Personalized Medicine: Using Omics and Big

Data to Analyze and Manage Health

Michael Snyder
May 18th, 2015

Conflicts: Personalis, Genapsys, AxioMx, Novartis

Precision Medicine is of High Interest

Health Is a Product of Genome & Exposome
Genome

Exercise

Health

Disease
Food

Pathogens

Stress

The Cost of DNA Sequencing is Dropping

http://www.genome.gov/

Human Genome Cost <$2K

Impact of Genomics on Medicine
• Understand and Treat Disease
– Cancer
– Mystery diseases
– Prenatal diagnostics

• Pharmacogenomics

– Determining which drug side effects and doses

• Managing Health Care in Healthy Individuals?

Cancer Genome Sequencing
1) Cancer is a genetic disease: both inherited and
somatic
2) 10-20 “driver” mutations
3) Every cancer is unique
4) Sequence genomes
(cancer tissue and
normal) find genetic
changes and suggest
possible therapies
Vogelstein et al., March Science, 2013

Patient with Metastatic Colon Cancer
Chromosome 7: Two amplification regions
EGFR
Genomic
Copy
Number

CDK6

Chr 7p arm

Chr 7q arm

CEN

Each cancer is unique,
containing private novel
variants
• Many affect genes lie in known pathways and
inform diagnosis: Most times a new drug can
be suggested.
Gleevac: Targets Abl and Kit oncogenes

Undiagnosed Mystery Diseases
• 0.4% of live births
• 8% of adults have genetic disorder
recognized by adulthood
• 25 M US Citizens
• $5M/individual/lifetime

Ng et al., 2010 Nat. Genetics

Solving Mystery Diseases: Beery Dizygotic
Twins: Dopamine Responsive Dystonia
• Constantly sick, colicky, failed
to meet milestones “floppy”;
MRI showed some
abnormalities
• Children diagnosed with
dystonia
• Trial of L-DOPA showed
dramatic improvement in 2 days
• Sequenced genomes-found
mutation in SPR Gene
• Administered dopamine +
seratonin precursor

X

From Richard Gibbs, Baylor

Solving Mystery Diseases: Child With Variety of Conditions
Developmentally Delayed, Significant Health Issues

Father
SNVs:
Private:
Indels:

Mother

3,119,588
596,691
750,522

SNVs:
Private:
Indels:
F

M

A1

Child
SNVs:
Private:
Indels:

3,125,880
581,754
723,379

3,118,638
33,158
673,809

SNVs: Single
nucleotide variants
Indels: =
Insertions/deletions
(~<100bp)

Candidates:
TCP10L2,
SUPV3L1, PIEZO1
DNAH2, NGLY1,
FANCA, WFS1

Lessons Learned
1) Overall success rate for identifyng causative
mutations is low 25%
2) Information not always directly actionable but still
valuable. Helps in future family planning.
3) Best success with
a) Specific phenotypes
b) Large families
4) Need large database to share information:
Recurrence is key. ClinVar

Challenges with Sharing Data
1) Need large amount
2) Presently siloed at individual care providers
3) Privacy

Challenges with Sharing Data
1) Need large amount
2) Presently siloed at individual care providers
3) Privacy

Solution
1) Leave data at the collection site
2) Interogate it at that site
 Global Allliance

Personal Genome Sequencing:
Can genome sequencing of a healthy
person be useful in health care?

Sequencing Genomes of Healthy People:
Incorporate into Medicine
Genomic
GGTTCCAAAAGTTTATTGGATGCCGTTTCA
GTACATTTATCGTTTGCTTTGGATGCCCTA
ATTAAAAGTGACCCTTTCAAACTGAAATTC
ATGATACACCAATGGATATCCTTAGTCGAT
AAAATTTGCGAGTACTTTCAAAGCCAAATG
AAATTATCTATGGTAGACAAAACATTGACC
AATTTCATATCGATCCTCCTGAATTTATTG
GCGTTAGACACAGTTGGTATATTTCAAGTG
ACAAGGACAATTACTTGGACCGTAATAGAT
TTTTTGAGGCTCAGCAAAAAAGAAAATGGA
AATTAATTTTGAAGTGCCATTGA….

