MARC-OLIVIER DUCEPPE

PROTÉOME ET BILAN PHOTOSYNTHÉTIQUE DE LA

POMME DE TERRE (SOLANUM TUBEROSUM L.) EN
RÉPONSE AU DORYPHORE DE LA POMME DE TERRE
(LEPTINOTARSA DECEMLINEATA SAY)

Thèse présentée
à la Faculté des études supérieures de l‟Université Laval
dans le cadre du programme de doctorat en biologie végétale
pour l‟obtention du grade de Phisolophiae Doctor (Ph.D.)

DÉPARTEMENT DE PHYTOLOGIE
FACULTÉ DES SCIENCES DE L‟AGRICULTURE ET DE L‟ALIMENTATION
UNIVERSITÉ LAVAL
QUÉBEC

2011

© Marc-Olivier Duceppe, 2011

 ii

Avant-propos

Cette thèse de doctorat est présentée sous la forme d‟articles scientifiques et comprend 4 chapitres. Une
introduction générale s'attarde, d'abord, à l‟importance économique de la pomme de terre, notre modèle
d‟étude, et à l‟impact négatif des insectes défoliateurs sur le rendement de cette production agricole. Le
Chapitre 1, intitulé « Revue de la littérature », dresse un survol des notions importantes et de l‟état des
connaissances actuelles à propos des réponses biochimiques et physiologiques des plantes aux insectes
défoliateurs; les hypothèses et objectifs de recherche du projet sont également décrits à la fin du chapitre.

Les Chapitres 2 à 4 présentent l‟ensemble des travaux effectués dans le cadre de la thèse. Ils sont rédigés
en anglais, sous la forme d‟articles scientifiques standards. Chaque article est précédé d‟une description
des objectifs poursuivis et d‟une synthèse des principaux résultats obtenus en cours de route. D'une
manière plus précise, le Chapitre 2 porte sur l‟analyse protéomique des réponses de la pomme de terre au
doryphore de la pomme de terre. Il intègre un article scientifique intitulé « Wounding, beetle leaf
feeding and aphid phloem feeding differentially alter the potato leaf proteome ». J'ai réalisé
l'essentiel des travaux décrits et rédigé le manuscrit présenté1. Le Prof. Conrad Cloutier et son équipe ont
contribué aux aspects entomologiques de ce travail. Le Prof. Dominique Michaud a dirigé mes recherches
et participé activement à la rédaction du manuscrit.

Le Chapitre 3 est une analyse protéomique des sécrétions orales du doryphore de la pomme de terre. Il
intègre un article scientifique intitulé « Host plant proteins in the larval regurgitant of Colorado
potato beetle, Leptinotarsa decemlineata Say ». J'ai réalisé l'essentiel des travaux décrits et rédigé le
manuscrit présenté. Le Prof. Cloutier et son équipe ont contribué aux aspects entomologiques de ce
travail. Le Prof. Michaud a dirigé les recherches et participé activement à la rédaction du manuscrit.

1
Une partie des travaux présentés dans ce chapitre ont été effectués dans le cadre de mes travaux de maîtrise,
réalisée dans le même laboratoire.
 iii

Le Chapitre 4 porte sur l‟effet d'une défoliation par le doryphore de la pomme de terre sur les capacités
photosynthétiques de sa plante-hôte, la pomme de terre. Il intègre un article scientifique intitulé « Insect
regurgitant- and plant leaf-derived factors impact photosynthesis in potato plants
interacting with the Colorado potato beetle ». J'ai réalisé l'essentiel des travaux décrits et rédigé le
manuscrit présenté. Le Prof. Cloutier et son équipe ont contribué aux aspects entomologiques de ce
travail. Le Prof. Yves Desjardins m‟a apporté une aide technique et logistique précieuse pour les mesures
de photosynthèse et m'a secondé pour l'interprétation des données. Comme pour les articles précédents, le
Prof. Michaud a dirigé mes recherches et participé activement à la rédaction du manuscrit.

Pour compléter la thèse, une Discussion et une Conclusion générales sont finalement présentées, avec
pour but de mettre en perspective les principaux résultats obtenus et de proposer des travaux futurs. Une
annexe résumant quelques notions de base sur les mesures de photosynthèse dans un contexte d‟étude des
stress chez les plantes est également incluse à la fin de la thèse.
Remerciements

J‟aimerais remercier en tout premier lieu mon directeur de thèse, le Dr Dominique Michaud,
pour m‟avoir permis de réaliser mon doctorat au sein de son laboratoire. Merci Dominique pour
ton soutien financier, professionnel et moral. Mon passage dans ton laboratoire fut une
expérience plaisante et très enrichissante. Tu as su me guider durant ce long parcours, tout
particulièrement durant la rédaction de ce manuscrit. Ton esprit de synthèse inouï et tes conseils
judicieux ont eu raison de la complexité de ce projet.

J‟adresse également mes remerciements les plus sincères à mon codirecteur de thèse, le Dr
Conrad Cloutier, avec qui j‟ai aussi eu l‟honneur de travailler durant ma maîtrise. Merci Conrad
pour tes précieux conseils. Ta rigueur scientifique est sans reproche et elle a certes contribué à
mener ce projet à bon terme. Je tiens également à remercier le Dr Yves Desjardins. Yves, ton
expertise et tes conseils éclairés concernant l‟aspect physiologique de ce projet m‟ont été d‟une
grande valeur.

Merci à tous ceux qui ont contribué de près ou de loin à l‟avancement de mon doctorat. Je pense
en particulier au personnel du CRH, au personnel de l‟INAF, à toute l‟équipe du laboratoire du
Dr Michaud et plus particulièrement M. Simon Boudreault, pour son aide inestimable avec les
insectes utilisés durant ce projet.

Je ne peux passer sous silence le Réseau Biocontrôle, qui, en plus de m‟avoir fourni un soutien
financier et technique, m‟a permis de rencontrer des gens magnifiques que je n‟oublierai jamais.
Je remercie aussi le Conseil de recherches en sciences naturelles et en génie du Canada
(CRSNG), pour son soutien financier essentiel.
 v

En terminant, merci à tous ceux qui me sont si chers, vous m‟avez donné l‟énergie nécessaire
aux moments opportuns.
Je dédie cette thèse à tous ceux qui m’ont soutenu
durant la réalisation de ce projet.
Résumé

Les plantes ont développé, au cours du temps, des mécanismes de protection leur permettant de
survivre et de se développer en dépit des nombreux stress biotiques auxquels elles sont soumises.
Cette thèse doctorale, en trois volets, visait à caractériser les réponses biochimiques et
physiologiques de la pomme de terre (Solanum tuberosum) attaquée par un insecte coléoptère, le
doryphore de la pomme de terre (Leptinotarsa decemlineata). Le premier volet du projet visait à
caractériser l'impact de l'insecte sur le protéome foliaire de la plante, en utilisant comme modèle
des plantes traitées avec des larves de doryphore, des plantes soumises à des blessures
mécaniques et des plantes infestées par un insecte suceur, le puceron de la pomme de terre
(Macrosiphum euphorbiae). Le second volet visait à caractériser le protéome des sécrétions
orales du doryphore, avec pour objectif de cerner l'incidence relative des protéines de l'insecte et
de la plante hôte aux sites de blessure générés par l'herbivore. Le troisième et dernier volet visait,
enfin, à déterminer l'impact des altérations du protéome foliaire de la plante sur ses capacités
photosynthétiques, et à mettre en évidence l'impact possible des composantes moléculaires de la
plante sur les réponses observées. En résumé, nos résultats ont démontré que plusieurs protéines
des métabolismes primaire et secondaire, incluant des protéines associées à la photosynthèse,
sont régulées dans les feuilles en réponse au doryphore de la pomme de terre. L'impact négatif de
l'herbivore sur plusieurs protéines photosynthétiques, notamment celles du photosystème I, a
toutefois des répercussions négligeables sur la capture de lumière par la plante. La seconde phase
du processus photosynthétique, en revanche, est affectée de manière notable par le doryphore,
vraisemblablement par l'action de molécules provenant aussi bien de l'insecte que de la plante
elle-même. Ces résultats suggèrent, dans l'ensemble, un impact spécifique, mais limité du
doryphore de la pomme de terre sur le protéome primaire et les fonctions photosynthétiques de
sa plante hôte. Ils suggèrent aussi la mise en place de mécanismes compensatoires in planta et la
grande plasticité du métabolisme primaire de la plante en réponse à l'herbivore.
Abstract

Higher plants have developed, over time, a variety of protection mechanisms allowing them to
survive and cope with a variety of biotic stress cues in their surrounding environment. The main
goal of this three-part doctoral thesis was to characterize the biochemical and the physiological
responses of potato (Solanum tuberosum) to defoliation by the coleopteran insect herbivore
Colorado potato beetle (Leptinotarsa decemlineata). The first objective of the project was to
characterize the impact of the insect on the host plant's leaf proteome, using as a model plants
treated with potato beetle larvae, mechanically wounded plants and plants infested with a
sucking/piercing insect, the potato aphid (Macrosiphum euphorbiae). The second objective was
to gain some insight about the proteome of potato beetle oral secretions, with the aim of
assessing the relative incidence of insect and host plant proteins at wound sites generated during
insect feeding. The third objective, finally, was to determine the impact of leaf proteome
alterations on photosynthetic capacities of the host plant, and to determine the possible impact of
the plant's own molecular constituents on the responses observed. In brief, our results showed
that several proteins involved in the primary and the secondary metabolisms, including
photosynthesis-related proteins, were regulated in leaves in response to potato beetle feeding.
However, the negative impact of the insect on several photosynthetic proteins, notably
photosystem I proteins, only had negligible effects on the light capture process by the plant. The
second phase of photosynthesis, on the other hand, was significantly affected by the insect,
presumably via molecular effectors from both the insect and the host plant itself. These findings
suggest, overall, a specific, but somewhat limited impact of Colorado potato beetle larvae on the
leaf proteome and photosynthetic capacities of the potato host. They also suggest the possible
induction of compensatory mechanisms in planta and the high plasticity of primary metabolism
functions in the plant upon herbivore feeding.
Table des matières

Avant-propos................................................................................................................................... ii
Remerciements ............................................................................................................................... iv
Résumé.......................................................................................................................................... vii
Abstract ........................................................................................................................................ viii
Table des matières.......................................................................................................................... ix
Liste des figures ........................................................................................................................... xiii
Liste des tableaux .......................................................................................................................... xv
Liste des abréviations .................................................................................................................. xvii
Préface............................................................................................................................................. 1
Chapitre 1 Revue de la littérature ................................................................................................... 3
1.1 La réponse biochimique des plantes aux insectes défoliateurs ............................................. 5
1.1.1 Une description du stress « insecte défoliateur » ........................................................... 5
1.1.1.1 La composante mécanique ...................................................................................... 7
1.1.1.2 La composante biochimique ................................................................................. 11
1.1.2 En résumé..................................................................................................................... 22
1.2 La réponse physiologique des plantes aux insectes défoliateurs ........................................ 23
1.2.1 Les effets indirects des insectes herbivores sur la photosynthèse................................ 23
1.2.1.1 L‟impact du mode d‟alimentation ......................................................................... 24
1.2.1.2 L‟impact de la réponse de la plante ...................................................................... 25
1.2.2 Les techniques d‟imagerie à haute résolution .............................................................. 28
1.2.3 En résumé..................................................................................................................... 30
1.3 Description du projet de recherche ..................................................................................... 31
Chapitre 2 Protéome foliaire de la pomme de terre en réponse au doryphore de la pomme de terre
....................................................................................................................................................... 34
2.1 Résumé................................................................................................................................ 35
Wounding, beetle leaf feeding and aphid phloem feeding differentially alter the potato leaf
proteome ................................................................................................................................... 37
2.2 Abstract ............................................................................................................................... 38
 x

2.3 Introduction ......................................................................................................................... 39

2.4 Results ................................................................................................................................. 42
2.4.1 Differential gene-inducing effects among treatments .................................................. 42
2.4.2 Control, wounded and insect-treated leaves exhibit distinct proteome patterns .......... 43
2.4.3 Potato beetles and aphids differentially impact photosynthesis-related proteins in
leaves..................................................................................................................................... 47
2.5 Discussion ........................................................................................................................... 53
2.6 Materials and methods ........................................................................................................ 57
2.6.1 Plants ............................................................................................................................ 57
2.6.2 Stress treatments .......................................................................................................... 58
2.6.3 Northern blotting .......................................................................................................... 58
2.6.4 Real-time RT-PCR ....................................................................................................... 59
2.6.5 Sample preparation for 2-DE ....................................................................................... 61
2.6.6 2-DE ............................................................................................................................. 61
2.6.7 Gel image analysis ....................................................................................................... 62
2.6.8 MS analyses ................................................................................................................. 62
2.6.9 Protein identification .................................................................................................... 63
2.7 Acknowledgments............................................................................................................... 64
Chapitre 3 Caractérisation protéomique des sécrétions orales du doryphore de la pomme de terre
....................................................................................................................................................... 67
3.1 Résumé................................................................................................................................ 68
Host plant proteins in the larval regurgitant of Colorado potato beetle, Leptinotarsa
decemlineata Say ...................................................................................................................... 71
3.2 Abstract ............................................................................................................................... 72
3.3 Introduction ......................................................................................................................... 73
3.4 Results and discussion ........................................................................................................ 75
3.4.1 Salivary glands of Colorado potato beetle larvae ........................................................ 75
3.4.2 Insect and plant proteins in the regurgitant of potato beetle larvae ............................. 76
3.4.3 Insect digestive proteases and plant defense proteins in the potato beetle regurgitant 80
3.5 Materials and methods ........................................................................................................ 82
3.5.1 Plants and insects ......................................................................................................... 82
 xi

3.5.2 Sample collection ......................................................................................................... 82

3.5.3 Sample preparation for 2-DE ....................................................................................... 83
3.5.4 2-DE ............................................................................................................................. 83
3.5.5 Gel image analysis ....................................................................................................... 84
3.5.6 MS analyses and protein identification ........................................................................ 84
3.6 Acknowledgments............................................................................................................... 85
Chapitre 4 Efficacité photosynthétique de la pomme de terre en réponse au doryphore de la
pomme de terre ............................................................................................................................. 89
4.1 Résumé................................................................................................................................ 90
Insect regurgitant- and plant leaf-derived factors impact photosynthesis in potato plants
interacting with the Colorado potato beetle .............................................................................. 95
4.2 Abstract ............................................................................................................................... 96
4.3 Introduction ......................................................................................................................... 97
4.4 Results ................................................................................................................................. 99
4.4.1 Photosynthesis-related proteins are differentially regulated in wounded and insect-
treated leaves ......................................................................................................................... 99
4.4.2 Wounding and potato beetle herbivory differentially impact photosynthesis in potato
leaves................................................................................................................................... 105
4.5 Discussion ......................................................................................................................... 108
4.6 Materials and methods ...................................................................................................... 112
4.6.1 Plants .......................................................................................................................... 112
4.6.2 Stress treatments ........................................................................................................ 112
4.6.3 Leaf total proteins ...................................................................................................... 113
4.6.4 Immunodetections ...................................................................................................... 113
4.6.5 Photosynthetic parameters ......................................................................................... 114
4.7 Acknowledgments............................................................................................................. 115
Discussion générale et conclusion .............................................................................................. 122
Références ................................................................................................................................... 130
Annexe I Notions de base sur les mesures de photosynthèse ..................................................... 142
La photosynthèse .................................................................................................................... 143
Les courbes de réponse lumineuse et la fluorescence ............................................................. 147
 xii

Les courbes de réponse au CO2 .............................................................................................. 151

En résumé................................................................................................................................ 155
Liste des figures

Figure 1.1 Modélisation schématique de l‟impact d‟un insecte phytophage de type défoliateur. . 6
Figure 1.2 Classes d‟éliciteurs identifiés dans les sécrétions orales des insectes herbivores. ..... 17
Figure 1.3 Effet spatial de la défoliation sur l‟efficacité photosynthétique. ................................ 30
Figure 2.1 Northern blot analysis for the induction of Pin-II and protein P4 mRNA transcripts by
wounding (W), potato aphid piercing-sucking (A) and Colorado potato beetle leaf chewing
(CPB) in potato leaves. ......................................................................................................... 43
Figure 2.2 Gel image for the proteome of potato leaves subjected to potato aphid feeding, as
visualized after Coomassie blue staining following 2-DE. ................................................... 44
Figure 2.3 Venn diagram illustrating the relative number of proteins specifically or co-regulated
in potato leaves following mechanical wounding, Colorado potato beetle leaf chewing or
potato aphid feeding. ............................................................................................................. 46
Figure 2.4 Selected defense- (A) and photosynthesis- (B, C) related proteins identified as
modulated in potato leaves subjected to wounding (W) or Colorado potato beetle (CPB)
feeding................................................................................................................................... 49
Figure 2.5 Abundance of mRNA transcripts for photosynthesis-related proteins in potato leaves
subjected to wounding (W) or Colorado potato beetle (CPB) feeding. ................................ 52
Figure 3.1 Optical microscope images for the maxillary glands of Colorado potato beetle 4th-
instar larvae. .......................................................................................................................... 76
Figure 3.2 Representative 2-D gels for potato leaf proteome and the proteome of larval Colorado
potato beetle regurgitant and maxillary glands. .................................................................... 78
Figure 4.1 Immunodetection patterns of photosynthesis-related proteins in control, healthy
potato plants. ....................................................................................................................... 101
Figure 4.2 Effects of stress treatment and leaf age on steady-state levels of AtpB and PsbA in
potato leaves........................................................................................................................ 104
Figure 4.3 Effects of stress treatment on Vcmax and TPU photosynthetic parameters in potato
leaves, 3 and 24 h after initiating the treatments. ............................................................... 108
 xiv

Figure A.1 Niveaux d‟excitation de la chlorophylle en fonction de la longueur d‟onde des

photons incidents et voies de dissipation de l‟énergie. ....................................................... 143
Figure A.2 Paramètres de fluorescence, tels que mesurés par le LI-6400. ................................ 146
Figure A.3 Paramètres dérivés d‟une courbe de réponse lumineuse. ........................................ 147
Figure A.4 Comportement de la courbe de réponse lumineuse en fonction de l‟état
physiologique de la plante. ................................................................................................. 149
Figure A.5 Vue schématique du cycle de Calvin. ...................................................................... 153
Figure A.6 Paramètres dérivés des courbes ACi. ....................................................................... 154
Liste des tableaux

Table 2.1 Relative levels of potato leaf protein spots exhibiting a more than two-fold decrease or
increase for at least one treatment, compared to healthy control leaves (see Figure 2.2 for
protein numbering)................................................................................................................ 45
Table 2.2 Possible expression scenarios (excluding no response to either treatment) for stress-
regulated proteins in potato leaves subjected to mechanical wounding or potato beetle
chewing. ................................................................................................................................ 47
Table 2.3 Identity of stress-regulated proteins in potato leaves and their expression trend for
three different stress treatments1. .......................................................................................... 50
Table 2.4 Oligonucleotide primer sequences for real-time RT-PCR. .......................................... 60
Table 3.1 Insect and plant protein spots identified by MS (see Figure 3.2 for spot naming). ..... 79
Table 4.1 Photosynthesis-related proteins monitored by quantitative immunodetection1. ........ 100
Table 4.2 Effects of leaf age/position and treatment on photosynthesis-related proteins in potato
leaves................................................................................................................................... 103
Table 4.3 Variation in the number of AtpB and PsbO bands detected on immunoblots. .......... 104
Table 4.4 Effects of time and treatment on photosynthetic parameters derived from light
response curves. .................................................................................................................. 106
Table 4.5 Effects of time and treatment on fluorescence parameters inferred from data collected
with a LI-6400 system equipped with a fluorescence chamber. ......................................... 106
Table 4.6 Effects of time and treatment on photosynthetic parameters derived from ACi curves.
............................................................................................................................................. 107

Supplementary Table 2.1 MALDI-TOF MS identification of potato leaf proteins regulated by

wounding, potato beetle feeding or aphid phloem feeding. .................................................. 65
Supplementary Table 2.2 LC-MS/MS identification of potato leaf proteins regulated by
wounding, potato beetle feeding or aphid phloem feeding. .................................................. 66
Supplementary Table 3.1 SELDI-TOF MS identification of selected proteins from potato
leaves, and from larval Colorado beetle salivary glands and regurgitant. ............................ 86
 xvi

Supplementary Table 3.2 LC-MS/MS identification of selected proteins from potato beetle
salivary glands, potato beetle regurgitant and potato leaves. ................................................ 88
Supplementary Table 4.1 “Treatment x time interaction” mean values (±SD) of potato
photosynthetic parameters derived from light response curves (n=3). ............................... 116
Supplementary Table 4.2 “Treatment effect” mean values (±SD) of potato photosynthetic
parameters derived from light response curves (n=9)......................................................... 117
Supplementary Table 4.3 “Time effect” mean values (±SD) of potato photosynthetic parameters
derived from light response curves (n=15). ........................................................................ 117
Supplementary Table 4.4 “Treatment x time interaction” mean values (±SD) of potato
photosynthetic parameters derived from fluorescence measurements (n=3). ..................... 118
Supplementary Table 4.5 “Treatment effect” mean values (±SD) of photosynthetic parameters
derived from fluorescence measurements (n=9). ................................................................ 119
Supplementary Table 4.6 “Time effect” mean values (±SD) of photosynthetic parameters
derived from fluorescence measurements (n=15). .............................................................. 119
Supplementary Table 4.7 “Treatment x time interaction” mean values (±SD) of potato
photosynthetic parameters derived from CO2 response curves (n=3). ............................... 120
Supplementary Table 4.8 “Treatment effect” mean values (±SD) of potato photosynthetic
parameters derived from the CO2 response curves (n=9). .................................................. 121
Supplementary Table 4.9 “Time effect” mean values (±SD) of potato photosynthetic parameters
derived from CO2 response curves (n=15).......................................................................... 121

Tableau A.1 Paramètres photosynthétiques mesurés pour déterminer l‟état physiologique d‟une
plante soumise à différents traitements. .............................................................................. 145
Tableau A.2 Impact de la variation de la pente et du taux d‟assimilation maximal (Amax) de la
courbe de réponse lumineuse sur les différents paramètres de fluorescence mesurés et
dérivés. ................................................................................................................................ 151
Liste des abréviations

°C degré Celsius
1,3-PG 1,3-biphosphoglycérate
1-D unidimensionnel
2-D bidimensionnel
2-DE électrophorèse bidimensionnelle sur gel (two-dimensional gel electrophoresis)
2-HOT acide 2-hydroxyoctadécatriénoïque
3-PG 3-phosphoglycérate
32
P phosphore 32 (radio-isotope)
A taux d‟assimilation du CO2 (µmol CO2 m-2 s-1)
ADN acide désoxyribonucléique
ADP adénosine diphosphate
AJ acide jasmonique
Amax taux maximal de photosynthèse (µmol CO2 m-2 s-1)
Aobs taux de photosynthèse mesuré (µmol CO2 m-2 s-1)
ARN acide ribonucléique
AS acide salicylique
ATP adénosine triphosphate
ATPase adénosine triphosphate synthétase (ou ATP synthase)
AtpB sous-unité β du complexe ATPase
BM blessure mécanique
bp paire de bases (base pair)
Calc. calculé
Cc pression partielle de CO2 à l‟intérieur des chloroplastes (Pa)
cDNA ADN complémentaire
CHAPS 3-[(3-Cholamidopropyl)dimethylammonio]-1-propanesulfonate
Ci concentration intercellulaire de CO2 (µmol CO2 mol air-1)
CO2 dioxyde de carbone
CPB doryphore de la pomme de terre (Colorado potato beetle)
 xviii

cv. cultivar
Cys cystéine
Da Dalton
DNase désoxyribonucléase
EDTA acide éthylènediaminetétracétique (ethylenediaminetetraacetic acid)
EST étiquette de séquence transcrite (expressed sequence tag)
ETR taux de transport des électrons du PSII (Electron transport rate)
Exp. valeur expérimentale
FAC conjugué d‟acide gras (fatty acid – amino acid conjugate)
FAO Organisation des Nations Unies pour l‟Agriculture et l‟Alimentation (Food and
Agriculture Organization of the United Nations)
Fo fluorescence minimale
Fv/Fm efficacité photochimique maximale
Fv‟/Fm‟ efficacité photochimique du centre réactionnel oxydé du PSII, pour une feuille adaptée à la
lumière
g force gravitationnelle
G3P 3-phosphoglycéraldéhyde (glyceraldehyde 3-phosphate)
gm conductance du mésophylle (µmol m-2 s-1 Pa-1)
GOX glucose oxydase
H2O2 peroxyde d‟hydrogène
H3PO4 acide phosphorique
HCl chlorure d‟hydrogène
IEF focalisation isoélectrique (isoelectric focusing)
IPG gradient de pH stable (immobilized pH gradient)
J taux de transport d‟électrons du PSII servant à la réduction du NADP+ (µmol e- m-2 s-1)
L. Linné, Carl von
L:D ratio diurne : nocturne de la photopériode (light:dark)
LC chromatographie en phase liquide (liquid chromatography)
m/z rapport masse / charge
MALDI matrix-assisted laser desorption/ionisation
Met méthionine
 xix

MM masse moléculaire
MOWSE MOlecular Weight SEarch
MS spectrométrie de masse (mass spectrometry)
MS/MS spectrométrie de masse en tandem
mRNA acide ribonucléique messager
NADPH forme réduite du nicotinamide adénine dinucléotide phosphate
NADP+ forme oxydée du nicotinamide adénine dinucléotide phosphate
NCBI National Center for Biotechnology Information
NH4HCO3 bicarbonate d‟ammonium
NPQ dissipation non photochimique de la fluorescence (non photochemical quenching)
P Probabilité (P value)
P-R relié à la pathogenèse (Pathogenesis-related)
PAGE électrophorèse sur gel de polyacrylamide (polyacrylamide gel electrophoresis)
PCR réaction en chaîne par polymérase (polymerase chain reaction)
pH potentiel hydrogène
Pi phosphore inorganique
pI point isoélectrique
PsaC sous-unité VII du photosystème I
PsaD sous-unité II du photosystème I
PsaE sous-unité IV du photosystème I
PsbA sous-unité D1 du photosystème II
PsbO sous-unité de 33 kDa du « complexe de scission de l‟eau » du photosystème II
PSI photosystème I
PSII photosystème II
pv. pathovar
qN dissipation non photochimique de la fluorescence
qP dissipation photochimique de la fluorescence
RbcL grande sous-unité de la rubisco
RbcS petite sous-unité de la rubisco
Rd taux de respiration diurne (µmol CO2 m-2 s-1)
ROS formes réactives de l‟oxygène (reactive oxygen species)
 xx

RT transcriptase inverse (reverse transcriptase)

rubisco ribulose-1,5-bisphosphate carboxylase/oxygénase
RuBP ribulose-1,5-bisphosphate
RuBP_regen phase de la photosynthèse où du RuBP est régénéré
SD écart-type (standard deviation)
SDS dodécylsulfate de sodium (sodium dodecyl sulfate)
SE erreur-type (standard error)
SELDI surface-enhanced laser desorption/ionisation
SGN Solanaceae Genomic Network
TFA acide trifluoroacétique (trifuoroacetic acid)
TOF temps de vol (time-of-flight)
TPU utilisation des trioses phosphates (triphosphate use) (µmol m-2 s-1)
V volt
v/v volume / volume
Vcmax vélocité maximale de la carboxylation permise par la rubisco (µmol CO2 m-2 s-1)
Vh volt heure
W blessures mécaniques (wounding)
W+P blessures mécaniques additionnées d‟extrait végétal (wounding+plant extract)
W+R blessures mécaniques additionnées de régurgitant (wounding+regurgitant)
w/v poids/volume (weight/volume)
φPSII efficacité photochimique du PSII
↓ diminution
↑ augmentation
↔ aucune variation
Préface

La pomme de terre, Solanum tuberosum L., fait partie de la famille des Solanacées, qui inclut
aussi le tabac, la tomate et l‟aubergine. Elle est cultivée à travers le monde pour la valeur
nutritive de son tubercule, qui est riche en amidon, en vitamine C et en potassium (Gagnon et al.
2007).

En 2006, au Québec, la production de la pomme de terre s‟étendait sur plus de 19 000 hectares
(ha). Sa culture a engendré des revenus de 122 M$, ce qui en faisait la première culture
maraîchère d‟importance dans la province. À l‟échelle canadienne, c‟est plus de 160 000 ha de
pomme de terre qui ont été cultivés (Gagnon et al. 2007), pour une production de près de 5 M de
tonnes métriques (tm) et un revenu total de 900 M$.

La culture de la pomme de terre est aussi très importante mondialement. En 2006, l‟Organisation
des Nations Unies pour l‟Agriculture et l‟Alimentation (FAO) rapportait une production
mondiale de près de 314 M tm (Gagnon et al. 2007). Les principaux pays producteurs de cette
culture étaient, en ordre décroissant, la Chine (73,5 M tm, pour 23% de la production mondiale),
la Fédération de Russie (38,6 M tm), l‟Inde (23,9 M tm), les États-Unis (19,7 M tm), l‟Ukraine
(19,5 M tm) et l‟Allemagne (10 M tm). La pomme de terre est si importante mondialement que
l‟année 2008 fut proclamée Année internationale de la pomme de terre par les Nations Unies.

Comme toute plante agricole, les rendements en pommes de terre sont affectés par plusieurs
insectes et maladies. Le doryphore de la pomme de terre, Leptinotarsa decemlineata Say, est de
loin l‟insecte qui cause le plus de pertes économiques pour cette culture. Il est présent partout où
on la cultive en Amérique du Nord et en Europe de l‟Est. Sans contrôle phytosanitaire, le
doryphore peut consommer la totalité des surfaces photosynthétiques des plantes, avec des
conséquences majeures sur les rendements en tubercules (Noronha et al. 2008).
 2

L‟application de pesticides de synthèse représente le principal moyen de lutte contre le

doryphore en Amérique du Nord. Avec le temps, les populations visées ont développé une
résistance à la plupart des pesticides homologués. Plusieurs recherches impliquant des instances
gouvernementales, publiques et privées sont en cours dans le but de développer de nouvelles
stratégies de lutte contre cet insecte. La recherche fondamentale et la recherche appliquée sont
essentielles dans le développement de moyens de lutte intégrée efficaces. La recherche
fondamentale, en particulier, permet d‟identifier, à plus ou moins long terme, des éléments clés
pouvant mener à de nouvelles stratégies de lutte efficaces contre les ravageurs des cultures.

