pieces of DNA found naturally in
bacteria.
Plasmids can carry antibiotic resistance genes, genes for
receptors, toxins or other proteins.
Ori
pUC18
Amp
r

MCS
LacZ
Plasmids replicate separately from
the genome of the organism.
Plasmids can be engineered to be
useful cloning vectors.
2,686 bp
pUC 18
A Typical Plasmid
Lac Z
Gene
Multiple Cloning
Site
aagcttgcatgcctgcaggtcgactctagaggatccccgggtaccgagctcgaattc
HindIII SphI PstI SalI XbaI BamHI XmaI KpnI SstI EcoRI
AccI SmaI BanII
HincII
BspMI
Origin
of Replication
Amp
r

Gene
Genetic Engineering
Cloning Vectors
Plasmid vectors can be designed with a variety
of features:
Antibiotic resistance
Colorimetric markers
Strong or weak promoters for driving expression of
a protein
Genetic Engineering
Cloning Vectors
Antibiotic
Resistance
Gene
Genetic Engineering
Cloning Vectors
Multiple
Cloning
Region
The cloning marker for this plasmid is the lacZ gene.
Selecting for Transformants
The transformed bacteria cells are grown on
selective media (containing antibiotic) to select
for cells that took up plasmid.
For blue/white selection to determine if the
plasmid contains an insert, the transformants
are grown on plates containing X-Gal and IPTG.
Genetic Engineering
Cloning Vectors
So How Do You Know If
You Cloned Something?
IPTG - Induces
expression of lacZ
X-Gal - A lactose analog
which turns blue when
split by b-galactosidase
Ampicillin - Kills all
bacteria that lack the
plasmid
X-Gal
5-Bromo-4-chloro-3-indolyl b-D-galactopyranoside
OH
O
OH
HOCH
2

HO
Glucose
O
O
OH
HOCH
2

HO
HO
Galactose
Lactose
O-b-D-galactopyranosyl-(1->4)-b-D-glucopyranose
b-Galactosidease
Lac Z
gene product
X-Gal
5-Bromo-4-chloro-3-indolyl b-D-galactopyranoside
N
H
Br
Cl
O
O
OH
HOCH
2

HO
HO
Galactose
X-Gal
(Colorless)
H
2
O
b-Galactosidease
X-Gal
5-Bromo-4-chloro-3-indolyl b-D-galactopyranoside
OH
O
OH
HOCH
2

HO
HO
Galactose
Blue
N
H
Br
Cl
HO
So How Do You Know If
You Cloned Something?
Blue colonies - Express b-galatosidase
which metabolizes colorles X-gal to blue
and turn blue thus lacZ is not disrupted
and there is no foreign DNA cloned
Cloned fragments
disrupt lacZ thus make
no b-galactosidase and
colonies remain white
IPTG - Induces
expression of lacZ
X-Gal - A lactose analog
which turns blue when
split by b-galactosidase
Ampicillin - Kills all
bacteria that lack the
plasmid
Strategy
Extract DNA
Fragment DNA
Insert into vector
DNA Library in bacteria
Screen library
and grow up bacteria with clone of interest
A Library
The clone of interest
Polymerase Chain
Reaction
History
The Polymerase Chain Reaction (PCR) was not a
discovery, but rather an invention
PCR uses a special DNA polymerase to make
many copies of a short length of DNA (100 -
10,000 bp) that is defined by primers
Kary Mullis was the inventor of PCR
PCR is so important that Mullis was awarded the
1993 Nobel Prize in Chemistry
What PCR Can Do
PCR can be used to make many copies of any
DNA that is supplied as a template
It can start with only one original and make an
almost infinite number of copies
Amplified fragments of DNA can be sequenced
to discover the code for a given gene
Defective genes can be amplified to diagnose any
number of illnesses
Genes from pathogens can be amplified to identify
them (ie. HIV)
Amplified fragments can act as genetic fingerprints
How PCR Works
PCR is an artificial way of doing DNA
replication
Instead of replicating all the DNA
present, only a small segment is
replicated, but this small segment is
replicated many times
As in replication, PCR involves:
Melting DNA = Denaturation
Priming = Annealing
Polymerization = Extension
Components of a PCR Reaction
Buffer (containing Mg
++
)
Template DNA
2 Primers that flank the fragment of
DNA to be amplified
dNTPs
Taq DNA Polymerase (or another
thermally stable DNA polymerase)
A thermophilic (heat-loving) bacteria called Thermus aquaticus is
the source of Taq DNA polymerase used in PCR reactions.
The first round of PCR
94C 37-65C 70-75C
PCR increases the yield of DNA
exponentially
PCR
Melting
94
o
C
T
e
m
p
e
r
a
t
u
r
e

