Panax ginseng C. A.

Meyer
E EMetabolic Engineering of Ginsenoside Biosynthetic Pathway for the Enhanced Production of Oleanane-type Ginsenoside [Ro] in Panax ginseng C. A. Meyer

Metabolic Engineering of Ginsenoside Biosynthetic Pathway for the Enhanced Production of Oleanane-type Ginsenoside [Ro] in Panax ginseng C. A. Meyer
The main biologically active constituents in P. ginseng are the complex mixture of triterpene saponins known as Ginsenosides (Rx). These are found only in the four-year-old roots. These ginsenosides are synthesized via Isoprenoid pathway. With the exception of Ginsenoside Ro, which is an oleanane-type triterpenoid, all ginsenosides are the dammarane-type separated into panaxadiol and panaxatriol classes. -amyrin synthase [AS] is the key enzyme involved in oleanane-type ginsenoside [Ro] biosynthesis.

Medicinal properties of Oleanane-type ginsenosides [Ro] Anti-platelet aggregation Fibrinolytic action Stimulation of phagocytic action Anti-hepatic activity Anti-inflammatory activity Anti-tumor activity Anti-oxidant activity

Isoprenoid Pathway

Heterologous expression studies of -amyrin synthase cDNA in E. coli BL21 DE3 pLys S
vCloning of -amyrin synthase cDNA into pRSET A expression vector and subsequent transformation into E. coli BL21 DE3 pLys S vIPTG-induced expression of -amyrin synthase cDNA v vRecombinant -amyrin synthase purification using Ni-NTA columns vPolyclonal antibodies in rabbits vIn vitro -amyrin synthase assay vCrystallographic studies of recombinant -amyrin synthase

Standardisation of expression conditions

UI 25oC 37oC M

1 2 3 4 5 6 7 8 9 10 1112 13 14 15 16 17 18 19

r 1h

r 2h

r r N 3h O/ 1h

r 2h

r 3h

O/

IPTG: 0.5mM O.D of Induction: 0.5

IPTG induced expression and Ni-NTA column purification of AS

SDS-PAGE
1 AS 87 kDa 2 3 4 5 6 kDa 116 66 45 35 25 2

Coomasie
3 4 5 6 kDa 116 66 45 35 25

Silver
6 5 AS 87 kDa

Sample IPTG induced E. coli BL21 [pRSET A] Uninduced E. coli BL21 [pRSET A :: AS] IPTG induced E. coli BL21 [pRSET A :: AS] Soluble fraction IPTG induced E. coli BL21 [pRSET A :: AS] membrane fraction Ni-NTA purified AS Marker

o.

Parameters
Culture OD600 : 0.5 IPTG: 0.25, 0.5, 0.75 or 1.0 mM Incubation: 1, 2, 3 h or overnight

Recovery of Ni-NTA eluted AS 850 g/ml

Temperature: 25 or 37 oC

kDa
116 66 45 35
AS 87 kDa

25

Fig. 1. SDS-PAGE of the over-expressed AS recombinant protein. A. Expression of recombinant His-tagged AS protein in E. coli BL21 DE3 pLys S. Ten micrograms of protein extracts prepared from IPTG-induced or uninduced E. coli BL21 DE3 pLys S cells containing pRSET A or pRSET A-AS were fractionated on 12.5 % SDS-PAGE and stained with coomassie brilliant blue R-250. Lanes contain protein extracts as follows; Lane 1. Total protein of uninduced E. coli BL21 DE3 pLys S (pRSET A), lane 2. total protein of IPTG-induced E. coli BL21 DE3 pLys S (pRSET A), lane 3. total protein of uninduced E. coli BL21 DE3 pLys S (pRSET A-AS), lane 4. total protein (soluble fraction) of IPTG-induced E. coli BL21 DE3 pLys S (pRSET A-AS), lane 5. total protein (insoluble fraction) of IPTG-induced E. coli BL21 DE3 pLys S (pRSET A-AS), lane 6, the purified recombinant AS fusion protein, lane 7. Protein marker. B. The Ni-NTA-purified lysate containing the recombinant AS fusion protein stained with silver nitrate.

Immuno blot analysis of r-bAS with -bAS antibody from rabbit

-His

-bAS
0 0 40 :80 1: 1 0 60 :200 1 1 1:

To amplify BAS1 from pRSETA and clone into pET32b vector (with thioredoxin tag) BAS3F: Sal I site CCGTCGACGCATGTGGAAGCTTAAGATAGCGG BAS3R:Not I site TTGCGGCCGCTTAGGTGCCTAGGGACGG 1 2 3 4 5

6 kb 2.4 kb

2.6 kb

1: uncut pET32b 2: pET32b/SalI-NotI 3: uncut bAS3-TA 4: bAS3TA/SalI-NotI 5: 1 kb Ladder

Clone confirmation of bAS-pET32b

1 2 3 4 5 6 7 8 1 2 3 4 5

~4.5 kb 1.6 kb

1 2 3 4 5 6 7 8 9 10 11 1: uncut pET-bAS 2: pET-bAS/SacI 3: uncut pET32b 4: pET32b-SacI 5: 1 kb Ladder Expected SacI1.6kb+6.8kb

Agrobacterium-mediated transformation of AS gene in P.ginseng

A. tumefaciens LBA 4404 [pBIN AR :: AS] construct
RB

35 PRO

AS

NOS TER

NOS PRO

npt II

NOS TER LB

P. ginseng seeds In vitro plantlets Nodal explants Callus induced [MS+2,4-D (1 mg/l) +Kn (0.1 mg/l)] Kanamycin sensitivity test MS + Kan [25 200 mg/l] 100 mg/l Co-cultivated with 0.5 O.D. culture of A. tumefaciens LBA 4404 [pBIN AR :: AS] for three days in dark Selection medium [MS semisolid + Cefotaxime (250 mg/l) + Kanamycin (100 mg/l)] thrice of 15 days incubation Transgenic calli [MS+2,4-D (1 mg/l) +Kn (0.1 mg/l)] In vitro shoot regeneration Somatic embryogenesis Transgenic plant

To be done
Molecular analysis of transformed P. ginsengplants to confirm the stable integration and the constitutive expression of -AS gene. In vitro -amyrin synthase assay and HPLC profiling. To get bAS in the soluble fraction in E. coli a.subcloning into pBAD vector for tightly controlled expression b.subcloning into pMAL vector (MBP fusions are generally cytosolic)

HPLC-chromatograms of a mixture of ginsenosides. Eluent: A, acetonitrile-water (27.5 : 72.5); B, acetonitrile-water (16.5 : 83.5) Column: Glass-ODS (4 rnm I.D. X 150 ram). Flow-rate: 1.0 ml/min. Detection at 203 nm.

Y. Matsushima et al

HPLC-chromatograms of a ginseng extract. Eluent: A, acetonitrile-water (27.5 : 72.5); B, acetonitrile-water (16 : 84) Column: Glass-ODS (4 mm I.D. X 150 mm). Flow-rate: 1.0 ml/min. Detection at 203 nm.

Y. Matsushima et al