Vous êtes sur la page 1sur 44

C

I
T

S
E
O
S
S
N
S
E
4
G
U
A
1
A
0
I
Q M
S D
I
2
L
I E
G
E
E
T
R
N
B
U D O
D
O
O
F
T
S
E
C
E
I
X
S
O
R N
U
I
R
7
A
A IO
T
I
E
L
D
ES
T
V
U
R
C
A
U C E
M
M
R
O
F
O
L
T
N O IN R
M ES CT AU
Antoine Huguenin
D
E &
Laboratoire de

P
S GS
N

Parasitologie Mycologie

Bref historique
-2000: Premires description cliniques de
myctomes (Atharvaveda)
1829: Champignon impliqu dans le favus
(Schnlein)
1876: R.Koch, bactrie responsible de
lanthrax
1881: R. Koch premier milieu de culture
1884: Coloration de GRAM
1977: Sanger squenage
1986-1988: premiers squenages de lADN
16S
1987 Premier automate de squenage
1988: Tanaka dcrit le principe du MALDI-TOF

Lessors des nouvelles techniques


Depuis 2005:
Spectromtrie de masse:
PCR/ESI-TOF
MALDI-TOF
Gnomique
Explosion du squenage:
NGS (Next-Generation Sequencing)
NNGS (Next-Next Generation Sequencing)
PCR multiplex/puces ADN.

Pourquoi une telle acceleration?

Pourquoi une telle acceleration?

Hayden ECE. Biodefence since 9/11: The price of protection. Nature.


2011 Sep 7;:1502.

Le Saint-Graal de lidentification
En cas dattaque bioterroriste:
Identification RAPIDE (<24h) => pas
dtape de culture
Dtection SIMULTANEE de plusieurs
pathognes bactriens, viraux ou fongiques
Systme didentification TRANSPORTABLE
Detection des facteurs de
virulence/rsistances: SOUCHES
LETHALISES
Dtection de NOUVELLES SOUCHES
6

PCR/ESI-TOF
IBIS T5000 Biosensor (2006) Coopration
DARPA/Brker

ECKER D, DRADER J, GUTIERREZ J, GUTIERREZ A, HANNIS J, SCHINK A, et al. The Ibis


T5000 Universal Biosensor: An Automated Platform for Pathogen Identification and Strain
Typing. SAGE Publications; 2006 Dec;11(6):34151.

2006: IBIS T5000 Biosensor

2006: IBIS T5000 Biosensor

PLEX-ID (2009)

10

PLEX-ID (2009)

11

PLEX-ID (2009)
Broad Fungal Kit

12

MALDI-TOF vs ESI

13
Lavigne J-P, Espinal P, Dunyach-Remy C, Messad N, Pantel A, Sotto A. Mass
spectrometry: a revolution in clinical microbiology? Clinical Chemistry and

MALDI-TOF en myco levures


Score-oriented dendrogram of ATCC and DSMZ type strains of Candida species and yeastlike fungi (n = 18) Microflex LT spectrometer.

14

Marklein G et al. J. Clin. Microbiol. 2009;47:2912-2917

MALDI-TOF en myco champignons


filamenteux

15
Ranque S, Normand A-C, Cassagne C, Murat J-B, Bourgeois N, Dalle F, et al. MALDI-TOF
mass spectrometry identification of filamentous fungi in the clinical laboratory. Mycoses.

MALDI TOF les piges

16
Normand A-C, Cassagne C, Ranque S, L'Ollivier C, Fourquet P, Roesems S, et al. Assessment
of various parameters to improve MALDI-TOF MS reference spectra libraries constructed for
the routine identification of filamentous fungi. BMC Microbiol. BioMed Central Ltd; 2012 Dec

MALDI TOF importance de la


librairie

17

MS dans un laboratoire de
microbiologie

18
Fournier P-E, Drancourt M, Colson P, Rolain J-M, La Scola B, Raoult D. Modern clinical
microbiology: new challenges and solutions. Nature Microbiology Review; 2013 Aug

Next generation sequencing (NGS)


Next generation sequencing: plus vite, moins
chers, tude du gnome ou du transcriptome
complet

Illumina : Genome analyzer/MySeq


Ion Torrent: Personal Genome Machine/Proton
Roche 454 sequencing: GS Junior/FLX
SOLID Applied biosystem Life technology

Next-Next generation sequencing?