1. Predict risk
2. Diagnose
3. Monitor
4. Treat

Sequencing Genomes of Healthy People:
Incorporate into Medicine
Genomic
GGTTCCAAAAGTTTATTGGATGCCGTTTCA
GTACATTTATCGTTTGCTTTGGATGCCCTA
ATTAAAAGTGACCCTTTCAAACTGAAATTC
ATGATACACCAATGGATATCCTTAGTCGAT
AAAATTTGCGAGTACTTTCAAAGCCAAATG
AAATTATCTATGGTAGACAAAACATTGACC
AATTTCATATCGATCCTCCTGAATTTATTG
GCGTTAGACACAGTTGGTATATTTCAAGTG
ACAAGGACAATTACTTGGACCGTAATAGAT
TTTTTGAGGCTCAGCAAAAAAGAAAATGGA
AATTAATTTTGAAGTGCCATTGA….

Family History
Medical Tests:
Few Tests (<20)

1. Predict risk
2. Diagnose
3. Monitor
4. Treat &
5. Understand
Disease States

Personalized Medicine: Combine Genomic
and Other Omic Information
Genomic
GGTTCCAAAAGTTTATTGGATGCCGTTTCA
GTACATTTATCGTTTGCTTTGGATGCCCTA
ATTAAAAGTGACCCTTTCAAACTGAAATTC
ATGATACACCAATGGATATCCTTAGTCGAT
AAAATTTGCGAGTACTTTCAAAGCCAAATG
AAATTATCTATGGTAGACAAAACATTGACC
AATTTCATATCGATCCTCCTGAATTTATTG
GCGTTAGACACAGTTGGTATATTTCAAGTG
ACAAGGACAATTACTTGGACCGTAATAGAT
TTTTTGAGGCTCAGCAAAAAAGAAAATGGA
AATTAATTTTGAAGTGCCATTGA….

Transcriptomic, Proteomic,
Metabolomic

1. Predict risk
2. Diagnose
3. Monitor
4. Treat &
5. Understand
Disease States

Personal “Omics” Profiling (POP)
Genome
Epigenome
Transcriptome
Proteome
Cytokines
Metabolome
Autoantibody-ome
Microbiome (Gut, Urine,
Nasal, Tongue, Skin)

Personal
Omics
Profile

Personal “Omics” Profiling (POP)
Genome
Epigenome
Transcriptome
Proteome
Cytokines
Metabolome
Autoantibody-ome
Microbiome (Gut, Urine,
Nasal, Tongue, Skin)

Personal
Omics
Profile
Initially
40K
Molecules/
Measurements

Now
Billions!

Personal Omics Profile
61 months; >100 Timepoints; 7 Viral Infections

/

*

/
Chen et al., Cell 2012

Genome Interpretation Pipeline
Sequence Genome
(Illumina, Complete Genomics)

Call SNVs, Indels, SVs
(3.5M SNVs, 500K Indels, 3K SV)

Disease GeneComplex/Commo
Pharmaco(HGMD) n
Disease Risk
genomics
Risk Variants Genotypes

Specific
Disease
Variants

List of Rare “Damaging” Variants in
Disease Genes (51 total)
Missense
• ALAD, ABCC2, ACADVL, ADAMTS13, AGRN, BAAT, CDS1,
CHD7, COL4A3, CTSD, DGCR2, DLD, DYSF, EPCAM,
FGFR1OP, FKRP, GAA, GNAI2, HSPB1, IGKC, ITPR1,
MED12, MKS1, NTRK1, PCM1, PKD1, PLEKHG5, PMS2,
PRSS1, PTCH2, SERPINA1, SETX, SYNE1, TERT, TTN,
VWF, ZFPM2, PNPLA2.
Nonsense
• PRAMEF2, PLCXD2, NUP54, RP1L1, PIK3C2G,
NDE1, GGN, CYP2A7, IGKC

Not Rare But Important
• KCNJ11 , KLF14, GCKR …

Bolded Genes expressed in PBMC (RNA).

