DNA Structure, replication,

PCR

Margit Burmeister
BIOINF 523, Biology Boot Camp
Figure 5-2b Essential Cell Biology (© Garland Science 2010)
Figure 5-2c Essential Cell Biology (© Garland Science 2010)
Figure 5-6a Essential Cell Biology (© Garland Science 2010)
 Important features of DNA
• There is a direction: 5’ to 3’, defined by the
sugar phosphate backbone
• 5’ ends usually contain a phosphate
• DNA is double stranded
• the two strands are anti-parallel (5’-3’,
usually written on top)
5’ –CTATAG – 3’
||| || || || || |||
3 ’–GATATC – 5’
Figure 1-2c Molecular Biology of the Cell, Fifth Edition (© Garland Science 2008)
 DNA Replication is semi
conservative

Each new DNA molecule consists half of the old, half of the new DNA –
inheritance is semiconservative
Figure 5-2 Molecular Biology of the Cell (© Garland Science 2008)
Figure 5-5 Molecular Biology of the Cell (© Garland Science 2008)
 Properties of polymerases
• DNA has directionality 5’ to 3’ due to the
directionality of the sugar backbone.
• Synthesis always occurs 5’ to 3’
– DNA polymerase involved in replication
– RNA polymerase in transcription
• Synthesis requires energy – typically
from triphosphate to monophosphate
• DNA polymerase requires a primer to
start
The two strands are not equal
during DNA replication

Since the DNA strands are antiparallel, and replication proceeds in

the 5' to 3' direction on EACH strand, one strand will form a
continuous copy. The top strand here….
 The Lagging Strand

…while the other, lagging strand will form a series of

short pieces with gaps. These are called “Okazaki
fragments” and require the use of other enzymes to
complete the process.
 Ligation ties Okazaki fragments

The process of ligation ties several Ogazaki fragments together.

This process of ligation is important in the development of

recombinant DNA technologies and genetic engineering

Figure 5-13 Molecular Biology of the Cell (© Garland Science 2008)

Origins of DNA replication
 Directionality of synthesis:
leading and lagging strands

Figure 6-12 Essential Cell Biology (© Garland Science 2010)

Replication animation

06.4-replication_I.wmv

06.5-DNA_replication_fork.wmv
 Properties of polymerases
• DNA has directionality 5’ to 3’ due to the
directionality of the sugar backbone.
• Synthesis always occurs 5’ to 3’
– DNA polymerase involved in replication
– RNA polymerase in transcription
• Synthesis requires energy – typically
from triphosphate to monophosphate
• DNA polymerase requires a primer to
start polymerization reactions
Figure 5-11 Molecular Biology of the Cell (© Garland Science 2008)
Figure 6-16 Essential Cell Biology (© Garland Science 2010)
 Error rates are low
• Proofreading: DNA polymerase makes
occasionally mistakes during replication.
– There are several proofreading mechanism
to eliminate most of these mistakes

An error rate of 1/109 leads to an average mutation rate of 10-9

Telomere movie

06.6-telomere_replication.wmv
Figure 6-16 Essential Cell Biology (© Garland Science 2010)
Figure 6-18 Essential Cell Biology (© Garland Science 2010)
 Telomeres are involved in
aging and cancer
• Decline of the length of telomeres
during aging is well established.
• Telomeres are longer in young cells, in
stem cells and some cancer cells.
• When there are too many too short
telomeres, cells undergo apoptosis (a
regulated “suicidal” cell death)
• Telomere length variation is inherited.
 DNA is condensed
• DNA is wrapped around
histones in large coils in
the cell
– special enzymes are
necessary to uncoil and
recoil DNA
– the DNA is a very long
molecule that is highly
condensed

05.2-chromosome_coil.wmv
 Summary of DNA replication
• A pairs with T, G pairs with C
– G- C bond has 3 noncovalent hydrogen bonds
– A-T bond has 2 bonds and is thus weaker
• DNA replication is semi-conservative
• Polymerization proceeds 5’ to 3’
• Leading strand – continuous polymerization
• lagging strand: Okazaki fragments – ligation
• DNA Polymerization needs primers
• High fidelity after proof reading: errors 10
-9
 PCR History
• In 1983, recombinant DNA technology or genetic
engineering – the manipulation of DNA in bacteria –
discussed and done next week! - already existed.
• DNA could be manipulated after cloning in libraries
and selection, a cumbersome process
• Scientists realized that the principle of DNA
replication, by virtue of the need for primers, can be
used to target a specific DNA sequence for
exponential amplification for further analysis.
• Credit is somewhat disputed: 1971 Gobinda
Khorana, 1983 Kary Mullis at Cetus
• Nobel prize to Kary Mullis in 1993 – very fast
Figure 8-45a Molecular Biology of the Cell (© Garland Science 2008)
Figure 8-45b Molecular Biology of the Cell (© Garland Science 2008)
 10.1-PCR.wmv

http://www.youtube.com/watch?v=2KoLnIw
oZKU&feature=related
 What is needed for a PCR
reaction?

