Biochemistry 455

Microanalysis of Carbohydrate Mixtures -Calculations-

Dual Isotope Counting

Ch1 Ch2

profile overlaps that of 3H Need to calculate 14C cpm in Ch 1 Subtract this value from Ch 1 to get true 3H cpm Add this value to Ch 2 to get true 14C cpm

14C

Data Analysis
Subtract background 3H cpm from all Ch 1 values Subtract background 14C cpm from all Ch 2 values Determine 14C cpm in Ch 1:
14C

cpm in Ch 1 = Ch1/Ch2 ratio 14C cpm in Ch 2

14C 14C

Constant value (TA supplies)

cpm in Ch 1 = Ch1/Ch2 ratio x

cpm in Ch 2

Data Analysis
True 3H cpm = Total Ch 1 cpm (3H + True
14C 14C)

14C

cpm in Ch 1

cpm =

14C

cpm in Ch 2 +

14C

cpm in Ch 1

Now that we know the true cpm values, we can calculate [sugar]

Data Analysis
(3H
Qmol sugar = Qmol sugar cpm in peak) x 3H cpm

Fraction recovered True 3H cpm in peak: From paper chromatogram (corrected) results
3H

cpm per Qmol sugar: Value provided by TA Total 14C cpm in glucitol peak Fraction recovered = Total 14C cpm in reaction

1) From paper chromatogram (corrected) results 2) Calculate from value of 14C cpm per Ql, given by TA

Data Analysis
Prepare a plot of 14C cpm AND 3H cpm vs. segment # (dual y axes) Identify glucitol peak Calculate Rglucitol values for the other sugars
Rglucitol =
Distance (segment #) from 3H peak to origin Distance (segment #) from glucitol peak to origin

Biochemistry 455
In Vitro Transcription, Day 1

Ribosomal RNA (rRNA)

Associated with protein as part of ribosome 2 ribosomal subunits ~70% of total cellular RNA

Bacterial 16S rRNA

Many RNA molecules have secondary structure due to intramolecular base pairing

Large Ribosomal Subunit

Purple = protein Orange+white = 23S rRNA Burgundy+white = 5S rRNA Red = P site Green = A site

Eukaryotic ribosome

Transfer RNA (tRNA)

Small molecules of 75-80 nucleotides Cloverleaf structure Contains an anti-codon sequence that base pairs with codon of mRNA when charged with its specific amino acid ~20% of total cellular RNA

Structure of tRNA

2r structure

3r structure

Messenger RNA (mRNA) essenger

Wide size range (150-10,000 nt) Synthesized by RNA polymerase using a DNA template and rNTPs (ribonucleotide triphosphates) Provides the code for translation into amino acid sequence Transcripts refers to RNA molecules Stability of individual mRNA molecules varies ~5% of total cellular RNA

Small Nuclear RNA (snRNA)

Combines with proteins (snRNPs) to form splicesome in eukaryotes Involved in processing RNA

RNA vs. DNA

Phosphate

Base

Sugar 2 OH

RNA vs. DNA

RNA is primarily singlestranded

RNA only

DNA only

RNA Polymerase
Reads 3 to 5 (binds to dsDNA) Synthesizes 5 to 3 Does NOT need primer to begin synthesis; no proofreading ability
Error rate is in in 10,000 to 1,000,000

Only reads one strand (template or antisense strand); synthesizes complementary strand (coding or sense strand) Substrates are rNTPs

Types of Polymerases and Promoters

Viral (simplest)
Single protein, ~100 kDa Recognizes simple 26-nt promoter Examples: T7 & SP6

Bacterial (larger)
5 subunit complex, ~500 kDa Recognizes more complex promoter sequence (-35 + -10 region)

Types of Polymerases and Promoters

Eukaryotic (most complex)
RNA polymerase I makes rRNA RNA polymerase II makes mRNA RNA polymerase III makes tRNA and others Recognition sites contain TATA boxes, as well as regions that bind enhancers and repressors that affect polymerase activity

The more complex the organism, the more complex the polymerase & the promoter

Transcription Unit
Promoter
Tells RNA polymerase which strand to use Tells RNA polymerase where to start NOT included in message

Terminator
Tells RNA polymerase where to stop IS included in message

RNA Polymerase (E. coli) (E. coli)

Core enzyme = EEFF[ [ Holoenzyme = Core+W W = Specificity factor
In 1955, Marianne Grunberg Manago and Steven Ochoa reported the isolation of an enzyme that catalyzed the synthesis of RNA. For this work, Ochoa shared the 1959 Nobel Prize in Medicine with Arthur Kornberg (who received the Prize for his work on DNA polymerase I).

