DNA marker technologies “A tool for studyng DNA polymorphisms”

RAPD: Randomly Amplified Polymorphic DNA

RFLP: Restriction Fragment Length Polymorphism

SNP Insertion and Deletions

 AFLP
Amplified Fragment Length
Polymorphism
SSR: Simple Sequence Repeats
STR: Short Tandem Repeats

TCCCAAGCTCTTCCTCTTCCCTAGATCAATACAGACAGAAGACA
GGTGGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGA
TAGATATCATTGAAAGACAAAACAGAGATGGATGATAGATACATG
CTTACAGATGCACAC

= 12 GATA

7 repeats
8 repeats
9 repeats
10 repeats
11 repeats
12 repeats
13 repeats

Target region
(short tandem repeat)
Substractive Cloning (Alternative Protocols)

1. 2.
c-DNA Microarray Technology
qPCR: Quantitative Polymerase Chain Reaction
TaqmanProbes
Dyes

Scorpion Probes
Beacon Probes
Protein Microarray Technology
Tissue Array Technology
Allozymes

1 2 3 4
5 6
Linkage, Recombination and Gene Mapping
- Linkage: Is referred to genes located on the same chromosome. These genes do
not obey Mendel’s principle of independent assortment. Independent assortment is
a consequence of genetic recombination.

Recombination: Is the process in which F1

progeny produces novel combinations of
alleles in its gametes.
Notation for Crosses with
linkage…

F1
Or
QBP. Enoc Mariano Cortés Malagón
Two classes of homologous recombination events:
Experiment…

Configuration for linked genes…

Cis-configuration or Trans-configuration or
“in coupling” “in repulsion”
Gene Mapping with Recombination Frequencies.

Chromosome maps calculated by using the genetic phenomenon of recombination

are called genetic maps. Distance on genetic maps are measured in map units
(m.u.). One map unit equals 1% recombination, m.u. are also called centiMorgans
(cM).

Example: If gene A have a distance of 5 m.u. from gene B, and gene B is 10 m.u.
from gene C. Therefore gene A is 15 m.u. from gene C.

Or

Both maps are indeed correct, to have additional information more genes are
needed. Suppose that we have an additional gene “D” with the following
recombination frequencies:
Excercise….
Locating Genes with Genomewide Association Studies.

Genomewide Associations studies

determine possible associations
between traits and particular
haplotypes in a population.

Example: Imagine that we are

interested in finding genes that
contribute to a particular phenotype.
When a mutation that predispose to
a particular phenotype first arise, it
will occur on a particular
chromosome, and its associated
with a specific set of alleles on that
chromosome. This group of alleles
associated with a phenotype is
called haplotype, and the
associations between a mutations
and those alleles is called linkage
disequilibrium.
Physical Mapping Methods.
A common issue with genetic maps its that recombination units do not always
correspond to physical distances on the chromosome. Deletion mappings is a kind of
physical mapping method.
Deletion mapping is based on the absence of stained bands on a chromosome. To locate
genes, recessive-homozygous individuals are crossed with heterozygous individuals
with a particular deletion. If the gene of interest is located in the missing region, only
half of the progeny will display the mutant phenotype and the other half will display
wild type/incomplete wild type phenotype.
Somatic Cell Hibridization another physical mapping method, consist of fussing a cell
with a cell line to form a cell with two nuclei or heterokaryon. Hybrid cells will loose
chromosomes, and in situ hybridization can be used to identify the gene of interest in
several colonies.