Au cours de ce projet de recherche, nous avons étudié certains aspects moléculaires,

biochimiques et physiologiques de l‟interaction « pomme de terre-doryphore », en nous attardant
principalement au côté « végétal » de l‟interaction. Notre décision de travailler avec la pomme de
terre comme modèle d‟étude, outre son importance économique, repose sur le fait qu‟elle fait
partie des Solanacées, une des familles taxonomiques les plus étudiées dans le domaine des
stress biotiques et abiotiques chez les plantes. Les récents travaux réalisés par le Dr Ian Baldwin
et ses collaborateurs, au Max Planck Institute for Chemical Ecology en Allemagne, représentent
un exemple éloquent de l‟importance des Solanacées dans l‟avancement des nos connaissances
sur les interactions plantes-insectes. Ce groupe de recherche a notamment publié une série
d‟articles scientifiques sur la réponse du tabac sauvage (Nicotiania attenuata) à son herbivore
spécialiste, le lépidoptère Manduca sexta (Halitschke et al. 2001; Hermsmeier et al. 2001;
Schittko et al. 2001; Winz and Baldwin 2001; Halitschke et al. 2003; Hui et al. 2003; Giri et al.
2006; Gaquerel et al. 2009), qui a changé notre vision de la réponse des plantes aux stress
biotiques. Les recherches de ce groupe innovaient du fait qu‟elles étudiaient les réponses de la
plante hôte à l‟aide d‟une approche globale basée sur l‟utilisation de plusieurs méthodes
d‟analyses complémentaires, une approche que nous avons préconisée durant le présent projet de
recherche. Les travaux du Dr Baldwin ont entre autres montré que les deux partis impliqués dans
l‟interaction, la plante et l‟insecte, avaient, au cours d‟une longue période de coévolution, acquis
de nombreuses armes défensives et offensives afin d‟augmenter leur valeur adaptative (fitness)
par une gamme de mécanismes de tolérance, de résistance, de compensation et d‟évasion.
Chapitre 1 Revue de la littérature
 4

Les plantes vasculaires, qui sont sessiles, possèdent un système de défense sophistiqué pour
contrer l‟effet néfaste des différents stress auxquels elles sont soumises. Leur arsenal comprend,
en bref, des moyens de lutte physiques et biochimiques qui peuvent être constitutifs ou induits
(Kessler and Baldwin 2002).

Les défenses induites impliquent une importante dépense énergétique qui n‟est pas sans
répercussions sur le métabolisme primaire de la plante stressée (Schwachtje and Baldwin 2008).
Celle-ci doit les déployer judicieusement, de manière à maximiser ses chances de survie sans
trop compromettre sa croissance, sa reproduction et ses réserves énergétiques. Dans le but de
maximiser leur valeur adaptative, les végétaux ont développé avec le temps des mécanismes de
reconnaissance des stress, qui permettent d‟exprimer les moyens de défense nécessaires aux
moments opportuns.

Ces mécanismes d‟induction sont de complexité variable. Parfois, la reconnaissance n‟implique

qu‟un seul gène, comme dans le cas des réactions d‟incompatibilité avec certaines bactéries ou
certains champignons phytopathogènes (Cui et al. 2005). Dans d‟autres cas, comme pour les
insectes herbivores défoliateurs, la reconnaissance résulte de « l‟interprétation » d‟un grand
nombre de stimuli. Une compréhension approfondie de ces mécanismes de reconnaissance
facilitera certainement, avec le temps, le développement de moyens de lutte efficaces contre les
ravageurs des cultures, basés sur une « optimisation raisonnée » des défenses intrinsèques de la
plante.

Les paragraphes qui suivent décrivent plus en détail les interactions plantes-insectes à l‟échelle
biochimique, en portant une attention particulière sur la réponse de la plante aux insectes
défoliateurs comme le doryphore de la pomme de terre, un insecte d‟importance agronomique
majeure. Le portrait type d‟un insecte défoliateur sera aussi tracé, en décrivant de quelle manière
il est perçu comme un stress par sa plante hôte.
 5

1.1 La réponse biochimique des plantes aux insectes défoliateurs

L‟interaction entre un insecte phytophage et sa plante hôte est un processus très complexe. En
présence d‟un insecte spécialiste, l‟interaction est d‟autant plus complexe qu‟elle résulte de
milliers, voire de millions d‟années de coévolution. Cette grande complexité rend évidemment
impossible la prise en compte de tous les éléments impliqués dans l‟interaction et il devient alors
important de développer des modèles d‟étude. Parfois très simples, parfois plus étoffés, ces
modèles permettent de décomposer un système complexe en sous-systèmes de complexité
moindre. Tout compte fait, l‟élucidation des sous-systèmes nous aide à mieux comprendre le
processus global, un peu comme le fait de placer les morceaux d‟un casse-tête nous permet de
visualiser l‟image finale.

1.1.1 Une description du stress « insecte défoliateur »

Lorsqu‟un insecte herbivore comme le doryphore de la pomme de terre s‟alimente, d‟importantes

blessures sont infligées à sa plante hôte. Durant la prise alimentaire, de petits morceaux de tissus
végétaux sont prélevés à répétition par les mandibules de l‟insecte, qui agissent ni plus ni moins
comme des couteaux. La chair de la plante est alors déchirée et broyée pour être ensuite
ingurgitée par l‟insecte, causant ainsi une réduction des surfaces photosynthétiques. Les tissus à
proximité du site d‟alimentation sont également recouverts de régurgitant, un mélange de salive
et de reflux intestinaux de l‟insecte, qui contient du matériel végétal partiellement digéré et des
microorganismes. Les fèces de l‟insecte peuvent aussi entrer en contact avec les cellules
végétales fraîchement endommagées. Enfin, certains insectes de plus grande taille peuvent
endommager l‟épiderme des feuilles durant leur déplacement, dû à leur poids parfois important
qui doit être supporté par des pattes menues, créant ainsi de multiples perforations (Hall et al.
2004).
 6

Ces éléments qui caractérisent le stress « insecte défoliateur » peuvent être regroupés en deux
catégories principales : 1- les éléments de nature mécanique et 2- les éléments de nature
biochimique. Ils représentent les diverses composantes de l‟interaction qui permettront à la
plante de décoder le stress « insecte défoliateur » et d‟ajuster le déploiement de ses défenses en
fonction de son agresseur. Théoriquement, plus la reconnaissance sera efficace et rapide, plus la
plante augmentera son aptitude à survivre et à se reproduire.

La Figure 1.1 décortique en sous-systèmes l‟impact d‟un stress causé par un insecte phytophage
défoliateur « modèle ». Les composantes principales, mécanique et biochimique, intègrent
plusieurs sous-composantes qui jouent un rôle potentiellement important dans l‟activation des
mécanismes de défense de la plante hôte.

Figure 1.1 Modélisation schématique de l‟impact d‟un insecte phytophage de type défoliateur.
 7

1.1.1.1 La composante mécanique

Des insectes phytophages défoliateurs comme le doryphore de la pomme de terre causent des
bris mécaniques majeurs aux tissus végétaux lorsqu‟ils s‟alimentent. La plante hôte, de son côté,
est capable de « reconnaître » ce type de stress.

Les insectes herbivores représentent un stress pour les plantes parce qu‟ils perturbent le
fonctionnement normal de leur métabolisme. Les insectes défoliateurs, en particulier, affectent
directement leur plante hôte par le retrait de surfaces photosynthétiques. En tant qu‟organismes
phototautotrophes, les plantes sont entièrement dépendantes de l‟énergie lumineuse pour
compléter leur cycle vital. Conséquemment, le retrait, le bris ou l‟isolation de tout tissu impliqué
dans la production, le transport ou l‟entreposage des réserves énergétiques se traduit par une
baisse de la valeur adaptative de la plante attaquée. L‟introduction de composés phytotoxiques à
l‟intérieur des cellules lors de l‟alimentation de l‟insecte, comme des oxydases durant
l‟alimentation des pucerons (Madhusudhan and Miles 1998), constitue une autre forme d‟effet
direct des insectes herbivores sur la plante hôte.

De surcroît, les cellules endommagées des tissus touchés représentent une porte d‟entrée pour les
bactéries et les champignons phytopathogènes. Elles constituent aussi une porte de sortie pour
l‟eau. Par exemple, lorsque les tissus intervasculaires des feuilles de soya (Glycine max L.) sont
blessés mécaniquement, leur taux de transpiration augmente jusqu‟à 150 % pendant six jours
suivant la blessure (Aldea et al. 2005).

La plante blessée, dans ces conditions, a tout avantage à corriger la situation le plus rapidement
possible. Pour y parvenir, elle doit détourner une partie plus ou moins importante de son
métabolisme primaire (croissance, reproduction et mises en réserve) vers son métabolisme de
défense, dit secondaire. Les blessures mécaniques occasionnées par les insectes herbivores ont
 8

donc aussi un effet indirect sur la plante hôte, en provoquant un déséquilibre métabolique dans
les cellules non blessées.

1.1.1.1.1 Les signaux chimiques

Les nombreux travaux de recherche effectués sur le sujet au cours des deux dernières décennies
ont permis d‟identifier plusieurs signaux impliqués dans la réponse des plantes aux blessures et
aux insectes herbivores. Bien que le « signal primaire » à la base de l‟ensemble des réponses
n‟ait pas encore été identifié, des hypothèses ont été avancées suggérant que la propagation du
signal de stress après blessure puisse être de nature hydraulique (Stratmann and Ryan 1997),
électrique (Rhoades et al. 1996) ou chimique (Ryan 2000).

Plusieurs molécules bioactives (ou signaux chimiques) ont été identifiées dans les tissus
avoisinant les sites de blessures (réponse locale) et dans les tissus distaux (réponse systémique).
Par exemple, des blessures mécaniques induisent une accumulation transitoire locale et
systémique d‟espèces réactives d‟oxygène (ROS, reactive oxygen species) dans les feuilles (van
Breusegem et al. 2001), de même que la production d‟oligogalacturonides (Bergey et al. 1999) et
d‟acide jasmonique (Farmer and Ryan 1990).

La systémine, première hormone peptidique identifiée chez les plantes (Pearce et al. 1991), est
également retrouvée dans tous les tissus des Solanacées en réponse à des blessures et aux
insectes herbivores (Ryan 2000). Ce polypeptide de 18 acides aminés possèderait les
caractéristiques nécessaires pour agir comme médiateur du signal de stress des régions atteintes
aux régions distales, et serait impliqué dans la réponse systémique. D‟autres phytohormones
agissant à titre de médiateur chimique, comme l‟éthylène (O'Donnell et al. 1996) et l‟acide
abscissique (Pena-Cortes et al. 1989), seraient aussi impliquées dans l‟induction de la réponse
aux blessures mécaniques.
 9

La majorité des réponses induites par les blessures surviennent rapidement. À l‟intérieur de
quelques minutes ou quelques heures après le stress, il y a génération/relâchement, perception,
translocation et « interprétation » de signaux spécifiques qui activeront les gènes de défense
reliés aux blessures mécaniques (Leon et al. 2001). Par exemple, chez Arabidopsis, certains
gènes de la famille TOUCH voient leur expression centupler en moins de dix minutes en réponse
au toucher (Braam and Davis 1990). Les gènes TOUCH, ainsi que certains gènes encodant des
protéines reliées à la pathogenèse (protéines P-R) et des kinases, sont aussi surexprimés dans les
feuilles d‟Arabidopsis 15 minutes après une blessure physique (Reymond et al. 2000). Les voies
de signalisation cellulaire impliquant la phosphorylation des protéines et le complexe calcium-
calmoduline sont également sollicitées en réponse aux blessures mécaniques.

1.1.1.1.2 L’effet spatio-temporel

L‟effet spatio-temporel (ou effet espace x temps) détermine par ailleurs l‟intensité (ou la
sévérité) des blessures mécaniques. Cette composante est importante dans la reconnaissance et
l‟induction des mécanismes de défense chez les plantes. Il a été démontré à maintes reprises que
la réponse des plantes aux blessures et aux insectes herbivores diffère tant sur le plan qualitatif
que sur le plan quantitatif. L‟intensité des blessures serait d‟ailleurs un élément important dans la
reconnaissance de l‟agresseur.

Les plantes attaquées par des insectes herbivores produisent des composés volatils qui attirent
leurs ennemis naturels, une relation tritrophique qui témoigne de la coévolution des espèces dans
l‟environnement (Turlings et al. 1990). Or, lorsque des plantes sont sujettes à des blessures
simples, elles produisent une gamme de composés volatils qui diffèrent sur le plan qualitatif ou
quantitatif, en comparaison à des plantes attaquées par des insectes herbivores. En revanche, des
travaux réalisés par Mithofer et collaborateurs (2005) ont montré qu‟un robot permettant
d‟infliger des blessures mécaniques complexes reproduisant le motif alimentaire des herbivores
 10

(dans l‟espace et dans le temps) induisait une signature qualitative de composés volatils similaire
à celle induite par les herbivores.

Pour des raisons pratiques, l‟effet spatio-temporel n‟est souvent pas complètement pris en
compte dans les dispositifs expérimentaux où l‟on utilise un traitement « blessures » à titre de
référence pour « mimer » l‟impact d‟un insecte défoliateur. Il est d‟ailleurs en général impossible
de recréer un traitement de référence parfait. Afin d‟illustrer ces propos, prenons comme
exemple une expérience où nous voudrions vérifier l‟effet des sécrétions orales d‟un insecte
phytophage sur les réponses de sa plante hôte. Pour réaliser cette expérience, nous aurions besoin
d‟un minimum de trois traitements : un traitement témoin sans stress, un traitement avec l‟insecte
phytophage étudié et, finalement, un traitement « stress » de référence. Ce dernier traitement
devrait idéalement engendrer le même type de blessures dans le temps et dans l‟espace que
l‟insecte phytophage, mais sans qu‟il y ait déposition de sécrétions orales. La meilleure façon de
réaliser ce traitement serait d‟utiliser des insectes dont on aurait éliminé l‟aptitude à excréter des
fluides. Dans les faits, cette procédure est très difficile à réaliser et est aussi tributaire de
l‟anatomie et de la morphologie de l‟insecte à l‟étude.

Un groupe de recherche de l‟Université de la Pennsylvanie a toutefois réalisé cette tâche avec

succès. Musser et collaborateurs (2002) ont réussi à bloquer, par cautérisation, la sécrétion de
salive labiale chez la larve du lépidoptère Manduca sexta. Les glandes labiales, qui sont les
principales glandes salivaires chez M. sexta (Peiffer and Felton 2005), contiennent une grande
quantité de glucose oxydase (GOX), une enzyme qui joue un rôle majeur dans la modulation de
la réponse de défense du tabac (Nicotiana tabacum). Lorsque des plants de tabac sont blessés
mécaniquement, leur taux de nicotine augmente en réponse au stress, par rapport à des plants non
blessés (témoin). À l‟inverse, lorsque des plants de tabac sont attaqués par des larves de M. sexta,
le taux de nicotine reste similaire à celui des plantes témoins. Ces résultats à eux seuls indiquent
que les sécrétions orales de l‟insecte sont probablement impliquées dans la réponse différentielle
observée entre les deux traitements de stress. Par contre, nous ne pouvons conclure sur
l‟influence de l‟effet spatio-temporel dans une telle expérience. Rien n‟indique qu‟à lui seul, le
 11

motif d‟application différentiel des blessures mécaniques occasionnées par les deux traitements
n‟ait pu expliquer la différence d‟accumulation de nicotine observée.

En complément à ces observations, les auteurs ont montré que des plants de tabac attaqués par
des larves incapables de sécréter de la salive labiale (conséquence de la cautérisation), mais dont
le comportement alimentaire est inchangé, accumulent des taux de nicotine similaires aux plants
blessés mécaniquement. En ajoutant ce dernier traitement à leur expérience, Musser et son
équipe ont montré formellement que la salive labiale de l‟insecte prévenait l‟augmentation du
taux de nicotine dans la plante, favorisant ainsi les taux de croissance et de survie de l‟insecte. Le
tabac répondait de manière similaire à l‟attaque par d‟autres larves de lépidoptères, comme
Heliothis virescens (Delphia et al. 2006). Sur le plan biologique, il apparaissait clair, par ces
travaux, que la composante mécanique ne pouvait à elle seule expliquer la totalité des réponses
observées chez une plante soumise à la défoliation par un insecte herbivore.

1.1.1.2 La composante biochimique

Au cours d‟une interaction plante-insecte, une multitude de signaux moléculaires sont échangés
entre les deux partis. Ces molécules servent à communiquer des informations essentielles sur le
partenaire d‟interaction. Par exemple, pour l‟insecte, ces signaux lui permettent de juger si les
tissus de la plante représentent une source alimentaire adéquate ou non. Pour la plante, ils lui
permettent d‟identifier son agresseur et de déployer des défenses adaptées afin d‟augmenter ses
chances de survie sans trop affecter sa croissance et son développement (Kessler and Baldwin
2002).

Les molécules qui induisent l‟activation des mécanismes de défense chez les plantes sont
appelées éliciteurs. Dans certains cas, les éliciteurs produits lors de l‟interaction induisent des
mécanismes de défense chez la plante qui favorisent plutôt la survie de l‟insecte que celle de la
 12

plante – on parle alors d‟effecteurs (Felton and Tumlinson 2008). Ces médiateurs chimiques
sont transmis à la plante par la salive, le régurgitant ou les fèces de l‟insecte. À titre de référence,
la salive est produite par les glandes salivaires alors que le régurgitant provient du tube digestif et
est libéré par la cavité buccale. Le terme « sécrétions orales » est souvent utilisé, aussi, pour
décrire le régurgitant. D‟autres glandes pourraient aussi être à l‟origine de signaux biochimiques
reconnus par la plante hôte (Felton 2008).

Les éliciteurs « transmis » à la plante durant l‟alimentation de l‟insecte herbivore peuvent être de
nature animale; c‟est le cas notamment de la β-glucosidase, retrouvée dans les sécrétions orales
des larves du lépidoptère Pieris brassicae (Mattiacci et al. 1995). D‟autres éliciteurs sont
d‟origine végétale, comme l‟inceptine (Schmelz et al. 2006), un peptide qui provient de la
dégradation de l‟ATPase chloroplastique de la plante hôte. Cette protéine est partiellement
hydrolysée dans le tube digestif de l‟insecte et un fragment stable, l‟inceptine, est reconnu par la
plante pendant la régurgitation. Le mécanisme d‟action de l‟inceptine serait basé sur la
reconnaissance d‟un fragment peptidique qui n‟est normalement pas produit dans les cellules
végétales. Il est probable aussi que des molécules, qui sont normalement séquestrées à l'intérieur
d'un compartiment cellulaire, soient libérées lorsque les feuilles sont broyées. Maintenant libres
dans le régurgitant, elles pourraient être reconnues par la plante comme un indice d'herbivorie
(Heil 2009). Il existe aussi des éliciteurs hybrides, qui résultent de la fusion de molécules en
provenance de la plante et de l‟insecte. La volicitine fut le premier éliciteur hybride identifié,
chez les larves de Spodoptera exigua (Alborn et al. 1997). Cette molécule est produite dans le
régurgitant de l‟insecte, où un groupement hydroxyle et une glutamine sont ajoutés à l‟acide
linolénique dérivé des tissus de la plante hôte (Paré and Tumlinson 1998).

Sur le plan expérimental, le rôle « éliciteur » des sécrétions orales est démontré lorsque
l‟application du régurgitant d‟un insecte sur des blessures mécaniques artificielles restitue, en
totalité ou en partie, la réponse de la plante hôte répondant à l‟herbivore. De façon similaire, un
éliciteur spécifique est identifié lorsqu‟un composé du régurgitant reproduit, en totalité ou en
partie, la réponse observée suite à l‟application de régurgitant. La réponse de la plante est
 13

caractérisée en mesurant, par exemple, la production de composés volatils (quantité et qualité).

L‟activation des sentiers métaboliques de défense comme ceux de l‟acide jasmonique, de l‟acide
salicylique et de l‟éthylène; la production et l‟accumulation de molécules associées aux stress
comme le peroxyde d‟hydrogène et les inhibiteurs de protéases; ou l‟activité d‟enzymes comme
les peroxydases, sont souvent utilisées, aussi, comme indicateurs pour évaluer l‟effet inducteur
des éliciteurs.

1.1.1.2.1 La salive

La salive des insectes herbivores est habituellement difficile à isoler et à récolter en quantité
suffisante pour être étudiée avec les techniques analytiques conventionnelles. Pour cette raison,
très peu d‟informations sont disponibles sur la composition chimique de la salive des insectes
herbivores et sur son rôle dans l‟activation des réponses défensives des plantes.

Les lépidoptères possèdent deux paires de glandes salivaires : les glandes labiales (ou glandes à
soie) et les glandes mandibulaires (Felton 2008). Les glandes labiales, généralement longues et
tubulaires, convergent pour former un canal commun. Le contenu de ces glandes est sécrété par
un organe spécialisé qui forme une petite protubérance, la filière (Felton and Eichenseer 1999).
Les glandes labiales représentent les principales glandes salivaires de l‟insecte durant les stades
larvaires. En stimulant la salivation à l‟aide d‟une solution de saccharose, on peut récolter la
salive en quantité suffisante pour en déterminer la composition (Peiffer and Felton 2005).
Jusqu‟à présent, seules des protéines ont été identifiées dans la salive labiale (Liu et al. 2004).
Par contre, tout porte à croire que plusieurs autres groupes de composés soient aussi présents.

Par ailleurs, les glandes mandibulaires des lépidoptères sont généralement plus discrètes que les
glandes labiales (Felton and Eichenseer 1999), quoique leur taille demeure variable entre les
espèces (Parthasarathy and Gopinathan 2005). Ces glandes sont reconnues pour être riches en
 14

lipides (Wroniszewska 1966; Eichenseer et al. 2002; Howard and Baker 2004) et leur contenu est
déchargé par l‟entremise de pores situés sur les mandibules (Felton and Eichenseer 1999). Les
coléoptères de la famille des Chrysomelidae, contrairement aux lépidoptères, ne possèdent pas de
glandes labiales, mais plutôt une paire de glandes maxillaires (Nault 1997). Ces glandes,
généralement longues et tubulaires, seraient déchargées à l‟extérieur par une ouverture dans
l‟épiderme de la région cardo-stripitale des maxilla (Srivastava 1959). À notre connaissance,
aucune étude n‟a été menée pour déterminer la composition spécifique du contenu des glandes
maxillaires chez les Chrysomelidae.

La seule molécule clairement identifiée dans la salive des insectes herbivores comme ayant la
capacité d‟induire une réponse défensive chez la plante hôte est la GOX. Cette enzyme fut
d‟abord isolée dans les glandes labiales de larves d‟Helicoverpa zea (Eichenseer et al. 1999) et,
par la suite, chez plusieurs autres lépidoptères (Merkx-Jacques and Bede 2004). Comme discuté
précédemment, la GOX présente dans la salive des larves d‟H. zea provoque une inhibition de la
surproduction de nicotine induite par les blessures (Musser et al. 2002) et permet d‟augmenter
leurs chances de survie lorsqu‟elles s‟alimentent sur des plants de tabac. Pour cette raison, la
GOX est considérée comme étant un effecteur qui, produit par les glandes salivaires de l‟insecte,
cause une suppression des mécanismes de défense de la plante normalement induits en réponse
aux insectes herbivores. Cette notion demeure toutefois relative : cette même molécule,
lorsqu‟appliquée sur des blessures mécaniques chez le soya, agit comme un éliciteur des
défenses contre des agents pathogènes et réduit l‟incidence des symptômes pathologiques causés
par Pseudomonas syringae pv. glycinea (Felton and Eichenseer 1999).

Sur le plan biochimique, la GOX catalyse la conversion du D-glucose en acide D-gluconique et

en peroxyde d‟hydrogène (H2O2). Cette production d‟H2O2 serait à l‟origine de la suppression
des défenses la plante contre les herbivores. Cette forme réactive de l‟oxygène induit
effectivement chez les plantes le sentier métabolique de l‟acide salicylique (AS), associé à la
défense contre les agents pathogènes, un antagoniste bien caractérisé du sentier métabolique de
l‟acide jasmonique (AJ), généralement associé à la protection contre les insectes herbivores
 15

(Fidantsef et al. 1999; Stout et al. 1999; Felton and Korth 2000). C‟est donc par un mécanisme
d‟interférence métabolique que la salive d‟H. zea confèrerait un avantage à l‟insecte et, par
conséquent, une résistance accrue de la plante aux agents pathogènes (Fidantsef et al. 1999;
Musser et al. 2005).

Ce type de stratégie offensive semble répandu dans la nature. Par exemple, la bactérie
phytopathogène Pseudomonas syringae produit une toxine, la coronatine, qui mime l‟action de
l‟AJ (Zhao et al. 2003). En induisant l‟activation de sentiers métaboliques antagonistes chez son
hôte, la bactérie peut par la suite compléter son cycle vital et proliférer. Fait à noter, des plants
d‟Arabidopsis infectés par P. syringae montrent une résistance induite systémique contre
Trichoplusia ni, un insecte herbivore défoliateur (Cui et al. 2005).

1.1.1.2.2 Le régurgitant

Plusieurs études ont montré que les sécrétions orales des insectes herbivores induisent
l‟activation des mécanismes de défense chez la plante hôte. Néanmoins, seules quelques unes ont
ciblé le ou les éliciteurs impliqués.

Les premiers travaux ayant mis en évidence le rôle des sécrétions orales des insectes herbivores
sur l‟activation des mécanismes de défense de la plante hôte remontent au début des années
1990. Turlings et collaborateurs (1990) ont montré, par exemple, que l‟application de régurgitant
du lépidoptère Spodoptera exigua sur des feuilles de maïs blessées restaurait la réponse observée
lorsque les plantes étaient soumises à l‟insecte. Les plants de maïs émettent de grandes quantités
de composés volatils en réponse aux larves de S. exigua. En revanche, des blessures mécaniques
n‟induisent pas une telle production de composés volatils, à moins d‟y ajouter du régurgitant de
S. exigua.
 16

Korth et Dixon (1997) ont montré en outre, de manière éloquente, l‟importance du régurgitant
dans la réponse aux insectes herbivores défoliateurs. L‟accumulation des transcrits d‟ARN
messager du gène pinII, codant pour un inhibiteur de protéases, est plus rapide chez des plants de
pomme de terre attaqués par des larves de Manduca sexta que chez des plants blessés
mécaniquement. En ajoutant du régurgitant de l‟insecte sur les blessures, la cinétique
d‟accumulation des transcrits de pinII était à l‟inverse similaire à celle observée chez les feuilles
attaquées par M. sexta. Ces deux exemples classiques montrent que les sécrétions orales des
insectes herbivores de type broyeur sont impliquées dans l‟activation des défenses indirectes et
directes chez les végétaux.

Les résultats de plusieurs autres études ont aussi suggéré que le régurgitant de l‟insecte a un effet
sur la réponse de la plante hôte, mais aucune preuve directe n‟appuie en général ces conclusions.
C‟est le cas, par exemple, de mes travaux de maîtrise (Duceppe 2004). Comme nous avions
uniquement comparé les réponses de la pomme de terre au doryphore et aux blessures
mécaniques, nous ne pouvions affirmer avec confiance que les différentes réponses observées
entre ces deux traitements étaient liées à la présence de sécrétions orales chez l‟insecte. Comme
le projet visait à étudier la réponse de la plante à des stress de différentes natures, plutôt que
l‟effet des sécrétions orales, nous n‟avions alors pas inclus de traitement avec le régurgitant de
l‟insecte.

Le régurgitant contient de la salive, des tissus végétaux plus ou moins digérés, des sucs
gastriques, des microbes provenant de l‟insecte ou de la plante hôte, et toutes sortes de particules
potentiellement ingérées par l‟insecte. Toutes les molécules qui composent ces différentes
fractions sont donc sujettes à entrer en contact avec les cellules de la plante hôte et bon nombre
de celles-ci représentent des éliciteurs potentiels. Plusieurs éliciteurs ont été identifiés dans le
régurgitant des insectes herbivores. Ils peuvent être regroupés en cinq familles, selon leur nature
chimique (Felton and Tumlinson 2008): 1) les protéines, 2) les conjugués d‟acides gras, 3) les
acides gras, 4) les peptides et 5) les oxilipines (Figure 1.2). Tous les éliciteurs identifiés jusqu'à
maintenant ont été identifiés à partir du régurgitant de larves de lépidoptères (chenilles),
 17

exception faite des éliciteurs de type « acides gras » retrouvés chez certains orthoptères
(sauterelles).

Figure 1.2 Classes d‟éliciteurs identifiés dans les sécrétions orales des insectes herbivores.
Adapté de Felton et Tumlinson (2008). La structure tridimensionnelle de la β-glucosidase est
tirée de Pozzo et al. (2010).

1. Les protéines : Le premier éliciteur identifié dans les sécrétions orales d‟un insecte
herbivore fut la β-glucosidase, retrouvée dans le régurgitant de Pieris brassicae
 18

(Mattiacci et al. 1995). Il fallut ainsi cinq ans pour identifier le premier éliciteur du
régurgitant d‟un insecte herbivore après avoir montré sa capacité à reproduire, du moins
en partie, la réponse de la plante aux insectes herbivores lorsqu‟appliqué sur des blessures
mécaniques. Certains composés volatils impliqués dans l‟attraction des parasitoïdes
d‟insectes herbivores (défense indirecte) sont entreposés sous forme de β-glucosides chez
le chou (Brassica oleracea); la β-glucosidase permettrait la libération de ces composés
volatils. Une application ectopique de l‟enzyme sur des feuilles non blessées ou des
blessures mécaniques seules n‟engendrent pas la libération des composés volatils attirant
les prédateurs de l‟herbivore (Boland et al. 1992), alors que l‟application de β-
glucosidase sur des blessures le fait.

La glucose oxydase est la seule autre protéine identifiée jusqu'à présent qui pourrait aussi
faire partie de cette catégorie, bien qu‟elle soit plutôt considérée comme un effecteur
(Felton and Tumlinson 2008). Le régurgitant du doryphore de la pomme de terre
(Leptinotarsa decemlineata) contiendrait aussi des protéines qui pourraient agir à titre
d‟effecteurs, mais leur identité reste inconnue (Lawrence et al. 2007).