100
0
50
T i m e
5 3
3 5
PCR
Melting
94
o
C
T
e
m
p
e
r
a
t
u
r
e

100
0
50
T i m e
3 5
5 3
Heat
PCR
Melting
94
o
C
Annealing
Primers
50
o
C
Extension
72
o
C
T
e
m
p
e
r
a
t
u
r
e

100
0
50
T i m e
3 5
5 3
5
5
Melting
94
o
C
PCR
Melting
94
o
C
Melting
94
o
C
Annealing
Primers
50
o
C
Extension
72
o
C
T
e
m
p
e
r
a
t
u
r
e

100
0
50
T i m e
30x
3 5
5 3
Heat
Heat
5
5
5
PCR
Melting
94
o
C
Melting
94
o
C
Annealing
Primers
50
o
C
Extension
72
o
C
T
e
m
p
e
r
a
t
u
r
e

100
0
50
T i m e
30x
3 5
5 3
5
5
5
5
5
5
PCR
Melting
94
o
C
Melting
94
o
C
Annealing
Primers
50
o
C
Extension
72
o
C
T
e
m
p
e
r
a
t
u
r
e

100
0
50
T i m e
30x
3 5
5 3
5
5
5
5
5
5
Heat
Heat
PCR
Melting
94
o
C
Melting
94
o
C
Annealing
Primers
50
o
C
Extension
72
o
C
T
e
m
p
e
r
a
t
u
r
e

100
0
50
T i m e
30x
3 5
5 3
5
5
5
5
5
5
5
5
5
5
Fragments of
defined length
PCR
Melting
94
o
C
Melting
94
o
C
Annealing
Primers
50
o
C
Extension
72
o
C
T
e
m
p
e
r
a
t
u
r
e

100
0
50
T i m e
30x
3 5
5 3
5
5
5
5
5
5
5
5
5
5
DNA Between The Primers Doubles With
Each Thermal Cycle
0
Cycles
Number
1
3
8
2
4
1
2
4
16
5
32
6
64
Gel electrophoresis
Indirect method to analyze and compare genomes
Separation of nucleic acids or proteins on the basis of their
rate of movement through a gel in an electrical field.

A method of separating large molecules (such as DNA
fragments or Proteins ) from a mixture of similar
molecules.

An electric current is passed through a medium
containing the mixture, and each kind of molecule travels
through the medium at a different rate, depending on its
electrical charge and size.

Agarose and acrylamide gels are the media commonly
used for electrophoresis of proteins and nucleic acids
The pH and other buffer conditions are arranged so
that the molecules being separated carry a net
(negative) charge so that they will me moved by the
electric field toward the positive pole.
As they move through the gel, the larger molecules
will be held up as they try to pass through the pores
of the gel, while the smaller molecules will be
impeded less and move faster.
This results in a separation by size, with the larger
molecules nearer the well and the smaller molecules
farther away.
The Phosphate groups on the backbone of
the DNA molecule readily give up their H
+
ions, therefore nucleic acids are negatively
charged in most buffer systems.

DNA molecules will migrate away from the
negative electrode (cathode), and migrate
towards the positive electrode (anode).

DNA molecules will migrate away from the negative
electrode (cathode), and migrate towards the positive
electrode (anode).
Rate of movement depends on:

1- Size
2- Electrical charge
3- Other physical properties of the macromolecules
Agarose (a polysaccharide isolated
from seaweed).
Ethidium bromide (a stain which
fluoresces under ultraviolet light when
bound to DNA).
Materials required
Agarose Gel Electrophoresis
Analysis of isolated DNA
Separation of DNA restricted with Hae III
(RFLP analysis) followed by a Southern Blot
and Hybridization with a labeled probe
Post Amplification confirmation and
qualitative assessment of PCR product

DNA sequencing
Reading the genetic code
Review of DNA replication
(synthesis) requirements
DNA synthesis occurs in the 5 to 3 direction.
DNA synthesis requires a template and a primer.
DNA replication is semi-conservative (one strand copied).
DNA replication is carried out by an enzyme called DNA
polymerase.
DNA synthesis requires a 3-OH to make the
next phosphodiester bond during DNA
synthesis
normal
dNTP
Dideoxy NTPs block DNA
synthesis
H
A mixture of dNTPs and ddNTPs
are used in DNA sequencing
Polyacrylamide gel electrophoresis is
used to visualize the results of the
sequencing reaction
Fluorescent dye coupled to
reaction allows visualization
of di-deoxy termination
events by means of a laser
that detects the colored
product.

