Vous êtes sur la page 1sur 37

Vecteurs de

Clonage

Anne universitaire 2015/2016

Mahmoudi Lobna
L3

A. Dfinitions
Un vecteur est une squence d'ADN
permettant la propagation, la slection,
la modification d'une squence d'ADN
d'intrt.
En
bref
l'tude
et
la
manipulation d'une squence d'ADN
isole.
Le clonage est l'action d'isoler et
d'insrer dans un vecteur un fragment
d'ADN d'intrt pour le multiplier
l'identique.
L'ADN gnomique est le support
physique de l'ensemble des gnes de la

B. Utilit
Permet de conserver
squence d'ADN
donne.

une

Permet de la multiplier pour en


accrotre la
quantit.
Permet de la modifier pour y
introduire des
mutations, dltions.

C. Principes
Un Vecteur
Circulaire
Linaire
Une Cellule hte
Procaryote
Eucaryote
Un fragment d'ADN
gnomique

ADN

I - Proprits des vecteurs de


clonage

capables de rplication autonome dans une cellule hte


donne
(origine
de
eucaryotique)

rplication

de

type

procaryotique

et/ou

possdent un polylinker ou site multiple de clonage

Possdent des proprits permettant la slection de la cellule


hte (rsistance ATB)

Principes gnraux dutilisation dun vect

- Prparation du vecteur

- Prparation de lADN insrer

- Ralisation dun recombinant

- Incorporation lhte

1. Obtention de lADN
recombinant

+ traitement
PAL

2. La ligation
(ligature...)
Une enzyme,
la ligase, est
capable
de
lier de faon
covalente
deux
molcules
dADN
en
une.

3.Diffrents vecteurs pour


Taille diffrentes
maximum utilisations
approximative

du
fragment dADN qui peut tre clon
dans VECTEURS
chaque vecteur HOTE
INSERT
(Kb)
Plasmides

Bactrie

10

Phage lambda

Bactrie

25

Cosmide

Bactrie

45

Phage P1

Bactrie

100

(bacterial artificial
chromosome)

Bactrie

300

(yeast artificial chromosome)

Levure

1000

BAC
YAC

4. Les plasmides comme vecteurs


de clonage
Molcule dADN de taille rduite, d'origine
bactrienne
Molcule dADN circulaire taille 2kb 5kb
Peut accepter jusqu 10kb dADN exogne
Peut
tre
considre
minichromosome
capable
autonome
Confre la rsistance
antibiotiques= slection

comme
un
de
rplication
un

ou

plusieurs

5. Les classes de plasmides


5.1. Les plasmides de premire gnration :
Ce sont les premiers avoir t utiliss en gnie
gntique. Ce sont des plasmides ltat naturel, non
modifis au laboratoire. Il sagit des plasmides
suivants :
ColE1
RSF 2124
pSC 101

5.2. Les plasmides de deuxime gnration :


Ce ne sont pas des plasmides naturels mais rsultent
de plusieurs transformations : plasmides "artificiels".
La srie la plus importante de ces plasmides est la
srie pBR 312 pBR 322. Le plasmide pBR 322 est
constitu de 4,4 Kb et possde deux gnes de
rsistance : un pour la ttracycline (TcR), lautre pour
lamplicilline (ApR). il possde, en plus, 20 sites
uniques pour les endonuclases de restriction dont 11
localiss sur les deux gnes de rsistance.

Carte du plasmide
pBR322

pUC8

polylinkers de pUC8 et
ACGAATTCCCGGGGATCCGTCGACCTGCAGCCAAGCTTGGCACTG
pUC9

Polylin
ker
pUC 9

ACGCCAAGCTTGGCTGCAGGTCGACGGATCCCCGGGAATTCACTG

Polylin
ker

5.3. Les plasmides de troisime gnration :


La famille pUC : Ont une taille qui avoisine 2,6 Kb et
ayant intgr les gnes de rsistance lampicilline
(ApR) et lacZ. Un polylinker identique celui du
phage M13 est associ lacZ. Les diffrents pUC (de
pUC8 pUC19) ne diffrent que par le nombre de