2. Les conjugués d’acides gras (fatty acid-amino acid conjugates, ou FAC) : La volicitine
fut le premier éliciteur de cette famille à être identifié chez les larves du lépidoptère
Spodoptera exigua (Alborn et al. 1997), mais les FAC semblent être répandus chez les
insectes de cet ordre (Pohnert et al. 1999; Mori et al. 2001; Alborn et al. 2003). Chez tous
les lépidoptères étudiés jusqu‟à maintenant, les FAC sont produits dans le jabot
œsophagien et la partie antérieure du système digestif par l‟action d‟enzymes
membranaires (Tumlinson and Lait 2005). Étrangement, les FAC sont rapidement
hydrolysés dans le tube digestif de l‟insecte après leur synthèse. Ils pourraient servir de
signaux transmetteurs transitoires ou de surfactants pour l‟insecte, mais leur rôle exact
reste toujours à déterminer.

Les FAC retrouvés dans le régurgitant varient en fonction des aliments consommés par
les larves. C‟est d‟ailleurs une stratégie qu‟a adoptée Heliothis subflexa, un lépidoptère
qui s‟alimente sur les fruits de Physalis angulata. Ces derniers étant dépourvus d‟acide
 19

linolénique, l‟insecte augmente ses chances de survie en ne produisant pas de volicitine

(De Moraes and Mescher 2004). Chez la plante hôte, les FAC induisent la production
systémique de composés volatils qui attirent les prédateurs et les parasitoïdes de
lépidoptères. Il est intéressant de constater que les groupes fonctionnels ajoutés par
l‟insecte à cet éliciteur hybride (un groupement hydroxyle et une glutamine ou un
glutamate) semblent très importants dans la reconnaissance des FAC par la plante hôte
(Truitt et al. 2004).

3. Les acides gras : Ces éliciteurs de composés volatils ont d‟abord été identifiés dans les
sécrétions orales des sauterelles Schistocerca americana (Alborn et al. 2007). Fréquents
dans le sous-ordre des Cælifera chez les Orthoptera, ils ont été nommés « cæliférines ».
Les cæliférines sont composées d‟une chaîne d‟acides gras saturée ou mono-insaturée de
15 à 20 carbones, au sein de laquelle le carbone α contient un groupement hydroxyle
sulfaté, et le carbone ω un second groupement hydroxyle sulfaté ou une fonction
carboxyle conjuguée à la glutamine par un lien amide. Cette structure moléculaire
rappelle celle des FAC, mais la structure de ces composés ne change pas en fonction de la
diète de l‟insecte.

4. Les peptides : Une nouvelle classe d‟éliciteurs, les éliciteurs peptidiques, fut identifiée
dans les sécrétions orales des insectes herbivores par Schmelz et collaborateurs (2006),
qui cherchaient à identifier les composantes du régurgitant des larves du lépidoptère
Spodoptora frugiperda responsables de l‟émission d‟éthylène chez le niébé (Vigna
unguiculata). Bien que les sécrétions orales de S. frugiperda contiennent des FAC, ceux-
ci n‟avaient pas la capacité d‟induire le relâchement caractéristique d‟éthylène observé
suite à l‟application du régurgitant de l‟insecte. Ces résultats étaient surprenants, surtout
que les FAC furent d‟abord identifiés chez le genre Spodoptera (Alborn et al. 1997). En
décomposant le régurgitant de l‟insecte en multiples fractions, les auteurs ont identifié
l‟agent responsable de l‟induction, un peptide qu‟ils ont nommé « inceptine ».
L‟inceptine provient d‟une protéolyse partielle de l‟ATPase γ chloroplastique, une
protéine conservée essentielle aux plantes, dans le système digestif de l‟insecte (Schmelz
 20

et al. 2007). Ce fragment protéolytique n‟est habituellement pas produit dans la plante
hôte, ou du moins n‟est pas exposé à son récepteur potentiel. Chez le niébé, la détection
de S. frugiperda impliquerait ainsi la reconnaissance de fragments protéolytiques
hétérologues, par un processus de reconnaissance du « non-soi ».

Les sécrétions orales de plusieurs lépidoptères possèdent la capacité d‟induire un flux

d‟ions transmembranaire en conditions artificielles (Maischak et al. 2007), une activité
cellulaire associée à la formation de pores. Or, des peptides présents dans le régurgitant
de S. littoralis induisent une telle activité membranaire (Luhring et al. 2007). De surcroît,
ces peptides seraient impliqués dans la diffusion de la volicitine dans les cellules de la
plante hôte. Cette mobilité serait toutefois restreinte à de très courtes distances, puisque la
volicitine n‟est pas retrouvée dans les feuilles non attaquées par les insectes herbivores
(Truitt and Pare 2004). Ces peptides ne semblent donc pas être impliqués dans le
processus d‟élicitation; leur rôle physiologique, ainsi que leur origine, restent toujours à
déterminer.

5. Les oxilipines : Cette famille d‟éliciteurs n‟a été découverte que très récemment.
Gaquerel et collaborateurs (2009) ont décrit brièvement le rôle de l‟acide 2-
hydroxyoctadécatriénoique (2-HOT) dans la perception des larves de Manduca sexta chez
le tabac sauvage (N. attenuata), mais les données qui supportent leurs propos n‟ont pas
encore été publiées. Cette oxilipine serait produite dans le régurgitant de l‟insecte à partir
de l‟acide linolénique par l‟action d‟une α-dioxygénase, tous deux en provenance de la
plante. Cette enzyme d‟origine végétale particulièrement stable est résistante à la
protéolyse et active dans les conditions retrouvées dans le tube digestif de M. sexta.
Comme les FAC et l‟inceptine, l‟éliciteur 2-HOT représenterait un éliciteur produit dans
le régurgitant des insectes herbivores, mais dérivé au départ de la plante.

En somme, les éliciteurs sont des molécules que la plante hôte a « appris » à reconnaître et à
utiliser au cours de sa coévolution avec l‟agresseur. Les éliciteurs sont parfois produits par
l‟insecte directement, tandis que d‟autres dérivent de la plante, qui reconnaît alors ses propres
molécules, souvent modifiées par l‟insecte.
 21

Le concept de coévolution implique que les deux parties impliquées dans l‟interaction soient en
constante bataille pour contrecarrer ou surclasser les moyens offensifs et défensifs de
l‟adversaire, une sorte de course à l‟armement (Ryan and Byrne 1988). Dans cette optique, les
sécrétions orales des insectes herbivores ont acquis, au fil du temps, de nouvelles fonctions qui
ne sont pas directement reliées à la digestion proprement dite. En ce qui concerne la plante hôte,
elle a « appris » à reconnaître certaines molécules présentes dans les sécrétions orales de ses
ravageurs afin de bien cerner la nature du stress exercé et d‟adapter ses mécanismes de défense
en conséquence. De leur côté, certains insectes herbivores trompent leur hôte en leur présentant
des éliciteurs, les « effecteurs », qui induisent les « mauvais » mécanismes de défense, avec
comme résultat une augmentation de leur valeur adaptative au détriment de la plante hôte.

Même si de plus en plus de recherches démontrent l‟importance du rôle des sécrétions orales
dans les interactions plante-insecte, l‟implication des différents composés potentiellement actifs
reste à déterminer dans bien des cas (Halitschke et al. 2003). Aussi, des travaux récents
suggèrent que le régurgitant et la salive peuvent contribuer conjointement à la réponse observée
chez la plante en conditions naturelles (Delphia et al. 2006). Par exemple, des plants de tabac
(Nicotiana tabacum) blessés mécaniquement et traités avec du régurgitant de larves d‟Heliothis
virescens, un lépidoptère, relâchent plus de nicotine volatile que des plants traités avec de la
salive de l‟insecte ou des plants attaqués par l‟insecte lui-même. De plus, un mélange de salive et
de régurgitant induit une libération plus faible de nicotine volatile que le régurgitant seul. Cet
exemple met en évidence la complexité des systèmes biologiques en milieux naturels et
démontre du même coup l‟importance d‟évaluer le rôle de l‟ensemble des fluides sécrétés lors
des interactions plantes-insectes (Felton and Tumlinson 2008).
 22

1.1.1.2.3 Autres sources

Les fèces déposées sur les feuilles par les insectes défoliateurs qui s‟alimentent contiennent en
outre plusieurs composantes qui peuvent induire une réponse défensive chez l‟hôte. Par exemple,
les fèces de larves de Manduca sexta contiennent des FAC (Roda et al. 2004). Les excréments
des larves de M. sexta qui s‟alimentent sur la tomate (Solanum lycopersicum) contiennent aussi
plusieurs protéines végétales non digérées, incluant des protéines P-R et plusieurs inhibiteurs de
protéases (Chen et al. 2007).

Les insectes herbivores sont également souvent porteurs de microbes. Des virus, des bactéries ou
des champignons peuvent éventuellement contaminer les feuilles ou les pièces buccales de
l‟insecte et contribuer à la production d‟éliciteurs (Felton and Eichenseer 1999). Par exemple,
plusieurs coléoptères de la famille de Chrysomelidae intègrent des virus en s‟alimentant sur des
plantes infectées, qui sont ensuite transmis par l‟intermédiaire du régurgitant (Gergerich et al.
1983). Les fèces peuvent aussi contenir des virus phytopathogènes (A'Brook and Benigno 1972).

1.1.2 En résumé

En somme, l‟interaction établie entre une plante et un insecte herbivore est très complexe. Au
cours des deux dernières décennies, des progrès technologiques importants ont mené au
développement d‟outils analytiques très puissants qui ont permis des percées significatives dans
notre compréhension de ce domaine important de la biologie végétale.

Même si les blessures mécaniques sont partie intégrante des dommages infligés par les
herbivores, il est aujourd‟hui clair qu‟elles induisent une réponse différente de la réponse aux
insectes herbivores. Il importe, à cet égard, de considérer le facteur spatio-temporel de la
blessure, de même que toutes les molécules libérées par l‟insecte qui peuvent entrer en contact
 23

avec la plante. De surcroît, l‟interaction entre ces différents facteurs pourra influencer la réponse
de la plante. Ultimement, c‟est par la reconnaissance d‟éliciteurs spécifiques et par l‟entremise
d‟un réseau complexe de voies métaboliques endogènes que les plantes pourront déployer des
moyens de défense adéquats pour assurer leur croissance et leur reproduction en présence de
leurs agresseurs herbivores.

La mise en place d‟une défense efficace implique un coût énergétique élevé, où la plante doit
reconfigurer son métabolisme en détournant une partie de l‟énergie dirigée au bon
fonctionnement de la photosynthèse vers la production de composés structuraux et biochimiques
dédiés à la défense. Les paragraphes qui suivent décrivent comment les insectes herbivores
peuvent influencer le métabolisme primaire des plantes.

1.2 La réponse physiologique des plantes aux insectes défoliateurs

L‟assaut d‟une plante par un insecte défoliateur a un impact direct sur la photosynthèse,
généralement estimé en mesurant la quantité de surfaces foliaires perdues (Nabity et al. 2008).
Les herbivores induisent aussi une panoplie de réactions biochimiques dans les tissus restants,
qui peuvent avoir un impact indirect sur la photosynthèse (Aldea et al. 2006b). Les effets
indirects sur la photosynthèse pourraient même être, dans certains cas, plus importants que la
somme des effets directs (Zangerl et al. 2002).

1.2.1 Les effets indirects des insectes herbivores sur la photosynthèse

Les effets indirects des insectes herbivores sur la photosynthèse sont variables et dépendent
d‟une multitude de facteurs. Les insectes se nourrissant à partir de tissus spécifiques, comme le
phloème, induisent généralement une baisse de la photosynthèse (Nabity et al. 2008). En
 24

revanche, il est souvent admis que les insectes défoliateurs n‟affectent pas les capacités
photosynthétiques de leurs plantes hôtes (Peterson et al. 2004), bien que certaines études aient
montré qu‟ils pourraient induire une réduction (e.g. Zangerl et al. 2002) ou, à l‟inverse, une
augmentation de la photosynthèse (e.g. Thomson et al. 2003). L‟activation de mécanismes
compensatoires chez la plante hôte induirait cette hausse de la photosynthèse (Trumble et al.
1993).

1.2.1.1 L’impact du mode d’alimentation

Les effets indirects des insectes herbivores sur la photosynthèse peuvent être associés au mode
d‟alimentation de l‟insecte. Par exemple, les tissus du xylème et du phloème peuvent être
endommagés durant la période d‟alimentation. Le transport de l‟eau, du saccharose et des autres
nutriments, ainsi que l‟ouverture des stomates, sont alors perturbés, avec un impact à la baisse
sur la photosynthèse dans les tissus restants (Nabity et al. 2008). Certains insectes herbivores,
comme les pucerons, engendrent très peu de dommages cellulaires lors de leur alimentation
(Miles 1987). Par contre, comme la sève qu‟ils consomment est pauvre en nutriments (Douglas
1993), ils doivent en consommer une bonne quantité pour satisfaire leurs besoins nutritionnels,
ce qui altère l‟équilibre osmotique et les relations source/puits dans la plante, propre à induire
une baisse de la photosynthèse (Veen 1985; Macedo et al. 2003).

Chez Arabidopsis, des larves de 4e stade du lépidoptère Trichoplusia ni ont très peu d‟effets
indirects sur la photosynthèse (légère baisse de l‟efficacité quantique, φPSII), tandis que les larves
de 1er stade induisent une forte répression de la variable φPSII (Tang et al. 2006). Cette différence
est attribuée au fait que les deux stades larvaires présentent un motif alimentaire différent, les
larves de 1er stade faisant plus de trous de plus petite taille que les larves de 4e stade. Les larves
de 1er stade occasionneraient ainsi un stress hydrique plus sévère que les larves de stade 4 et, par
conséquent, une diminution plus marquée de la photosynthèse.
 25

1.2.1.2 L’impact de la réponse de la plante

Les effets indirects sur la photosynthèse peuvent également être causés par la réponse de la
plante aux insectes herbivores. En situation de stress, les besoins des tissus touchés en ressources
énergétiques et structurales sont élevés (Karban and Baldwin 1997). Conséquemment, une part
plus ou moins grande du métabolisme primaire (croissance, mises en réserve et reproduction) est
détournée vers le métabolisme secondaire (ou de défense) et une réorganisation métabolique
s‟impose alors (Mitra et al. 2008).

1.2.1.2.1 La reconfiguration du métabolisme primaire

Quatre hypothèses ont été proposées par Schwachtje et Baldwin (2008) pour expliquer la
reconfiguration du métabolisme primaire des plantes en réponse aux insectes herbivores :

1. Les caractères associés à la résistance ont un coût d‟expression élevé pour la plante et
sont souvent surexprimés suite à l‟attaque. Ils nécessitent donc une réduction de la
croissance, de la reproduction ou de l‟entreposage des réserves, ou une augmentation de
l‟assimilation du CO2 pour répondre aux besoins métaboliques accrus.

2. La tolérance à l‟herbivorie nécessite certains ajustements physiologiques dans la plante

pour remédier aux effets négatifs engendrés suite à l‟attaque. Par exemple, des plants du
tabac sauvage Nicotiana attenuata blessés mécaniquement (herbivorie simulée) changent
rapidement leurs relations source-puits pour rediriger les sucres vers les racines, une
partie de la plante qui est moins vulnérable aux insectes défoliateurs (Schwachtje et al.
2006).
 26

3. Les métabolites primaires pourraient agir comme signal dans les voies métaboliques de
défense. C‟est le cas, notamment, de l‟isoleucine (Kang et al. 2006), du saccharose (Ahn
and Lee 2003) et de certaines protéines de réserve (Zhu-Salzman et al. 2008).

4. Les changements apportés au métabolisme primaire pourraient être aussi des mécanismes
de défense en soi. Cette hypothèse reste toutefois laborieuse à vérifier, car il est difficile
de priver une plante d‟un métabolite primaire sans en altérer la physiologie. Pour pouvoir
étudier le rôle défensif des métabolites primaires dans la réponse aux herbivores, il faudra
développer des approches sophistiquées permettant de bloquer l‟expression de gènes
spécifiques à des moments précis et dans des tissus particuliers (Mitra et al. 2008;
Schwachtje and Baldwin 2008). Les promoteurs inductibles pourraient s‟avérer d‟une
grande utilité dans ce cas (Stitt and Sonnewald 1995), mais le développement de tels
systèmes d‟expression reste garant de la disponibilité en promoteurs adéquats. Il
importera, dans les années à venir, de continuer à scruter le génome des végétaux et
d‟approfondir nos connaissances sur l‟activation des voies métaboliques des plantes dans
le but de découvrir de nouveaux promoteurs inductibles qui permettront d‟élucider pas à
pas les rôles potentiels des métabolites primaires.

Les plantes utilisent une ou plusieurs stratégies pour contrer les effets néfastes des insectes
herbivores. Évidemment, la reconfiguration du métabolisme primaire implique une panoplie de
changements biochimiques. Plusieurs de ces changements laissent croire que la photosynthèse
pourrait être affectée négativement.

1.2.1.2.2 L’expression des gènes et des protéines photosynthétiques

Il est connu que la reconfiguration du métabolisme primaire en réponse aux insectes défoliateurs
induit la sous-expression de plusieurs gènes et protéines associés à la photosynthèse, notamment
la rubisco. Plusieurs études utilisant des techniques analytiques variées (hybridation soustractive,
PCR en temps réel et micropuces d‟ADN), ont montré que le gène encodant la petite sous-unité
 27

de la rubisco (RbcS) était sous-exprimé en réponse à l'alimentation par des larves du lépidoptère
Manduca sexta chez différentes variétés de tabac (Hermsmeier et al. 2001; Halitschke et al.
2003; Izaguirre et al. 2003). Chez le riz (Oryza sativa), l‟exposition des feuilles à l‟acide
jasmonique, une molécule produite en grande quantité en réponse aux insectes défoliateurs
(Baldwin et al. 1997; Thaler et al. 2002), ou des traitements au froid, aux métaux lourds et aux
rayons ultraviolets, induisent une baisse de la teneur des deux sous-unités de la rubisco et une
augmentation de leur dégradation (Rakwal et al. 1999; Rakwal and Komatsu 2000; Hajduch et al.
2001; Yan et al. 2006).

La compréhension des mécanismes cellulaires qui causent cette diminution de la teneur en

rubisco dans les feuilles suite aux stress biotiques demeure toutefois partielle, de même que les
avantages associés à cette reconfiguration du métabolisme primaire. La diminution de la
concentration en rubisco est associée, entre autres, à une augmentation de la teneur en
jasmonates dans les tissus des plantes stressées (Reinbothe et al. 1994). L‟AJ est connu pour
influencer de façon négative la transcription des gènes encodant les deux sous-unités de la
rubisco (Rakwal and Komatsu 2000). La rubisco, qui représente plus de 40 % des protéines
totales dans les feuilles (Taiz and Zeiger 1998), est associée à la qualité nutritive des plantes pour
les insectes défoliateurs. Une baisse de la teneur en rubisco se traduirait ainsi par une diminution
de la valeur nutritive des feuilles (Mitra and Baldwin 2008). Il n‟est cependant pas clair si cette
réponse constitue réellement un « moyen de défense » pour la plante. Par exemple, les larves du
lépidoptère généraliste Spodoptera littoralis montrent une croissance normale lorsqu‟elles
s‟alimentent de plants transgéniques de tabac sauvage (N. attenuata) montrant une faible teneur
en rubisco. De manière similaire, les larves du lépidoptère spécialiste M. sexta montrent une
croissance accélérée sur ces mêmes plantes (Mitra and Baldwin 2008). Les acides aminés libérés
suite à la dégradation protéolytique de la rubisco pourraient en revanche être réutilisés par la
plante pour la synthèse de nouvelles protéines (Reinbothe et al. 1994), notamment des protéines
de défense (métabolisme secondaire).
 28

Plusieurs autres gènes et protéines photosynthétiques sont aussi réprimés en réponse à

l‟herbivorie ou à l‟application de sécrétions orales sur des blessures mécaniques. Par exemple,
des protéines du photosystème I (PSI) sont très fortement sous-exprimées suite à une attaque par
le doryphore chez la pomme de terre (Duceppe 2004). Divers isoformes de la rubisco activase
sont aussi réprimés en réponse à M. sexta et à ses sécrétions orales chez le tabac sauvage (Giri et
al. 2006), de même que plusieurs gènes associés au PSI et au photosystème II (PSII)
(Hermsmeier et al. 2001; Halitschke et al. 2003; Hui et al. 2003).

La sous-expression des gènes et des protéines photosynthétiques semble être, en définitive, un

phénomène généralisé en réponse au stress chez les plantes. En conséquence, l‟herbivorie
induirait normalement une baisse de la photosynthèse, mais la réponse mesurée est parfois
variable. Cette réponse dépendrait en fait en grande partie du type d‟agresseur et de la stratégie
défensive déployée par la plante (Nabity et al. 2008), les mécanismes impliqués dans la
régulation de la photosynthèse étant complexes et diversifiés.

1.2.2 Les techniques d’imagerie à haute résolution

Outre les facteurs biologiques, plusieurs facteurs logistiques associés aux designs expérimentaux
et à l‟instrumentation peuvent influencer les conclusions d‟une étude sur les effets de
l‟herbivorie sur la photosynthèse. Les appareils de mesure de photosynthèse possèdent
généralement des chambres d‟échanges gazeux qui permettent de prendre des lectures sur une
partie plus ou moins grande de la plante, allant de quelques cellules d‟une feuille à l‟ensemble de
la plante. Or, qu‟advient-il si les changements d‟activité photosynthétique ne sont que très
localisés? Si une petite chambre ne couvrant qu‟une portion limitée d‟une feuille est placée sur la
zone où les changements sont observés, une variation significative de la photosynthèse sera
mesurée. Par contre, si l‟appareil est placé sur une zone où la photosynthèse reste inchangée, les
conclusions seront différentes. En revanche, dans le cas où une grande chambre est utilisée pour
 29

effectuer les mesures, les variations de photosynthèse risquent d‟être tamponnées et non
détectées.

Des avancées technologiques au cours des dernières années ont permis de développer de
nouveaux outils permettant de remédier à certaines contraintes attribuables à l‟appareillage. Avec
des instruments d‟imagerie sophistiqués, il est maintenant possible, par exemple, de quantifier la
variation des processus physiologiques, biochimiques et biophysiques avec une résolution quasi
cellulaire (Aldea et al. 2006a; Nabity et al. 2008). Cette nouvelle résolution permet d‟apporter un
diagnostic autrefois impossible à réaliser. Par exemple, lorsque des larves de H. zea sont placées
sur des feuilles de soya (Glycine max), ils percent la cuticule à plusieurs endroits. Ces dommages
sont imperceptibles à l‟œil nu, mais causent une importante perte hydrique qui influence la
photosynthèse (Aldea et al. 2005). En juxtaposant des données spatiales obtenues par des
analyses complémentaires, les mécanismes impliqués dans la régulation de la photosynthèse
pourront éventuellement être mieux compris.

L‟imagerie à haute résolution a permis de montrer, entre autres, que les effets indirects engendrés
par les insectes défoliateurs sont parfois plus grands que la somme des effets directs (Zangerl et
al. 2002). La Figure 1.3A illustre, par exemple, qu‟après 24 h, des feuilles de panais (Pastinaca
sativa) attaquées par des larves du lépidoptère Trichoplusia ni montrent de larges zones de faible
activité photosynthétique s‟étendant bien au-delà des sites d‟alimentation. À l‟opposé, chez le
soya, des larves d‟H. zea causent une diminution très localisée de la photosynthèse, ne s‟étendant
qu‟à quelques cellules au-delà des sites d‟alimentation (Figure 1.3B).
 30

Figure 1.3 Effet spatial de la défoliation sur l‟efficacité photosynthétique.

A. Les zones bleues au pourtour des trous (en noir) indiquent un taux de transfert réduit des
électrons à travers le PSII (tiré de Zangerl et al. 2002). B. Les zones orangées au pourtour des
trous indiquent une efficacité quantique réduite (tiré d'Aldea et al. 2005).

Il apparaît, à ce stade, que les techniques d‟imagerie ont un avenir prometteur dans l‟étude de la
réponse des plantes aux insectes défoliateurs. Les appareils de mesures d‟échanges gazeux
demeureront un outil essentiel dans cette discipline; c‟est la combinaison de techniques
analytiques complémentaires qui augmentera notre capacité à comprendre des phénomènes
biologiques aussi complexes.

1.2.3 En résumé

En résumé, les plantes possèdent différents outils pour percevoir et « identifier » les stress
qu‟elles subissent et pour déployer des moyens de luttes appropriés favorisant leur survie et leur
reproduction. En parallèle, les insectes phytophages possèdent une batterie de stratégies
offensives et défensives leur permettant de contourner les moyens de défense mis en place par la
plante hôte. L‟établissement d‟une défense efficace demande beaucoup d‟énergie à la plante, qui
doit en retour détourner une partie de l‟énergie normalement attribuée à son métabolisme
primaire vers son métabolisme secondaire. Plusieurs sentiers métaboliques sont alors impliqués
dans le processus et plusieurs gènes et protéines photosynthétiques sont potentiellement réprimés
 31

durant l‟interaction. À l‟échelle physiologique, les réponses aux stress demeurent variables et ne
sont pas nécessairement représentatives des changements observés à l‟échelle moléculaire. La
photosynthèse varie en fonction de plusieurs facteurs et il est toujours difficile de prédire
l‟impact d‟un insecte défoliateur sur la réponse physiologique de la plante hôte, d‟où
l‟importance des mesures de photosynthèse dans toute caractérisation des réponses aux stress
biotiques.

1.3 Description du projet de recherche

Le présent projet de doctorat était une suite logique de mes travaux de maîtrise, qui portaient sur
l‟étude protéomique des défenses induites chez la pomme de terre (Solanum tuberosum L.) en
réponse au doryphore de la pomme de terre (Leptinotarsa decemlineata Say) et au puceron de la
pomme de terre (Macrosiphum euphorbiae Thomas). Mes résultats montraient, entre autres, que
plusieurs protéines reliées à la photosynthèse et au métabolisme primaire chez la pomme de terre
pouvaient montrer une teneur réduite en réponse au doryphore, sans être affectées par des
blessures mécaniques appliquées de manière artificielle (Duceppe 2004).

Par l‟intégration de nouvelles données biochimiques et physiologiques, les travaux de la présente

thèse visaient à tester les hypothèses suivantes :

1. La sous-expression des protéines photosynthétiques observée chez la pomme de terre en

réponse au doryphore de la pomme de terre est orchestrée génétiquement.

2. Les sécrétions orales du doryphore de la pomme de terre jouent un rôle dans la réponse
observée chez sa plante hôte.

3. La réponse de la plante au traitement « doryphore » est systémique.

 32

4. Le doryphore de la pomme de terre engendre un déséquilibre du processus

photosynthétique chez son hôte.

Afin de vérifier ces hypothèses, le projet de recherche a été divisé en plusieurs objectifs. Dans un
premier temps, nous avons tenté d‟identifier, par électrophorèse bidimensionnelle couplée à la
spectrométrie de masse, un maximum de protéines modulées en réponse au doryphore et aux
blessures mécaniques. Ensuite, nous en avons ciblé certaines reliées au métabolisme primaire et
à la photosynthèse, dans le but de développer des amorces d‟amplification pour étudier et
comparer les motifs d‟expression génétique et protéique en réponse aux blessures et au
doryphore. Du matériel végétal récolté durant ma maîtrise a été utilisé pour ces analyses.

Pour la réalisation des objectifs subséquents, un nouveau dispositif expérimental a été conçu afin
d‟extraire un maximum d‟information quant à l‟évolution dans le temps et dans l‟espace de la
réponse de la plante aux blessures mécaniques et au doryphore. Plusieurs traitements ont été
ajoutés afin de déterminer l‟importance des sécrétions orales du doryphore dans la réponse
observée. Concrètement, l‟abondance de plusieurs protéines photosynthétiques clés a été
déterminée par immunodétection. Les aspects biochimiques du système étudié pouvaient ainsi
être caractérisés plus en détail, par l‟introduction d‟une nouvelle technique d‟analyse,
complémentaire à celles utilisées précédemment. Finalement, de nombreux paramètres
photosynthétiques ont été mesurés pour caractériser l‟évolution de l‟état physiologique des plants
de pomme de terre en réponse aux différents traitements.

Les résultats obtenus au cours de ce projet de recherche sont présentés ici sous la forme d‟articles
scientifiques. Un premier article traite des résultats obtenus suite aux analyses protéomiques
réalisées dans le cadre de ma maîtrise, complémenté de nouvelles identifications de protéines et
de données d‟expression génétique réalisées plus récemment. L‟addition de ces données
complémentaires a permis de raffiner nos conclusions par rapport au travail antérieur, tout en
permettant d‟émettre de nouvelles hypothèses de recherche testées dans les articles suivants. Le
 33

deuxième article de la thèse présente des résultats visant à caractériser les sécrétions orales du
doryphore de la pomme de terre. Ces travaux se sont avérés utiles pour planifier les traitements
effectués au cours des recherches subséquentes, notamment pour confirmer la pertinence de
sélectionner comme traitement éliciteur la composante « plante ». Les conclusions de la thèse
relatives aux aspects physiologiques de la photosynthèse sont présentées dans un troisième
article, qui résume l‟ensemble des résultats obtenus suite aux analyses par immunodétection et
aux mesures de photosynthèse sur la base d‟un suivi systématique des échanges gazeux.
Chapitre 2 Protéome foliaire de la pomme de terre en
réponse au doryphore de la pomme de terre
 35

2.1 Résumé

Objectifs poursuivis

 Identifier, par électrophorèse bidimensionnelle, un maximum de protéines des feuilles de

la pomme de terre modulées en réponse au doryphore de la pomme de terre.

 Déterminer si les protéines modulées sont régulées à l‟échelle génétique, par des essais de
PCR en temps réel.

Cette première partie du projet consistait à identifier les protéines foliaires de la pomme de terre
dont la concentration changeait en réponse au doryphore, en utilisant une approche protéomique
« classique » basée sur l‟électrophorèse bidimensionnelle (2-DE) couplée à la spectrométrie de
masse. Le protéome foliaire de la plante a aussi été caractérisé suite à des blessures mécaniques
et un traitement avec des pucerons afin de déterminer l‟influence du type de stress sur la réponse
observée.

L‟attrait principal de l‟électrophorèse 2-D repose sur le fait que cette technique permet d‟étudier
plusieurs centaines de protéines simultanément et, par conséquent, nous évite d‟avoir à choisir
des protéines candidates à priori. En procédant ainsi, nous pouvons avoir une vue d‟ensemble des
phénomènes à l‟étude de manière non biaisée, sans choix préalable de modèles considérés
pertinents et représentatifs.