Rare Variants in Disease Genes (51 Total)
Missense
• ALAD, ABCC2, ACADVL, ADAMTS13, AGRN, BAAT, CDS1,
CHD7, COL4A3, CTSD, DGCR2, DLD, DYSF, EPCAM,
FGFR1OP, FKRP, GAA, GNAI2, HSPB1, IGKC, ITPR1,
MED12, MKS1, NTRK1, PCM1, PKD1, PLEKHG5, PMS2,
PRSS1, PTCH2, SERPINA1, SETX, SYNE1, TERT, TTN,
VWF, ZFPM2, PNPLA2.
Nonsense
• PRAMEF2, PLCXD2, NUP54, RP1L1, PIK3C2G,
NDE1, GGN, CYP2A7, IGKC
Not Rare But Important

High
• KCNJ11 , KLF4, GCKR …
Cholesterol
Diabetes

Aplastic
Anemia

Genome Sequence (Ilumina, Complete Genomics)
*

*
*

Predict Type 2
Diabetes
* Previously known

*
100%

Rong Chen
and Atul Butte

Glucose levels

Glucose (mg/dL)

0%

160
150
140
130
120
110
100
90
80

Glycated HgA1c (%):
HbA1c(Day
(%)Number)
(Day Number)

6.4 6.7
6.4
6.7
(329) (369)
(329) (369)

4.9 5.4 5.3
4.7
4.9
5.3 (602)
4.7
(476) 5.4
(532) (546)
(476) (532) (546) (602)

+)"
+% #)" # +%
" # " " #)"-1+)"
#5 0 #% " "0# % )")"# # 2 0 0% " "2#5 0% )"3#0 0 & "3" 5#0 & )"4 0#0 '" "4 #5 0 ')"5 0#0 ("5 "5#0 ()"
6 0 #0 )"6 5"0#
Day Number (Relative to 1st Infection)
LIFESTYLE
HRV
RSV
CHANGE
HRV Infection

RSV Infection

Life Style Change

Normal Range 3.8-5.7%

Normal Range 70-99 mg/dL

Extended Time Line

}
{
HR
V

RSV

HRV

HRV

Adenovir
us
Changed life
style

SkinRash/Itc
h

HRV
Exercis
e

Molecules and Biochemical Pathways that Change
During Acquisition of Diabetes
Insulin
Biosynthetic
Pathway

Glucose Regulation
of Insulin Secretion

Platelet Plug
Formation

RSV

18 days

george mias

Many Unaddressed Challenges

1) Interpreting regulatory/non protein coding
regions
2) DNA Methylation
3) Microbiome
4) Exposome

Epigenetics: DNA Methylation
• Affected by nutrition, lifestyle
factors, aging, and environment
• Causes gene silencing

We can map all the methylated
sites in a person’s DNA

5 methylC

Possible Phenotypic Consequences of
DNA Methylation: Epigenetic Changes
My DNA
me
from:

me me me me
me me me me

Inactivated by:

Mom

Epigenetics

Dad

Mutations

KCJN18
Implicated in Thyrotoxic periodic paralysis

Your Microbiome is Important
for Your Health
• We have 10 Trillion human cells, but 100 Trillion
bacteria
• Helps digest food you eat
• Makes essential vitamins, eg, B12
• Implicated in Inflammatory Bowel
Disease (Crohn’s and ulcerative
colitis), Diabetes, Obesity, MI

Personal Omics Profile
61 months; >100 Timepoints; 7 Viral Infections

/

*

/
Chen et al., Cell 2012

Identifying the Microbe Causing Illness
Nasal microbes
--Top 25 most abundant microbial
species

Streptococcus
pneumoniae
Fever Recovery

Healthy

Gut microbiome temporal profiles
-- At the family level analyzed by RTG
6%
1%

4%

5%
14%

6%

18%

2%

3%

1%

3%
3%
20%

26%

10%

13%

1%

11%

11%

15%

28%
7%

26%

1%
0%

57

43
Healthy
3%
1%

Fever

3%

9%

0%

8%

43_2

0%
1%

14%

5%
18%

10%
11%

2%
1%

Bacteroidaceae7%
Clostridiaceae

9%

1%

58b

1%

59

Healthy

Eubacteriaceae
5%

10%
11%

1%

Erysipelotrichaceae

18%

33%

14%

58
Recovery
Bacteroidaceae

46%
11%

1%

14%

9%

9%

6%

5%
33%

10%

50%

6%

12%

7%

2%

1%

38%

9%

4%
15%

2%
1%

Lachnospiraceae

13%
26%

Porphyromonadaceae

Clostridiaceae

Prevotellaceae

Erysipelotrichaceae

Rikenellaceae

Eubacteriaceae

Ruminococcaceae

Lachnospiraceae

Others

13%
26%

Porphyromonadaceae
Prevotellaceae

Wenyu Zhao, George Weinstock

Other Data Types: Sensors

71
71
AliveCor
Measures ECG

Moves App
Basis
Measures
Heart Rate
Sleep
Stress

Genome Sequencing in Healthy People–
Other Examples
• One teenager had her genome
sequenced; found to have genetic
susceptibility for blood clots (factor V
mutation) affects her birth control
decisions