Les plasmides comme vecteur de


clonage

6. Introduction de lADN
recombinant dans les cellules
type procaryotique
htes

De
(bactries):

Cas
dun
vecteur
plasmidique: lADN est
introduit
dans
les
bactries
traites
spcialement
le
plus
souvent
par
choc
thermique ou par choc
lectrique.

lectroporateur

6.1. Identification des clones intressan


Dans ce cas les bactries transformes avec le
vecteur ne possdant pas ou possdant linsert sont
slectionnes
un criblage est ncessaire

6.2. Criblage des clones


intressants
pBR322

AmpR
TetR

AmpR
TetS
Clone intressant

ge -screening- des clones intressants


Test
blanc-bleu
complmentation)

(-

LES PHAGES
Virus
de
bactrie-infectieux
:
Rendem
: 48 Kb

Les phages et les bactries htes sont


gnralement mutes pour
viter le cycle de Lysognie au profit du cycle
lytique.
Grande partie non essentielle
VECTEURS
2 Types :
Insertion ( zap, gt CHARON cDNA
Faible capacit 10 Kb
Dltion : substitution
(Charon, EMBL, DASH, FIX)
Partie non essentielle stuffer est
dlte et remplace : 25 Kb
Slection spi.

7. Les phages comme vecteurs


de clonage
Phage
virus
bactries

=
de

7.1. Introduction de lADN


recombinant dans les cellules htes

De type
procaryotiqu
e:
Cas dun
vecteur
phagique

8. Les cosmides comme vecteurs


de clonage

9. Les YACs comme vecteurs de


clonage

YAC
:
Artificial

Yeast

chromosome

10. Bacterial Artificial


Chromosomes
BAC :
Avantages
Grande capacit
d'insertion
Facilit de
manipulation (comme
7.4kb
plasmide)
Hte bactrien
Copie unique
parA, parB and repE
Pas (peu) de
sont des genes requis
rarrangement
pour la stabilit du BAC.
OriS est une origine de
rplication

CM
:
gne
de
rsistance
au

III - APPLICATIONS DES


Clonage etVECTEURS
amplification dune

squence dADN

Cration
des
banques
gnomiques et dADNc

dADN

- Introduction dun gne dans des


cellules, des plantes ou des organismes
(animaux transgniques)
- Production dARN
- Production de protines codes par
les gnes insrs

Banques dADN
-Banques
gnomique

dADN

- Banques de cDNA

Principe du clonage (cas dune banque


gnomique)

Banque (librairie) dADN


gnomique

Comment
dfinir
si
une
banque
est
suffisamment grande pour esprer trouver un
fragment
dintrt?
Calcul afin
de dfinir la probabilit de trouver une
squence donne dans une banque.
N=In(1-P)/In(1-f)
N: nombre de recombinants
P: probabilit dsire
f:
proportion
de
gnome
dans
un
seul
recombinant
Ex: 99% de probabilit davoir une
squence reprsente dans une banque
de fragments de 17kb dun gnome
eucaryote (3.109pb)
N=
In(1-0.99)/In(1(1,7.104/3.109))=8,1.105 colonies

Banque dADNc

Le
problme
ici est
lobtention
de clone dit
full
length.

Obtention de lADN de lorganisme


donneur

A
partir
lARN:
Principe
"reverse

de

transcription":

de
la

Production de protines
Utilisation de vecteur
dexpression

Production de protines
humaines but thrapeutique
- Facteur VIII de la coagulation
dans lhmophilie A
- Hormone de croissance
- Insuline

Exemple de
linsuline

CELLULES HTES
-Bactries : E. Coli
premier hte utilis
nombreux vecteurs plasmidiques connus
et utilisables
culture en masse dans les fermenteurs
taux dexpression levs (plusieurs g de
protine/litre)
MAIS secrtent mal les protines : clatement
des bactries
-pas
de
modifications
posttraductionnelles

-Levure saccharomyces cerevisiae


modifications post traductionnelles
MAIS pas de secrtion, moins bon rendement

Transfert et clonage du gne de linsuline