Nos analyses protéomiques ont révélé, entre autres, que plusieurs protéines impliquées dans la
photosynthèse, notamment des protéines du PSI, étaient fortement réprimées en réponse au
doryphore de la pomme de terre, mais non par de simples blessures mécaniques. En revanche, la
 36

teneur spécifique de plusieurs protéines du PSII restait inchangée en réponse à ce même

traitement (Duceppe 2004). À la lumière de ces résultats, nous voulions déterminer si cette
réponse différentielle des protéines constituantes des deux photosystèmes était orchestrée à
l‟échelle transcriptionnelle (génétique) ou plutôt à l‟échelle post-transcriptionnelle.

Nous avons donc, dans un second temps, mesuré le taux d‟expression des gènes encodant ces
protéines par une approche de PCR en temps réel (PCR quantitative). Nous avons aussi mesuré
l‟expression de gènes encodant d‟autres protéines également régulées en réponse au doryphore
de la pomme de terre. Contrairement aux résultats obtenus par l‟analyse protéomique, nos
résultats ont montré que pratiquement tous les gènes étudiés étaient réprimés en réponse au
stress, sans égard au type de stress subi, suggérant la mise en place d‟une régulation à la fois pré-
et post-transcriptionnelle des gènes étudiés.

Il convient de noter que l‟analyse protéomique présentée ici a été réalisée en partie au cours de
ma maîtrise. Au terme de ces recherches, nous avions identifié plusieurs protéines qui montraient
une variation de concentration en réponse aux différents traitements de stress, mais plusieurs
protéines qui étaient fortement réprimées par le traitement « doryphore » n‟avaient pu être
identifiées. Dans un second effort, nous avons identifié ici plusieurs de ces protéines d‟intérêt.
Nous étions à présent beaucoup plus confiants dans l‟interprétation de nos résultats, et nous
pouvions aller de l‟avant avec la suite du projet (Chapitre 3 et Chapitre 4, plus loin).
 37

Wounding, beetle leaf feeding and aphid phloem feeding

differentially alter the potato leaf proteome

Marc-Olivier Duceppe1, Conrad Cloutier2 and Dominique Michaud1

1
Département de phytologie/Centre de recherche en horticulture, Université Laval, Québec QC,
Canada

2
Département de biologie/Centre de recherche en horticulture, Université Laval, Québec QC,
Canada

Keywords: Wounding, herbivory, Colorado potato beetle, potato aphid, potato, two-dimensional
gel electrophoresis, mass spectrometry, Solanaceae.

Correspondence: Dr. Dominique Michaud, Département de phytologie, Université Laval,

Pavillon des services (INAF), Québec (QC), Canada, G1V 0A6
 38

2.2 Abstract

Plant responses to biotic and abiotic stress cues are very complex and involve the regulation of
many genes, proteins and metabolites. Here, we performed a comparative proteomic analysis of
the plant's response to wounding and herbivory, using as a model potato plants (Solanum
tuberosum L.) subjected to mechanical wounding, to defoliation by the Colorado potato beetle
Leptinotarsa decemlineata Say, or to phloem sap sucking by the potato aphid Macrosiphum
euphorbiae Thomas. Out of approximately 500 leaf proteins monitored by two-dimensional gel
electrophoresis (2-DE), 31 were up- or downregulated by at least one stress treatment, compared
to healthy control plants. Of these proteins, 29 were regulated by potato beetle herbivory, eight
by wounding and eight by potato aphid feeding. Some proteins were up- or downregulated by
two different treatments, while others showed diverging expression patterns in response to
different treatments. As expected, some modulated proteins identified by mass spectrometry
were typical defense-related proteins, such as, for instance, a number of wound-inducible
protease inhibitors and pathogenesis-related proteins. Protein components of the photosynthetic
apparatus or functionally related to photosynthesis were also modulated, notably by potato beetle
feeding inducing a strong, more than twofold decrease of some photosystem I proteins.
Quantitative RT-PCR assays were performed with nucleotide primers for different
photosynthesis-related proteins to assess the impact of wounding and herbivory at the gene level.
Whereas differential, sometimes divergent, responses were observed at the proteome level
following wounding and potato beetle feeding, downregulating effects were systematically
observed for both treatments at the transcriptional level. Our data illustrate, overall, the
differential impacts of wounding and insect herbivory on defense- and photosynthesis-related
components of the potato leaf proteome, presumably associated with the detection of distinct
physical and chemical cues in target tissues.
 39

2.3 Introduction

Because mechanical damage upregulates genes and proteins in plant tissues that are also
upregulated by chewing herbivores, artificial wounding has often been used in experimental
setups to mimic insect herbivory (de Bruxelles and Roberts 2001). It is now well established,
however, that these stress cues induce a number of distinct defense responses in plants. The oral
secretions of herbivorous insects at the wound site, and the feeding patterns characteristic of
insect chewing, were readily identified as strong determinants of the host plant's response. Korth
and Dixon (1997), for instance, reported a fast accumulation of mRNA transcripts for 3-hydroxy-
3-methylglutaryl-coenzyme A reductase and the wound-inducible proteinase inhibitor II (Pin-II)
in potato leaves attacked by the lepidopteran pest Manduca sexta, compared to a slower
accumulation in mechanically wounded leaves. Another example of differential effects of
wounding and herbivory was provided by Reymond et al. (2000), who monitored more than 150
defense-related genes by DNA microarray analysis in Arabidopsis, and showed that many genes
previously described as 'wound-inducible' in leaves were not upregulated upon feeding by the
lepidopteran butterfly Pieris rapae.

Oral secretions introduced in wound tissues during insect feeding would play a central role in the
observed responses (Felton 2008). A number of defense elicitors have been isolated and
characterized from the oral secretions of herbivorous insects, and their ectopic application onto
mechanical wounds were shown to induce defense responses naturally observed following
herbivory (e.g. Korth and Dixon 1997; McCloud and Baldwin 1997; Lawrence et al. 2007).
Some elicitors are of enzymatic nature, such as for instance a β-glucosidase from the caterpillar
Pieris brassicae, which induces natural plant volatiles emission following herbivory when
ectopically applied on wounded leaves of wild mustard Brassica oleracea (Mattiacci et al. 1995).
Non-protein elicitors have also been identified, including the disulfide-bridged peptide inceptin
and a number of fatty acid-amino acid conjugates (FAC's) synthesized de novo during the
herbivory process. Inceptin triggers an increase of salicylic acid and jasmonic acid
concentrations in cowpea leaves, associated with a significant change in the profile of volatiles
 40

emitted by the plant (Schmelz et al. 2006; Schmelz et al. 2007). Volicitin, a FAC from the
regurgitant of Spodoptera exigua caterpillars, also induces the release of volatiles when applied
to mechanically wounded maize leaves, similar to the volatiles induced by insect damage
(Alborn et al. 1997; Turlings et al. 2000). Likewise, a synthetic FAC applied at biologically
realistic concentrations to mechanical wounds on Nicotiana attenuata leaves elicits a systemic
release of volatiles, a jasmonic acid burst and mRNA transcript changes similar to those induced
by the application of M. sexta regurgitant naturally containing the elicitor (Halitschke et al.
2001).

Herbivore feeding guilds interacting with the host plant, as well as wounding patterns during
herbivory, also have a strong impact on the responses observed. Mithofer et al. (2005) showed
that sustained mechanical wounding applied to lima bean leaves in such a way as to reproduce
the leaf removal pattern observed with Spodoptora littoralis larvae can reproduce volatile
emission patterns induced by the insect. It is also documented that chewing herbivores, such as
caterpillars, do not induce the same defense response as piercing-sucking insects like aphids,
which obtain their nutrients directly from the phloem. Unlike chewing herbivores, aphids
establish a prolonged interaction with the host plant, from which they take large amounts of
phloem sap (Walling 2000). Their specialized mouthparts, or stylets, allow them to reach the
sieve tubes via an intracellular route, without causing major damage to plant tissues (Tjallingii
and Hogen Esch 1993; Miles 1999). This feeding behaviour minimizing tissue injury translates
into a unique type of plant-insect interaction, where the defense genes induced in planta have
been reported to be similar to those induced by pathogenic infection (Moran and Thompson
2001). No elicitor has yet been formally identified in aphid saliva, but it is likely that different
molecules in gelling and watery saliva act as elicitors. A resistance gene named Mi, which
confers resistance to aphids and root-parasitic nematodes, has been isolated from tomato
(Kaloshian et al. 1995). This gene encodes a protein member of the nucleotide-binding, leucine-
rich repeat family of resistance factors implicated in gene-for-gene interactions (Rossi et al.
1998), a common pathogen resistance mechanism mediated through the recognition of specific
elicitors from the aggressor. It is not clear whether molecule(s) recognized by the Mi protein
originate(s) from the aphids, from bacteria or viruses they may carry, or from a bioactive product
 41

released from the plant (Miles 1999), but this example supports the idea that aphids are perceived
as pathogens by the host plant (Li et al. 2006). It also further illustrates the striking complexity of
metabolic responses to biotic stress cues in plants, which obviously implicate the specific and
coordinated regulation of many genes, proteins and metabolites.

From an experimental viewpoint, high-throughput, non-biased 'omics' technologies such as

transcriptomics, proteomics and metabolomics are of particular value for deciphering complex
stress-related processes in plants (Shulaev et al. 2008; Yuan et al. 2008; Hirayama and Shinozaki
2010; Urano et al. 2010). In particular, classical proteomic approaches involving two-
dimensional gel electrophoresis (2-DE) and mass spectrometry (MS) (Chevalier 2010) are well
suited to simultaneously monitor the hundreds of proteins characterizing plant-herbivore
arthropod systems (e.g. Giri et al. 2006; Chen et al. 2007; Nguyen et al. 2007; Philippe et al.
2009; Wei et al. 2009; Francis et al. 2010). In the present study, we used a 2-DE/MS approach to
compare the response of cultivated potato plants (Solanum tuberosum) to either mechanical
wounding or herbivory by two specialized insect herbivores, the defoliating pest Colorado potato
beetle (Leptinotarsa decemlineata) and the potato aphid Macrosiphum euphorbiae. Previous
studies reported specific metabolic effects for the regurgitant of Colorado potato beetles on
leaves of Solanaceae. For instance, Kruzmane et al. (2002) reported a significant increase of
ethylene biosynthesis, peroxidase activity and polyphenol oxidase activity in wounded potato
leaves treated with this fluid. In a transcriptomic study with EST microarrays for Solanaceae
species, Lawrence et al. (2008) reported the induction of 73 genes in wounded potato leaves
treated with potato beetle regurgitant, in parallel to the repression of 54 other genes. An
interesting example of gene repression mediated by the potato beetle oral secretions was
provided by the same group (Lawrence et al. 2007), who showed the ability of a [10,30]-kDa
fraction of this insect regurgitant to inhibit the expression of two wound-inducible proteinase
inhibitor genes in tomato leaves. In line with these observations, we document here the
differential effects of wounding, leaf chewing and phloem sap feeding on the steady-state levels
of different defense- and photosynthesis-related proteins in potato leaves.
 42

2.4 Results

2.4.1 Differential gene-inducing effects among treatments

A northern blot analysis was first carried out with leaf RNA extracts to confirm the gene
inducing effects of wounding, potato beetle chewing and aphid feeding (Figure 2.1). Previous
studies reported the differential effects of chewing insects, sap-sucking insects, the wound
hormone jasmonic acid and a number of pathogen elicitors on the induction of Pin-II- and
protein P4-encoding genes in Solanaceae (e.g. Fidantsef and Bostock 1998; Fidantsef et al. 1999;
Rivard et al. 2004; Girard et al. 2007). As expected, mRNA transcripts for Pin-II, a wound-
inducible protein, were easily detected in leaf extracts of plants subjected to both wounding and
potato beetle herbivory, while remaining at low levels in control and aphid-treated plants
(Student's t-test; P=0.0001). By contrast, mRNA transcripts for protein P4-encoding gene, a
pathogen-inducible protein also induced by aphids in leaves (Fidantsef et al. 1999), were
detected, respectively, at very high and moderate levels in aphid- and potato beetle-treated
plants, compared to lower basic levels in control and mechanically wounded plants (Student's t-
test; P<0.0001). These observations, which confirmed distinct gene inducing effects among
treatments, also point to the onset of distinct protein complements in the proteome of potato
leaves challenged by different biotic stresses.
 43

Figure 2.1 Northern blot analysis for the induction of Pin-II and protein P4 mRNA transcripts by
wounding (W), potato aphid piercing-sucking (A) and Colorado potato beetle leaf chewing
(CPB) in potato leaves.
Each bar in the upper panels is the mean of three independent (biological replicate) values ±SD.
Leaf total RNA was extracted 24 h after initiating the stress treatments. The membranes were
hybridized with 32P-labelled cDNA probes encoding either Pin-II or protein P4. Equal RNA
loading in each well was controlled by ethidium bromide fluorescence of total RNA fixed onto
the membrane (not shown). C, leaves from healthy control plants.

2.4.2 Control, wounded and insect-treated leaves exhibit distinct proteome

patterns

A comparative proteomic study involving image analysis following 2-DE was conducted to
assess this hypothesis, using leaf protein extracts from control, wounded and insect-treated
plants. The major protein ribulose-1,5-bisphosphate carboxylase/oxygenase (rubisco) was barely
detectable on the 2-D gels, as reported earlier for potato leaf proteins extracted under similar
acidic conditions (Badri et al. 2009; Goulet et al. 2010b). Of more than 500 proteins detected
(Figure 2.2), 31 were up- or downregulated by at least two-fold in treated plants, compared to
their basic level in untreated control plants, including three proteins produced de novo following
wounding and/or potato beetle feeding (Table 2.1). The relative number of up- and
downregulated proteins in leaves, and the expression trend of each modulated protein compared
to control plants, differed depending on the stress exerted. Potato beetle feeding had, by far, the
 44

strongest impact, with 29 proteins modulated by at least two-fold in leaf extracts, compared to 8
proteins for both the wounding and aphid treatments (Table 2.1, Figure 2.3). Moreover, most
proteins modulated by mechanical wounding or aphid feeding were upregulated compared to the
control, in sharp contrast with the downregulation of 18 proteins, out of 29, modulated by potato
beetle larval feeding (Table 2.1). None of the proteins detected was affected by all stress
treatments, thereby indicating a strong specificity of the plant's response at the proteome scale.

Figure 2.2 Gel image for the proteome of potato leaves subjected to potato aphid feeding, as
visualized after Coomassie blue staining following 2-DE.
Protein spot numbers point to proteins up- or downregulated following mechanical wounding,
Colorado potato beetle leaf chewing and/or potato aphid feeding. A 3 to 10 pI gradient was used
for IEF. Values on the left refer to commercial molecular weight protein markers (kDa). A total
of 167 µg of protein was loaded on the 2-D gel. Proteins synthesized de novo upon wounding or
potato beetle chewing are not shown on this gel.
 45

Table 2.1 Relative levels of potato leaf protein spots exhibiting a more than two-fold
decrease or increase for at least one treatment, compared to healthy control leaves (see
Figure 2.2 for protein numbering).
Data refer to average normalized volumes of the spots considered, divided by the average
normalized volume for the corresponding spot in control gels. P values (Student's t-test) are
included as a comparator for the 'two-fold threshold' criterion. Asterisks indicate significant
(*, P < 0.05) or highly significant (**, P < 0.01; ***, P < 0.0001) differences among
treatments. N refers to proteins induced de novo (newly-synthesized) following stress
treatment. Numbers in parentheses indicate averaged normalized volumes.

Stress treatment
Protein spot Wounding Potato beetles Potato aphids P value
14 1.3 0 4.6 <.0001***
15 1.6 0 4.1 0.0003***
72 1.9 4.1 1.0 0.0165*
76 0.6 3.2 1.0 0.0125*
81 0.4 8.5 0.8 0.0005***
104 1.3 0.4 3.5 0.0710
114 0.5 0 1.0 <.0001***
124 1.1 2.5 1.0 0.0001***
198 1.1 0.3 0.8 0.2828
204 0.8 0 0.6 0.0013**
230 0.8 0.3 1.3 0.0047**
260 0.9 0 0.8 0.0086**
301 1.3 0.4 0.9 0.1569
304 0.9 0 1.0 <.0001***
306 1.2 0 1.5 0.0679
328 2.5 2.7 0.9 0.0391*
346 2.5 2.3 0.7 0.1553
349 1.1 0.2 1.4 0.0166*
396 1.7 2.6 0.8 0.0321*
426 2.0 0.6 1.0 0.1636
444 2.5 0 1.2 <.0001***
445 2.3 0 2.4 0.0045**
450 1.8 0 2.4 0.0003***
451 1.5 0 2.4 0.0154*
461 1.3 0 4.3 0.0002***
464 1.3 2.9 1.4 0.0770
469 1.0 0 1.0 0.0049**
504 1.5 1.3 4.1 0.1604
Newly-synthesized proteins
526 N (0.029) <.0001***
527 N (0.011) N (0.056) 0.0002***
528 N (0.089) 0.0003***
Control (unmodulated) proteins
172 0.7 0.9 1.3 0.1261
298 0.9 0.9 1.0 0.8711
421 0.9 1.0 1.1 0.7679
 46

Figure 2.3 Venn diagram illustrating the relative number of proteins specifically or co-regulated
in potato leaves following mechanical wounding, Colorado potato beetle leaf chewing or potato
aphid feeding.
Black circles represent upregulated proteins, blank squares downregulated proteins. Any
significantly regulated protein is represented more than once if showing diverging expression
trends for different treatments.

A detailed assessment of the responses to wounding and potato beetle feeding was undertaken to
further assess the possible differential effects of these treatments in planta (Table 2.2). In theory
with a 3-state response (unregulated, up, down), nine (32) different scenarios may describe the
effects of two treatments on a single gene or protein expression, including no response to either
treatment (1 scenario); up- or downregulation by only one treatment (see Table 2.2, 4 scenarios);
up- or downregulation by both treatments (2 scenarios); and contrasting effects causing an up-
(or down-) regulation effect by one treatment, concomitant with down- (or up-) regulation by the
other treatment (2 scenarios). In the present case, at least one modulated protein was detected for
seven, out of eight, possible response scenarios (Table 2.2). A majority of proteins were
modulated by only one treatment (22 proteins, out of 30 proteins modulated, overall), with
specific downregulation by potato beetle leaf chewing representing the most common situation
(14 proteins). Interestingly, some proteins were up- or downregulated by both wounding and
potato beetle feeding (Protein spots 76, 114, 328, 346 and 527), but some others showed
 47

diverging, contrasting patterns strongly suggesting specific effects in planta (Protein spots 81,
444 and 445). A similar conclusion could be drawn for the potato beetle and aphid treatments,
where most proteins modulated by aphid feeding were also modulated by potato beetles, but in a
contrasting manner (see Table 2.1).

Table 2.2 Possible expression scenarios (excluding no response to either treatment) for stress-
regulated proteins in potato leaves subjected to mechanical wounding or potato beetle chewing.
Regulated protein spots correspond to those proteins showing a more than twofold increase or
decrease in wounded or potato beetle-treated leaves, compared to healthy control leaves (see
Table 2.1). Upward arrows indicate an upregulating effect following wounding and/or potato
beetle herbivory; downward arrows indicate a downregulating effect.

Scenario Wounding Potato beetles Regulated proteins

1 ↑ - 426
2 - ↑ 72, 76, 124, 396, 464, 526, 528
3 ↓ - none
4 - ↓ 14, 15, 104, 198, 204, 260, 301, 304, 306, 349,
450, 451, 461, 469
5 ↑ ↑ 76, 328, 346, 527
6 ↓ ↓ 114
7 ↑ ↓ 444, 445
8 ↓ ↑ 81

2.4.3 Potato beetles and aphids differentially impact photosynthesis-related

proteins in leaves

Several proteins showing altered content in wounded and/or insect-treated leaves were
confidently identified by matrix-assisted laser desorption-ionization time-of-flight (MALDI
TOF) MS or liquid chromatography (LC) MS/MS (Figure 2.4, Table 2.3, Supplementary Tables
2.1 and 2.2). As expected, a number of these proteins corresponded to well-characterized
inducible stress-related proteins, including aspartate and cysteine protease inhibitors, the
 48

pathogenesis-related 'PR-4' protein P2, and a chloroplastic L-ascorbate peroxidase. Proteins

constituent of the photosynthetic apparatus or functionally involved in photosynthesis were also
identified, in line with the widely reported impact of herbivory on this process (e.g. Delaney et
al. 2008; Nabity et al. 2008; Bilgin et al. 2010). Interestingly, an ATP synthase β protein subunit
and a number of photosystem I protein components were downregulated in response to potato
beetle feeding, in contrast with aphid feeding having no impact, or even an upregulating impact,
on these proteins (Table 2.3).
 49

Figure 2.4 Selected defense- (A) and photosynthesis- (B, C) related proteins identified as
modulated in potato leaves subjected to wounding (W) or Colorado potato beetle (CPB) feeding.
Bars represent average normalized volumes in 2-D gels ±SD; gel parts illustrate protein level
alterations after 24 h. Numbers in parentheses refer to protein spot numbers on 2-D gels (see
Figure 2.2). Bars with the same letter are not significantly different (Student's t-test, α=0.05). C,
control treatment; CDI, cathepsin D inhibitor; API-3, aspartic protease inhibitor 3; PDI, protein
disulfide isomerase; RbcL fragment, fragment of rubisco large subunit; CPN60-alpha, rubisco
subunit-binding protein alpha subunit; RCA, rubisco activase; PsaD, photosystem I reaction
center subunit II; PsaE-B, photosystem I reaction center subunit IV B; PsbO, 33-kDa
photosystem II oxygen evolving complex protein.
 50

Table 2.3 Identity of stress-regulated proteins in potato leaves and their expression trend for three different stress treatments1.

Spatial coordinates Stress treatment4

Theoretical2 Measured3 Wounding Potato Potato
beetles aphids
General function Spot Protein (NCBI Accession No.) pI MM pI MM
DEFENSE 349 Putative L-ascorbat peroxidase, chloroplastic (Q9THX6) 8.3 37.7 9.0 25.6 - ↓ -
RESPONSES 396 Cystein protease inhibitor 7 (O24385 8.6 20.0 4.7 25.0 - ↑ -
464 Aspartic protease inhibitor (CAA45723) 7.5 23.7 5.3 24.2 - ↑ -
15 EST537399 similar to a subtilase (NP_199378) 9.4 85.1 8.8 92.6 - ↓ ↑
469 Aspartic protein inhibitor 3 (P58518) 8.6 18.6 9.0 24.3 - ↓ -
426 Aspartic protein inhibitor 3 (P58518) 8.6 18.6 8.6 24.6 ↑ - -
504 Pathogenesis-related protein P2 (CAA41439) 8.5 16.0 8.2 19.1 - - ↑
ENERGY 104 ATP synthase β subunit (AAM52206) 5.1 53.6 5.5 45.8 - ↓ ↑
METABOLISM 304 Rubisco large subunit fragment (CAA70392) 6.5 44.6 9.0 26.6 - ↓ -
172 5 Rubisco activase (AAC15236) 8.6 50.7 5.4 43.0 - - -
444 Photosystem I reaction center subunit II (P12372) 9.7 22.9 9.1 24.4 ↑ ↓ -
451 Photosystem I reaction center subunit IV B (Q41229) 9.7 15.2 9.4 24.4 - ↓ ↑
461 Photosystem I reaction center subunit IV (P12354) 10 13.4 9.4 24.3 - ↓ ↑
298 5 33-kDa PSII oxygen evolving complex protein (CAA35601) 5.9 35.3 5.0 33.9 - - -
421 5 23-kDa PSII oxygen evolving protein (CAA67696) 8.3 28.0 5.3 26.2 - - -
PROTEIN 72 Rubisco subunit binding-protein alpha subunit (P08824) 4.8 52.4 4.5 56.7 - ↑ -
SYNTHESIS 76 EST396117 similar to a protein disulfide isomerase (Q9XF61) 4.8 57.1 4.7 53.1 - ↑ -

1
Additional information on MS data and protein identification outputs is given in Supplementary Tables 2.1 and 2.2.
2
Theoretical pI and MM, expressed in kDa, values were calculated with the Expasy 'PeptideMass' algorithm (http://ca.expasy.org/tools/pi_tool.html).
3
Measured pI and MM, expressed in kDa, values were estimated with the ImageMaster 2D Elite program (GE Healthcare), using Bio-Rad Broad Range
molecular standards.
4
Upward pointing arrows indicate a twofold or more than twofold upregulation, downward arrows a twofold or more than twofold downregulation.
Blank (-) signs indicate comparable levels with control healthy leaves.
5
Unmodulated, negative controls, found at comparable levels in stressed and control healthy plants.
 51

Quantitative RT-PCR assays were conducted with nucleotide primers for different
photosynthesis-related proteins to estimate and compare the impact of wounding and potato
beetle feeding at the gene transcription level (Figure 2.5). Preliminary tests with primers for the
Pin-II and protein P4-encoding genes and the above-described northern blot signals (see Figure
2.1) as a reference first allowed to confirm the validity of RT-PCR amplifications under our
experimental conditions (not shown). Surprisingly, both treatments induced a systematic
downregulation of the genes monitored (Figure 2.5), including genes, such as psaE-B for
photosystem I subunit IV-B (Protein spot 451) and atpB for ATPase subunit β (Spot 104),
encoding proteins unaffected by wounding (see Figure 2.4). The 'control' gene rca, encoding a
protein remaining unaltered on 2-D gels (spot 172), was also downregulated.
 52

Figure 2.5 Abundance of mRNA transcripts for photosynthesis-related proteins in potato leaves
subjected to wounding (W) or Colorado potato beetle (CPB) feeding.
The transcripts were extracted after 24 h, and quantified by real-time RT-PCR using appropriate
oligonucleotide primers. Each bar is the mean of three independent (biological replicate) values
±SD. Numbers in parentheses refer to protein spot numbers on 2-D gels (see Figure 2.2). See
Table 2.4 for complete gene identification. C, healthy control plants.
 53

2.5 Discussion

Previous studies reported the differential effects of wounding and insect herbivory on the
metabolism of higher plants, using different experimental approaches involving the monitoring
of model genes and proteins, or, more recently, 'omics' approaches for the systemic analysis of
whole mRNA transcripts or protein complements. Transcriptomics has been instrumental, over
the last several years, to decipher complex cellular and biochemical processes in plant-insect
systems, which often implicate dynamic cross-talks between defense metabolic pathways in host
plant tissues and the regulation of numerous genes at the transcription level (e.g. Schenk et al.
2000; Moran et al. 2002; Halitschke et al. 2003; Lawrence et al. 2008). A number of recent
studies also documented the potential of proteomics in the elucidation of stress-inducible
responses (e.g. Nguyen et al. 2007; Wei et al. 2009; Goulet et al. 2010b). While DNA
microarray- and RT PCR-based transcriptomics are of obvious interest to interpret stress
responses at the gene level, proteomics give a close overview of the metabolic output in planta.
Our data, which point to the onset of differential protein regulation patterns in mechanically
wounded and insect-treated plants despite similar transcriptional control patterns, support recent
models suggesting a regulatory role for metabolic effectors in the oral secretions of attacking
herbivores such as the potato beetle. They also support the potential of proteins as biologically
relevant markers for a realistic account of the situation in vivo, and the emerging idea that a
correct understanding of stress-inducible responses in plants should involve the integration of
genomics, proteomics and metabolomics data for the overall monitoring of transcriptional, post-
transcriptional and post-translational regulatory mechanisms controlling their incidence
(Mazzucotelli et al. 2008).

About thirty proteins had their concentration increased or decreased by at least twofold in
wounded or potato beetle-treated potato leaves under our experimental conditions, similar to Giri
et al. (2006) reporting the modulation of 18 proteins, out of approximately 500 monitored
proteins, in leaves of N. attenuata subjected to M. sexta larvae herbivory. Most interestingly,
none of the proteins modulated here was up- or downregulated by all three stress treatments, and
 54

most of these proteins were up- or downregulated by only one treatment (see Figure 2.3). These
observations, along with the unaltered normalized volumes observed on 2-D gels for more than
90% of the proteins detected, underline the remarkable stability of the host plant's leaf proteome
under various stress conditions. They also underline, in accordance with the treatment-specific
expression patterns observed for Pin-II and protein P4 mRNA transcripts (Figure 2.1), the onset
of specific responses in planta depending on the stress exerted. The differential, even diverging,
expression trends observed for a number of proteins following different stress treatments (Table
2.2) highlighted, in particular, the diversity of possible responses in planta, not only involving
the regulation and expression rate of several genes and proteins, but also their accumulation
trend in plant tissues.

Experimental biases influencing data interpretation, such as the focus on abundant proteins
during 2-DE, the adoption of a conservative twofold threshold for protein spot selection or the
use of a wound treatment not reproducing the injury pattern observed during insect feeding,
cannot be excluded de facto. It is well known, in particular, that leaf damage pattern, intensity
and duration may significantly impact stress perception and wound hormone (e.g. jasmonic acid)
accumulation in wounded plants, with a likely impact on stress metabolic pathways and defense
gene inductions (Baldwin et al. 1997). Nevertheless, a number of observations support the
hypothesis of distinct effects for the three treatments assessed. For instance, the limited and
specific effects of potato aphids could be expected a priori given the feeding habits of these
insects and their limited impact on the integrity of host plant tissues (Miles 1999). Our proteomic
data indicating the upregulation of a PR-4 protein (Spot 504) upon potato aphid feeding also is in
line with previous reports on plant-aphid interactions and those models proposing different
recognition and response schemes in planta in response to phloem sap feeding and chewing
arthropods (Fidantsef et al. 1999; Moran and Thompson 2001; Voelckel and Baldwin 2003;
Thompson and Goggin 2006).

