Vous êtes sur la page 1sur 31

StufftoDo

MidtermI
questionsdue1/31

Emailmeyourquestion(withanswers),
ifyouhavethecapability,mailcompletequestions,
figures,etc.andall,
ifnot,writequestions,withinstructionsi.e.inFigure2
ofxpaper,blah,blah,blah,

Fridayafternoon,IllpostthequestionsontheWEBpage,on
Monday,youllhavetimetoworkonthemtogether,inclass.

memory+ analysis
0pts 5pts
memoryonly integrationofinformation
CycleSequencing
ChainTermination
ddNTPs dNTPs
aDNApolymeraseapplication.

Primer

Template

TaqDNAPolymerasew/Buffer Cycles =
PolymerizationuntilTaqhitsddNTP.
dNTPs

dNTPsandddNTPS
(mixture)
LinkedonCourseWEBPage.

CycleSequenceTutor

andananimation,
http://www.dnalc.org/shockwave/cycseq.html
Disclaimer:thisreviewisheavilybiasedtowardthepublicsequencingconsortium.
HierarchicalClonebyClone WholeGenomeAssembly

MapFirst:thensequence SequenceFirst:thenmap
GenomeSequencingStrategy
#1
ClonebyCloneApproach
Orderclonesalongthegenome,thensequence,

notdependentonaccelerationofsequencingcapacity,
notdependentonadvancedcomputeranalysis,
notdependentonasofyetsequencingtechnologies,
repeatsnotasbigaproblem?
heavyupfrontdemandforhumanlabor.
OnlinePrimer:mapping
ClonebyClone
OrderedApproach
GenomicLibraries

howmanyclones
tocoveragenome?
Vectors
(carryinsertDNA)
Vector Host Inserts
Plasmid E.coli upto15kb,
Phage E.coli upto25kb,
Cosmid E.coli upto45kb,
BAC E.coli 100500kb, plasmid/phagehybrid

YAC Yeast 2501000kb. Bacterial


Artificial
Chromosome

YeastArtificial
Chromosome
GenomicSequencesandCoverage
pfindingclone

N=ln(1.9999)
ln(1v/2,900,000,000)
genome
v=averagevectorinsertsize
size

6
plasmid(5kb) =5.3x10
6
phage(20kb) =1.3x10
5
BAC(125kb) =2.2x10
YAC(500kb)=27,000clones
ClonebyClone
OrderedApproach
Contigs
(ContiguosSequences)

Findoverlappingends

Clone1

Clone2

Sequence,

RestrictionFragmentLengthPolymorphisms(RFLPs).
SequenceContig
RFLP
Restrictionenzymescut
specificDNA
specifically,

Fragmentlengths
provideclone
identificationdata.
Contigs
(ContiguosSequences)

Findoverlappingends

Mergegoodpairsofreadsinto
longercontigs

FindtheminimalTillingPath,
minimumsetof
overlappingclonesthat
coverthegenome.
MinimalTillingPath

Fig.2

Identifyminimal
overlappingclones.

ShotgunSequenceEachClone
BacterialArtificialChromosomes
BACs

UniversalPrimingSites,

Onthevector,flankingthegenomic
insert.
Shotgun
(selfquiz)

~8x10xcoverage:

Toshotgunsequence10,000bp,
youdneed80k100kbpof
sequence,or~160~180
sequencingreactions.

But,10,000bp,at500bpper
sequencingreactioncouldbe
doneinasfewas20sequencing
reactions.

WhyShotgun?
Contigs

QC
StructuralGenomicStrategies
#2

WholeGenomeAssemblyApproach:
Sequencefirst,thenorder,

dependentonadvancesincomputeranalysisand
sequencingtechnologies,
dependentonautomatedlabor.
WGA
ReadPairs=MateEndPairs
PairedEndSequencing,

sequencebothendsofthevectorinsert,using
vectorderivedprimers,

Maintainmatepairdata.

insert

5 3

3 5
vector
ExampleSequenceOutput
(example:5kbinsert)

5read(543bp)
atatgtatattgaattacatacatattattaatgcacatttttatccggagttgtggaccatagaaagacatattgactcctcaa
agtaaattctgcatgttacattgaaatcataggctaaatttgagatgcactatttttagaaagtgtagagaaaaggacaggaaga
aataagcgaaagctttggtaagccaccaaacctgattactggaagaaaagaaaaaagttccgagaatagagttagatcgctggtg
agggttttaaatggaacacaacaatggttgttttagagtgtgttattcttttgtatttataccttctcataggtttcttgtaata
cacgcttcttcctctctctccctctctcttatggcctcgtcttgaaagcgtcttgcatgctaagagaaggctttagagcaaggag
agaagggagaagttgatttatacgtccatcggatatatcttctttttatatctgtctctcttttaaggaagaaaaatggcgactg
aattctcgtgggatgaaatcaagaaagaaaatg...

restofinsert(unsequenced,~3.9kb)
...ggcttgaaatatttggggcaaacaagcttgaagagaaatcagagaacaagtttttgaaattcttggggttcatgtggaatc
ctctctcatgggttatggagtctgctgcaatcatggctattgttttagctaatggaggaggaaaggcgccggattggcaagatt
ttatcggtattatggtgttgcttatcatcaactccaccataagtttcatcgaggagaacaatgctggcaatgccgctgctgctc
tcatggcaaatcttgcaccaaagactaaggtatgcaaatttctcaatacatatatataggtatgtattttctaaaaaggagagt
tatataacctatgtgtgaatgtaggtgttgagagatggtaaatggggggagcaagaggcttcaatcttggttccgggtgatttg
ataagcatcaaattgggtgacattgttcctgctgatgctcgtctcctcgaaggagatcctttaaaaattgaccaatctgctctt
actggtgaatcccttccaaccaccaaacacccaggagat3read(540bp)

plustracedatafilesassociatedwiththesesequenceruns.
WGA
StructuralGenomicStrategies
#3(Hybrid)
ProjectComparisons
(NYT:10/3/2002)

Decoding the genome of Plasmodium falciparum, the most dangerous of the


four single-cell parasites that cause malaria, took six years and cost about $20
million, paid for by the Wellcome Trust of London, the National Institutes of
Health in Bethesda, Md., and other sources. Dr. Malcolm J. Gardner of the
Institute for Genomic Research in Rockville, Md., led a large team of scientists Hybrid
there and at the Sanger Centre near Cambridge in England. Completion of the
falciparum genome was first announced at a conference in Las Vegas in
February.

The genome of Anopheles gambiae, the primary carrier of the parasite, was
begun more recently and took a mere 15 months even though its genome is far
larger some 278 million units of DNA encoding 14,000 genes compared with
the parasite's 23 million units of DNA and 5,268 genes. The mosquito team was WGA
led by Dr. Robert A. Holt of Celera Genomics in Rockville. The $14 million cost
was born by the National Institutes of Health, by Genoscope in France and other
sources.
Wednesday
WGA,
ShotgunSequencing,
HybridApproach.

Compartmentalized
Shotgun
Approach
Pleaseread
Science291:13041315