DNA SEQUENCING AND GENE CLONNING

PRESENTED BY:
KALPANA DALEI
PhD SCHOLAR
DEPT. OF LIFE SCIENCE
NIT ROURKELA
DNA Sequencing
• Refers to methods for determining the order of the nucleotides bases adenine ,guanine, cytosine
and thymine in a molecule of DNA.
• Basically done to find the alteration or mutation in DNA.

Diagnosis Biotechnology

Application

Forensic Biological
biology Systematics
Methods of Sequencing
1. First generation Sequencing
Automated Sanger’s chain termination method
Maxam-Gilbert chemical degradation
Shotgun Sequencing
2. Next generation Sequencing (After 2005)
a. Second Generation: Roche 454, Illumina (Solexa), Applied
Biosystems SOLiD system
b. Third generation NGS : Pac Bio, Oxford Nanopore, ion Torrent
Sanger Chain Termination Method
• Developed by Fred Sanger in mid
1970.
• Used dideoxynucleotide (ddNTPs)
for chain termination, generate
fragments that ends in ddATP,
ddGTP, ddCTP or ddTTP.
Workflow of Sanger’s Method

Bands are separated using polyacrylamide gel

that separates fragments of one nucleotide
difference.
Readout of Reaction Product

Two forms of labeling: –

Radioactive • Primer labeled (32P or 33P)
• dNTP labeled (35S or 32P) –
Nonradioactive ( Fluorescence )
Primer labeled ,ddNTP labeled
Maxam-Gilbert Sequencing
• The single stranded DNA to be fragmented is labelled with radioactive phosphate at 5’ end.
• The labelled DNA is then divided into four aliquots, each of which is treated with separate reagents
for cleavage at specific site.
Dimethyl Sulfate Formic acid Hydrazine Hydrazine+1.5% NaCl
Piperidine Piperidine Piperidine Piperidine
Shotgun Sequencing
• Used to sequence whole
genomes
• Steps:
• DNA is broken up
randomly into smaller
fragments
• Dideoxy method
produces reads
• Look for overlap of reads
Strand Sequence
AGCATGCTGCAGTCATGCT-------
First Shotgun Sequence
-------------------TAGGCTA
Second Shotgun Sequence
AGCATG--------------------
------CTGCAGTCATGCTTAGGCTA
Reconstruction AGCATGCTGCAGTCATGCTTAGGCTA
Drawbacks of 1st Generation Sequencing
• The dideoxy method is good only for 500-
750bp reactions
Haemophilus influenzae: first bacterium genome
• Expensive: Cost per sequence about 20$ sequenced in 1995 Sequencing technique; first gen.
• The human genome is about 3 billion bp automated Sanger ‘s sequencing
Method: Shotgun sequencing
• Poor quality in the first 15-40 bases of the Genome size: 1.8 million base in which 1,749 genes
sequence were embedded.
• Low throughput thus not suitable for large Time: about 13 months
scale projects due to cost and time factor
• Good for small scale sequencing projects

Human genome project (HGP)

Time: 13 Year project (1990-2003),
DNA Sequencing Cost: 3 Billion US dollar
Size: 3 billion base pairs (it covers about 94% of the human
genome) and revealed that there are about 20,500 genes
in human genome
 Key features of NGS techniques

•Speed (high-throughput)
•Cost (per sequence very low)
•Data volume (massive amount) Mb, Gb, Tb range
•Data quality (high quality within a specified length)
•Scale up (modify as per project need)

NGS
Second Generation: 454 Pyrosequencing, Illumina,
Applied Biosystems SOLiD system

Third Generation: PacBio Technology, Oxford

Nanopore, ion Torrent

Currently, three platforms dominate the market:

Roche 454 system, Illumina Genome Analyzer and Applied Biosystems
SOLiD system.
Roche 454 Pyrosequencing

Developed by Roche in 2005

•300 million bases

•Single 9-hour run

GS FLX Pyrosequencer TM

APS: Adenosine 5 phosphosulfate

Workflow of Roche 454
 Software analyzes the light produced versus nucleotide incorporated

454 Sequencing Data Analysis software uses the signal intensity of each nucleotide
incorporation event at each well position to determine the sequence of all reads in parallel.
Illumina/Solexa

Solexa was an independent company but in

2006 Illumina acquired
3 steps
•Library preparation
•Cluster generation
•Sequencing

• Illumina utilizes a unique "bridged"

amplification reaction that occurs on the
surface of the flow cell.
1 flow cell with 8 channels
Workflow
Chemistry of Illumina sequencing
Pacific Biosciences (PacBio RS platform)

• PacBio RS is a third generation DNA sequencing system that incorporates novel Single Molecule Real
Time (SMRT) Sequencing

• Extraordinarily long reads: Produce reads with average lengths of 3,000 to 5,000 bp, with the longest
reads over 20,000 base pairs.

• Extremely high accuracy: Sequence individual molecules with 99% accuracy

• Shortest run time: Sequence for as little as 30 minutes and still get reads longer than Sanger
sequencing.

• Least GC bias: Sequence through regions of extremely high or low GC content with ease, resulting in
more even coverage.

• No amplification bias: Samples need not be amplified, improving coverage uniformity and avoiding
artifacts.
Single Molecule Real Time (SMRT) Sequencing

Single Molecule Real Time (SMRT) Sequencing

Phospholinked fluorescent nucleotides-

fluorescent label is attached to phosphate
GENE CLONING
• Gene cloning is making a large number of copies of a gene.
• This is done by rDNA technology.
• A foreign gene is inserted into a bacterial plasmid and this
recombinant DNA molecule is returned to a bacterial cell.
• Under suitable conditions, the bacterial clone will make the
protein encoded by the foreign gene and passed on to its
descendents.
Steps In Gene Cloning

1. Isolation of foreign DNA.

2. Selection of vector.
3. Insertion of DNA into vectors
4. Transfer of RDNA vectors into
host and cloning.
5. Selection of transformed cells.
Step 1. Isolation of Gene of Interest
The gene of interest carrying the desired character is isolated from the source.
The source may be plant, animal or bacteria.

Step 2. Selection and Isolation of Vector

The cloning vectors are called molecular vehicle that carries the gene of interest.
The characteristics of cloning vectors are
• Must be small in size
• Must have origin of replication
• Must have multiple restriction sites
• Must have selectable marker for screening

Different vectors used in gene cloning are

Plasmids (< 10kbp)
Cosmidd (32 - 47 kbp)
Bacteriophage (10 - 23 kbp)
BAC and YAC (100 - 2,000 kbp)
Step 3: Insertion of foreign DNA into Vectors

•Both vector and desired DNA are cut

by same restriction endonuclease.
•It produce either blunt or sticky ends.
Step 4: Transfer of rDNA into host
DNA can be transferred into the host by any of the techniques
Microinjection
Electroporation
Biolistic
Transformation
Transfection
Chemical method etc
Step 5: Selection of Transformant

Antibiotic Resistance
• The medium in this petri dish
contains the antibiotic Kanamycin.

• The bacteria on the right contain

Kanr, a plasmid that is resistant to
Kanamycin, while the one on the
left has no resistance
 Other Methods of Selection

1. A radioactive nucleic acid probe may be used to detect those colonies

that have the new DNA gene.

2. Antibodies (often labeled with radioactivity) that react with the

protein product of the gene may be used to determine which colonies
contain the new gene.

3. PCR using primer complementary to desired gene.

4. Sequencing DNA