Interpretation issues may remain more problematic for the non-biological wounding treatment,
but a number of observations, such as the detection of an aspartate protease inhibitor isoform that
 55

is upregulated exclusively in wounded leaves (Spot 426) and the diverging accumulation trends
of photosystem I reaction center subunit II (Spot 444) in leaves subjected to wounding and
potato beetle feeding, again suggest treatment-specific effects. Most convincingly, RT-PCR data
showed comparable repressing effects for mechanical wounding and potato beetle treatments on
the transcription rate of several photosynthesis-related genes, despite clearly divergent
abundances observed on 2-D gels for the corresponding proteins (Spots 104, 304, 444 and 451).
These findings suggest, overall, the onset of stress-specific gene and protein regulatory
mechanisms in the host plant involving a combination of regulatory events common to different
stress cues, and treatment-specific regulatory events leading to distinct responses at the proteome
level. From this perspective, the differential metabolic effects of wounding and potato beetles
would have resulted from a combination of common transcriptional regulation events likely
triggered by wounding and the 'wound hormone' jasmonic acid (Howe 2004), followed by
specific effects of the potato beetle (regurgitant) (Lawrence et al. 2007; Lawrence et al. 2008)
post-translationally altering the turnover of some regulated proteins in planta, via regulatory
schemes still to be elucidated.

As expected, defense-related proteins such as PR-proteins (e.g. proteins P2 and P4) and wound-
inducible (Ser, Cys and Asp) protease inhibitors were induced in leaves by wounding, aphid
and/or potato beetle treatments. Of particular interest is, by contrast, the downregulation of a
Kunitz-type Asp protease inhibitor in potato beetle-treated plants (Spot 469). Asp-type inhibitors
are well-characterized antidigestive proteins induced by jasmonic acid in potato leaves (Kreft et
al. 1997) and known to strongly inhibit Asp, cathepsin D-like digestive proteases implicated in
dietary protein digestion in the Colorado potato beetle larval midgut (Brunelle et al. 1999;
Brunelle et al. 2004). From a physiological viewpoint, the downregulation of an Asp protease
inhibitor and the slight repression of a second isoform despite twofold upregulation in wounded
leaves (Spot 426), along with the previously reported downregulation of Ser protease inhibitors
in wounded tomato leaves treated with potato beetle regurgitant (Lawrence et al. 2007), could
represent an advantage for the insect in vivo. The biological significance of protease inhibitor
downregulation in planta may remain equivocal at this stage considering the number and
diversity of protease inhibitor isoform- (including Kunitz inhibitor isoform-) encoding genes in
 56

the potato genome (Heibges et al. 2003), but it is tempting to speculate about a possible evasive
strategy by the insect to elude target protease inhibition. In a similar way, the downregulation of
an ATP synthase β subunit (Spot 104) in potato leaves could contribute to attenuate the impact of
host plant defenses and help maintain the insect's fitness, considering the role attributed to host
plant (N. attenuata) ATP synthase fragments as a 'non-self' trigger of defense responses upon
herbivory (Schmelz et al. 2006).

The downregulation of photosynthesis-related proteins in response to herbivory is more difficult

to interpret. A number of proteomics and transcriptomics studies have already reported the
repression of photosynthesis-related proteins in plants under stress conditions, such as a strong
reduction and fragmentation of rubisco in metal-treated rice plants (Hajduch et al. 2001),
downregulation of rubisco small subunit transcription in N. attenuata leaves subjected to M.
sexta herbivory (Hermsmeier et al. 2001), and lowered rubisco activase content in wounded
leaves of the same plant treated with the oral secretions of M. sexta larvae (Giri et al. 2006).
Several hypotheses have been proposed to explain these observations in terms of metabolic
strategies to sustain plant's or herbivore's fitness. A number of authors have suggested the need
for a reallocation of carbon resources towards defense responses in the host plant (Somssich and
Hahlbrock 1998; Hermsmeier et al. 2001; Schwachtje and Baldwin 2008). The degradation of
rubisco, in this perspective, would provide the plant with an important source of amino acids for
newly synthesized defense proteins (Reinbothe et al. 1994; Bilgin et al. 2010), while also
lowering the nutritive value of leaf tissues by limiting dietary protein availability to the aggressor
(Mitra and Baldwin 2008).

Two alternative hypotheses could also explain the observed effects, namely: (1) the secretion of
biochemical effectors in the insect regurgitant that might limit energy resources available to the
host plant or promote the accumulation of compounds, such as reactive oxygen species, toxic to
plant cells (Felton and Eichenseer 1999; Musser et al. 2002); and (2), a general disturbance of the
whole plant system under stress conditions that might negatively affect photosynthesis and
induce compensatory responses. The strong and specific downregulation of chloroplastic L-
 57

ascorbate peroxidase (Spot 349) and photosystem I proteins (Spots 444, 451 and 461) observed
here following potato beetle feeding is compatible with the hypothesis of reduced energy
production and increased accumulation of toxic oxidizing molecules. The specific upregulation
of the 60-kDa chaperonin -subunit rubisco chaperone (Spot 72) and protein disulfide isomerase
(Spot 76) upon potato beetle treatment, along with the maintenance of rubisco activase (Spot
172) content, support the idea of compensatory responses to sustain protein biosynthesis, folding
and assembly. Overexpression of the 60-kDa rubisco chaperone, also observed in tobacco leaves
attacked by M. sexta larvae (Hui et al. 2003), could represent a general strategy for plants to
better regulate rubisco assembly under stress conditions. Work is underway to assess the net
resulting impacts of mechanical wounding and potato beetle herbivory on photosynthesis in
potato leaves, keeping in mind the striking plasticity of major physiological processes in plants.
Work is also underway to further dissect the inducing effects of the potato-potato beetle system
components, including the plant itself. Studies have described, in recent years, the elicitor
activity of plant-derived compounds in plant-herbivore systems (Heil 2009), including plant
protein fragments coming back to the host plant via the insect regurgitant (e.g. Schmelz et al.
2006; Schmelz et al. 2007; Gaquerel et al. 2009).

2.6 Materials and methods

2.6.1 Plants

Thirty-five days-old potato plants (Solanum tuberosum L., cv. Superior) cultivated in a Conviron
growth chamber (Conviron, Winnipeg, Manitoba) were used for the experiments. The plants
were grown in 2-gallon pots, in a Promix BX substrate (Premier Tech Horticulture, Rivière-du-
Loup QC, Canada), watered as needed and fertilized once a week with a 200 ppm solution of 20-
20-20 adjusted to pH 5.8 with H3PO4. Environmental conditions in the growth chamber were
maintained as follows: a light intensity of 125 µEinstein m-2s-1, a 14/10 h L:D photoperiod, a
24oC /18oC L:D thermoperiod, and a relative humidity of 60%.
 58

2.6.2 Stress treatments

The study involved four treatments: (i) artificial wounding with a razor blade; (ii) defoliation
with 4th-instar Colorado potato beetle larvae (Leptinotarsa decemlineata Say); (iii) sap feeding
with 2nd-instar potato aphids (Macrosiphum euphorbiae Thomas); and (iv) a 'no-stress' control
treatment with unchallenged, healthy plants. The artificial wounding treatment consisted of three
1 cm-long cuts through the lamina with a sterile razor blade on a terminal leaflet of the plant's 4 th
upper leaf, followed by the same treatment 2 h later on another terminal leaflet, then repeated
after 4 h on the 3rd terminal leaflets. For the potato beetle treatment, one 4th-instar larva reared on
potato plants (cv. Superior) was placed for 24 h onto the abaxial side of the 4th upper leaf, in such
a way as to leave about 50% of the initial leaf surface at the end of the treatment. For the sap
feeding treatment, 50 aphids reared on potato plants (cv. Superior) were deposited onto the
abaxial side of the 4th upper leaf and left to feed on the plant for 24 h. All insects were confined
to the treated leaves using specially designed cages made of clear plastic and nylon. Each
treatment included three repetitions, with plant replicates distributed randomly in the growth
chamber. Cages for insect confinement were fixed on all plants, including wounded (leaflet-cut)
and control plants, to avoid confounding effects due to the experimental setup. The 4th (treated)
and 3rd (younger) upper leaves of all treated and control plants were collected and pooled after 24
h, ground to a fine powder in liquid nitrogen, and kept at –80oC until further analysis.

2.6.3 Northern blotting

mRNA transcripts for Pin-II- and protein P4-encoding genes were visualized by northern blotting
as described earlier (Rivard et al. 2004), with total RNA extracted from potato leaves according
to Logemann et al. (1987). The probe for protein P4 gene was amplified by PCR from a leaf
RNA population of benzothiadiazole–treated tomato plants (Solanum lycopersicum), using the
following oligonucleotide primers (GenBank Accession Number M69247): [5‟–AAATG
 59

GGGTT GTTCA ACATC TCATT G–3‟]/[5‟–CAATA ATAAT AGGAT ATCAA TCCGA

TCCAC–3‟]. The probe for Pin-II was amplified from methyl jasmonate-treated tomato leaves
using the following primers (Accession Number K03291): [5‟–GCCAA GGCTT GTACT
AGAGA ATGTG GT–3‟]/[5‟–GGACA AGTCT AGAGT CACAT TACAG GGTAC–3‟]. For
northern blot analysis, 10 µg of total RNA was resolved in 1.2% (w/v) formaldehyde-agarose
gels and blotted onto nitrocellulose membranes (Logemann et al. 1987). The membranes were
32
hybridized for 20 h with P-labelled DNA probes and washed under stringent conditions. The
filters were subjected to autoradiography for 24 h at –80°C, using intensifying screens.

2.6.4 Real-time RT-PCR

mRNA transcripts for Pin-II, protein P4 and different photosynthesis-related proteins were
quantified by real-time RT-PCR as described earlier (Rivard et al. 2006), using a Roche
LightCycler apparatus [System 1.0] and the LightCycler-FastStart DNA Master SyBRGreen I kit
(Roche Diagnostics, Laval QC, Canada). Leaf total RNA was extracted with the Concert Plant
RNA Reagent (Invitrogen Life Technologies, Burlington ON, Canada) following the supplier's
instructions, and contaminant DNA was removed by treatment with DNase I (Roche
Diagnostics). First-strand cDNA was produced with 2 µg of total RNA using Qiagen‟s
Omniscript RT kit (Qiagen, Mississauga ON, Canada). Two hundred ng of reverse-transcribed
RNA was used for amplification, using specific oligonucleotide primers (Table 2.4). The
specificity of RT-PCR product formation was confirmed by melting curve analysis and gel
electrophoresis. Elongation factor 1-α (ef1-α) was used as a control (housekeeping) gene for the
tests (Nicot et al. 2005).
 60

Table 2.4 Oligonucleotide primer sequences for real-time RT-PCR.

Gene Protein Spot Accession No.1 Forward primer (5’–3’) Reverse primer (5’–3’) Size (bp)
atpB ATPase β subunit 104 AY300043 ATGAGAGTTGGTTTGACTGC CGAATTGTTTCTGCTAGACC 629
rbcL Rubisco (large subunit) 304 M76402 GAACGTGAACTCACAACCAT GACATACGTAACGCTTTTGC 351
rca Rubisco activase 172 SGN-U243405 AATACACCGTCAACAACCAG CACCAATGTTTTCAATTCCA 382
apx L-Ascorbate peroxidase 349 SGN-U247328 ATGAGGATCGCTTTCATAGAC ATTTTCTGGTCTGCTGATCTC 311
(chloroplastic) + SGN-U258329
psaD PsaD (PSI subunit II) 444 STU556864 TGGAAACAATCCCTCCTATC ACAAATTGGGTCCTTCTCTC 310
psaE-B PsaE-B (PSI subunit IV-B) 451 SGN-U245041 CCTAATGTCACCTCTAACTCTG TAAAACATGGAAAGCACAGG 458
pinII Proteinase inhibitor II --- L37519 AATCTTGGGTTTGGGATATG TATGTGGATCGCAATTTAGG 178
p4 PR-1 protein P4 --- AJ250136 GCACAAAATTATGCCAACTC AGTTGCATGAAATGAACCAC 271
ef1-α Elongation factor 1- --- AB061263 ATTGGAAACGGATATGCTCCA TCCTTACCTGAACGCCTGTCA 101

1
Accession numbers from the NCBI GenBank Database (http://www.ncbi.nlm.nih.gov) or the Solanaceae Genomics Network Database ('SGN' sequences; http://www.sgn.cornell.edu).
 61

2.6.5 Sample preparation for 2-DE

Leaf proteins for 2-DE were extracted from frozen leaf powder (see above), essentially as
described by Damerval et al. (1986). In brief, 300 µg of leaf powder was precipitated in 1 mL of
10% (v/v) trichloroacetic acid/0.07% (v/v) 2-mercaptoethanol diluted in acetone, for 2 h at –
20oC. After centrifugation at 20,000 g for 25 min at 4oC, the pellets were washed four times with
1 mL of acetone containing 0.07% (w/v) 2-mercaptoethanol. The pellets were vacuum-dried in a
SPD121 Thermo Savant SpeedVac centrifuge (Thermo Fisher Scientific, Mississauga ON,
Canada) for 15 min at 20oC, and the proteins resolubilized by sonication for 1 h at 30oC, in
60 μL of electrophoretic sample buffer [8 M urea containing 2% (w/v) CHAPS, 0.5% (v/v) IPG
buffer 3-10 (GE Healthcare, Baie d'Urfé QC, Canada) and 60 mM dithiothreitol] per mg of dried
pellet. Protein concentration in the extracts was determined according to Ramagli and Rodriguez
(1985), with ovalbumin as a standard.

2.6.6 2-DE

2-DE first involved isoelectric focusing (IEF) (1st dimension), followed by 12% (w/v) SDS-
PAGE (2nd dimension). IEF was performed in 13-cm Immobiline DryStrip gel strips (GE
Healthcare) along a 3 to 10 pH gradient, with 167 µg of leaf protein per gel strip. Proteins were
applied on the strips and resolved using an IPGphor apparatus (GE Healthcare). The program for
IEF involved the following sequential steps: rehydration at 30 V for 12 h; 100 V for 1 h; 500 V
for 1 h; 1,000 V for 1 h; 5,000 V for 1 h; and 8,000 V to reach 25,960 Vh. Following IEF, the
strips were incubated twice for 20 min in Tris-HCl equilibration buffer, pH 8.8, containing 6 M
urea, 30% (v/v) glycerol, 2% (w/v) SDS and 0.1% (w/v) dithiothreitol (or 5% (v/v)
iodoacetamide for the second incubation), and used immediately for the second dimension. SDS-
PAGE (Laemmli 1970) was performed at 200 V in 1-mm thick polyacrylamide slab gels, using
the PROTEAN Plus Dodeca Cell (Bio-Rad, Mississauga ON, Canada) allowing for the
simultaneous processing of twelve gels. After migration, the gels were fixed overnight in water
 62

containing 10% (v/v) acetic acid and 50% (v/v) ethanol. The proteins were stained with the Bio-
Safe Coomassie Blue reagent (Bio-Rad), following the supplier's instructions.

2.6.7 Gel image analysis

Image analysis was carried out as described recently (Badri et al. 2009) using the Phoretix 2-D
Expression software, v2005 (NonLinear USA Inc, Durham NC, USA), after digitalizing the gels
with an Amersham Image Scanner digitalizer and the ImageMaster LabScan software, v3.0 (GE
Healthcare, Baie d'Urfé QC, Canada). Automatic spot detection and „non-spot background‟
subtraction were performed following the supplier‟s instructions to eliminate staining
background inherent to the image capture process. The gel containing the highest number of
protein spots was identified, and used as a reference gel for protein spot matching. An average
virtual gel was constructed for each set of three gels (three biological replicates), that included
protein spots found on at least two gels. Average spot intensities were normalized to the total
spot volume with a multiplication factor of 100 to minimize errors due to differences in staining
intensity or in the amount of protein loaded. Spot matching was performed with the average gels,
and those spots showing more than twofold differences in density were selected for protein
identification. The spots were also assessed statistically based on a one-way analysis of variance,
with a significance threshold ( value) of 0.05.

2.6.8 MS analyses

Protein spots for identification were excised manually from the gels, digested with sequencing
grade trypsin (Promega, Madison WI, USA) and subjected for MS analysis to the Eastern
Québec Proteomics Center (Centre de recherche du CHUL, Québec QC, Canada). In-gel protein
digestion was performed on a MassPrep liquid handling station (Waters, Lachine QC, Canada),
according to the manufacturer's specifications. The extracted peptides were lyophilized by
 63

SpeedVac centrifugation and resuspended in 3 µL of 0.1% (v/v) trifluoroacetic acid in water

until further analysis. The matrix for MALDI-TOF MS was α-cyano-4-hydroxycinnamic acid
diluted at 20 mg/mL in 50% (v/v) acetonitrile/0.1% (w/v) trifluoroacetic acid. Equal volumes of
peptides and matrix solutions were mixed, and 1 µL of the resulting solution was spotted on a
stainless steel MALDI sample plate. The solution was allowed to air-dry at 20oC, and washed
three times with 2 µL of 0.1% (w/v) trifluoroacetic acid. MALDI-TOF MS spectra were acquired
on a Voyager-DE PRO Biospectrometry Workstation (Applied Biosystems) in the positive-ion
reflector delayed-extraction mode, and analyzed using the DataExplorer software, v4.0 (Applied
Biosystems). MS/MS peptide spectra were generated by microcapillary reverse-phase
chromatography coupled to an LCQ DecaXP (Thermo Fisher Scientific) quadrupole ion trap
mass spectrometer with a nanospray interface. A 10-µL aliquot of the peptide sample was loaded
onto a 75-µm internal diameter C18 picofrit column (New Objective, Woburn MA, USA). The
peptides were eluted along a water-acetonitrile/0.1% (v/v) formic acid gradient, at a 200 nL/min
flow rate.

2.6.9 Protein identification

Mass spectra generated by MALDI-TOF MS were analyzed using the Rockefeller University
ProFound algorithm for protein identification, v4.10.5 (http://prowl.rockefeller.edu/cgi-
bin/ProFound), with the following search criteria: a maximum of one missed trypsin cleavage,
complete carboxyamidomethylation of cysteine residues, methionine residues in the oxidized
form, and maximal mass deviation of 100 ppm. MS/MS spectra were analyzed using the
SEQUEST (Eng et al. 1994) and MASCOT (Perkins et al. 1999) algorithms, with an MS-MS
deviation tolerance of 0.5 Da and a peptide deviation tolerance of 2 Da. All MS data were
searched against non-redundant Viridiplantae entries of the National Center for Biotechnology
Information database (http://www.ncbi.nlm.nih.gov).
 64

2.7 Acknowledgments

We thank Mr. Simon Boudreault for invaluable help with insect rearing. This work was funded
by the Natural Science and Engineering Research Council of Canada (NSERC) and the Québec's
Fonds québécois de la recherche sur la nature et les technologies (FQRNT). M.-O. Duceppe was
the recipient of NSERC and FQRNT postgraduate scholarships.
 65

Supplementary Table 2.1 MALDI-TOF MS identification of potato leaf proteins regulated by wounding, potato
beetle feeding or aphid phloem feeding.

Spot Protein Accession pI MM Matched peptides Coverage MOWSE

number1 (Exp./Calc.)1 (Exp./Calc.)1 (m/z) score
104 ATP synthase beta subunit AAM52206 5.5/5.1 45.8/53.6 1490.67 22% 79
2678.16
1045.53
1201.59
1328.57
1601.70
1617.66
2313.89
1431.57
304 RuBisCo large subunit fragment CAA70392 9.0/6.5 26.6/44.6 1450.76 17% 52
1451.76
1793.71
1794.78
1561.78
1467.76
426 Aspartic protease inhibitor 3 P58518 8.6/8.6 24.6/18.9 1518.63 32% 72
1348.62
1053.53
2061.91
444 Photosystem I reaction center subunit II, chloroplast precursor P12372 9.1/9.7 24.4/23.0 1682.76 30% 106
1175.62
1294.66
1003.50
1527.77
906.45
888.44
451 Photosystem I reaction center subunit IV B, chloroplast precursor Q41229 9.4/9.7 24.4/15.2 975.61 27% 62
1003.51
875.40
2660.25
2271.06
469 Aspartic protease inhibitor 3 P58518 9.0/8.6 24.3/18.9 1518.69 32% 52
1348.67
1053.57
2062.01
1
Experimental (Exp.) molecular mass (MM), expressed in kDa, and pI values were estimated with the ImageMaster 2D Elite program (GE Healthcare), using Bio-Rad Broad
Range molecular standards. Calculated (Calc.) MM and pI values were established with the Expasy 'PeptideMass' algorithm (http://ca.expasy.org/tools/pi_tool.html).
 66

Supplementary Table 2.2 LC-MS/MS identification of potato leaf proteins regulated by wounding, potato beetle feeding or aphid
phloem feeding.

Spot Protein NCBI Accession MOWSE pI MM Matched unique peptide sequences

No. score (Exp./Calc.)1 (Exp./Calc.)1
15 EST similar to a subtilase (NP_199378) EST537399 58 8.8/9.4 92.6/85.1 SPPGYAVDIVP
76 EST similar to a protein disulfide isomerase (Q9XF61) EST396117 80 4.7/4.8 53.1/57.1 EADGIVSYVK
AAQILSQNDPPVVLAK
72 Rubisco subunit binding-protein alpha subunit P08824 90 4.5/4.8 51.752.5 TNDSAGDGTTTASVLAR
GILNVAAIK
349 Putative L-ascorbate peroxidase, chloroplast precursor Q9THX6 67 9.0/8.2 25.6/37.9 LTLYDAIK
STFIASAISK
STFIASAISK
396 Cysteine protease inhibitor 7 O24385 62 4.7/8.6 25.0/20.1 LCVDETVWKVNDEELVVTGGNVGNENDIFK
VNDEELVVTGGNVGNENDIFK
445 Photosystem I reaction center subunit II, chloroplast precursor P12372 211 9.4/9.7 23.1/22.9 EGVGQNFR
KEQCLALGTR
VFPNGEVQYLHPK
EQIFEMPTGGAAIMR
450 Aspartic protease inhibitor CAA45723 82 9.0/7.5 19.6/23.7 YNSDVGPSGTPVR
461 Photosystem I reaction center subunit IV, chloroplast precursor P12354 73 9.4/10.0 24.4/13.4 ESYWYK
TRYPVVVR
TRYPVVVR
YPVVVR
464 Cathepsin D inhibitor S10721 48 5.3/7.8 24.2/20.8 YNSDVGPSGTPVR
504 Pathogenesis-related protein P2 CAA41439 153 8.2/8.5 19.1/16.0 LDTNGLGYQR
VTNTGTGTQETVR
1
Experimental (Exp.) molecular mass (MM), expressed in kDa, and pI values were estimated with the ImageMaster 2D Elite program (GE Healthcare), using Bio-Rad Broad Range molecular
standards. Calculated (Calc.) MM and pI values were established with the Expasy 'PeptideMass' algorithm (http://ca.expasy.org/tools/pi_tool.html).
Chapitre 3 Caractérisation protéomique des sécrétions
orales du doryphore de la pomme de terre
 68

3.1 Résumé

Objectifs poursuivis

 Analyser la composition protéique des sécrétions orales du doryphore de la pomme de

terre par électrophorèse bidimensionnelle.

 Déterminer l‟origine des protéines contenues dans le régurgitant du doryphore.

 Identifier des éliciteurs protéiques potentiels dans le régurgitant du doryphore.

Les travaux réalisés dans le premier article ont clairement montré que le doryphore induisait une
réponse protéomique différente de celle induite par des blessures mécaniques chez la pomme de
terre, nous menant à l‟hypothèse selon laquelle les sécrétions orales de l‟insecte jouent un rôle
important dans la réponse de la plante hôte.

Il existe présentement très peu d‟informations sur la composition des sécrétions orales des
insectes herbivores, et encore moins sur celles du doryphore de la pomme de terre. Chez les
larves du lépidoptère Helicoverpa zea, les glandes salivaires contiennent une enzyme, la glucose
oxydase (GOX), qui joue un rôle très important dans l‟interaction avec la plante hôte (Musser et
al. 2002). Or, il s‟avère que la GOX représente un constituant majeur de la salive et des extraits
de glandes labiales chez H. zea (Eichenseer et al. 1999). Dans cette optique, nous voulions
explorer le contenu protéique des sécrétions orales du doryphore en utilisant notre expertise en
protéomique, afin d‟identifier les protéines majeures du régurgitant et des glandes salivaires de
l‟insecte. De plus, des travaux réalisés par Lawrence et collaborateurs (2007) laissaient présumer
que le régurgitant du doryphore de la pomme de terre contient un composé de poids moléculaire
entre 10 et 30 kDa ayant la capacité de moduler les réactions de défense de la pomme de terre.
 69

Son poids moléculaire suggérait que ce composé pouvait être une protéine, appuyant du même
fait la pertinence d‟une analyse protéomique du régurgitant de l‟insecte.

Nous avons, en premier lieu, entrepris des travaux préliminaires d‟anatomie sur des larves de
doryphore de stade 4 afin de prédire la provenance de la salive. Les larves du doryphore ne
possèdent pas d‟organe spécialisé dans l‟excrétion de la salive, qui permettraient de déduire à
priori le type de glandes présentes. En comparaison, les larves d‟H. zea possèdent une filière
(spinneret) attachée au labium (Musser et al. 2006), indiquant que cette structure sécrète
potentiellement le contenu des glandes labiales. Nous avons néanmoins pu établir, par dissection
sous microscope optique, que les larves de doryphore possédaient des glandes maxillaires très
développées.

En second lieu, nous avons procédé à l‟analyse protéomique du régurgitant du doryphore par
l‟électrophorèse 2-D couplée à la spectrométrie de masse. Nous avons ainsi pu comparer le
protéome du régurgitant à celui de feuilles de pomme de terre et à celui des glandes maxillaires
de l‟insecte. Comme il nous était impossible de récolter directement la salive produite par ces
glandes, nous avons procédé à l‟analyse des glandes entières. Cette étude a permis de mettre en
évidence la présence possible de plusieurs protéines végétales dans le régurgitant, qui montraient
de toute évidence une résistance à la protéolyse dans le système digestif de l‟insecte. La présence
de telles protéines est intéressante parce qu‟il a été montré que des protéines végétales ou des
fragments peptidiques stables de ces protéines dans le régurgitant peuvent agir comme éliciteurs
ou être impliqués dans la production d‟éliciteurs (Schmelz et al. 2006; Gaquerel et al. 2009). La
présence de protéines végétales dans le régurgitant a aussi été confirmée directement par
spectrométrie de masse. L‟identification des spots majeurs sur les gels 2-D de régurgitant nous a
permis en outre de confirmer la prédominance des protéases digestives de l‟insecte dans ce fluide
biologique.
 70

Au terme des travaux réalisés dans cette partie du projet, il nous apparaissait clair que la fraction
végétale du régurgitant pouvait jouer un rôle important dans l‟interaction entre le doryphore et la
pomme de terre. Par conséquent, nous avons jugé pertinent d‟intégrer dans notre plan
expérimental ultérieur un traitement où serait ajouté un extrait de feuille de pomme de terre sur
des blessures mécaniques artificielles (Chapitre 4, plus loin).
 71

Short communication

Host plant proteins in the larval regurgitant of Colorado

potato beetle, Leptinotarsa decemlineata Say

Marc-Olivier Duceppe1, Conrad Cloutier2 and Dominique Michaud1

1
Département de phytologie/Centre de recherche en horticulture, Université Laval, Québec QC,
Canada

2
Département de biologie/Centre de recherche en horticulture, Université Laval, Québec QC,
Canada

Keywords: Colorado potato beetle, two-dimensional gel electrophoresis, salivary glands,

regurgitant, potato, mass spectrometry.

Correspondence: Dr. Dominique Michaud, Département de phytologie, Université Laval,

Pavillon des services (INAF), Québec (QC), Canada, G1V 0A6
 72

3.2 Abstract

The oral secretions of herbivorous insects contain various elicitors of plant defense responses,
including a number of proteins and peptides presumably derived from both the insect and the
host plant. Here we looked for the presence of potato plant (Solanum tuberosum) proteins in the
regurgitant of Colorado potato beetle (Leptinotarsa decemlineata) larvae actively ingesting leaf
tissues. The whole proteome of 4th-instar larvae regurgitant and the proteome of maxillary
(salivary) glands freshly isolated from 4th-instars were first resolved by two-dimensional gel
electrophoresis (2-DE), and then compared in silico with the proteome of “non-stressed”, healthy
potato leaves. Out of more than 900 protein spots detected on 2-D gels, very few, if any, of the
maxillary gland proteins could be confidently matched with proteins from the regurgitant. By
contrast, several proteins of the host plant were found under a stable form in the regurgitant,
including a peroxidase, a wound-inducible aspartic protease inhibitor and a thaumatin-like
pathogenesis-related protein. The occurrence of plant proteins in the regurgitant, concomitant
with the predominance of digestive Cys proteases known to efficiently digest leaf proteins in this
medium, points to the high structural stability of these proteins along the potato/potato beetle
continuum and a possible direct defensive role during insect feeding. It also makes plausible
recent hypotheses in the literature suggesting a role for plant-derived protein elicitors in host
plants responding to herbivorous insects.
 73

3.3 Introduction

The labial, maxillary and mandibular glands of insect arthropods produce saliva, which is then
secreted through specialized structures such as the spinneret, or through pores located in
mouthparts (Srivastava 1959; Musser et al. 2002). Different combinations of salivary glands are
found among insects, varying from one taxonomic group to another or during larval development
leading to pupal and adult stages. Larvae of the lepidopteran noctuid Helicoverpa zea, for
instance, secrete saliva from labial and mandibular glands (Musser et al. 2006), unlike larvae and
adults of the coleopteran chrysomelid Galeruca tanaceti possessing only maxillary glands
(Srivastava 1959). In the American aspen beetle Gonioctena americana, salivary glands are
present in larvae but absent in adults (Mason and Lawson 1981), similar to the mulberry
silkworm Bombyx mori bearing salivary glands at larval stages which undergo complete
disintegration during the pupal stages (Parthasarathy and Gopinathan 2005).

Little is still known about the exact composition and functions of saliva in insect chewing
herbivores, but significant progress has been achieved over the last decade towards the
identification of its main molecular constituents, especially in caterpillars. The presence of
several proteins in labial and mandibular glands of H. zea, in particular, has been reported in
several instances (Eichenseer et al. 1999; Liu et al. 2004; Peiffer and Felton 2005). The
mandibular glands of H. zea were also shown to contain different classes of lipid hydrocarbons,
including monoenes and a whole range of n- and methyl alkanes (Wroniszewska 1966; Howard
and Baker 2004). Many types of molecules are likely to be present, indeed, in the saliva of
herbivorous insects, to support its multiple physical and physiological roles including, among
others, mouthparts lubrication, plant tissue digestion, detoxification of dietary compounds, water
balance control, pH regulation, microbe control, defense against predators, and the elicitation of
various physiological responses in host plant tissues (Ribeiro 1995).
 74

During herbivory, oral secretions –or "regurgitant"– of the chewing insect leak out of the mouth
cavity and are deposited on the host plant at, or around, the wound sites (Peiffer and Felton
2009). Oral secretions are a complex mixture of saliva and reflux from the midgut, containing
digestive enzymes mixed with microbes, partly processed plant material, and secreted
constituents of accessory glands (Ribeiro 1995; Felton and Eichenseer 1999; Felton 2008). In
recent years, a number of molecules from the regurgitant were shown to strongly impact major
physiological processes in host plant tissues. 'Elicitors' acting as recognition and initiation signals
for defense responses in planta have been identified, as well as 'effectors' allowing the attacking
insect to circumvent, and eventually manipulate, host plant defenses (Felton and Tumlinson
2008).

