Vous êtes sur la page 1sur 75

UNIVERSIDAD POLITCNICA DEL VALLE DE TOLUCA

INGENIERIA EN BIOTECNOLOGA

ASIGNATURA:
Qumica orgnica

cido nucleicos

Alumnos
MIRANDA VILCHIS ALEJANDRA LIZZET
NAVA FLORES MAYRA
PAZOS MURILLO ROMINA FRANCESHCA
ROBLES PEREZ CARLOS OCTAVIO
VILCHIS ORTIZ GABRIELA
*
*

Guanosina monofosfato
*
*

El cido
Desoxirribonucleico es
una macromolcula
forma el material
gentico dentro de cada
clula.
*

En las clulas eucariotas se


localiza bsicamente en el
ncleo en los cromosomas
Mientras que en las clulas
procariotas el ADN se
encuentra disperso en el
citoplasma
La principal funcin del
DNA es contener la
informacin, que, al
expresarse de manera
selectiva y regulada,
permite generar una nueva
clula (organismos
unicelulares) o un nuevo
organismo
El ADN es un nucletido por lo que esta formado por

-Bases nitrogenadas

-Grupo fosfato

-Azcar pentosa
*
El grupo fosfato esta compuesto un tomo de P y cuatro de oxgeno,
deriva del cido fosfrico (H PO )
3 4
*
La pentosa es la desoxirribosa, un glcidos monosacrido
cclico formados por cinco tomos de carbono. Esta se
diferencia de la ribosa en que poseen un tomo de oxgeno
menos
*
Timina
Adenina
Guanina
Citosina
Unin de bases nitrogenadas:
Adenina Timina por medio de 2 puentes de hidrogeno.
Citosina Guanina por medio de 3 puentes de
hidrogeno.
*
Estructura primaria

Estructura secundaria del ADN: el doble hlice

Estructura terciaria: superenrollado


*
Es la secuencia de nucletidos de una cadena o
hebra. Es decir, la estructura primaria del ADN
viene determinada por el orden de los
nucletidos en la hebra o cadena de la molcula.

Para indicar la secuencia de una cadena de ADN


es suficiente con los nombres de las bases o su
inicial (A, T, C, G) en su orden correcto y los
extremos 5' y 3' de la cadena nucleotdica.

As, por ejemplo:

5'ACGTTTAACGACAAGGACAAGT
ATTAA3'
*
Los esqueletos azcar-
fosfato, que corren en
direcciones anti
paralelas en las dos
cadenas, quedan en la
parte exterior de la
hlice.
*
La longitud de la molcula de ADN es mucho mayor que su
dimetro; no es rgida y puede plegarse sobre si misma de una
forma parecida a como lo hacen las protenas cuando adoptan
su estructura terciaria.
*
*Definicin:
*El ARN (cido ribonuclico) es un cido
nuclico de cadena sencilla compuesto por
los nucletidos, azcar pentosa (ribosa)
bases nitrogenadas y grupo fosfato
DIFERENCIAS ENTRE EL
ADN Y ARN
AZCAR DESOXIRIBOSA AZUCAR RIBOSA
*como esta formado?
El ARN est compuesto por
Adenina, Citosina, Guanina y
Uracilo y el azcar que forma el
esqueleto de la cadena junto con
el fosfato es ribosa a diferencia del
ADN que tiene desoxirribosa.
*ADENINA
*Es un derivado de la purina (es una base prica) en la
que un hidrgeno ha sido sustituido por un grupo
amino (NH2). Forma parte de la molcula de
trifosfato de adenosina, que constituye la fuente
principal de energa a nivel celular, y est presente
en muchas sustancias naturales como la remolacha,
el t y la orina.
*Citosina
*La citosina fue descubierta en 1894
cuando fue aislada en tejido del timo
de carnero.
*Guanina
Es una base nitrogenada prica, una de las
cinco bases nitrogenadas que forman parte de
los cidos nucleicos (ADN y ARN), est presente
en los excrementos de los caros, que es un
alrgeno causante de enfermedades como la
rinitis y faringitis.La guanina fue aislada por
primera vez en 1844 a partir de los
excrementos de aves marinas, utilizada como
fertilizante. El cido nico se puede convertir
en guanina.
*Uracilo
*Es una pirimidina, una de las cuatro bases
nitrogenadas que forman parte del ARN, El
uracilo fue descubierto originalmente en el ao
1900. Fue aislado por hidrlisis del cido
ribonucleico de las levadura que se encontraron
en ciertos rganos de bovinos: timo y bazo, as
como en el esperma de los arenques y en el
germen de trigo.
URACILO:
GEN
GENOMA
GENOTIPO
FENOTIPO
* TIPOS DE ARN:
*Se conocen tres tipos principales de
ARN y todos ellos participan de una u
otra manera en la sntesis de las
protenas. Ellos son: El ARN mensajero
(ARNm), el ARN ribosomal (ARNr) y el
ARN de transferencia (ARNt).
*ARN Mensajero:
Transporta la informacin gentica
desde el ADN nuclear hasta los
ribosomas para la sntesis de protenas.
*ARN de
transferencia:
*Molcula clave en sntesis de
protenas (60 a 120 bases
nitrogenadas). Reconoce los tripletes
o codones, funciona como
transportador de aminocidos que
traducen la informacin almacenada
en la secuencia de nucleotidos del
ARNm a la secuencia de aminocidos
de las protenas.
*Arn ribosomal:
*Interaccionacon las protenas
para formar robosomas la
maquinaria celular bsica en la
que tiene lugar la sntesis de
protenas.
*Procesado del arn
*2 tipos generales del procesado del ARN:
*1.- Procesado de una transcrito de ARN puede
suponer la eliminacin de las secuencias sobrantes
mediante endonucleasas y exonucleasas, como en el
procedimiento de los genes de ARNr y ARNt.
*2.- Eliminacin de las secuencias sobrantes y la
reunificacin de segmentos del ARN recin
transcritos, como en el corte y empalme del ARNm
Replicacin del ADN
Qu es la Replicacin del ADN?
Proceso por el que una clula produce una copia de s mismo por medio de enzimas que adems de
ser muy exactas poseen un sistema de reparacin de errores. El mecanismo de replicacin es
esencialmente el mismo en todas las clulas.

