Genetics and Recombinant

DNA
BIT 120
 Mitosis
• 46 chromosomes
• 23 pairs
• 22 pairs autosomes (Chromosomes
other than the X or Y sex
chromosomes)
• 1 pair sex chromosomes: XX and XY
• Mitosis is the process that facilitates the
equal partitioning of replicated
chromosomes into two identical groups.
 Stages of Mitosis
• Prophase: The chromatin, diffuse in interphase, condenses into
chromosomes. Each chromosome has duplicated and now consists
of two sister chromatids. At the end of prophase, the nuclear
envelope breaks down into vesicles.

• Metaphase: The chromosomes align at the equitorial plate and are

held in place by microtubules attached to the mitotic spindle and to
part of the centromere.

• Anaphase: The centromeres divide. Sister chromatids separate and

move toward the corresponding poles.

• Telophase: Daughter chromosomes arrive at the poles and the

microtubules disappear. The condensed chromatin expands and the
nuclear envelope reappears. The cytoplasm divides, the cell
membrane pinches inward ultimately producing two daughter cells
(phase: Cytokinesis).
 Genes on Chromosomes
• Definition of Gene: The functional and
physical unit of heredity passed from
parent to offspring. Genes are pieces of
DNA, and most genes contain the
information for making a specific protein
• One gene one enzyme
• One gene one peptide
 Meiosis - The Genetics of
Reproduction
• Diploid – 2 chromosomes per pair
• Haploid – set of one chromosome
• The process of meiosis essentially
involves two cycles of division, essentially
involving a gamete mother cell (diploid
cell) dividing and then dividing again to
form 4 haploid cells. These can be
subdivided into four distinct phases which
are a continuous process
Prophase I
Metaphase I
Anaphase I
Telophase I
 Meiosis II
• Meiosis II is simply a mitotic division of
each of the haploid cells produced in
Meiosis I. There is no interphase between
Meiosis I and Meiosis II and the latter
begins with:
Prophase II
Metaphase II
Anaphase II
Telophase II
 Summary: Meiosis Steps
• Prophase - Homologous chromosomes in the
nucleus begin to pair up with one another
and then split into chromatids (one half of a
chromosome) where crossing over can
occur. Crossing offer can increase genetic
variation explained soon.
• Metaphase - Chromosomes line up at the
equator of the cell, where the sequence of
the chromosomes lined up is at random,
increasing genetic variation via independent
assortment explained soon.
 Summary: Meiosis Steps
• Anaphase - The homologous
chromosomes move to opposing poles
from the equator
• Telophase - A new nuclei forms near
each pole alongside its new
chromosome compliment.
• At this stage two haploid cells have
been created from the original diploid
cell of the parent.
 Summary: Meiosis Steps
• Prophase II - The nuclear
membrane disappears and the
second meiotic division is
initiated.

• Metaphase II - Pairs of
chromatids line up at the equator
 Summary: Meiosis Steps
• Anaphase II - Each of these
chromatid pairs move away from the
equator to the poles via spindle fibres

• Telophase II - Four new haploid

gametes are created that will fuse
with the gametes of the opposite sex
to create a zygote.
 Summary: Meiosis Steps
• When Meiosis II is complete,
there will be a total of four
daughter cells, each with half
the total number of
chromosomes as the original
cell.
• Increases Genetic diversity
 Crossing Over
• During meiosis, when homologous
chromosomes are paired together, there
are points along the chromosomes that
make contact with the other pair. This
point of contact is deemed the chiasmata,
and can allow the exchange of genetic
information between chromosomes. This
further increases genetic variation
 Mendel’s Work
• Gregor Mendel, an Austrian monk is most
famous in this field for his study of the
phenotype of pea plants, including the
shape of the peas on the pea plants.

• 2 laws:
– Segregation
– Independent Assortment
 Mendel cont’d
• Mendel's goal was to have a firm scientific
basis on the relationship of genetic
information passed on from parents to
offspring
• Did work with Pea plants - looked at traits
for color and texture
• For texture - showed more round than
wrinkled; for color - more green than
yellow
 Mendel cont’d
• Idea of Dominant and Recessive
• Idea of alleles - alternate forms of the
same gene
• Monohybrid cross
 Segregation
– Mendel's First Law
– "The alleles of a gene exist in pairs
but when gametes are formed, the
members of each pair pass into
different gametes. Thus each
gamete contains only one allele of
each gene."
 Independent Assortment
• Genes affecting different traits will
separate independently from one another
during gamete formation.
• Dihybrid cross - see example next slide
• Can use to see how 2 or more genes will
sort out
 Dihybrid Cross