Felton and Tumlinson (2008) have described four classes of elicitors in the regurgitant of insect
herbivores: (i) protein (e.g. enzyme) elicitors such as β-glucosidase from the caterpillar Pieris
brassicae interacting with cabbage (Brassica oleracea) (Mattiacci et al. 1995); (ii) fatty acid-
amino acid conjugates such as volicitin, isolated from the oral secretions of Spodoptera exigua
larvae (Alborn et al. 1997; Alborn et al. 2000; Halitschke et al. 2001); (iii) peptide elicitors such
as inceptin, a disulfid-bridged peptide in the oral secretions of Spodoptera frugiperda larvae
derived from a chloroplastic ATP synthase of the host plant leaves (Schmelz et al. 2006); and
(iv) fatty acids elicitors, the cæliferins, isolated from the oral secretions of grasshoppers (Alborn
et al. 2007). The oxylipin 2-hydroxyoctadecatrienoic acid, a fatty acid derivative, has been
identified, recently, as a new type of regurgitant elicitor (Gaquerel et al. 2009). This compound,
produced from plant leaf linolenic acid in M. sexta larvae by the action of a leaf α-dioxygenase
reaching the midgut after leaf tissue ingestion, would enable the host plant to monitor the
progression of herbivory and sustain the deployment of defense responses via the production of
jasmonic acid (Gaquerel et al. 2009).

By contrast, a number of metabolic effectors in the regurgitant of insect herbivores were shown
to interfere with the induction of host plant defenses. A well described example is glucose
oxidase from the labial glands of H. zea larvae (Eichenseer et al. 1999), which prevents the
 75

accumulation of wound-inducible toxins in leaf tissues (Musser et al. 2002). Other examples are
the saliva of the lepidopteran caterpillar Heliothis virescens reducing the production of defense-
related volatiles in tobacco (Delphia et al. 2006), and regurgitant fractions of the coleopteran
herbivore Colorado potato beetle (Leptinotarsa decemlineata) inhibiting the expression of
wound-inducible serine proteinase inhibitors in wounded tomato leaves (Lawrence et al. 2007).
An objective of the present study was to provide a first image of the regurgitant proteome of
Colorado potato beetle larvae, taking into account the strong and specific impact of this insect on
the transcriptome and proteome profiles of potato leaves (Lawrence et al. 2008; Duceppe et al.
2010b) and the downregulating effects of high-molecular-weight compound(s) in the regurgitant
affecting the expression of defense proteins in planta (Lawrence et al. 2007). A second objective
was to look for the presence of plant proteins or protein fragments in the same source material, in
view of recent hypotheses in the literature suggesting a role for plant-derived molecules,
including proteins, in the elicitation of plant defenses by herbivorous insect oral secretions
(Schmelz et al. 2006; Gaquerel et al. 2009).

3.4 Results and discussion

3.4.1 Salivary glands of Colorado potato beetle larvae

Dissection work was first conducted to gain some basic information about the overall structure of
potato beetle salivary glands, and to assess the feasibility of isolating these glands as source
material for comparative proteome analyses. Dissection of 4th-instar larvae revealed the presence
of long, hyper-developed maxillary glands (Figure 3.1A) running along the dorsal side of the
insect to reach the end of the abdomen. Each gland consisted of a long, usually unbranched
multicellular salivary duct (Figure 3.1B). No labial glands were observed, as also reported for
other Chrysomelidae larvae (e.g. Srivastava 1959).
 76

Figure 3.1 Optical microscope images for the maxillary glands of Colorado potato beetle 4th-
instar larvae.
Panel A is an overview of maxillary glands still attached to the insect's head. Panel B illustrates
the general architecture of isolated maxillary glands, forming a long multicellular salivary duct.

3.4.2 Insect and plant proteins in the regurgitant of potato beetle larvae

A comparative proteomic study was then carried out with protein extracts of maxillary glands,
potato beetle larva regurgitant, and whole potato leaves to produce a first image of the beetle‟s
regurgitant proteome, and to determine the origin of the constituent proteins (Figure 3.2).
Overall, 711 protein spots were detected in protein extract of the regurgitant following two-
dimensional gel electrophoresis (2-DE), compared to 921 and 682 spots in the extract of larval
maxillary glands and potato leaves, respectively. Unexpectedly, no protein resolved on 2-D gels
for the maxillary glands could be confidently matched with proteins of the regurgitant, in sharp
contrast with several plant protein spots detected on both the leaf and regurgitant proteome maps
(see square boxes a to d on Figure 3.2). A very high dissimilarity between the regurgitant and
salivary gland proteomes, as also observed earlier for the lepidopteran caterpillar H. zea (Liu et
al. 2004; Peiffer and Felton 2005), might explain the absence of detectable overlap between the
two proteome maps. It is difficult to estimate the relative abundance of saliva (secreted) proteins
in whole protein extracts of salivary glands, and thus a masking effect during electrophoresis due
 77

to the predominance of structural, non secreted proteins cannot be excluded. Technical

constraints might also explain our observations, including the deficient extraction of some major
proteins under acidic conditions as observed for ribulose 1,5-bisphosphate carboxylase
oxygenase in potato leaf extracts (Goulet et al. 2010a), or a selective and rapid turnover of these
proteins in the regurgitant before sample collection or in vitro during the extraction process.
 78

Figure 3.2 Representative 2-D gels for potato leaf proteome and the proteome of larval Colorado
potato beetle regurgitant and maxillary glands.
Alphanumeric codes refer to proteins identified by mass spectrometry (see Table 3.1,
Supplementary Tables 3.1 and 3.2). Numbers (e.g. Spot 426) on 2-D gels for the potato leaf
proteome refer to protein spots characterized earlier (see Duceppe et al. 2010b). Boxes a to d on
2-D gels for the insect regurgitant highlight gel areas displaying potato leaf proteins.
 79

Table 3.1 Insect and plant protein spots identified by MS (see Figure 3.2 for spot naming).

Sample source Spot Protein NCBI Source data No. matches Coverage MM pI
Accession No. Exp./Calc.2 Exp./Calc.2
Beetle salivary G1 Disulfide isomerase XP_001950073 MS/MS 2 3% 62.8/57.3 8.5/4.8
glands G2 β-tubulin AAB84297 MS/MS 7 17% 60.6/50.2 4.8/4.8
G3 ATPase β EAL29273 MS/MS, SELDI 5, 9 29%, 28% 56.4/54.3 5.0/5.1
G4 Cathepsin D AAL51056 MS/MS 1 2% 31.4/42.3 4.9/6.9
G5 Glutathione S-transferase S4 NP_001136128 MS/MS 1 6% 27.7/23.6 6.9/8.4
G6 Moj29, similar to cyclophilin AAZ42765 MS/MS 3 22% 25.5/18.1 8.5/9.0
G7 Cytoplasmic actin type 5 AAQ18433 SELDI 10 33% 47.8/41.8 5.3/5.3
Beetle regurgitant R1 Digestive cysteine protease intestain AAN77406 MS/MS 1 5% 34.6/21.6 4.2/4.6
R2 No hits MS/MS - - 33.3/- 4.2/-
R3 Digestive cysteine protease intestain AAN77406 MS/MS 1 5% 33.1/21.6 4.4/4.6
R4 Digestive cysteine protease intestain ABM55485 SELDI 5 61% 30.9/23.5 5.1/7.8
R5 Digestive cysteine protease intestain AAS20591 SELDI 7 34% 29.8/36.3 5.6/5.7
R6 Digestive cysteine protease intestain ABM55485 SELDI 5 61% 30.1/23.5 6.1/7.8
R7 Thaumatine-like protein AAU95244 SELDI 7 52% 28.1/25.0 4.6/5.3
Potato leaves P1 Peroxidase AAK52084 SELDI 13 35% 48.7/39.1 8.0/6.0
426 Aspartic protease inhibitor 3 P58518 MALDI1 4 32% 24.4/15.2 9.4/9.7

1
See proteomic data in Duceppe et al. (2010b).
2
Experimental (Exp.) molecular mass (MM), expressed in kDa, and pI values were estimated with the ImageMaster 2D Elite program (GE Healthcare), using Bio-Rad Broad
Range molecular standards. Calculated (Calc.) MM and pI values were established with the Expasy 'PeptideMass' algorithm (http://ca.expasy.org/tools/pi_tool.html).
 80

Protein spot overlap in the leaf and regurgitant proteomes, in line with the detection of plant
proteins in the frass of M. sexta larvae (Chen et al. 2007), was likely due to the selective stability
of some leaf proteins in the beetle midgut. Since regurgitant proteins were collected from
actively feeding larvae and immediately precipitated upon harvesting, small bite-size leaf pieces
and plant juice from chewing could have accounted, at least in part, for the presence of plant
proteins in regurgitant extracts. The small number of leaf proteins and the absence of naturally
abundant ones on 2-D gels of the regurgitant proteome, however, point instead to the very high
stability of some specific leaf proteins in the midgut environment, in contrast with the rapid and
efficient processing of most of them to fulfill dietary needs in amino acids (see Brunelle et al.
1999). Plant proteins and protein fragments resistant to midgut proteolysis could have defensive
roles in vivo, by directly interfering with digestion in the attacking herbivore midgut or, via the
regurgitant, by indirectly eliciting the activation of defense responses in wounded plant tissues.
Many studies, over the years, have reported the expression of antidigestive proteins such as
lectins (De Hoff et al. 2009), protease inhibitors (Valueva and Mosolov 2004) and -amylase
inhibitors (Franco et al. 2002) in plants undergoing herbivory, and the high stability of these
proteins in target insects has been documented in several instances (e.g. Bouchard et al. 2003).
Studies have also suggested a role for plant proteins and protein fragments in the elicitation of
plant defense responses upon herbivory (Heil 2009), which would act as metabolic effectors for
the biosynthesis of oxylipin elicitors (Gaquerel et al. 2009) or as feedback triggers for the
perception and activation of defense responses in planta (Schmelz et al. 2006; Schmelz et al.
2007).

3.4.3 Insect digestive proteases and plant defense proteins in the potato beetle
regurgitant

Mass spectrometry analyses were performed to identify a number of proteins in the three
biological samples assessed by 2-DE (Table 3.1, Supplementary Tables 3.1 and 3.2). With the
exception of a secreted cathepsin D-like protease likely involved in dietary protein digestion (see
Protein spot G4 on Figure 3.2) (Brunelle et al. 1999) and a glutathione S-transferase possibly
 81

involved in the mitigation of oxidative stresses (Spot G5 on Figure 3.2) (Fournier et al. 1992),
most proteins identified in potato beetle maxillary glands corresponded to non secreted
intracellular proteins exhibiting cell structure or metabolic functions. By contrast, five major
proteins in the insect regurgitant –out of seven selected for identification– corresponded to
secreted Cys proteases (Spots R1, R3, R4, R5 and R6), in line with the well documented
importance of these enzymes for leaf protein digestion in the midgut, together with cathepsin D
(Thie and Houseman 1990; Michaud et al. 1995; Brunelle et al. 1999). Interestingly, plant
proteins in the regurgitant included an aspartic protease inhibitor naturally induced in leaves
upon wounding (Spot 426: see Duceppe et al. 2010b) and active against potato beetle digestive
cathepsin D (Brunelle et al. 1999; Brunelle et al. 2004); and a thaumatin-like pathogenesis-
related protein with antinutritive properties (Spot R7) (Pierpoint et al. 1990). A plant peroxidase
was also detected (Spot P1), in accordance with a previous study reporting a systemic increase of
peroxidase activity in wounded potato leaves treated with potato beetle regurgitant (Kruzmane et
al. 2002). Plant peroxidases, in conjunction with hydrogen peroxide, catalyze the oxidation of
plant phenolics, which can then cause the irreversible denaturation of proteins, peptides and
amino acids and show toxic effects in the digestive tract of herbivore arthropods (Felton and
Duffey 1991).

Our data confirm, overall, the occurrence of plant proteins in the regurgitant of Colorado potato
beetle larvae, presumably acting as toxic or antinutritive proteins to lower the nutritional value of
plant tissues upon herbivory (Bi et al. 1997). The occurrence of protease-resistant leaf proteins in
the regurgitant is in agreement with recent hypotheses suggesting a role for plant proteins and
protein fragments in the elicitation of defense responses via the oral secretions of their
herbivorous enemies (Schmelz et al. 2006; Gaquerel et al. 2009; Heil 2009). It also underlines,
finally, the possible dynamic role of plant-derived compounds in plant–insect interactions, and
the relevance of designing experimental setups aimed at discriminating the effect of the insect
and plant components.
 82

3.5 Materials and methods

3.5.1 Plants and insects

Potato plants (Solanum tuberosum L., cv. Superior) were grown in greenhouse in 2-gallon
containing pots in a Promix BX substrate, watered as needed and fertilized once a week with 20-
20-20 in water adjusted at pH 5.8 with H3PO4. A 14/10 h L:D photoperiod and a 24oC /18oC L:D
thermoperiod were maintained in the greenhouse throughout the experiments. Supplemental
lighting using high pressure sodium lamps was also provided, since the plants were grown in
October and November.

3.5.2 Sample collection

Leaf tissue for 2-DE was collected from the 4th upper leaf of a healthy 30 days-old potato plants
using a razor blade, ground to a fine powder in liquid nitrogen, and kept at –80oC until further
analysis. To harvest the regurgitant, CPB larvae were held inverted and oral secretions were
forced out by applying a gentle pressure with the tip of the micropipette on the ventral side of the
thoracic region. The ejected slurry was then aspirated with the micropipette. Insect regurgitant
samples was collected from three 4th-instar larvae starved for 12 h and then allowed to feed for 1
h on healthy unwounded potato plants. Maxillary glands were harvested by dissecting of 4th-
instar larvae in Pringle's saline solution (Pringle 1938). Exposed glands still attached to the head
were pinched with tweezers close to their attachment point, torn off the insect, quickly rinsed in
fresh Pringle's saline solution, and collected in a microcentrifuge tube containing 1 mL of ice-
cold 10% (w/v) trichloroacetic acid in acetone, supplemented with 0.07% (v/v) 2-
mercoaptoethanol. A total of 68 maxillary glands were pooled and homogenised by sonication
using a Branson 450 digital sonicator (Branson Ultrasonics, Danbury CT, USA). Sonication took
place for 20 s (1-s pulses, 1-s intervals) in ice-cold trichloroacetic-acetone, at 10% intensity.
 83

3.5.3 Sample preparation for 2-DE

The protein extraction procedure for 2-DE were adapted from Damerval et al. (1986). One mL of
ice-cold acetone containing 10% (w/v) trichloroacetic acid (TCA) and 0.07% (v/v) 2-
mercaptoethanol was added to the plant (300 mg of leaf tissue) and insect (60 µL of regurgitant
or 68 maxillary glands) samples, and incubated overnight at –20oC to allow for protein
precipitation. After centrifugation at 20,000 g for 26 min at 4oC, the supernatants were carefully
removed, and the pellets were washed with 1 mL of acetone supplemented with 0.07% (v/v) 2-
mercaptoethanol. The resulting mixtures were vortexed, incubated at –20oC for 10 min, and re-
centrifuged at 4oC to remove contaminants. After three washes, the pellets were dried in a fume
hood and solubilized overnight at room temperature in 350 µL of electrophoresis sample buffer
(8 M urea, 2% (v/v) CHAPS, 0.5% (v/v) IPG buffer pH 3-10, 60 mM dithiothreitol). The
samples were centrifuged for 20 min at 20,000 g, and the clear supernatants used as source
material for 2-DE. Protein concentration in the extracts was determined according to Ramagli
and Rodriguez (1985), using ovalbumin as a protein standard (Sigma, Oakville ON, Canada).

3.5.4 2-DE

2-DE first involved isoelectric focusing (IEF) (1st dimension), followed by 12% (w/v) SDS-
PAGE (2nd dimension). IEF was performed in 13-cm Immobiline DryStrip gel strips (GE
Healthcare, Baie d'Urfé QC, Canada) along a 3 to 10 pI gradient, with 250 µL [ca. 150 µg
protein] of sample per gel strip. Proteins were applied on the strips and resolved using an
IPGphor apparatus (GE Healthcare). The program for IEF involved the following sequential
steps: rehydration at 30 V for 12 h; 100 V for 1 h; 500 V for 1 h; 1,000 V for 1 h; 5,000 V for
1 h; and 8,000 V to reach 25,960 Vh. Following IEF, the strips were incubated twice for 20 min
in Tris-HCl equilibration buffer, pH 8.8, containing 6 M urea, 30% (v/v) glycerol, 2% (w/v) SDS
and 0.1% (w/v) dithiothreitol (or 5% (v/v) iodoacetamide for the second incubation), and used
 84

immediately for the second dimension. SDS-PAGE (Laemmli 1970) was performed at 30 mA in
1.5-mm thick polyacrylamide slab gels using the PROTEAN II xi Cell (Bio-Rad, Mississauga
ON, Canada), until the migration front reached the bottom of the gels. After migration, the gels
were fixed overnight in water containing 10% (v/v) acetic acid and 50% (v/v) ethanol. The
proteins resolved were stained with the Bio-Safe Coomassie Blue reagent (Bio-Rad), following
the supplier's instructions.

3.5.5 Gel image analysis

Comparative image analysis was carried out using the Phoretix 2-D Expression software, v2005
(NonLinear USA Inc, Durham NC, USA), after digitalizing the 2-D gels with an Amersham
Image Scanner digitalizer and the ImageMaster LabScan software, v3.0 (GE Healthcare).
Automatic spot detection was performed and manually edited as needed. Spots were matched
manually between gels of different sample types. Two independent 2-D gels were made for each
sample type. Proteins spots selected for identification were present in both gel replicates.

3.5.6 MS analyses and protein identification

Protein spots selected for identification were cut out manually from the gels, washed in Milli-Q
water, and incubated for 15 min in 250 µL of water/acetonitrile (1:1 v/v). After additional
washes in acetonitrile and 0.5 M NH4HCO3, the proteins were reduced with dithiothreitol,
alkylated with iodoacetamide, and digested with mass spectrometry (MS) grade Trypsin Gold
(Promega, Madison WI, USA) (Jensen et al. 1999). The peptides were extracted from gel slices
for 20 min with 2% (v/v) TFA in acetonitrile. The resulting solution was dried at 20oC in a
vacuum centrifuge, and reconstituted in 5 µL of 0.1% (v/v) TFA in 25% (v/v) acetonitrile. The
peptides were applied onto H4 ProteinChip surfaces (Bio-Rad, Mississauga ON, Canada) and
submitted to surface-enhanced laser desorption ionization time-of-flight (SELDI TOF) MS for
tryptic digest analysis as described earlier (Badri et al., 2009). Peptide mass fingerprints were
 85

used to search Viridiplantae (green plants) and Metazoa (Insects) entries of the National Center
for Biotechnology Information database (http://www.ncbi.nlm.nih.gov) using the Mascot
algorithm for protein identification (http://www.matrixscience.com), with the following criteria
for protein matching: peptide mass tolerance of 0.8 Da, carbamidomethylated Cys residues (fixed
modification) and Met residues in oxidized form (variable modification). Samples which could
not be identified with the SELDI mass fingerprints were sent to the Institute for Biomolecular
Design (Edmonton AB, Canada) for liquid chromatography (LC)-MS/MS analysis using an
electrospray ionization-ion trap mass spectrometer. Search parameters for NCBI database mining
with MS/MS data were as follows: carbamidomethylated Cys residues (fixed modification) and
Met residues in oxidized form (variable modification), peptide mass tolerance of ±1.5 Da,
fragment mass tolerance of ±0.8 Da, and a maximum of one missed cleavage. Protein
identifications were accepted when matching hits were significant at P<0.05, based on the
MOWSE score (Matrix Science, London, U.K.).

3.6 Acknowledgments

We thank Mr. Simon Boudreault for invaluable help with insect rearing, dissection and
microscopy. This work was funded by the Natural Science and Engineering Research Council of
Canada (NSERC). M.-O. Duceppe was the recipient of a NSERC postgraduate scholarship.
 86

Supplementary Table 3.1 SELDI-TOF MS identification of selected proteins from potato leaves, and from larval
Colorado beetle salivary glands and regurgitant.
See Figure 3.2 and Table 3.1 for protein spot numbering and biological function assignment.

Sample source Spot Protein NCBI Accession MOWSE MM pI Coverage Matched peptides (m/z)
No. score Exp./Calc.1 Exp./Calc.1

Salivary G7 Cytoplasmic actin type 5 AAQ18433 103 47.8/41.8 5.3/5.3 33% 794.96
glands 975.94
1131.99
1198.22
1548.83
1790.79
1954.02
1985.71
2231.11
2359.19
Regurgitant R4 Digestive cysteine protease intestain ABM55485 70 30.9/36.4 5.1/7.0 34% 508.71
798.92
939.94
994
1143.03
1432.56
1448.36
1813.73
2330.29
3024.3
R5 Digestive cysteine protease intestain AAS20591 80 29.8/36.3 5.6/5.7 34% 700.71
2960.42
4179.82
1229.11
1267.32
1157.20
1189.88
1
Experimental (Exp.) molecular mass (MM), expressed in kDa, and pI values were estimated with the ImageMaster 2D Elite program (GE Healthcare), using Bio-Rad Broad Range
molecular standards. Calculated (Calc.) MM and pI values were established with the Expasy 'PeptideMass' algorithm (http://ca.expasy.org/tools/pi_tool.html).
 87

Supplementary Table 3.1 SELDI TOF MS identification of selected proteins from potato leaves, and from larval
Colorado beetle salivary glands and regurgitant (Cont'd).

Source sample Spot Protein NCBI Accession MOWSE MM pI Coverage Matched peptides
No. score Exp./Calc.1 Exp./Calc.1 (m/z)
Regurgitant R6 Digestive cysteine protease intestain ABM55485 70 30.1/36.4 6.1/7.0 34% 508.71
798.92
939.94
994
1143.03
1432.56
1448.36
1813.73
2330.29
3024.3
R7 Putative thaumatine-like protein AAU95244 74 28.1/25.0 4.6/5.3 52% 1127.09
1451.62
1549.68
2041.18
2083.89
2230.59
2868.56
Potato leaves P1 Peroxidase AAK52084 68 48.7/39.1 8.0/6.0 35% 807.77
949.84
996.95
1089.96
1142.25
1324.53
1347.63
1617.14
1633.15
1659.83
1816.05
2114.09
2921.13
4262 Aspartic protease inhibitor 3 P58518 24.6/18.6 8.6/8.6 32% 1518.63
1348.62
1053.53
2061.91
1
Experimental (Exp.) molecular mass (MM), expressed in kDa, and pI values were estimated with the ImageMaster 2D Elite program (GE Healthcare), using Bio-Rad Broad
Range molecular standards. Calculated (Calc.) MM and pI values were established with the Expasy 'PeptideMass' algorithm (http://ca.expasy.org/tools/pi_tool.html).
2
See full proteomic data in Duceppe et al. (2010b).
 88

Supplementary Table 3.2 LC-MS/MS identification of selected proteins from potato beetle salivary glands, potato
beetle regurgitant and potato leaves.
See Figure 3.2 and Table 3.1 for protein spot numbering and biological function assignment.

Source sample Spot Protein NCBI Accession MOWSE MM pI Matched unique peptide sequences2
No. score Exp./Calc.1 Exp./Calc.1
Insect salivary G1 Disulfide isomerase XP_001950073 72 62.8/57.3 8.5/4.8 SHLLLFLSK
glands ILEFFGMKK
G2 β-tubulin AAB84297 394 60.6/50.2 4.8/4.8 TAVCDIPPR
IREEYPDR
NMMAACDPR
FPGQLNADLR
INVYYNEASGGK
AILVDLEPGTMDSVR
MSATFIGNSTAIQELFK
G3 ATPase β EAL29273 608 56.4/54.3 5.0/5.1 IGLFGGAGVGK
TIAMDGTEGLVR
IMNVIGEPIDER
FTQAGSEVSALLGR
VALTGLTVAEYFR
TVLIMELINNVAK
VALVYGQMNEPPGAR
VALVYGQMNEPPGAR
LVLEVAQHLGENTVR
FLSQPFQVAEVFTGHAGK
AIAELGIYPAVDPLDSTSR
G4 Cathepsin D AAL51056 51 31.4/42.3 4.9/6.9 FYTEFDLGNNR
G5 Glutathione S-transferase S4 NP_001136128 74 27.7/23.6 6.9/8.4 FLLSYGGVEFEDVR
G6 Cyclophilin AAZ42765 74 25.5/18.1 8.5/9.0 DFMIQGGDFTK
DTNGSQFFITTK
HYGAGWLSMANAGK
Insect regurgitant R1 Digestive cysteine protease intestain AAN77406 68 34.6/21.6 4.2/4.6 LLADEDELKK
R2 No hits 33.3/- 4.2/-
R3 Digestive cysteine protease intestain 80 33.1/21.6 4.4/4.6 LLADEDELKK
1
Experimental (Exp.) molecular mass (MM), expressed in kDa, and pI values were estimated with the ImageMaster 2D Elite program (GE Healthcare), using Bio-Rad Broad Range
molecular standards. Calculated (Calc.) MM and pI values were established with the Expasy 'PeptideMass' algorithm (http://ca.expasy.org/tools/pi_tool.html).
2
“M” represents oxidized methionin.
Chapitre 4 Efficacité photosynthétique de la pomme de
terre en réponse au doryphore de la pomme de terre
 90

4.1 Résumé

Objectifs poursuivis

 Valider l‟effet répresseur de l‟herbivorie par le doryphore sur les protéines

photosynthétiques de la pomme de terre par immunodétection (western blot), une
technique analytique complémentaire à l‟électrophorèse 2-D.

 Évaluer la nature systémique de la réponse « photosynthétique » de la pomme de terre au

doryphore de la pomme de terre.

 Mesurer l‟impact du doryphore de la pomme de terre sur l‟efficacité photosynthétique de

sa plante hôte.

Comme nous l‟avons montré dans le premier article, les insectes herbivores et les blessures
mécaniques induisent de nombreux changements dans l‟expression des gènes et des protéines
chez la plante de pomme de terre (réponses biochimiques). Certains de ces changements,
notamment une forte répression de plusieurs protéines photosynthétiques et des gènes encodant
ces protéines, nous laissaient alors croire qu‟ils n‟étaient pas sans répercussion sur le
métabolisme primaire de la plante hôte, en particulier sur son efficacité photosynthétique. En
revanche, il est bien connu que les plantes sont des organismes complexes qui possèdent une très
grande plasticité leur permettant d‟augmenter leur aptitude à survivre et à se reproduire sous des
conditions non optimales, ce qui pourrait contribuer à une certaine atténuation des effets notés à
l‟échelle physiologique.

Les travaux réalisés dans le cadre de ce troisième article étaient la suite logique des travaux
réalisés dans le premier, tenant compte aussi des résultats obtenus dans le second article lors de
la mise en place du dispositif expérimental. Plus spécifiquement, ces travaux visaient à
 91

caractériser la réponse photosynthétique de plants de pomme de terre au doryphore de la pomme

de terre, autant sur le plan biochimique que sur le plan physiologique. Une attention particulière
était portée à l‟importance des sécrétions orales de l‟insecte.

En comparaison avec le premier article, deux traitements supplémentaires ont été intégrés aux
expériences. Un premier traitement consistait à ajouter du régurgitant d‟insectes actifs sur des
blessures mécaniques artificielles. En comparant la réponse de la plante à ce traitement aux
réponses observées suite à des blessures mécaniques seules et à l‟herbivorie, il nous était
possible d‟évaluer ou d‟isoler l‟impact du régurgitant sur la photosynthèse.

Le second traitement additionnel consistait à ajouter un extrait homogénéisé de feuilles de

pomme de terre sur des blessures mécaniques. Ce traitement a été introduit suite à nos résultats
obtenus dans le cadre de l‟article du Chapitre 3, où nous avons montré que plusieurs protéines
des feuilles de pomme de terre ne sont pas dégradées dans le régurgitant du doryphore. Or, il est
connu que certaines protéines ou fragments peptidiques végétaux stables dans le régurgitant
peuvent agir comme éliciteurs ou être directement impliqués dans la production de ces composés
(Schmelz et al. 2006; Gaquerel et al. 2009). De telles molécules pourraient-elles expliquer les
résultats obtenus dans l‟article du Chapitre 2?

Nous avons donc jugé utile de déterminer l‟importance spécifique de la fraction végétale du
régurgitant de l‟insecte sur la réponse photosynthétique de la pomme de terre. Lorsqu‟un insecte
comme le doryphore se nourrit, les tissus foliaires de la plante sont broyés en fines particules et
le contenu cellulaire est exposé aux composantes digestives de l‟insecte. Les composés végétaux,
qui sont normalement isolés les uns des autres dans les cellules, sont désormais mélangés et
peuvent engendrer des interactions chimiques favorisant la production de nouvelles molécules
généralement absentes dans les cellules de la plante. Ces molécules, au contact des cellules
végétales blessées par l‟entremise du régurgitant, pourraient alors être reconnues comme des
 92

molécules étrangères par la plante, même si elles proviennent à l‟origine de ses propres tissus
(Heil 2009).