Genome Sequencing in Healthy People–
Other Examples
• One teenager had her genome
sequenced; found to have genetic
susceptibility for blood clots (factor V
mutation) affects her birth control
decisions
• Sequenced 12 healthy
individuals
- ~3 follow up tests: Cost $4001400
- one woman had a BRCA1
mutation which is associated with
increased risk of breast and
ovarian cancer. Opted for surgery

Personal “Omics” Profiling (POP)
~100 Prediabetics
Genome
Epigenome
Transcriptome
Proteome
Cytokines

Personal
Omics
Profile

Metabolome
Autoantibody-ome
Microbiome (Gut, Urine,
Nasal, Tongue, Skin)

Sensors

Weight gain perturbation
Weight gain
30
days

T1
baseline

Maintain
Weight loss
peak weight
7
days

T2
peak

Maintain

60
days

90
days

T3
post

T4
followup

• 20 participants have completed overfeeding
through T3:
10 insulin sensitive (IS)
10 insulin resistant (IR)
• Blood sampling at indicated timepoints
• Microbiome (gut, urine, nares, skin) on most
individuals

Transcriptional differences between IR
and IS at baseline
Insulin Sensitive (7) Insulin Resistant (8)

test statistic
-2.5

-2

-1.5

-1

-0.5

0

0.5

1

1.5

2

2.5

Maturity Onset Diabetes of the
Young (e.g. HHEX) q<0.0001
Oxidative Phoshorylation (e.g.
COX5A, COX5B) q<0.0001
Ribosome (e.g. RPL9, RPS7) q<0.0001
Defensins (e.g. CCR2, CCR6) q<0.0001
Platelet-Specific Genes (e.g. CXCL5,
PF4V1) , q<0.001
Olfactory Signaling (e.g. OR10AD1,
OR1K1) q<0.0001
FGFR Binding and Activation (e.g. FGFR1,
KLB) q<0.015
EGF Signaling (e.g. EGR2, EGR3, FOSL1,
JUN) q<0.017

Gene Set Enrichment Analy

Individualized Health
+

+

The Future?
Genomic Sequencing

Omes and Other Information:
Home Sensors

GGTTCCAAAAGTTTATTGGATGCCGT
TTCAGTACATTTATCGTTTGCTTTGG
ATGCCCTAATTAAAAGTGACCCTTTC
AAACTGAAATTCATGATACACCAATG
GATATCCTTAGTCGATAAAATTTGCG
AGTACTTTCAAAGCCAAATGAAATTA
TCTATGGTAGACAAAACATTGACCAA
TTTCATATCGATCCTCCTGAATTTAT
TGGCGTTAGACACAGTTGGTATATTT
A….

1. Predict risk
2. Early Diagnose
3. Monitor
4. Treat

What
is
Research
and
What
is
Many observations are research
Clinical
- Variants of Unknown Significance
- Signatures of disease states (eg Microbiome)

Information from Patients will help the next person
- Diagnostics
- Drug responses

Challenges
People who get their genome sequenced can better
manage their health
#1 Problem: Who pays?

Challenges
People who get their genome sequenced can better
manage their health
#1 Problem: Who pays?
US medical system not incentivized for this
a) We usually treat people when they are sick, not
healthy
b) People change providers—Why should provider pay
out a lot of money
Countries with socialized medicine have a huge
advantage.

Conclusions
1) Personal genome sequencing is here.
2) Integrated omics analysis can provide a detailed
physiological perspective for what is occurring.
3) Perturbations (Viral and Dietary) can have dramatic
effects on a person’s biochemical physiology
4) Every person’s complex disease profile is different
and following many components longitudinally may
provide valuable information.
5) You are responsible for your own health