Rr, round & wrinkled

Yy, yellow and green
 New convention for naming
• See overhead

• now would be Ww and Gg

• Exceptions:
– incomplete dominance
– multiple alleles
– linked genes
 Sex Determination
• XX females
• XY males - not “truly” a homologous pair

Arrows indicate genes

on the X chromosome
for which there is no
complement on the Y
chromosome
 SRY gene - Sex Determining
Region Y
• Gene on Y chromosome that determines
embryo will be a male
• Produces TDF - testis determining factor

Testis-
determining
factor
 Sex-linked Genes
• Some examples:
∀ • Red-Green colour blindness
∀ • Hemophilia - A condition which
prevents the clotting of the blood
∀ • DMD - muscular dystrophy
∀ • Hypertension
Inheritance - hemophiliac male
Inheritance - carrier female
 Pedigree Analysis
• Charts to look at inheritance pattern of
genes in humans

• http://www.blc.arizona.edu/courses/181gh/rick

• http://www.ndsu.nodak.edu/instruct/mcclean/p
 Chromosomal mutations
http://www.people.virginia.edu/~rjh9u/chromdel.html

• Gene deletion
 Chromosomal mutations
http://www.people.virginia.edu/~rjh9u/chromdup.html

• Gene duplication
 Chromosomal mutations
http://www.people.virginia.edu/~rjh9u/chrominv.html

• Gene inversion
 Chromosomal mutations
http://www.people.virginia.edu/~rjh9u/chromtran.html

• Gene translocation
 DNA-level mutation
• Previous examples chromosomal level
changes

• changes can occur at DNA level

• also can have deletion, insertion, inversion

and substitution
 DNA mutation
1.Deletion
Here, certain nucleotides are deleted, which affects
the coding of proteins that use this DNA sequence. If
for example, a gene coded for alanine, with a genetic
sequence of C-G-G, and the cytosine nucleotide was
deleted, then the alanine amino acid would not be
able to be created