This shows four different
reactions as done with the
old manual sequencing.
Automated DNA sequencing
with fluorescent dyes
coupled to each reaction
Automated DNA sequencing
with fluorescent dyes coupled
to each reaction
Automated DNA sequencing output-
4 reactions carried out in one tube
Mutations
Mutation = Change
DNA
mRNA
Transcription
Introduction
The Central Dogma
of Molecular Biology
Cell
Polypeptide
(protein)
Translation
Ribosome
Macromutations
Four major types of Macromutations are
recognized:
1 Deletions - Loss of chromosome sections
2 Duplications - Duplication of chromosome
sections
3 Inversions - Flipping of parts of chromosomes
4 Translocations - Movement of one part of a
chromosome to another part
Macromutation - Deletion
Chromosome
Centromere
A B C D E F G H
Genes
E F
A B C D G H
Macromutation - Duplication
Chromosome
Centromere
A B C D E F G H
Genes
A B C D E F E F G H E F
Duplication
Macromutation - Inversion
Chromosome
Centromere
A B C D F E G H
Genes
A B C D E F G H
Inversion
Macromutation - Translocation
A B E F C D G H
Chromosome
Centromere
Genes
A B C D E F G H
Micro or Point Mutations
Two major types of Macromutations are recognized:
1 Frame Shift - Loss or addition of one or two nucleotides
2 Substitutions - Replacement of one nucleotide by
another one. There are a number of different types:
Transition - Substitution of one purine for another purine,
or one pyrimidine for another pyrimidine.
Transversion - Replacement of a purine with a pyrimidine
or vice versa.
Frame Shift Mutations
5
AGUC-AUG-ACU-UUG-GUA-GUU-GAC-UAG-AAA
3

3
AGTTCAG-TAC-TGA-AAC-CAT-CAA-CTG-ATCATC
5

3
AGTTCAG-TAC-TGA-ACA-CCA-TCA-ACT-GATCATC
5

5
AGUC-AUG-ACU-UGU-GGU-AGU-UGA-CUAGAAA
3

Met Thr Cys
Gly
Ser
Met Thr Val Val Val Leu
Frame shift mutations tend to have a dramatic effect on proteins as
all codons down stream from the mutation are changed and thus
code for different amino acids. As a result of the frame shift, the
length of the polypeptide may also be changed as a stop codon will
probably come at a different spot than the original stop codon.
Purine to
Pyrimidine
Transversion
Pyrimidine to
Pyrimidine
Transition
Substitution Mutations
3
AGTTCAG-TAC-TGA-ATA-CCA-TCA-ACT-GATCATC
5

3
AGTTCAG-TAC-TGA-ACA-CCA-TCA-ACT-GATCATC
5

5
AGUC-AUG-ACU-UGU-GGU-AGU-UGA-CUAGAAA
3

Met Thr Cys
Gly
Ser
3
AGTTCAG-TAC-TGA-AAA-CCA-TCA-ACT-GATCATC
5

3
AGTTCAG-TAC-TGA-ACA-CCA-TCA-ACT-GATCATC
5

5
AGUC-AUG-ACU-UGU-GGU-AGU-UGA-CUAGAAA
3

Met Thr Cys
Gly
Ser
5
AGUC-AUG-ACU-UAU-GGU-AGU-UGA-CUAGAAA
3

Met Thr
Gly
Ser Tyr
5
AGUC-AUG-ACU-UUU-GGU-AGU-UGA-CUAGAAA
3

Met Thr
Gly
Ser
Phe
Val
Mutant b-globin
H
2
N
OH
OH
C
O
H
2
C
H
C
CH
2

C
O
Acid
Glu
Normal b-globin
T C T
Normal b-globin DNA
H
2
N
OH
C
O
H
3
C
H
C
CH
CH
3

Neutral
Non-polar
A G A
mRNA
T C A
Mutant b-globin DNA
A G U
mRNA
The Sickle Cell Anemia Mutation
Thymine Dimers
Thymine
Thymine
H
P
O
HO
O
O
CH
2