• DNA starting material (template, about 50-

100 ng)
• A primer set (2 primers)
• dNTPs
• Enzyme (Taq, thermostable)
• Buffer, salt
 Purposes of PCR
• Identify presence of a DNA in a mix (e.g. viral DNA
such as SARS or HIV or H1N1 in blood or tissue) –
a yes/no answer may be enough
• Introduce subtle changes into a piece of DNA
• Amplify all of the DNA from a small amount of DNA
(e.g. Neanderthal, Egyptian mummies)
• Sequence of a piece of DNA for future uses
• Amplify selectively one piece of DNA from the
genomic DNA mix of an organism for analysis such
as genotyping (as we will do in the laboratory)
http://www.youtube.com/watch?v=x5yPkxCLads
 Summary
• PCR uses the idea of DNA replication for purposes of
scientific analysis
• Taq Polymerase is a thermostable enzyme isolated
from a bacterium living in hot springs
• PCR can be used to EXPONENTIALLY amplify a
desired sequence – all, a subset, or a contaminant
such as viral DNA from a complex mix
• The choice of primers is the major determinant of
what is amplified
 Per3 repeat polymorphism
The Per3 gene is involved in sleep regulation.
In the coding region of Per3 is a repeated sequence of 54 bases
with 2 alleles, one with 4 and one with 5 repeats. It is in the coding
region, and thus affects protein function.

Some papers (Archer 2003) claim that people with the 4 allele are
more night owls (people who like to stay up late) and people with
the 5 allele more “early birds” (people who like to be active in the
early morning)

In Caucasians, the 4 and the 5 allele have frequencies of about

0.55/0.45, but in China, the 4 allele is more common, ~0.89 allele
frequency.
 Sequence of the Per 3 repeat
• Exon 18 contains the repeat:
• Exon 18 and adjacent introns were amplified
using forward (5′-
CAAAATTTTATGACACTACCAGAATGGCTGAC-3′)
and reverse (5′-
AACCTTGTACTTCCACATCAGTGCCTGG-3′)
primers, the resultant PCR products separated
on 1.5% agarose gels, and visualized using SYBR
Green I Stain (FMC BioProducts, Rockland, ME).
 Sequence around and of Per3 exon 18
(Primers red bold underlined, repeat in green, coding region in CAPS)

• accaagacggctactgagtgtggaggtgtgaaataaagggatgattccta
tcacaggctggaagcaataagacagctcaaaattttatgacactaccaga
atggctgacaattttaaacttatgaactgtttatttctggaattttccat
ttactatttttggaccttggttgaccacaggtaactgaaactacagaaag
caaaaccatgaataaaggaggactactgtattttgtgataagaagattaa
agtgtcttttcatgtgcccttactttctagcagTGTGTTACAGGCAACAA
TGGCAGTGAGAGCAGTCCTGCTACTACCGGTGCACTGTCCACGGGGTCAC
CTCCCAGGGAGAATCCATCC
• CATCCTACTGCCAGCGCTCTGTCCACAGGATCGCCTCCCATGAAGAATCCATCC
• CATCCTACTGCCAGCGCTCTGTCCACAGGATCGCCTCCCATGAAGAATCCATCC
• CATCCTACTGCCAGCACACTGTCCATGGGATTGCCTCCCAGCAGGACTCCATCC
• CATCCTACTGCCACTGTTCTGTCCACGGGGTCACCTCCCAGCGAATCCCCATCC
• AGAACTGGTTCAGC
AGCATCAGgtagtggatcaggacaactaatgtttcaaactccaatgccag
acattcactatgtgctgagctctcactgtgtgccccaggcactgatgtgg
aagtacaaggtttttttttctttttccctttttcctttttgtcaggtata
ttggggtatatttatacacaataaaattcaccagtttgaggggtacaaac