History of Genetic Manipulation:

Recombinant DNA Technology

 Electrophoresis is a molecular technique

that separates nucleic acids and proteins
based on

Size
and

+-+Charge+-+

DNA is a negatively charged

molecule and therefore is
attracted to positive charges.

Agarose provides a matrix through

which DNA molecules migrate.
Size larger molecules move
through the matrix slower than small
molecules

How to make an agarose gel.

Weigh out a specified amount of agarose powder.

Add the correct amount of buffer.
Dissolve the agarose by boiling the solution.
Pour the gel in a casting tray.
Wait for the gel to polymerize.

Recombinant DNA technology

Techniques

that allows DNA to be combined

from different sources; also called gene or DNA
splicing

 Vector DNA source which can replicate and is

used to carry foreign genes or DNA fragments.
Lambda phage

Plasmid

Recombinant DNA A vector that has taken up a

foreign piece of DNA.

Restriction enzyme an enzyme which binds

to DNA at a specific base sequence and then
cuts the DNA.

Restriction enzymes are named after the

bacteria from which they were isolated.
a. Bacteria use restriction enzymes to chop up
foreign viral DNA.

Recognition site specific base sequence on DNA

where a restriction enzyme binds.
a. All recognition sites are palindromes, which means
they read the same way forward and backward.
(example: RACECAR

or

GAATTC
CTTAAG

b. Each restriction enzyme has its own unique

recognition site.

After cutting up a long piece

of DNA, you can run the
samples on an agarose gel.
a. The smaller fragments
migrate further than the
longer fragments.
b. The bands are compared to
standard DNA of known
sizes. This is often called
a DNA marker, or a DNA
ladder.

http://207.207.4.198/pub/flash/4/4.html

After analyzing your results, you draw a restriction map

of the cut sites.
a. A restriction map is a diagram of DNA showing
the cut sites of a series of restriction enzymes.

Restriction enzymes cut in the middle of the

recognition site.
a. When restriction enzymes cut down the middle of
the sequence, blunt ends are generated.
Example: GATC
CTAG

GA + TC
CT
AG

b. When restriction enzymes cut in a zig zag pattern,

sticky ends are generated.
Example: GAATTC
CTTAAG

G
CTTAAG

AATTC
G

i.

ii.

Sticky ends are very useful because if two different

pieces of DNA are cut with the same restriction
enzyme, the overhanging sticky ends will
complementarily base pair, creating a recombinant
DNA molecule.
DNA ligase will seal the nick in the phosphodiester
backbone.

Model Organisms
E.

coli grows rapidly (20 min generation time),

easy to work with, easy to transform, normally not
pathogenic, and inexpensive

Bacterial Transformation bacteria take up and express

foreign DNA, usually a plasmid.
Plasmid circular piece of DNA

Steps of Bacterial Transformation

1. Choose a bacterial host.
a. E.coli is a model organism.
i. Well studied
ii. No nuclear membranes
iii.Has enzymes necessary for replication

DNA/
Chrom.

Steps of Bacterial Transformation

2. Choose a plasmid to transform.
a.

Characteristics of a useful plasmid.

i. Single recognition site
Plasmid only cuts in one place, so this ensures that the
plasmid is reformed in the correct order.
ii. Origin of replication
Allows plasmid to replicate and make copies for new cells.
iii. Marker genes
Identifies cells that have been transformed.
gene for antibiotic resistance bacteria is plated on media
with an antibiotic, and only bacteria that have taken up a
plasmid will grow
gene that expresses color bacteria that have taken up a
recombinant plasmid are a different color than bacteria
that have taken up a NONrecombinat vector.

Steps of Bacterial Transformation

3. Prepare bacterial cells for transformation of plasmid.
a. Treat with calcium chloride, which allows plasmid to
pass through bacterial cell walls. This is the most
common method.
b. Electroporation - brief electric pulse
c. Directly inject plasmid into bacterial cell.

Steps of Bacterial Transformation

4. Plate transformation solution on appropriate media.
a. Contains nutrients for bacteria.
b. Contains antibiotic to distinguish transformed bacteria
from NONtransformed bacteria.

5. Incubate plates overnight.

a. E.coli grows in the human body,
and is therefore incubated at
body temperature (37C)

6. Analyze plates.
http://www.sumanasinc.com/webcontent/animations/content/plasmidcloning.html

Cosmids
Contain

cos ends of lambda DNA, a plasmid

origin of replication, and genes for antibiotic
resistance, but most of the viral genes have been
removed
Replicate a low copy no. plasmid

Bacterial Artificial
Chromosomes
Large,

low-copy-number plasmids, present as

one to two copies in bacterial cells that contain
genes encoding the F-factor.
BACs can accept DNA inserts in the 100- to 300
kb range
Widely used in the Human Genome Project.