OH
H
P
O
OH
HO
O
O
CH
2

O
O
H
H
P
OH
O
O
CH
2

O
O
H
H OH
P
O
OH
O
O
CH
2

NH
2

N
N
N
N
NH
2

N
N
N
N
Thymine Dimers
Thymine
Thymine
H
P
O
HO
O
O
CH
2

OH
H
P
O
OH
HO
O
O
CH
2

O
O
H
H
P
OH
O
O
CH
2

O
O
H
H OH
P
O
OH
O
O
CH
2

NH
2

N
N
N
N
NH
2

N
N
N
N
Thymine Dimers
Thymine
Thymine
OH
H
P
O
HO
O
O
CH
2

OH
H
P
O
OH
HO
O
O
CH
2

O
H OH
O
O
CH
2

NH
2

N
N
N
N
NH
2

N
N
N
N
O
H
H
P
O
O
CH
2

O
O
H
P OH
O
P
h
o
t
o
l
y
a
s
e

Thymine Dimers
Thymine
Thymine
H
P
O
HO
O
O
CH
2

OH
H
P
O
OH
HO
O
O
CH
2

O
O
H
H
P
OH
O
O
CH
2

O
O
H
H OH
P
O
OH
O
O
CH
2

NH
2

N
N
N
N
NH
2

N
N
N
N
P
h
o
t
o
l
y
a
s
e

Thymine Dimers
Thymine
Thymine
H
P
O
HO
O
O
CH
2

OH
H
P
O
OH
HO
O
O
CH
2

O
O
H
H
P
OH
O
O
CH
2

O
O
H
H OH
P
O
OH
O
O
CH
2

NH
2

N
N
N
N
NH
2

N
N
N
N
Recombination
Ways Bacteria Exchange Genetic
Material
1 Transformation - Bacteria take up DNA from
their environment and incorporate it into their
genome (i.e. the Griffith experiment)
2 Conjugation - The direct transfer of DNA by
bacteria usually via plasmids
3 Transduction - Movement of DNA between
bacteria by viruses
Transformation Of Bacteria
Two Strains Of Streptococcus
Capsules
Smooth Strain
(Virulent)
Rough Strain
(Harmless)
Experimental
Transformation Of Bacteria
The Griffith Experiment
- Control
+ Control
- Control
OUCH!
Avery, MacLeod and McCarty
1944 Avery, MacLeod and McCarty decided to
repeat Griffiths 1928 experiment and try to
discover the transforming factor
They did this by using extracts from the heat
killed cells and digesting specific classes of
molecules with enzymes
No Nuclease
Yes Protease
Yes Lipase
Transformation? Enzyme
Yes Saccharase
1 Transformation
Insertion
Crossing
over
1 Transformation
1 Transformation
1 Transformation
1 Transformation
1 Transformation
F
-
bacteria
2 Conjugation
F plasmid
Mating Bridge
F
+
bacteria
F
plasmid
2 Conjugation
F
-
bacteria
F plasmid
F
+
bacteria
F
plasmid
Mating Bridge
2 Conjugation
F
-
bacteria
F plasmid
F
+
bacteria
F
plasmid
Mating Bridge
2 Conjugation
F
-
bacteria
F plasmid
F
+
bacteria
F
plasmid
Mating Bridge
2 Conjugation
F
-
bacteria
F plasmid
F
+
bacteria
F
plasmid
F
plasmid
Mating Bridge
Transfer of
genetic material
Hfr Recombination
F
+
bacteria
F
-
bacteria
F plasmid
Integration
Hfr cell
Hfr Recombination
F
+
bacteria
Hfr cell F plasmid
Integration
F
-
bacteria
Recombinant
Bacteria
Phage Strategies
Lysis
Bacteriophage Attack
Destruction of
the bacterias
DNA
Replication of
the viral
genome
Production of
viral parts
Packaging
Infection
Phage Reproduction:
The Lytic Cycle
Destruction of
the bacterias
DNA
Replication of
the viral
genome
Production of
viral parts
Packaging
Infection
Lysis
Many generations
of bacteria
Temperate
phage
Phage Reproduction:
The Lysogenic Cycle
Integration of
phage DNA into
the bacterial
genome
Circularization
of phage DNA
Infection
On to the
lytic cycle
Exit of phage
3 Transduction
Generalized
Destruction of
the bacterias
DNA
Lysis
Replication of
the viral
genome
Production of
viral parts
Packaging
Infection
3 Transduction
Specialized
Temperate
Phage
Part of the
bacterias
DNA
Replication of
the viral
genome
Production of
viral parts
Packaging
Lysis