En las clulas procariotas hay 1 lugar En las clulas eucariotas el proceso es


de origen de replicacin que se muestra esencialmente el mismo pero el ADN es mucho
en la horquilla de replicacin y que ms grande. Hay varios orgenes de replicacin,
seala el avance de la copia. En el sitio adems el avance de replicacin es ms lento.
en que empieza la replicacin se
organizan las protenas en un complejo
llamado replisma.
Hebra 3 -> 5
Cadena
continua 5->
Molde 3

Cadena
Hebra 5-> 3 retardada
codificante 5 -> 3
TAPAS DE LA REPLICACIN DEL ADN

Iniciacin Elongacin Finalizacin


Inicializacin

Separacin
de cadenas

ARN
Cebador
Elongacin

Se aade
ADN Pol

Se aaden
fragmentos
de Okazaki
Es el proceso de obtencin de un ARN mensajero (ARNm) a partir del ADN
correspondiente a un gen.
Elementos de la transcripcin

ARN Polimerasa
No se tiene el factor sigma.
En procariotas no se necesitan la CAP Y LA POLI-A.
Proceso de Transcripcin
Se fueron: el factor sigma y los factores de transcripcin
Independiente de
Independiente de

Dependiente
de
Es un proceso de la biologa molecular que
implica la generacin de una cadena
de cido desoxirribonucleico (ADN) de doble
cadena a partir de un cido
ribonucleico (ARN) de cadena simple.

Enzimas que participan:


Retrotranscriptasa
RNAsa H
Integrasa
Proceso de transcripcin inversa en
el virus de clase VI
Virus de clase VI, tambin
llamado retrovirus son virus de ARN de
transcripcin inversa con un ADN
intermedio. Su genoma consta de dos
molculas de sentido positivo de cadena
sencilla de ARN con tapa de un 5 'y 3.
*
Qumica orgnica Autor: Jhn Mc Murry octava edicin
Vernica Burriel Coll. (2015). ESTRUCTURA Y PROPIEDADES DE LOS
CIDOS NUCLICOS . 06/03/2017, de UNAM
Sitio web:
http://www.uv.es/tunon/pdf_doc/AcidosNucleicos_veronica.pdf
Watson, J. D.; Baker, T. A.; Bell, S. P.; Gann, A.; Levine, M. et Losick, R
(2006). 2. Los cidos nucleicos transmiten informacin
gentica. Biologa Molecular del Gen (5. ed.). Madrid: Mdica
Panamericana.
Watson, J. D.; Baker, T. A.; Bell, S. P.; Gann, A.; Levine, M. et Losick, R
(2006). 8. La duplicacin del DNA. Biologa Molecular del Gen (5
Ed.). Madrid: Mdica Panamericana.