Yeast Artificial Chromosomes

Small

plasmids grown in e. coli and introduced into

yeast cells.
Minature verision of a eukaryotic chromosome
Contains an origin of replication, selectable markers, two
telemeres, and a centromere that allows for replication of
the YAC and segregation into daughter cells
Used to clone 200 kb to 1 million bases in size
Used in the Human Genome Project

Expression Vectors
Contain

a promoter for max synthesis of mRNA which is

translated into protein
However

it is not always possible to express a functional

protein in bacteria
Doesnt

process (fold) the protein properly

Degrades the mRNA, or the protein is lethal to the bacteria
Viruses

(SV40) can be used as expression vectors in

mammalian cells (variations of SV40 have been used in gene
therapy)

How Do You Identify and Clone a

Gene of Interest? Build a Library
A

collection of cloned DNA fragments from a particular

organism contained within bacteria or viruses as the host
Can be saved for relatively long period of time
Screened to pick out different genes of interest
Two types are used:
Genomic

library and complementary DNA (cDNA) library

How are they made? (know figure 3.6)

http://www.sumanasinc.com/webcontent/animations/content/dnalibrary.html

 Rarely

is an entire gene is cloned in one piece, even in

a cDNA library
When small pieces of a gene are cloned, scientists
sequence these pieces and look for sequence overlaps
Overlapping fragments of DNA can be pieced together
like a puzzle in a reconstruct the full-length gene
Look for start and stop codons in the sequenced pieces
is one way to predict if the entire gene has been pieced
together
An example of DNA walking strategy

Chromosome Walking

POLYMERASE CHAIN
REACTION
"PCR has transformed molecular biology
through vastly extending the capacity to identify,
manipulate and reproduce DNA. It makes
abundant what was once scarce -- the genetic
material required for experimentations."

 The purpose of PCR is to amplify small amounts

of DNA to produce enough for analysis.

Reaction Requirements
Template starting amount of DNA
Target segment of DNA you wish to amplify

Reaction Requirements
Primers short pieces of single stranded DNA
that binds to the template DNA. Allows DNA
polymerase to to attach and begin replication.

3-TACGACCCGGTGTCAAAGTTAGCTTAGTCA-5
5-ATGCT-3
3-AGTCA-5
5-ATGCTGGGCCACAGTTTCAATCGAATCAGT-3

Reaction Requirements

Polymerase attaches nucleotides to the

template.
Taq polymerase is extracted from bacteria
that live in hot springs, so they remain active
at temperatures up to 90C.

3-TACGACCCGGTGTCAAAGTTAGCTTAGTCA-5
5-ATGCTGGGCCACAGTTT-3
3- AAGTTAGCTTAGTCA-5
5-ATGCTGGGCCACAGTTTCAATCGAATCAGT-3

Reaction Requirements
Magnesium required for DNA polymerase to
work
Nucleotides needed to make new DNA
segments
Buffer maintain constant pH
Thermocycler machine that cycles through
required temperatures

STEPS:
1. Heat samples to 90C for a minute or so to
separate double stranded template DNA.

STEPS:
2. Drop temperature to around 50 or 60C to
allow primers to anneal.

STEPS:
3. Maintain temperature at 70C for a minute or
two to allow the polymerase to elongate the
new DNA strands.

4. Repeat denaturation, annealing, and synthesis

steps over and over and over.

http://www.sumanasinc.com/webcontent/animations/content/pcr.html

* PCR amplification is logarithmic, meaning the

number of copies is doubled with every cycle.

2n

Cloning by PCR
Review

figure 3.9
You need to know some of the sequences of what you
are interested in cloning as PCR requires primers
Since thermostable polymerases add an A to the 3 end
use a T vector for cloning (contain single-stranded
thymine nucleotide at each end which can
complementary base pair with overhanging adenine
nucleotides)

Human Genome Project

Francis Collins

Craig Venter

Who owns your DNA?

Automated Sequencing

G labeled with blue dye

A labeled with red dye
T labeled with green dye
C labeled with black dye

Medicine

Evolutionary Biology

The Genome is mapped.

Now what??????

<>

Southern Blotting
Developed by Edward Southern.
Hybridization technique in which a DNA probe
binds to DNA.
Used to determine if a specific DNA sequence is
present in a sample or where a band containing a
specific sequence is located on a gel.

Procedure for Southern Blotting

1. Cut genomic DNA with restriction enzymes and
run on an agarose gel.

Procedure for Southern Blotting

2. Transfer DNA to a nylon membrane.

Procedure for Southern Blotting

3. Hybridize a DNA probe to specific sequences on
the membrane.
The probe will only bind if it is
complementary to the DNA sequence.
GATCCGCTATGTGGGCTGAC
GGCGATACAC

Procedure for Southern Blotting

4. You will only visualize bands where the probe
has hybridized to the DNA.

Chromosomal Location and Gene

Copy Number
Southern

Blotting- combine restriction enzyme

digest+gel electrophoresis, transfer to a blot and
incubate with a labeled DNA or RNA probe to locate a
specific site on DNA (figure 3.15)
Northern Blotting- Isolate RNA, separate by size, transfer
to a blot, and identify a specific RNA using a labeled
probe (figure 3.16)
Western Blotting-separate proteins by size, transfer to a
blot, identify with labeled antibody

http://learn.genetics.utah.edu/units/biotech/microarray/