Techniquement, c‟est à l‟aide d‟anticorps spécifiques dirigés contre des protéines clés de la
chaîne photosynthétique et par des mesures de fluorescence et d‟échanges gazeux avec un
appareil de type LI-6400 (LI-COR Biosciences, Lincoln, NE, USA) que nous avons étudié
l‟efficacité photosynthétique de la pomme de terre en réponse au doryphore. Différents
paramètres photosynthétiques ont été mesurés à plusieurs reprises tout au long de l‟expérience,
nous permettant ainsi de caractériser l‟évolution du processus dans le temps en réponse aux
différents traitements. Concernant l‟immunodétection des protéines photosynthétiques, nous
avons aussi mesuré les quantités relatives de protéines testées dans les feuilles plus jeunes et plus
âgées, par rapport aux feuilles traitées. Ces mesures additionnelles devaient permettre de
confirmer ou d‟infirmer la nature systémique de la réponse observée. En ajoutant une seconde
dimension à nos analyses, nous pouvions ainsi tirer un maximum d‟informations de nos
expériences et répondre à des questions restées sans réponse suite aux travaux réalisés dans le
cadre de l‟article du Chapitre 2.

L‟utilisation d‟anticorps dirigés contre des protéines clés de la photosynthèse, incluant des
protéines qui se sont révélées fortement réprimées par le doryphore de la pomme de terre lors de
notre étude protéomique, nous a permis de mesurer l‟impact de l‟insecte herbivore sur des
composantes biochimiques spécifiques de la photosynthèse. En ciblant des protéines retrouvées à
toutes les étapes clés du processus photosynthétique, nous pouvions espérer dresser un portrait
plus global de l‟impact du doryphore (notamment de ses sécrétions orales) sur le métabolisme
primaire de sa plante hôte.

Seulement deux protéines photosynthétiques parmi les sept étudiées, soient la sous-unité beta de
l‟ATP synthétase (AtpB) et la protéine D1 du photosystème II (PsbA), ont varié
significativement en fonction des traitements. De manière générale, l‟addition de régurgitant et
 93

d‟extrait de feuilles de pomme de terre sur des blessures mécaniques a permis de restaurer en
partie les effets observés en réponse au doryphore. Ces résultats sont très intéressants parce
qu‟ils confirment l‟importance des sécrétions orales du doryphore dans la réponse de la pomme
de terre à l‟insecte, de même que l‟importance de la fraction végétale dans la réponse de la plante
au régurgitant, tel que suggéré au chapitre précédent.

Dans l‟article du Chapitre 2, nos résultats montraient que plusieurs protéines foliaires de la
pomme de terre étaient fortement réprimées en réponse au doryphore. Or, à notre grande
surprise, aucun de ces résultats n‟a été confirmé par immunodétection. Plusieurs des protéines
photosynthétiques étudiées dans cette étude sont présentes sous diverses variantes, ou isoformes,
dans les cellules végétales (Obokata et al. 1993; Perez-Bueno et al. 2004), qui peuvent être
détectées beaucoup plus facilement par électrophorèse 2-D (en comparaison avec
l‟électrophorèse 1-D, tel qu‟utilisée pour l‟immunodétection). Ces résultats suggèrent que
seulement certains isoformes spécifiques des protéines photosynthétiques préalablement
identifiées seraient affectés négativement suite à l‟attaque par le doryphore.

Les mesures de photosynthèse ont permis par ailleurs d‟évaluer l‟impact des traitements de stress
sur l‟état physiologique de la plante. Les courbes de réponse lumineuse et les mesures de
fluorescence (voir Annexe I Notions de base sur les mesures de photosynthèse pour plus de
détails) ont montré que l‟efficacité des processus associés à la captation de la lumière et à sa
transformation en énergie pour la plante n‟ont pas été affectés par nos traitements de stress. À
l‟opposé, les processus associés à la fixation du carbone atmosphérique et la production de
photosynthétats étaient variables en réponse aux traitements de stress. En somme, les résultats
des mesures d‟échanges gazeux appuyaient les résultats obtenus par immunodétection en ce qui a
trait à l‟importance des sécrétions orales du doryphore. Il est intéressant de noter que l‟ajout
d‟extrait de feuilles de pomme de terre sur des blessures mécaniques permettait, encore plus que
l‟ajout de régurgitant, de restaurer une réponse similaire chez la plante à celle observée avec le
traitement doryphore.
 94

En résumé, les résultats obtenus dans ce troisième article nous ont permis d‟avoir une vue
d‟ensemble globale des réponses de la pomme de terre aux stress. Plus particulièrement, ils ont
permis de mettre en évidence que certains changements biochimiques détectables à l‟échelle du
protéome sont plus importants que d‟autres quant à leur impact net sur la physiologie de la
plante.
 95

Insect regurgitant- and plant leaf-derived factors impact

photosynthesis in potato plants interacting with the
Colorado potato beetle

Marc-Olivier Duceppe1, Conrad Cloutier2, Yves Desjardins1 and Dominique Michaud1

1
Département de phytologie/Centre de recherche en horticulture, Université Laval, Québec QC,
Canada

2
Département de biologie/Centre de recherche en horticulture, Université Laval, Québec QC,
Canada

Keywords: Photosynthesis, western blot, herbivory, potato, Colorado potato beetle, regurgitant,
plant sap, ATPase, rubisco, photosystem I, photosystem II.

Correspondence: Dr. Dominique Michaud, Département de phytologie, Université Laval,

Pavillon des services (INAF), Québec (QC), Canada, G1V 0A6
 96

4.2 Abstract

We recently described the differential effects of artificial wounding and Colorado potato beetle
feeding on the steady-state levels of photosynthesis-related proteins in potato leaves (Duceppe et
al. 2010; see Chapter 2, this thesis). Here we assessed the impact of these stress conditions at the
physiological level, to determine the impact of proteome alterations on photosynthetic
capabilities in leaves of the host plant. Quantitative immunodetection assays with polyclonal
antibodies directed against photosynthesis-related proteins were first conducted to further
characterize the impact of wounding and potato beetle feeding on key proteins of the
photosynthetic apparatus. Gas exchange and fluorescence measurements were then conducted to
evaluate the net impact of proteome alterations on various photosynthetic parameters.
Immunodetection assays revealed, in particular, an upregulation of the ATP synthase β subunit in
both insect-treated leaves and wounded leaves treated either with regurgitant of the herbivore or
with a crude preparation of the host plant's leaves. By contrast, the photosystem I structural
protein PsaD was found at lower levels in insect-treated leaves and wounded leaves treated with
leaf fluid, while remaining unaltered in control and wounded leaves complemented or not with
the insect regurgitant. Light response curves and fluorescence parameters, including light-
saturated assimilation rate (Amax), dark respiration rate, light compensation and saturation points,
and quantum efficiency (QE), remained unchanged up to 24 h after initiating the stress
treatments. By contrast, CO2 response curves showed triose phosphate use (TPU) and the
maximum rate of carboxylation by rubisco (Vcmax) to be strongly affected by wounding.
Interestingly, insect regurgitant and/or plant leaf extract applied to the wounds tempered, or even
inverted, the repressing effects of wounding, similar to potato beetle feeding having little effect
on the two parameters. These observations suggest, overall, a significant impact for insect
regurgitant- and plant leaf-derived compounds in planta, instrumental in shaping metabolic and
physiological responses in potato plants interacting with the Colorado potato beetle.
 97

4.3 Introduction

Leaf tissue damage by insect herbivores may reduce crop yields both directly by the removal of
photosynthetic surfaces, and indirectly by repressing photosynthesis in the remaining tissues
(Nabity et al. 2008). The indirect effects of insect herbivory can be important, as notably
illustrated with the wild parsnip (Pastinaca sativa)-cabbage looper (Trichoplusia ni) interaction
leading to a 20% reduction of photosynthesis for a leaf area reduction of only 5% (Zangerl et al.
2002). Genomic studies have underlined, over the last decade, the impaired expression of several
photosynthesis-related genes in plants undergoing insect herbivory or challenged with
herbivore‟s oral secretions. Hermsmeier et al. (2001), for instance, reported the downregulation
of photosynthesis-related mRNA transcripts in leaves of wild tobacco Nicotiana attenuata
attacked by larvae of the sphinx moth Manduca sexta, in sharp contrast with defense-related
genes showing a strong overexpression. Decreased levels of photosynthesis-related mRNA
transcripts were also observed in wounded potato (Solanum tuberosum) leaves treated with
Colorado potato beetle (Leptinotarsa decemlineata) regurgitant, unlike several stress/defense-
related genes being significantly upregulated (Lawrence et al. 2008). Contrasting effects of
herbivory on photosynthesis- and defense-related genes were also observed at the proteome
level, as illustrated, again, with the N. attenuata-M. sexta and potato-Colorado potato beetle
systems (Giri et al. 2006; Duceppe et al. 2010b).

Much progress has been made over the last decade towards understanding metabolic processes in
plants subjected to herbivore attack, but the underlying mechanisms altering photosynthesis and
other primary metabolism processes are complex and remain mostly unelucidated (Wu and
Baldwin 2010). Conclusions drawn from large-scale gene and protein expression studies clearly
point to an important reconfiguration of primary metabolic functions in planta, partly dependent
on the herbivore feeding guild (Nabity et al. 2008). On the other hand, the responses observed
are highly variable and specific to the plant-insect interaction established. It has been proposed,
for instance, that insect herbivores feeding on specific tissues have a net repressing effect on
photosynthesis while non-specialist defoliating herbivores would have little impact (Nabity et al.
 98

2008), but a diversity of scenarios have been described for similar plant-insect interactions,
leading for instance to either increased (e.g. Thomson et al. 2003) and decreased (e.g. Tang et al.
2006) photosynthetic rates in response to defoliation. Schwachtje and Baldwin (2008) have
proposed four overlapping, non-exclusive explanations for the reconfiguration of host plant
primary metabolism upon herbivore attack, involving: (1) metabolic trade-offs diverting energy
and carbon resources towards the establishment of defense responses; (2) adjustment of sink-
source relationships to reallocate carbon resources towards healthy organs and tissues
(Schwachtje et al. 2006); (3) induced changes in primary metabolism balances having, per se, a
defensive impact; and (4) the biosynthesis of primary metabolites acting as molecular signals in
the defense response. The relative balance of these metabolic changes in host plant tissues and
organs would determine the net impacts observed, and contribute to explain the diversity of
possible responses in planta.

At the molecular level, several studies have underlined the determinant impact of insect oral
secretions and regurgitant on the responses observed (e.g. Korth and Dixon 1997; McCloud and
Baldwin 1997; Halitschke et al. 2001; Musser et al. 2002; Voelckel and Baldwin 2004; Thivierge
et al. 2010). Some studies reproduced herbivory-induced changes of the primary metabolism by
an ectopic application of herbivore regurgitant on artificially generated wounds (e.g. Lawrence et
al. 2008). Other studies described transcriptional changes in leaves triggered by specific
compounds of oral secretions, such as for instance fatty acid-amino acid conjugates from tobacco
hornworm M. sexta reproducing transcriptional changes observed in N. attenuata leaves upon
attack by the same insect (Halitschke et al. 2001; Halitschke et al. 2003). Another example for
the regulatory role of oral secretions on primary metabolism functions was provided by Delaney
et al. (2008), who showed a reduction of photosynthesis in common milkweed (Asclepias
syriaca) upon attack by the milkweed tussock moth (Euchaetes egle), which was stronger than
when artificially removing a comparable amount of leaf tissue. Our main objective, in the present
study, was to assess the effects of insect herbivore feeding on photosynthetic capacities of the
host plant, using potato and larvae of the Colorado potato beetle as a model. Recent genomic and
proteomic studies underlined the repressing effects of potato beetle feeding and regurgitant on
the steady-state levels of photosynthesis-related mRNA transcripts and proteins in potato leaves
 99

(Lawrence et al. 2008; Duceppe et al. 2010b). Here we combined quantitative immunodetection
assays with gas exchange measurements and the monitoring of photosynthetic fluorescence
parameters to evaluate the net impact of such herbivore-inducible gene and protein
downregulations on the photosynthetic capacities of potato leaves.

4.4 Results

4.4.1 Photosynthesis-related proteins are differentially regulated in wounded

and insect-treated leaves

Quantitative immunodetection assays were carried out to monitor the fate of photosynthesis-
related proteins in wounded and insect-treated potato leaves, using polyclonal antibodies specific
to seven key proteins of the photosynthesis machinery (Table 4.1; Figure 4.1). All seven proteins
were immunodetected at their predicted size, except the core subunit of photosystem I, PsaC,
exhibiting a higher molecular weight likely resulting from covalent binding to Fe-S-containing
proteins (agrisera.com). Four bands, presumably including stable proteolytic fragments, were
systematically detected in plant extracts for the ATP synthase β subunit (AtpB), compared to
single bands for the PSI-C (PsaC) and PSI-D (PsaD) subunits of photosystem I; two bands for
the large subunit of ribulose 1,5-bisphosphate carboxylase oxygenase (rubisco; RbcL) and the
PSI-E subunit of photosystem I (PsaE); three bands for the D1 core protein of photosystem II
(PsbA); and six bands for the 33-kDa subunit of photosystem II oxygen evolving complex
(PsbO).
 100

Table 4.1 Photosynthesis-related proteins monitored by quantitative immunodetection1.

Protein name Name code Theoretical Assigned biological function

weight (kDa)2

Large subunit of ribulose 1,5- RbcL 53 CO2 fixation in the Calvin cycle
bisphosphate carboxylase
oxygenase (rubisco)

β subunit of ATP synthase AtpB 54 Core component of the chloroplastic

ATPase complex; involved in ATP
synthesis

C core subunit of photosystem I PsaC 9 Core component of photosystem I;

coordination of Fe-S clusters

D subunit of photosystem I PsaD 20 Core subunit of photosystem I

E subunit of photosystem I PsaE 11 Component of photosystem I reaction

center; possibly involved in ferredoxin
reduction

Photosystem II subunit A (or D1 PsbA 38 Core component of photosystem II

protein)

33-kDa subunit of photosystem II PsbO 33 Extrinsic component of photosystem II

oxygen evolving complex water splitting protein complex

1
All polyclonal antibodies were from AgriSera Antibodies (Vannäs, Sweden).
2
Expected molecular weights for Arabidopsis thaliana, according to agrisera.com.
 101

Figure 4.1 Immunodetection patterns of photosynthesis-related proteins in control, healthy

potato plants.
Numbers on the left correspond to commercial molecular weight markers; band numbers were
assigned to each protein band detected (see numbers on the right of each lane). AtpB, ATP
synthase β subunit; PsaC, core subunit C of photosystem I; PsaD, subunit D of photosystem I;
PsaE, subunit E of photosystem I; PsbA, subunit A of photosystem II; PsbO, 33-kDa subunit of
photosystem II oxygen evolving complex; RbcL, large subunit of ribulose 1,5-bisphosphate
carboxylase oxygenase.

Densitometric analyses were performed on the immunodetected protein bands to compare their
relative levels in control, mechanically wounded and insect-treated leaves (Table 4.2). Five
proteins, out of seven, showed unaltered band patterns compared to control leaves (ANOVA;
P<0.05), unlike AtpB and PsbA responding to stress treatments in a stress-specific manner
(Figure 4.2A). The ATPase β subunit was upregulated in wounded leaves complemented with
insect regurgitant or leaf fluid, but remained unaffected in wounded and insect-treated leaves. By
contrast, the D1 (PsbA) protein was downregulated in insect-treated leaves and wounded leaves
supplemented with leaf fluid, but showed unaltered levels in wounded leaves supplemented or
not with the insect regurgitant. All tested proteins were found at comparable levels in young
(Leaf 2), mature (Leaf 4; treated leaf) and older (Leaf 6) leaves, except AtpB showing increased
levels as a function of leaf age (Table 4.2; Figure 4.2B). No significant interactions were
 102

observed between leaf age/position (L) and stress treatment (T) effects for any of the proteins
tested (see 'sum' data, Table 4.2), thereby suggesting a similar response to stress treatments
throughout the plant, and thus a systemic induction (or repression) of AtpB and PsbA levels in
stress-responding leaves. Among the proteins exhibiting multiple band patterns, PsbO and AtpB
showed some inconsistencies in the number of bands detected from one sample to another (Table
4.3), dependent on leaf age at least in the latter case (Figure 4.2C).
 103

Table 4.2 Effects of leaf age/position and treatment on photosynthesis-related proteins in potato leaves.
See Figure 4.1 for protein band numbering. Data refer to P values comparing intensities of immunodetected bands (using the MIXED
procedure in SAS). Asterisks indicate significant differences (α=0.05). Band intensities were determined by densitometry using the
ImageMaster 2D Elite software.

AtpB PsbA PsaE

Band 1† Band 2 Band 3 Band 4 Band 1 Band 2† Band 3 Band1† Band 2
Effect Sum Sum Sum
(52kDa) (44.5kDa) (40kDa) (38kDa) (45kDa) (32kDa) (29kDa) (23kDa) (5.5kDa)
Leaf (L) 0.0004** 0.2730 0.0115* 0.0183* <.0001*** 0.0063* 0.7018 0.3036 0.6043 0.5200 0.5563 0.8164
Treatment (T) 0.0080** 0.0290* 0.6666 0.1287 0.0048** 0.6098 0.1564 0.2552 0.0152* 0.8692 0.2951 0.6768
Interaction L x T 0.2165 0.5759 0.6088 0.9821 0.1350 0.2595 0.7102 0.8309 0.6727 0.2990 0.0443* 0.1229

† Marks the protein band that matches the predicted mass.

Table 4.2 Effects of leaf age/position and treatment on photosynthesis-related proteins in potato leaves (Cont'd).

RbcL PsbO PsaD PsaC

Band 1† Band 2 Band 1† Band 2 Band 3 Band 4 Band 5 Band 6 Band 1 Band 1
Effect Sum Sum
(54kDa) (33kDa) (33kDa) (29kDa) (27kDa) (23.5kDa) (21.5kDa) (7.5kDa) (23kDa) (35kDa)
Leaf (L) 0.7880 0.8462 0.7541 0.9352 0.0095** 0.0670 <.0001*** 0.2192 0.0601 0.0865 0.8473 0.9498
Treatment (T) 0.4856 0.1020 0.3730 0.3923 0.2365 0.1652 0.7586 0.9061 0.9794 0.5005 0.5036 0.9212
Interaction L x T 0.6108 0.0368* 0.4261 0.0781 0.1758 0.1272 0.8969 0.1744 0.6028 0.1608 0.9004 0.2145

† Marks the protein band that matches the predicted mass.

 104

Figure 4.2 Effects of stress treatment and leaf age on steady-state levels of AtpB and PsbA in
potato leaves.
A, normalized levels of AtpB and PsbA in response to stress treatments (n=9). B, normalized
levels of AtpB in potato leaves 2, 4 and 6 (n=15). C, number of bands immunodetected with the
anti-AtpB antibodies in leaves 2, 4 and 6 (n=15). Each datum on this figure is the mean of three
independent (biological replicate) values ±SE. Bars with the same letter are not significantly
different (Student's t-test; P<0.05). C, control healthy leaves; W, wounded leaves; W+R,
wounded leaves supplemented with insect regurgitant; W+P, wounded leaves supplemented with
leaf fluid; CPB, leaves subjected to Colorado potato beetle herbivory.

Table 4.3 Variation in the number of AtpB and PsbO bands detected on immunoblots.
Data refer to P values comparing the number of immunodetected bands (using the GENMOD
procedure in SAS). Asterisk indicate a significant difference at α=0.05.

Effect AtpB PsbO

Treatment (T) 0.8647 0.7555
Leaf (L) 0.0151* 0.2280
Interaction T x L 0.4464 0.9895
 105

4.4.2 Wounding and potato beetle herbivory differentially impact

photosynthesis in potato leaves

A portable LI-COR system equipped with a fluorescence detection chamber was used to monitor
photosynthetic parameters in control and treated plants, 0, 3 and 24 h after initiating the
treatments. Light response curves were first produced to measure the impact of stress treatments
on maximum assimilation rate (Amax), quantum efficiency (QE), light compensation and
saturation points, and dark respiration rate (Table 4.4 and Supplementary Tables 4.1, 4.2 and
4.3). As indicated by the absence of significant stress treatment and treatment x time effects
(Table 4), these photosynthesis parameters were influenced only by the time variable, likely due
to fluctuations in environmental light conditions over 24 h. In a similar way, chlorophyll
fluorescence parameters related to photochemical reactions in photosystem II, including
maximum quantum efficiency of photosystem II (Fv/Fm), quantum yield of photosystem II
(φPSII), photochemical quenching (qp) and non-photochemical quenching (NQP), were not
influenced by the stress treatments (Table 4.5 and Supplementary Tables 4.4, 4.5 and 4.6),
despite a significant downregulation of protein D1 (PsbA) in leaves subjected to insect feeding or
treated with leaf fluid (see above).
 106

Table 4.4 Effects of time and treatment on photosynthetic parameters derived from light
response curves.
Data refer to P values for maximum assimilation rate (Amax), light compensation point (Light
Comp.), light saturation point (Light Sat.), dark respiration rate (Dark Resp.) and quantum
efficiency (QE) (using the MIXED procedure in SAS). Asterisks indicate significant differences
(α=0.05). Absolute data for these parameters are presented in Supplementary Tables 4.1, 4.2 and
4.3.

Effect Amax Light Comp. Light Sat. Dark Resp. QE

Time (t) 0.0180* 0.0331* 0.0576 0.0444* 0.2709
Treatment (T) 0.6179 0.1637 0.9896 0.2721 0.4977
Interaction t x T 0.3271 0.4800 0.1506 0.7980 0.7654

Table 4.5 Effects of time and treatment on fluorescence parameters inferred from data collected
with a LI-6400 system equipped with a fluorescence chamber.
Data refer to P values for maximum quantum efficiency of PSII photochemistry (Fv /Fm), PSII
maximum efficiency (Fv‟/Fm‟), PSII operating efficiency (φPSII), photochemical quenching of
fluorescence (qP) and non-photochemical quenching of fluorescence (NPQ) (using the MIXED
procedure in SAS). Asterisks indicate significant differences (α=0.05). Absolute data for these
parameters are presented in Supplementary Tables 4.4, 4.5 and 4.6.

Effect Fv/Fm Fv'/Fm' φPSII qP NPQ

Time (t) 0.1308 0.0198* 0.9297 0.0624 0.0014**
Treatment (T) 0.8258 0.3769 0.5224 0.5571 0.7759
Interaction t x T 0.3099 0.8479 0.8504 0.9238 0.7774

CO2 response (ACi) curves were produced to assess the impact of wounding and insect feeding
on maximum carboxylation rate allowed by rubisco (Vcmax), rate of photosynthetic electron
transport based on NADPH requirement (J), triose phosphate use (TPU), day respiration (Rd) and
mesophyll conductance (gm). Unlike J, Rd and gm showing comparable values in stressed and
control plants, Vcmax and TPU were both significantly affected by the stress treatments, but at
particular times (see significant 'time x treatment' interactions in Table 4.6 and Supplementary
Tables 4.7, 4.8 and 4.9). Wounded leaves exhibited Vcmax values decreased by 20 to 40%
compared to control leaves after 3 h and 24 h, in sharp contrast with insect-treated plants and
 107

wounded plants treated with leaf fluid or insect regurgitant exhibiting Vcmax values comparable
to, or higher than, those observed in control leaves. These contrasting responses to the wounding
treatments, also observed for TPU (Figure 4.3), were pointing to some insect regurgitant- and
plant-derived compound(s) inducing specific responses in planta.

Table 4.6 Effects of time and treatment on photosynthetic parameters derived from ACi curves.
Data refer to P values for maximum carboxylation rate allowed by rubisco (Vcmax), rate of
photosynthetic electron transport (based on NADPH requirement, J), triose phosphate use (TPU),
day respiration (Rd) and mesophyll conductance (gm). Asterisks indicate significant differences
(α=0.05). Absolute data for these parameters are presented in Supplementary Tables 4.7, 4.8 and
4.9.

Effect Vcmax TPU J Rd gm

Time (t) 0.5225 0.0633 0.2795 0.5922 0.2552
Treatment (T) 0.7004 0.6772 0.3317 0.2974 0.1836
Interaction t x T 0.0360* 0.0164* 0.5197 0.1431 0.3425
 108

Figure 4.3 Effects of stress treatment on Vcmax and TPU photosynthetic parameters in potato
leaves, 3 and 24 h after initiating the treatments.
Relative increases or decreases are presented, compared to corresponding values at time 0 (0%
increase/decrease). C, control healthy leaves; W, wounded leaves; W+R, wounded leaves
supplemented with insect regurgitant; W+P, wounded leaves supplemented with leaf fluid; CPB,
leaves subjected to Colorado potato beetle feeding.

4.5 Discussion

Several studies have reported downregulating effects of insect herbivory and/or insect oral
secretions on photosynthesis-related mRNA transcripts and protein levels in host plant leaves
(Hermsmeier et al. 2001; Halitschke et al. 2003; Hui et al. 2003; Izaguirre et al. 2003; e.g. Giri et
al. 2006; Lawrence et al. 2008; Duceppe et al. 2010b). Colorado potato beetle larvae and
regurgitant, for instance, were shown to repress the expression of several photosynthesis-related
genes in potato leaves, with a negative impact on several of the proteins encoded, including the β
subunit of chloroplastic ATP synthase and different photosystem I structural subunits (Lawrence
et al. 2008; Duceppe et al. 2010b). Our aim, in the present study, was to assess the resulting
impacts of such gene and protein downregulations at the physiological level, and to gain some
more insight about the influence of insect oral secretions on the responses observed in planta.
 109

Immunodetection assays were first conducted to assess the overall impact of wounding and
herbivory on key proteins of the photosynthetic machinery. Gas exchange and fluorescence
measurements were then carried out to measure the resulting effects of these stress conditions on
the host plant's photosynthetic capabilities.

Unexpectedly, given previous proteomic data suggesting the downregulating impact of Colorado
potato beetle herbivory on the steady-state levels of different photosystem I protein subunits
(Duceppe et al. 2010b), our quantitative immunodetection assays indicated a relatively small
impact of stress treatments on photosystem structural subunits in both treated and distal leaves,
concomitant with a null impact on photochemical processes leading to light capture and
utilization. Whereas, for instance, reduced levels of PsaD- and PsaE-encoding mRNA transcripts
in potato leaves subjected to potato beetle herbivory were previously associated with strongly
decreased signals of PsaD and PsaE protein spots on 2-D gels (Duceppe et al. 2010b),
immunodetections indicated unaltered steady-state levels for both proteins. Technical reasons
might explain this obvious discrepancy between the two studies, including in particular the high
resolution power of 2-DE compared to immunoassays relying on one-dimensional gel
electrophoresis; and the presence of stable protein degradation fragments in crude leaf protein
extracts, possibly dependent on the extraction conditions. Many photosynthetic proteins, such as
rubisco activase (Giri et al. 2006), the large subunit of rubisco (Hajduch et al. 2001; Giri et al.
2006; Yan et al. 2006) and several photosystem I and photosystem II subunits (Obokata et al.
1993; Perez-Bueno et al. 2004), are present as different isoforms in leaf tissues and thus are
potentially resolved as multiple protein spots on 2-D gels involving isoelectric focusing. Protein
fragmentation, generated either in planta under stress conditions (Hajduch et al. 2001; Yan et al.
2006) or as an artefact during protein extraction (Michaud and Asselin 1995), could also alter the
relative balance of protein species in leaf extracts and directly impact protein patterns observed
following electrophoresis. Immunodetections indicated no correlation between stress treatments
and the relative incidence of stable fragments in leaf extracts for any of the proteins monitored
(see Table 4.2), but the absence of specific fragments due to different extraction conditions
and/or proteolytic processes in vitro cannot be excluded. A 26-kDa fragment of rubisco large
subunit found at different levels in wounded and insect-treated potato leaf extracts following 2-
 110

DE (Duceppe et al. 2010b), for instance, was not detected here on the immunoblots, unlike a 33-
kDa species easily detected in all extracts.

Despite such technical limitations underlining the importance of integrated, multi-level

experimental strategies for a correct and realistic account of plant-insect interactions at the
physiological level, our data indicate a significant negative impact for Colorado potato beetle
oral secretions on photosynthetic [Calvin cycle-related] processes in potato plants, associated
with significantly altered levels of key proteins of the photosynthetic apparatus in leaf tissues.
Two proteins, out of seven selected, showed altered levels in treated leaves, dependent on the
stress exerted: the β subunit of ATP synthase, which directs ATP synthesis in the CF1
subcomplex of chloroplastic ATP synthase (Nelson and Ben-Shem 2004); and PsbA, a core
protein of photosystem II reaction center also known as protein D1, which interacts with several
cofactors of the electron transport chain in chloroplast thylakoids (Hankamer et al. 1997). The
ATP synthase β subunit, shown earlier to be repressed at the transcriptional level in N. attenuata
leaves treated with Manduca sexta regurgitant (Halitschke et al. 2003) or in potato leaves
subjected to potato beetle herbivory (Duceppe et al. 2010b), was upregulated in wounded leaves
supplemented with potato beetle regurgitant or plant fluid, while remaining stable in wounded
and potato beetle-damaged leaves. PsbA, characterized by a very high turnover rate (Singh 2000;
Nelson and Ben-Shem 2004) and naturally susceptible to proteolytic degradation under stress
conditions (Pandey and Yeo 2008), was downregulated in wounded leaves supplemented with
leaf fluid and in insect-treated leaves, while exhibiting unchanged levels in leaves supplemented
or not with insect regurgitant. These observations clearly suggest, overall, stress treatment-
specific responses in leaves, triggered by different components of the potato-potato beetle
system, including herbivore mediated molecules from, or derived from, the host plant itself.

On the other hand, the biological significance of these protein level alterations in planta and the
molecular determinants underlying the observed effects remain to be elucidated. The need for
abundant energy and carbon resources in plants actively responding to herbivore insects has been
proposed to explain the downregulation of photosynthesis-related genes and rapid turnover of
 111

photosynthetic proteins, including rubisco, in leaf tissues subjected to wounding, insect

herbivory or ectopic application of the 'wound hormone' jasmonic acid (Reinbothe et al. 1994;
Rakwal and Komatsu 2000; Hermsmeier et al. 2001; Schwachtje and Baldwin 2008). In the
present case, the negligible effects of wounding and potato beetle feeding on rubisco large
subunit levels in damaged and distal leaves, along with the null impact of these treatments on
photochemical reactions despite a significant downregulation of the D1 protein, suggest instead
the onset of compensatory mechanisms allowing for the loss of photosynthetic capacities to be
prevented. Additional studies will be welcome, in forthcoming years, to clarify this point and to
determine the impact of herbivory on sink-source relationships at the whole plant level. Studies
will also be welcome to identify insect- and/or plant-derived elicitors triggering gene expression
and metabolic changes in planta. The gene repressing effects of a high-molecular weight fraction
from the Colorado potato beetle regurgitant in wounded tomato leaves (Lawrence et al. 2007),
along with the presence of many proteins [including potato leaf proteins] under a stable form in
this biological medium (Duceppe et al. 2010a) and the significant impact of plant leaf fluid on
photosynthetic protein levels in wounded leaves (this study), suggest overall the involvement of
some insect- and/or plant-derived protein signals in vivo, as suggested earlier for a number of
plant hosts interacting with lepidopteran herbivores (Mattiacci et al. 1995; Musser et al. 2002;
Schmelz et al. 2006; Schmelz et al. 2007; Gaquerel et al. 2009).
 112

4.6 Materials and methods

4.6.1 Plants

Thirty days-old potato plants (Solanum tuberosum L., cv. Superior) grown in greenhouse were
used for the experiments. The plants were grown in 2-gallon containing pots in a Promix BX
substrate, watered as needed and fertilized once a week with 20-20-20 in water adjusted at pH
5.8 with H3PO4. A 14/10 h L:D photoperiod and a 24oC/18oC L:D thermoperiod were maintained
in the greenhouse throughout the experiments. Supplemental lighting using high pressure sodium
lamps was provided to counterbalance the short photoperiod in January and February, during
which the experiments were conducted.