Data at: snyderome.stanford.edu

The Personal Omics Profiling Project
Rui Chen, George Mias, Hugo Lam, Jennifer Li-Pook-Than,
Lihua Jiang, Konrad Karczewski, Michael Clark, Maeve
O’Huallachain, Manoj Hariharan,Yong Cheng, Suganthi Bali, Sara
Hillemenyer, Rajini Haraksingh, Elana Miriami, Lukas Habegger,
Rong Chen, Joel Dudley, Frederick Dewey, Shin Lin, Teri Klein,
Russ Altman, Atul Butte, Euan Ashley, Tom Quetermous, Mark
Gerstein, Kari Nadeau, Hua Tang, Phyllis Snyder
Phase 2 HMP:
Brian Piening, Wenyu Zhou, Kim Kukurba,
Colleen Craig, Sid Mitra, George Weinstock,
Tracey McLaughlin
Methylome:
Dan Xie, Volodymyr Kuleshov, Rui Chen, Dmitry
Pushkarev, Konrad Karczewski, Alan Boyle, Tim
Blauwkamp, Michael Kertesz

Stanford Genetics and Genomics Certificate
Take online courses in genetics and genomics and gain a greater
understanding of biology, human health and personalized medicine.
Topics include
• Essentials of Genetics
• Genomics and Other Omics
• Personalized Medicine
• Cancer Genetics and Genomics
• Genetic Engineering and
Biotechnology
• Fundamentals of Gene Therapy
• Stem Cell Biology

geneticscertificate.stanford.edu

For more information: stanford-genetics@stanford.edu

Overfeeding-induced transcriptional changes in IR
-3

-2

-1

0

1

2

3

Olfactory Signaling (e.g. OR51l1, OR52A1)
q<0.0001
Inflammatory Response to LPS (e.g. EGR3,
NFKB, CXCL1) q<0.01
TNF-alpha Targets (e.g. ICAM1, JUN, CD83)
q<0.03
NRG1 Signaling (e.g. FOSB, SFN) q<0.04
Platelet-specific genes (e.g. ITGB5,
NGFRAP1) q<0.0001
STAT5A Targets (e.g. VWF, ITGB5, MPL)
q<0.0001
FGFR Ligand Binding and Activation (e.g.
KLB, FGFR2) q<0.0001

Weight loss

Weight gain

-3

-2

-1

0

1

2

3

Platelet-specific genes (e.g. ITGB5,
NGFRAP1) q<0.0001
STAT5A Targets (e.g. VWF, ITGB5, MPL)
q<0.001
FGFR Ligand Binding and Activation (e.g.
KLB, FGFR2) q<0.005
Maturity Onset Diabetes of the Young (e.g.
HHEX, FOXA2) q<0.008
Olfactory Signaling (e.g. OR51l1, OR52A1)
q<0.0001
Inflammatory Response to LPS (e.g. EGR3,
NFKB, CXCL1) q<0.003
Voltage-Gated Potassium Channels (e.g.
KCNS1, KCNA2) q<0.005

Gene Set Enrichment Analy

Accurate Genome Sequencing
Whole Genome Sequencing
• Complete Genomics: 35 b paired ends (150X)
• Illumina: 100 b paired ends (120X)
Exome Sequencing
• Nimblegen
• Illumina
• Aglilent

Illumina
345K
9%

CG
3.30M
89%

100K
2%

3.3 M Hi conf. SNVs, 217K Indels and 3K SVs
2 or more Platforms
(Plus low confidence)

High interest drug response–related
variants: PharmaGKB
Gene

SNP

Patient
genotype

Drug(s) affected

CDKN2A/2
B

rs10811661

C/T

Troglitazone (increased betacell function)

CYP2C19

rs12248560

C/T

Clopidogrel (increased
activation)

LPIN1

rs10192566

G/G

Rosiglitazone (increased effect)

SLC22A1

rs622342

A/A

Metformin (increased effect)

VKORC

rs9923231

C/T

Warfarin (lower dose required)

3. Big Data Handling and Storage
Genome (1TB)
Epigenome (2TB)
Transcriptome (0.7TB)
(mRNA, miRNA, isoforms, edits)
Proteome (0.02 TB)
Cytokines
Metabolome (0.02 TB)
Autoantibody-ome
Microbiome (3TB)

Personal
Omics
Profile
Total =
5.74TB/Sa
mple +
1 TB
Genome

Study of 12 Healthy People

Dewey, Grove, Pan, Ashley, Quertermous et al

- 3 followup diagnostic tests (range 0-10)

- Cost ~$400-$1400 per individual (median $663$773

- 54 minutes per variants
- One individual had a BRCA1 nonsense
mutation—no known family history

Sign up to vote on this title
UsefulNot useful