2. Insertion
Similar to the effects of deletion, where a nucleotide
is inserted into a genetic sequence and therefore
alters the chain thereafter. This alteration of a
nucleotide sequence is known as frameshift
 DNA mutation
3.Inversion
Where a particular nucleotide sequence is reversed,
and is not as serious as the above mutations. This is
because the nucleotides that have been reversed in
order only affect a small portion of the sequence at
large
4.Substitution
A certain nucleotide is replaced with another, which
will affect any amino acid to be synthesized from this
sequence due to this change. If the gene is essential,
i.e. for the coding of hemoglobin then the effects are
serious, and organisms in this instance suffer from a
condition called sickle cell anemia. - CAN BE
SILENT MUTATION. CONSERVATION
SUBSTITUTION, OR SUBSTITUTION
Change in Sickle cell anemia
gene
 Other related topics
• Polyploidy
• Mutation Frequency
 Recessive human genetic
disorders
• Brachydactly - first human genetic
disorder characterized - short fingers and
toes
• Albinism - absence of pigmentation
• Sickle cell anemia - inefficient oxygen
transport due to abnormal shape red
blood cells
• PKU
• Tay Sachs - neurodegenerative
 Dominant Human genetic
disorders
• Huntington’s disease - progressive
destruction of brain cells
• Polydactly - extra fingers and toes
 Intro to Recombinant DNA
• Some unmet medical needs:
∀ • invasive fungi infections
∀ • drug resistant bacteria
∀ • hepatitis virus
∀ • new vaccines
∀ • HIV
∀ • Cancer
 Recombinant DNA
– Definition : DNA molecule produced artificially and
containing sequences from unrelated organisms.
• Genetic Engineering
• Use of techniques involving recombinant DNA
technology to produce molecules and/or organisms
with new properties.
• Biotechnology
• All inclusive term for several technologies including
but not limited to recombinant DNA. Refers to the
use of technology in applications for solving
fundamental problems in biology.
 Restriction endonucleases
• Also called restriction enzymes: digest
DNA at specific sequences
Sequence Recognition -R.E.
• Restriction endonucleases -- cut
double stranded DNA at specific
sequences, protection against
viruses in bacteria.
• Sequences often palindromes: a
sequence which is the same when
read in either direction. ”A man a
plan a canal: Panama”
Some common Restriction
enzymes
Restriction digests and agarose
gels - orientation
 DNA ligase
• DNA ligase joins 5'-phosphate and
3'-hydroxyl ends of DNA
• Two fragments formed by EcoRI
can be rejoined by ligase.
• Similarly, Eco RI fragments from two
different pieces of DNA can be joined
Ligation
 Plasmids
• Extrachromosomal, circular small (2-3
kb) DNA in a bacterial cell which can
replicate independently but which cannot
integrate into the host chromosome.
• Drug resistance plasmids are not
essential for the cell's growth, but confer
antibiotic resistance.
• Plasmids used for molecular cloning
have been artificially created by
recombining fragments of various existing
plasmids.
• Plasmids contain multiple cloning sites
with several restriction endonuclease
Example of a Plasmid
Example of a plasmid + insert
(DNA of interest)
Tools of recombinant DNA -
cloning
Creating a Recombinant DNA
molecule
• A plasmid (vector) is digested with EcoRI at a
single site to produce two sticky ends.
• A sample of human DNA is also digested with
EcoRI to produce pieces with the same sticky ends
• Human DNA- or cDNA copied from mRNA using
reverse transcriptase from retroviruses.
• The two samples are mixed and allowed to
hybridize, some molecules will form with pieces of
human DNA inserted into the plasmid vector at the
EcoRI site.
• DNA ligase is used to covalently link the
fragments.
Recombinant DNA molecule
Inserting recombinant DNA into
Host
· Transformation
– cell made competent to take up DNA
– competent cells: electroporation – poke holes in membrane
and calcium chloride- make cells more permeable to DNA
· Transfection
– when the cloning vector used has aspects of a virus, the host
cell can be infected (transfected) to insert the recombinant
molecule
· Electroporation
– the cell is placed in an electric field such that small pores are
temporarily opened in the membrane. Added DNA can enter
through these pores.
Transformation
 Selection
– Antibotic resistance
• Plasmid vector contains an
ampicillin resistance gene making
the cell resistant.
• Growth of transformed cells (cells
receiving the plasmid) can be
identified on agar medium
containing (e.g.) ampicillin.
Transformation
 Further selection
• The plasmid vector contains another identifiable
gene (e.g., a second drug resistance or an enzyme
activity), with the coding sequence of this gene
containing the restriction site for insertion.
• Insertion of the foreign DNA at this site
interrupts the reading frame of the gene and
result in insertional mutagenesis.
• In the following example, the Β-galactosidase
gene is inactivated. The substrate "X-gal" turns
blue if the gene is intact, ie. makes active enzyme.
White colonies in X-gal imply the presence of
recombinant DNA in the plasmid.
X-gal selection
 Cells ready for DNA uptake
• Competent cells: Treat the cells
with calcium chloride which
makes the cell membranes more
permeable to DNA. This
technique succeeds with species
that aren't naturally competent
e.g. E. coli.
• Electroporation - alternate method
 Finding the proper orientation of
clone
• Insert can go in both directions
• How to determine correct orientation
• Perform restriction digests using enzymes
outside the cloning fragment
• Add total fragments up
• Must add up to right size
 Link to Orientation
• http://homepages.strath.ac.uk/%7Edfs99109/B
 Finding the right Clone
• Hybridization (see overhead as well)
 Genomic library
• Source of DNA to clone
• all the cells in your body have identical
DNA
• problem with this method is introns
Genomic Library Construction
cDNA libraries: alternate source
(complimentary DNA library)
• Made from RNA by reverse transcription
(reverse transcriptase is enzyme)
• RNA made into double stranded DNA
• comes from tissue that expresses gene(s)
of interest
• no introns
• source abundant in message
• difficult to work with- RNA degrades more
rapidly than DNA
cDNA library construction - step 1
cDNA library construction - step 2
cDNA library construction - step 3
 Alternate cloning tool -
PCR
• Polymerase chain reaction
• amplification of small DNA quantities
• clone from genomic or cDNA source
• thermostable polymerase - heat to
separate DNA strands
PCR step 1: Denaturation
PCR step 2 - Annealing
PCR step 3 - Extension
After one round of PCR
After 2 rounds of PCR
After 3 round of PCR
 Required Components of PCR
• DNA template DNA
• thermocycler (or water baths)
• pool of free dNTPs
• Taq (or other heat-stable) DNA
polymerase
• Primers - annealed at appropriate
temperatures
 Conditions for PCR
• Denature: 94°C to 100°C , 1 minute
• For anneal temperature, 2°C for every A
and T, 4 °C for every C and G. 1minute - 2
minutes - GO 3-5 DEGREES BELOW
THAT TEMPERATURE
• Extension: 72 °C for 2 minutes
• Do this 30 cycles
• machine programmable
 Problem
• What is the annealing temperature for the
following primer (a 21 mer)?:

AAGCTTGTCCAGAATTTCGGC
 Solution
• 11 A/T X 2 = 22
• 10 C/G X 4 = 40

• 22 + 40 + 62

• Go a few degrees below that number, so

you would anneal at about 58°C
 Applications of recombinant
DNA
• Diagnosis of genes by RFLP (restriction
fragment length polymorphisms)
• Example sickle cell anemia
 RFLP
restriction fragment length polymorphism

converts a GAG codon (for Glu) to a GTG codon for Val

abolishes a sequence (CTGAGG, which spans codons 5, 6,

.
and 7) recognized and cut by one of the restriction enzymes
 Other diseases identified by
RFLP
• Cystic fibrosis
• Huntington’s disease
• Loss (or gain) of restriction enzyme sites
when amino acid change in middle of
codon, and thus, protein
 How do you know sequence of
DNA?
• Sanger sequencing - named after Fred
Sanger
• utilizes 2',3'-dideoxynucleotide
triphospates (ddNTPs), molecules that
differ from deoxynucleotides by the having
a hydrogen atom attached to the 3' carbon
rather than an OH group. (see upcoming
figure)
 Sanger (dideoxysequencing)
sequencing
• Need polymerase
• dNTPs
• ddNTPs
• primer
• DNA template
Sanger method
Product of sequencing
 Cellular expression systems
• Expression systems are based on the
insertion of a gene into a host cell for its
translation and expression into protein
• types of available systems
•.
o Bacteria - e.g. Escherichia coli (E.coli), Bacil us subtilis (B. subtilis)
o Yeast
o Culturedinsect cells – baculovirus or Drosophila
o Culturedmammaliancells – HEK 293cells, CHO cells
 Bacteria
• Advantages:
– short generation time
– simple physiology
– large yield of some proteins
• Disadvantages:
– no post-translational modifications -
glycosylation, phosphorylation
– degradation of proteins
– misfolded proteins
 Yeast
• Advantages:
– can perform post-translational modifications
– secrete proteins in media- easy to isolate from
there
• Disadvantages:
– active proteases
 Insect cells
• Advantages:
– high expression level
– correct folding
– correct post-translational modification
• Disadvantages:
– slow generation time
– costly- media and cells
– finicky
 Mammalian cells
• Advantages:
– cellular machinery same as gene of
interest
– folding, post-trans. Correct
– amino acid bias the same
• Disadvantages:
– expresses endogenous protein, need to find
correct cell line (by trial and error)
Mammalian Expression vectors
• Transient transfection - put into cells and
protein expressed for a short period of
time- usually 24 to 48 hours
• stable tranfection - integrated into
genome- expression carried on indefinitely
(need to select)
• expression vector allows for translation as
well
Introducing DNA into cells
DEAE dextran - an inert carbohydrate polymer (dextran)
coupled to a positively charged chemical group
(diethylaminoethyl -DEAE). DNA probably sticks to DEAE-
dextran via its negatively charged phosphate groups.

Calcium phosphate - forms an insoluble precipitate with DNA.

It was discovered that cells efficiently take up this precipitate.
More efficient than DEAE dextran or many cell types and can
be used for both transient and stable transfection. Not
suitable for cells which grow in suspension culture.
Introducing DNA into Cells
Electroporation - Cells are concentrated, mixed with the DNA
and placed in a small chamber with electrodes connected to
a specialised power supply. A brief electric pulse is applied,
which is thought to ‘punch holes’ in the cell membrane,
enabling the cell to take up DNA.
Lipofection - (liposome-mediated gene transfer) several lipid-
based methods have been developed in which DNA is
encapsulated by synthetic lipid bilayers which resemble cell
membranes. Liposomes are essentially spheres of synthetic
membrane filled with DNA. These fuse spontaneously with cell
membranes, releasing their contents into the cytoplasm.
Introducing DNA into cells
• Microinjection - The most efficient artificial means
of getting DNA into cells. DNA is injected into the
nucleus using a microelectrode needle. Very
tedious method because each and every cell has
to be injected individually. There are now
computer-based systems which will assist in the
process.
 Creating a fusion protein
• Gene products are “fused” together,
produced as a single polypeptide
• can then use a tag sequence to help
isolate that protein
• can purify over a column and get rid of tag
by cleavage (cutting)
 Technique of Cell Culture
• Follow handout – 4 pages
• How did Tissue Culture develop
• What is Tissue Culture
• How is T.C. performed
• What can go wrong
• References