Helicos
PacBio
Oxford nanonopore

19

Next generation sequencing (NGS)

Gnome fungique entier: 10Mb-1Gb


Gnome humain entier : 10Gb
20

Squenage classique
Echantillon
Echantillon

Extraction
Extraction ADN
ADN

PCR:
PCR: amplification
amplification
dune
dune rgion
rgion
spcifique
spcifique

Squenage
Squenage

5 ATGTGCCCGATTATAT 3
21

Identification
Identification par
par
BLAST
BLAST

S. prolificans 98% homologie


S. apiospermum71%

NGS
Echantillon
Echantillon
clinique
clinique

Extraction
Extraction ADN
ADN

Fragmentation

Prparation
Prparation
librairie
librairie
Amplification
Amplification de
de la
la
librairie
librairie
Squenage
Squenage

Analyse
Analyse des
des
donnes
donnes

PCR emulsion

Adaptateur de
ligation/ code
barre
Gnration
de cluster

Ligation
Pyrosquenag
e
Semiconducteur
TCAGTGATTATGGTAAACGTTTCAATTGGTGTGTACCTTTTAAGTCTTGGTGTTTTCCC
ATTGTGGTGGT
CTTCTCTATCCGAGCTAGAGGGCAGAAGAACTACTTACATAACTTCATTTGCATTATTG
TTTGCATTTAA
TATCGGGTCTGCTCTAGCTCCTGATATCAACTCATTTATTGCCTTGAGAATGCTCTGT
GGGGCTGCTTCT
GCCAGTGTTCAAAGTGTAGGTGCTGGAACAGTGGCTGATTTATATATTAGCGAAGAT
AGAGGTAAAAATT
TGAGTTATTACTATTTGGGTCCACTACTGGCGCCGCTACTATCTCCAATTTTTGGATCT
TTGTTAGTGAA
TCGCTGGCCCTGGAGATCCACTCAATGGTTTATGGTTATTTTATCCGGATGTAATGTC
ATTCTTTTGACG

22

NGS Illumina

23

NGS Illumina
Prparation de la bibliothque: ADN simple brin,
avec adaptateurs de ligation

Fixation sur la surface chambre de raction

24

NGS Illumina
Ligation et synthse du brin complmentaire

25

NGS Illumina
Dnaturation des fragments doubles brins

26

NGS Illumina
La librairie est prte !

27

NGS Illuma

Squenage : amplified
single molecule
sequencing

28

NGS Ion Torrent

29

NGS Ion Torrent


Appareil photo
numrique

Millions de pixels,
convertissant la lumire en
information digitale

Ion Torrent sequencing chip

Millions de puits convertissant un signal


chimique en information digitale

30

NGS Ion Torrent

Quand un nuclotide est incorpore


une molcule dADN il y a libration
dun proton, responsable dun
changement de pH

Les nuclotides sont ajouts


squentiellement
Le pH est mesur par le semiconducteur
et il est converti en ajout ou non de
nuclotide

31

NGS Ion Torrent

32

NGS Ion Torrent

33

NGS Ion Torrent

34

NGS Ion Torrent


Copy DNA

Load chip

A sample of DNA is cut


into millions of
fragments, and each
fragment is attached
to its own bead

The beads are then


flowed across the
chip, each being
deposited into a well

The fragment is copied


until it covers the bead
This automated
process produces
millions of beads
covered with millions
of different fragments

Then the chip is


flooded with one of
the four nucleotides

Incorporate
nucleotide

If the next base on the


DNA strand is
complementary to this
nucleotide, a
nucleotide will be
incorporated and
a hydrogen ion will be
released
The hydrogen ion
changes the pH of the
solution in
the well

Detect and call

An ion-sensitive layer
beneath the well
measures that pH
change and converts it
to voltage
This voltage change is
recorded, indicating
the nucleotide has
been incorporated and
the
base is called
This process happens
simultaneously in

35

NGS: Applications en
myco

Epidmies de C. gattii: gnotype


VGIIA: 1999-2008 Vancouver Colombie britannique,
formes pulmonaires
VGIIC: 2007 Etat de Washington, Oregon virulence +
++

Origines de lpidmie?
Modifications gntiques lorigine de la
virulence?

Engelthaler DM, Hicks ND, Gillece JD, Roe CC, Schupp JM, Driebe EM, et al.
Cryptococcus gattii in North American Pacific Northwest: Whole-Population Genome
Analysis Provides Insights into Species Evolution and Dispersal. mBio. 2014 Jul

36

NGS: Applications
Squenage
gnome complet
118 souches
(Illumina)

37
Engelthaler DM, Hicks ND, Gillece JD, Roe CC, Schupp JM, Driebe EM, et al.
Cryptococcus gattii in North American Pacific Northwest: Whole-Population Genome
Analysis Provides Insights into Species Evolution and Dispersal. mBio. 2014 Jul

NGS: Applications
Souche VGIIA sud amricaines et nordamricaines trs
proches

38

NGS: Applications
Souche VGIIC nord-amricaines trs homognes

39

NGS: Applications
Origine sudamricaine des
VGIIC nordamricaines?

40
Engelthaler DM, Hicks ND, Gillece JD, Roe CC, Schupp JM, Driebe EM, et al.
Cryptococcus gattii in North American Pacific Northwest: Whole-Population Genome
Analysis Provides Insights into Species Evolution and Dispersal. mBio. 2014 Jul

NGS: Applications
Gne de
virulence?
Variant VGIIA
expression +++ des
gnes du cluster 3.
Contient
collagnase =>
facteur de virulence
pulmonaire? (idem
aspergillus)

41

Next Next Generation sequencing


Nanopore Mini-ion

42

Next Next Generation sequencing


Nanopore Mini-ion

43

Et maintenant LE
BIOFIRE
Par Hlne

44