Sigma Factor
Directs RNA polymerase to promoter Offers mechanism for first level of transcriptional control
Only promoters recognized by current sigma factor will be sites for transcription initiation

Examples
rpoD: major sigma rpoS: operates during stationary phase rpoH: operates during heat shock

Structure of a Strong Bacterial Promoter

Pribnow or TATA box Determines start site

Spacer = 17 s 1 nt

1st nt in message

Recognized by W

Bacterial Promoters
Constitutive promoters
Usually associated with housekeeping genes Always ON

Inducible promoters
Expression regulated ON/OFF switch

Strong vs. weak promoters

Has to do with efficiency of RNA polymerase binding

Bacterial Transcription Initiation

RNA polymerase core binds W

W directs binding of holoenzyme to promoter

Bacterial Transcription Initiation

W dissociates leaving RNA polymerase core

RNA polymerase core unwinds DNA helix

Transcription Elongation

Ribose: RNA

Deoxyribose: DNA

RNA polymerase synthesizes the mRNA chain by forming phosphodiester bonds through the process of complementary base pairing. Energy of bond formation is provided by hydrolysis of a phosphate bond (rNTP).

Transcription Elongation
* * * * * * *
E K F

Which phosphate should be radiolabeled? Only E phosphate incorporated into chain Which nucleotide could be K labeled? 1st rNTP to be incorporated could be K labeled

Another Labeling Technique

Another way to label the 5 end
Use phosphorylase to remove all 5 phosphates Add polynucleotide kinase that adds phosphate from ATP to 5 end and releases ADP Which phosphate on ATP should be labeled?
Need K-32P-ATP

Transcription Bubble

Necessary for translation

An RNA-DNA heteroduplex forms in the transcription bubble. The DNA helix is unwound in advance of the bubble and reforms behind it.

Transcription Elongation

Only the area being actively transcribed is single-stranded http://opbs.okstate.edu/~petracek/Chapter%2026%20figures/Fig%2026-01a.JPG

RhoRho-independent Termination
A stem-loop (hairpin) structure forms in the newly synthesized mRNA transcript This is immediately followed by a string of U residues The hairpin destabilizes the RNA-DNA hybrid (weak bonds) The mRNA and RNA polymerase dissociate http://www-biology.ucsd.edu/classes/bimm100.WI00/images/12-1.gif

RNA Hairpin
A region of sequence complementarity in the mRNA transcript results in the formation of a stem-loop or hairpin The termination signal is in the message itself

http://www.dakotacom.net/~clamunyon/F01MolGen/F01MolGenSyl.html

RhoRho-dependent Termination

http://www.cofc.edu/~delliss/Biol312Lec/Procaryotic%20Txn/TxnTerm.html

RhoRho-dependent Termination

This type of termination requires an additional helper protein

http://www.cofc.edu/~delliss/Biol312Lec/Procaryotic%20Txn/TxnTerm.html

Organization of an Operon
Polycistronic message

Operon = OPERator regiON >1 gene under control of same promoter Coordinated control of expression Often encode enzymes in same metabolic pathway

T7 RNA Polymerase

T7 RNA polymerase is composed of a single polypeptide chain

pSP72 Plasmid

The pSP72 plasmid contains 2 distinct viral promoters, positioned at opposite ends of the MCS and oppositely oriented

Todays Work
Digest pSP72 plasmid with 3 different restriction enzymes
Produces linearized plasmid with different 3 ends

Perform transcription using T7 RNA polymerase Stops when it runs out of template
Run-off transcription

pSP72 Plasmid Sequence

SP6 promoter +1 HindIII 5-ATTAGGTGACACTATA ATTAGGTGACACTATAGAACTCGAGCAGCTGAAGCTTGCATGC 3-TAATCCACTGTGATATCTTGAGCTCGTCGACTTCGAACGTACG BamHI EcoRI

CTGCAGGTCGACTCTAGAGGATCCCCGGGTACCGAGCTCGAATTC

GACGTCCAGCTGAGATCTCCTAGGGGCCCATGGCTCGAGCTTAAG ATCGATGATATCAGATCTGCCGGTCTCCCTATAGTGAGTCGTATTA-3 ATATCACTCAGCATAAT TAGCTACTATAGTCTAGACGGCCAGAGGGATATCACTCAGCATAAT-5

T7 promoter +1 Template strand Coding strand (mRNA sequence; U replaces T) Note restriction cut site to determine length of template mRNA will be complement of same length

Todays Work
Digest plasmid Precipitate DNA with Pellet Paint Coprecipitant Wash DNA pellet Resuspend in Txn mix; add T7 polymerase and RNase inhibitor (at TA bench) Spin down sample Take to TAs they add E-32P-rCTP TAs will put in incubator and stop reaction All work involving isotope done behind Plexiglas shield