4.6.2 Stress treatments

The study involved five treatments: (i) mechanical wounding with a razor blade; (ii) wounding as
in (i), supplemented with 3 µL of regurgitant from Colorado potato beetle (Leptinotarsa
decemlineata Say) larvae; (iii) wounding as in (i), supplemented with 3 µL of plant leaf juice;
(iv) defoliation for 24 h with 4th-instar Colorado potato beetle larvae; and (v) a 'no-stress' control
treatment with unchallenged, healthy potato plants. Treatment (i) consisted of three 1 cm-long
incisions with a sterile razor blade on a terminal leaflet of the plant's 4th upper leaf, followed by
the same treatment 1 h later on a 2nd terminal leaflets, then repeated after 2 h on the 3rd terminal
leaflets. The potato beetle treatment involved one 4th-instar larva reared on potato plants (cv.
Superior), placed for 24 h on the abaxial side of the 4th upper leaf and confined to this leaf using
a cage made of clear plastic glass and nylon. Potato beetle regurgitant for the 'wounding + insect
regurgitant' treatment was collected with a 20-µL micropipette, as described earlier (Duceppe et
al. 2010a), from 4th instars actively ingesting potato leaves (cv. Superior), clarified by
centrifugation for 2 min at 10,000 g, and applied immediately on fresh mechanical wounds. Leaf
juice for the 'wounding + leaf juice' treatment was obtained by grinding leaf tissues in liquid
 113

nitrogen and sonicating the resulting slurry for 20 s with a Digital Sonifier 450 ultrasonic cell
disrupter (Branson, Danbury CT, USA) equipped with a microtip. The plant sample was then
incubated at room temperature for 5 min to allow for the degradation and processing of
constituent chemicals, clarified by centrifugation for 2 min at 10,000 g, and applied immediately
on fresh wounds. The experiment was set up as a factorial design, with three plant replicates for
each treatment distributed randomly in the greenhouse. Cages for insect confinement were fixed
on all plants, including wounded and control plants, to avoid confounding effects due to the
experimental setup. The 2nd (young), 4th (treated) and 6th (older) upper leaves of all treated and
control plants were collected after 24 h, ground to a fine powder in liquid nitrogen, and kept at –
80oC until further analysis.

4.6.3 Leaf total proteins

Leaf proteins for immunodetection (see below) were extracted from leaf tissue ground to a fine
powder in liquid nitrogen. Five mL of leaf protein extraction buffer (100 mM Tris-HCl, pH 6.8,
containing 1 mM EDTA, 0.1% (w/v) sodium docecyl sulfate, 1% (v/v) dithiothreitol, 0.01%
(w/v) polyvinylpyrolidone and 1 mM phenylmethylsulfonyl fluoride) was added to 1 g of leaf
powder, and the mixture was incubated on ice for 15 min, with gentle agitation every 5 min. The
protein extracts were clarified by centrifugation at 20,000 g for 20 min at 4°C, and kept at –80°C
until use. Total proteins were assayed according to Bradford (1976), with bovine serum albumin
as a standard (Sigma-Aldrich, Oakville ON, Canada).

4.6.4 Immunodetections

Immunodetections were performed as described earlier (Towbin et al. 1979) following 10%
(w/v) SDS-PAGE (Laemmli 1970) and protein transfer onto nitrocellulose membranes using the
Bio-Rad Mini Trans-Blot system (Bio-Rad, Mississauga ON, U.S.A.). Polyclonal antibodies for
the photosynthesis-related proteins PsaC (Prod. No. AS04-042), PsaD (AS04-046), PsaE (AS04-
 114

047), PsbA (AS01-016), PsbO (A05-092), RbcL (AS01-017) and AtpB (AS03-030) were
purchased from Agrisera (Vännäs, Sweden). Antigen/antibody complexes were revealed on
Kodak Biomax films (Kodak, Rochester NY, U.S.A.) using peroxidase-conjugated goat anti-
chicken secondary antibodies and the Western Lightning immunodetection kit (Perkin Elmer
Life Sciences, Whaltham MA, U.S.A.) (Khalf et al. 2010), following the supplier's instructions.
Protein signals were quantified by densitometry with the Phoretix 2D Expression software,
v2005 (NonLinear USA Inc., Durham NC, USA), after digitalizing the membrane images with
an Amersham Image Scanner digitalizer and the ImageMaster LabScan software, v3.0 (GE
Healthcare, Baie d'Urfé QC, Canada).

4.6.5 Photosynthetic parameters

Photosynthetic parameters were monitored 0, 3 and 24 h post-treatments using a LI-6400

Portable Photosynthesis System equipped with a fluorescence chamber (LI-COR Inc., Lincoln
NE, U.S.A.). Net photosynthesis in potato leaves for the light response curves was measured at a
CO2 concentration of 500 µmol m-2 s-1 and varying light intensities of 1500, 1000, 500, 200, 100,
50, 20 and 0 µmol m-2 s-1 (parI). The leaves were allowed to adapt to each intensity for 120 s
before measurements. The Photosyn Assistant software, v1.1.2 was used to derive the light-
saturated (maximum) assimilation rate (Amax), the dark respiration rate (Dark Resp.), light
compensation (Light Comp.) and saturation points (Light Sat.), and quantum efficiency (QE).
Net photosynthesis for the ACi curves was measured at CO2 concentrations of 400, 300, 200,
100, 50, 400, 400, 600, 800 µmol mol-1 CO2, under a constant light intensity of 500 µmol m-2 s-1.
The leaves were allowed to adapt to every CO2 concentration for 120 s before measurements.
The maximum carboxylation rate allowed by rubisco (Vcmax), photosynthetic electron transport
rate (J, based on NADPH requirement), triose phosphate use (TPU), day respiration (Rd) and
mesophyll conductance (gm) parameters were inferred from the ACi curves as described by
Sharkey et al. (2007a). The F0 and Fm fluorescence parameters were measured with leaves
acclimated in the dark for 20 min. Fo' and Fm' were measured on leaves acclimated for 20 min at
400 µmol mol-1 CO2 concentration and a light intensity of 500 µmol m-2 s-1.
 115

4.7 Acknowledgments

We thank Mr. Simon Boudreault for invaluable help with insect rearing. This work was
supported by the Biocontrol Network, a research network from the Natural Science and
Engineering Research Council of Canada (NSERC). M.-O. Duceppe was the recipient of a
NSERC doctoral fellowship.
 116

Supplementary Table 4.1 “Treatment x time interaction” mean values (±SD) of potato photosynthetic parameters derived
from light response curves (n=3).
C, control healthy leaves; W, wounded leaves; W+P, wounded leaves supplemented with leaf fluid; W+R, wounded leaves
supplemented with insect regurgitant; CPB, leaves subjected to Colorado potato beetle herbivory.

C W W+P
0h 3h 24 h 0h 3h 24 h 0h 3h 24 h
Amax 23.6±4.3 19.8±2.6 22.7±3.7 24.3±6.4 24.3±2.4 25.2±1.4 24.5±4.7 17.2±4 20.9±2.5
Light Comp. 27.3±5.7 20.5±2.8 17.0±1.4 29.6±2.7 25.6±6.8 20.8±2 26.5±5.7 26.5±3.9 24.3±5.9
Light Sat. 486±84 412±53 453±55 436±43 453±52 468±19 470±78 367±49 451±88
Dark Resp. -1.40±0.27 -1.06±0.27 -0.88±0.09 -1.73±0.15 -1.48±0.49 -1.17±0.17 -1.46±0.3 -1.34±0.31 -1.24±0.42
QE 0.0515±0.0014 0.051±0.0065 0.052±0.0054 0.059±0.0089 0.0571±0.0056 0.0564±0.0034 0.0552±0.0039 0.0502±0.0054 0.0499±0.0072

Supplementary Table 4.1 “Treatment x time interaction” mean values (±SD) of potato
photosynthetic parameters derived from light response curves (n=3) (Cont'd).

W+R CPB
0h 3h 24 h 0h 3h 24 h
Amax 25.7±9.1 18.7±1.7 20.7±0.4 24.3±0.4 22.1±3.4 20.1±2.1
Light Comp. 20.0±8.8 22.4±6.6 20.2±5.5 25.9±3.6 30.7±5.6 22.8±3.3
Light Sat. 521±187 403±99 389±25 456±30 480±130 412±27
Dark Resp. -1.09±0.61 -1.17±0.48 -1.12±0.27 -1.48±0.31 -1.53±0.19 -1.18±0.22
QE 0.0519±0.0087 0.0506±0.0084 0.0561±0.002 0.0568±0.0052 0.0505±0.0078 0.0514±0.0025
 117

Supplementary Table 4.2 “Treatment effect” mean values (±SD) of potato photosynthetic
parameters derived from light response curves (n=9).
C, control healthy leaves; W, wounded leaves; W+P, wounded leaves supplemented with leaf
fluid; W+R, wounded leaves supplemented with insect regurgitant; CPB, leaves subjected to
Colorado potato beetle herbivory.

C W W+P W+R CPB

Amax 22±2 24.6±0.5 21.7±3.6 20.9±3.6 22.2±2.1
Light Comp. 21.6±5.2 25.3±4.4 20.9±1.3 25.8±1.3 26.5±4
Light Sat. 450±37 452±16 438±73 429±55 449±34
Dark Resp. -1.11±0.26 -1.46±0.28 -1.13±0.04 -1.34±0.11 -1.40±0.19
QE 0.0515±0.0005 0.0575±0.0013 0.0528±0.0029 0.0518±0.003 0.0529±0.0034

Supplementary Table 4.3 “Time effect” mean values (±SD) of potato photosynthetic parameters
derived from light response curves (n=15).

0h 3h 24 h
Amax 24.5±0.7 20.4±2.8 21.9±2.1
Light Comp. 25.9±3.6 25.1±3.9 21±2.8
Light Sat. 474±32 423±44 435±33
Dark Resp. -1.43±0.23 -1.32±0.2 -1.12±0.14
QE 0.0549±0.0032 0.0519±0.0029 0.0532±0.0029
 118

Supplementary Table 4.4 “Treatment x time interaction” mean values (±SD) of potato photosynthetic parameters derived
from fluorescence measurements (n=3).
C, control healthy leaves; W, wounded leaves; W+P, wounded leaves supplemented with leaf fluid; W+R, wounded leaves
supplemented with insect regurgitant; CPB, leaves subjected to Colorado potato beetle herbivory.

C W W+P
0h 3h 24 h 0h 3h 24 h 0h 3h 24 h
Fv/Fm 0.814±0.011 0.805±0.011 0.824±0.010 0.813±0.006 0.807±0.015 0.814±0.005 0.782±0.040 0.805±0.022 0.81±0.010
Fv'/Fm' 0.728±0.009 0.708±0.026 0.703±0.034 0.714±0.026 0.687±0.022 0.712±0.019 0.696±0.027 0.691±0.021 0.687±0.020
φPSII 0.595±0.045 0.581±0.018 0.583±0.035 0.583±0.011 0.587±0.023 0.588±0.015 0.565±0.009 0.581±0.027 0.577±0.027
qP 0.816±0.053 0.821±0.007 0.829±0.023 0.816±0.022 0.854±0.007 0.826±0.038 0.812±0.028 0.841±0.022 0.84±0.0180
NPQ 0.284±0.054 0.408±0.120 0.566±0.248 0.401±0.074 0.621±0.316 0.401±0.163 0.394±0.091 0.610±0.266 0.634±0.229

Supplementary Table 4.4 “Treatment x time interaction” mean values (±SD) of

photosynthetic parameters derived from fluorescence measurements (n=3) (Cont'd).

W+R CPB
0h 3h 24 h 0h 3h 24 h
Fv/Fm 0.805±0.012 0.810±0.006 0.818±0.01 0.800±0.022 0.804±0.072 0.792±0.024
Fv'/Fm' 0.724±0.009 0.689±0.021 0.689±0.022 0.723±0.026 0.701±0.017 0.700±0.006
φPSII 0.573±0.029 0.557±0.018 0.556±0.017 0.587±0.027 0.584±0.038 0.591±0.003
qP 0.792±0.038 0.809±0.027 0.807±0.022 0.813±0.036 0.833±0.066 0.844±0.004
NPQ 0.296±0.035 0.573±0.236 0.610±0.27 0.354±0.128 0.702±0.484 0.512±0.046
 119

Supplementary Table 4.5 “Treatment effect” mean values (±SD) of photosynthetic parameters
derived from fluorescence measurements (n=9).
C, control healthy leaves; W, wounded leaves; W+P, wounded leaves supplemented with leaf
fluid; W+R, wounded leaves supplemented with insect regurgitant; CPB, leaves subjected to
Colorado potato beetle herbivory.

C W W+P W+R CPB

Fv/Fm 0.814±0.012 0.811±0.009 0.799±0.027 0.811±0.010 0.799±0.040
Fv'/Fm' 0.713±0.025 0.704±0.023 0.691±0.020 0.701±0.023 0.708±0.019
φPSII 0.586±0.031 0.586±0.015 0.574±0.021 0.562±0.021 0.587±0.024
qP 0.822±0.030 0.832±0.028 0.831±0.025 0.803±0.027 0.830±0.040
NPQ 0.419±0.186 0.474±0.213 0.546±0.215 0.493±0.233 0.523±0.293

Supplementary Table 4.6 “Time effect” mean values (±SD) of photosynthetic parameters
derived from fluorescence measurements (n=15).

0h 3h 24 h
Fv/Fm 0.803±0.022 0.806±0.030 0.812±0.016
Fv'/Fm' 0.717±0.021 0.695±0.020 0.698±0.021
φPSII 0.581±0.026 0.578±0.025 0.579±0.023
qP 0.810±0.032 0.832±0.033 0.829±0.024
NPQ 0.346±0.086 0.583±0.279 0.545±0.195
 120

Supplementary Table 4.7 “Treatment x time interaction” mean values (±SD) of potato photosynthetic parameters derived from
CO2 response curves (n=3).
C, control healthy leaves; W, wounded leaves; W+P, wounded leaves supplemented with leaf fluid; W+R, wounded leaves
supplemented with insect regurgitant; CPB, leaves subjected to Colorado potato beetle herbivory.

C W W+P
0h 3h 24 h 0h 3h 24 h 0h 3h 24 h
Vcmax 116±24 118±13 113±12 144±5 116±11 91±5 100±8 124±25 139±29
TPU 10.7±0.8 11.6±0.7 11.6±1.1 13.2±0.9 11.5±0.5 10.9±0.8 10.9±1.1 11.4±1.4 11.1±1.3
J 157±10 163±4 165±21 189±12 170±12 162±12 161±24 169±21 165±26
Rd 4.37±1.27 6.36±0.64 6.11±0.86 8.04±1.98 6.65±1.25 5.51±1.32 6.28±2.11 7.7±1.81 7.94±1.89
gm 3.28±0.08 3.21±0.88 3.36±0.66 2.57±0.56 2.80±0.74 2.79±0.03 4.08±1.55 2.45±0.51 2.28±0.43

Supplementary Table 4.7 “Treatment x time interaction” mean values (±SD) of potato
photosynthetic parameters derived from CO2 response curves (n=3) (Cont'd).

W+R CPB
0h 3h 24 h 0h 3h 24 h
Amax 136±40 112±27 137±31 135±17 126±3 127±8
Light Comp. 12.6±0.7 10.9±1.1 11.4±0.8 12.2±0.6 11.7±0.5 11.3±0.1
Light Sat. 210±51 164±9 168±11 176±11 173±13 167±4
Dark Resp. 8.67±2.92 6.82±0.39 7.55±1.44 7.32±1.62 8.29±2.66 6.03±0.76
QE 2.27±1.22 2.15±0.38 2.71±0.66 3.19±0.42 2.27±0.64 2.65±0.51
 121

Supplementary Table 4.8 “Treatment effect” mean values (±SD) of potato photosynthetic
parameters derived from the CO2 response curves (n=9).
C, control healthy leaves; W, wounded leaves; W+P, wounded leaves supplemented with leaf
fluid; W+R, wounded leaves supplemented with insect regurgitant; CPB, leaves subjected to
Colorado potato beetle herbivory.

C W W+P W+R CPB

Vcmax 116±15 117±24 121±26 128±31 129±10
TPU 11.3±0.9 11.8±1.2 11.1±1.1 11.6±1.1 11.7±0.5
J 162±12 174±16 165±21 181±34 172±10
Rd 5.61±1.25 6.73±1.74 7.31±1.85 7.68±1.83 7.21±1.88
gm 3.28±0.56 2.72±0.48 2.94±1.21 2.38±0.76 2.71±0.61

Supplementary Table 4.9 “Time effect” mean values (±SD) of potato photosynthetic parameters
derived from CO2 response curves (n=15).

0h 3h 24 h
Vcmax 126±25 127±16 121±25
TPU 11.9±1.2 10.6±0.8 11.3±0.8
J 178±30 142±12 165±14
Rd 6.93±2.34 6.44±1.53 6.63±1.48
gm 3.08±1.02 2.58±0.68 2.76±0.56
Discussion générale et conclusion

Hypothèses de recherche

1. La sous-expression des protéines photosynthétiques observée chez la pomme de terre en

réponse au doryphore de la pomme de terre est orchestrée génétiquement.

2. Les sécrétions orales du doryphore de la pomme de terre jouent un rôle dans la réponse
observée chez sa plante hôte.

3. La réponse de la plante au traitement « doryphore » est systémique.

4. Le doryphore de la pomme de terre engendre un déséquilibre du processus

photosynthétique chez son hôte.

Ce projet de recherche visait à caractériser l‟interaction « pomme de terre – doryphore » par une
approche intégrée basée sur l‟utilisation de méthodes d‟analyse complémentaires. Le projet était
divisé en trois parties au cours desquelles nous avons d‟abord étudié la réponse de la pomme de
terre aux blessures mécaniques, au doryphore de la pomme de terre et au puceron de la pomme
de terre à l‟échelle protéomique. Nos résultats ont montré que ces différents traitements de stress
induisaient des réponses distinctes chez la plante hôte. Les résultats les plus intéressants de cette
première partie du projet indiquaient que plusieurs protéines associées à la photosynthèse étaient
fortement réprimées en réponse au doryphore, mais restaient inaltérées suite à des blessures
mécaniques. Comme les blessures mécaniques représentent un aspect dominant de l‟herbivorie,
ces résultats suggéraient que les sécrétions orales de l‟insecte avaient un rôle à jouer dans cette
réponse différentielle.
 123

Parmi les protéines photosynthétiques fortement réprimées par le doryphore se trouvaient

plusieurs protéines du PSI. En revanche, les quelques protéines du PSII identifiées sur les gels 2-
D restaient inchangées en réponse au même traitement. Cette divergence entre la réponse des
protéines du PSI et du PSII suggérait que des mécanismes de régulation spécifiques étaient
activés en réponse au doryphore chez la pomme de terre. En raison de cette spécificité, nous
avons alors émis l‟hypothèse selon laquelle la régulation des protéines photosynthétiques
s‟effectuait à l‟échelle de la transcription des gènes. Pour vérifier cette hypothèse, nous avons
étudié le motif d‟expression de plusieurs gènes photosynthétiques par PCR en temps réel. Les
résultats de cette analyse ont montré que les traitements « doryphore » et « blessures
mécaniques » réprimaient l‟expression de plusieurs gènes photosynthétiques, suggérant du même
fait que la réponse différentielle des protéines du PSI et du PSII au traitement « doryphore »
résultait de mécanismes de régulation post-transcriptionnels additionnels. En somme, ces
résultats confirmaient notre première hypothèse de recherche, selon laquelle l‟expression réduite
des gènes photosynthétiques en réponse au doryphore de la pomme de terre est orchestrée
génétiquement, du moins à la base. En parallèle, des mécanismes de régulation supplémentaires
devaient également être activés, puisque les motifs d‟expression protéique observés ne
correspondaient pas aux patrons d‟expression génétique.

Comme les sécrétions orales du doryphore semblaient jouer un rôle important dans l‟induction
des réponses « défensives » de sa plante hôte, nous voulions en connaître davantage sur leur
composition biochimique. Nous avons alors tiré profit de notre expertise en protéomique pour
établir une cartographie sommaire des protéines du régurgitant et des glandes salivaires du
doryphore de la pomme de terre. Durant cette deuxième partie du projet, nous avons montré que
plusieurs protéines foliaires des plants de pomme de terre étaient résistantes à la protéolyse dans
l‟appareil digestif du doryphore. Ces protéines ont été détectées sous forme intacte, autant dans
les feuilles que dans le régurgitant de l‟insecte. La résistance à la protéolyse est caractéristique de
plusieurs protéines de défense et de plusieurs éliciteurs protéiques des réactions de défense des
plantes (Schmelz et al. 2006; Gaquerel et al. 2009). Nos résultats laissaient alors envisager que
des protéines ou des peptides dans les sécrétions orales du doryphore pouvaient avoir un rôle
important à jouer dans la réponse de la plante à l‟insecte, en appui à notre deuxième hypothèse
 124

de recherche. Ces résultats suggéraient aussi que la fraction végétale du régurgitant pouvait
contribuer de manière significative au rôle des sécrétions orales dans la réponse de la plante, une
information utile pour l'élaboration des expériences subséquentes.

La troisième partie du projet de recherche visait à apporter des explications aux observations
faites précédemment, en particulier celles relatives à la sous-expression de plusieurs gènes et
protéines impliqués dans la photosynthèse. Pouvions-nous reproduire ces résultats par d‟autres
méthodes analytiques? Est-ce que les réponses observées étaient systémiques ou localisées au
site des blessures? Quel était l‟impact de ces bouleversements métaboliques observés à l‟échelle
protéomique et génétique sur la physiologie de la plante? Est-ce que l‟application de régurgitant
sur des blessures mécaniques était suffisante pour restaurer la réponse observée suite au
traitement doryphore? Quel était le pouvoir éliciteur de la fraction végétale du régurgitant?

Pour répondre à ces questions, nous avons élaboré un nouveau dispositif expérimental incluant
des traitements supplémentaires nous permettant d‟évaluer l‟effet du régurgitant du doryphore,
ainsi que l‟effet de la composante végétale du système. De plus, une composante « espace » a été
incluse, pour évaluer la nature systémique des traitements; de même qu‟une composante
« temps » afin de caractériser l‟évolution des réponses de la pomme de terre jusqu‟à 24 h après le
début des traitements.

Dans un premier temps, nous avons utilisé des anticorps spécifiques dirigés contre plusieurs
protéines photosynthétiques préalablement identifiées comme étant réprimées suite à l‟attaque
par le doryphore, dans le but de valider nos résultats de protéomique. À notre grande surprise,
aucun résultat obtenu suite à notre analyse sur gels 2-D n‟a pu être reproduit par
immunodétection. Cette différence était vraisemblablement attribuable au fait que
l‟électrophorèse 2-D permet de séparer beaucoup plus finement les différents isoformes d‟une
même protéine que la technique d‟immunodétection utilisée en parallèle. Ces résultats
suggéraient alors que le doryphore n‟induisait la répression que de certains isoformes des
 125

protéines photosynthétiques. L‟immunodétection des protéines photosynthétiques a aussi permis

d‟établir que la réponse des feuilles aux traitements de stress était systémique, puisque les
feuilles plus âgées et plus jeunes montraient des concentrations de ces protéines similaires aux
concentrations mesurées dans les feuilles traitées.

Pour compléter l‟étude, nous avons mesuré une série de paramètres photosynthétiques sur des
plantes témoins et les avons comparés à ceux de plantes soumises au doryphore ou à des
blessures mécaniques laissées à nu ou enduites de régurgitant récolté à partir d‟insectes actifs ou
d‟extrait de feuilles de pomme de terre. En bref, différents paramètres mesurés ou dérivés des
courbes de réponse lumineuse et des mesures de fluorescence n‟ont montré aucune évolution
dans le temps en réponse aux traitements de stress sur une période de 24 h. En revanche, certains
paramètres dérivés des courbes de réponse au CO2 ont montré des variations mesurables en
fonction des traitements. Par exemple, nos résultats ont montré que l‟addition d‟extraits de
feuilles de pommes de terre induisait une réponse similaire à celle induite par l‟insecte herbivore.
En somme, les mesures de photosynthèse ont montré que la phase thermochimique de la
photosynthèse était beaucoup plus sensible à l‟herbivorie que la phase photochimique.

Les travaux réalisés dans cette troisième partie du projet ont permis de confirmer nos trois
dernières hypothèses de recherche, c‟est-à-dire (1) de confirmer l‟importance des sécrétions
orales du doryphore dans la réponse de la pomme de terre à l‟insecte; (2) de montrer que le
doryphore engendrait un déséquilibre physiologique chez sa plante hôte en réduisant la
carboxylation des plantes attaquées; et (3) d‟établir que cette réponse était systémique,
probablement par un transfert d‟information dans la plante stressée à partir des feuilles traitées.

Au terme de ce projet de doctorat, il nous est maintenant possible de réunir et d‟intégrer les
résultats obtenus pour chacune des parties et d‟en tirer un certain nombre de conclusions plus
générales.
 126

Nos résultats suggèrent, en particulier, qu‟il n‟existe pas nécessairement de liens de causes à
effets entre les données biochimiques et les données physiologiques générées par différentes
approches. Par exemple, notre analyse protéomique montrait que plusieurs protéines du PSI
impliquées dans l‟arrimage de la ferrédoxine et dans sa réduction chimique étaient fortement
réprimées par le doryphore, laissant alors supposer que le transfert d‟électrons de la chaîne
photosynthétique pourrait être perturbé. Or, des mesures de photosynthèse ont montré que la
phase photochimique n‟était pas affectée par ce traitement. D‟un autre côté, notre analyse
protéomique initiale laissait croire que la rubisco était également diminuée ou fragmentée chez
les plantes attaquées par le doryphore, en accord cette fois avec l‟impact négatif observé sur la
phase thermochimique pour certains traitements. Nous avons noté, par ailleurs, qu‟il n‟y avait
pas nécessairement de lien entre la variation du nombre des transcrits d‟ARNm d‟un gène et la
variation de concentration de la protéine encodée par ce gène en réponse à un traitement de
stress, illustrant encore la complexité des questions abordées.

Pourquoi certaines données biochimiques peuvent-elles « prédire » la réponse physiologique

observée, tandis que d‟autres ne le peuvent pas? Nos résultats suggèrent, dans l‟ensemble, que la
plante dispose d‟un système de régulation très complexe pour la gestion de son métabolisme
primaire, impliquant probablement plusieurs mécanismes de compensation (Trumble et al.
1993), comme la tolérance (Schwachtje and Baldwin 2008). Des éléments plus techniques
pourraient aussi expliquer les divergences observées. Les données de l‟étude protéomique et
celles de l‟étude physiologique pour le traitement « doryphore », par exemple, sont dérivées
d‟expériences indépendantes. Peut-être aurait-il été judicieux de récolter le matériel végétal à la
fin des expériences de mesures de photosynthèse pour y refaire une analyse protéomique. De
cette façon, nous aurions eu en main deux ensembles plus cohérents de données complémentaires
sur le même matériel végétal. Nous avons confiance, néanmoins, en la rigueur de nos résultats
antérieurs.
 127

Un des objectifs de la troisième partie du projet était d‟évaluer le rôle des sécrétions orales du
doryphore dans la réponse de la pomme de terre. Il était fait mention, dans le Chapitre 1, de
l‟importance d‟avoir un bon traitement de référence pour isoler l‟effet des sécrétions orales de
l‟effet global des insectes défoliateurs. En pratique, le traitement de référence idéal consisterait à
utiliser un insecte totalement dépourvu de sécrétions de toutes sortes (salive, régurgitant,
excrément et autres glandes). Dans cette optique, nous avons étudié l‟anatomie et la morphologie
des larves du doryphore et avons rapidement conclu qu‟il serait virtuellement impossible de
bloquer les sécrétions orales de l‟insecte sans altérer son comportement alimentaire. De surcroît,
les travaux réalisés à cette étape du projet étaient basés sur des résultats antérieurs, où la réponse
de la pomme de terre au doryphore était comparée à un traitement « blessures mécaniques »
particulier. Afin de nous assurer d‟un maximum de reproductibilité des résultats et d‟une
concordance maximale entre nos expériences, nous avons jugé essentiel de conserver notre
traitement « blessures mécaniques » tel qu‟utilisé lors de notre étude protéomique.

En l‟absence d‟un traitement de référence idéal, il apparaît pertinent de nous interroger sur la
validité de notre traitement « blessures mécaniques » pour mesurer l‟effet des sécrétions orales
du doryphore. Une brève revue de la littérature scientifique sur le sujet révèle que la plupart des
études de ce genre utilisent un traitement de référence qui consiste à provoquer des blessures
mécaniques artificielles semblables à celles que nous avons effectuées, avec des outils et un
motif d‟exécution variables. Il serait intéressant d‟évaluer l‟impact de ces différents traitements
de blessures mécaniques afin d‟établir la robustesse et la reproductibilité des traitements
appliqués. Considérant l‟ensemble des résultats des articles du Chapitre 2 et du Chapitre 4, il
nous apparaît néanmoins clair que notre traitement « blessures mécaniques » a induit des
réponses distinctes chez la plante, par rapport au traitement « doryphore ». Nos traitements
« blessures mécaniques » ont permis de démontrer, en particulier, que le régurgitant du
doryphore modifiait la réponse de la plante, en comparaison aux blessures mécaniques seules. Ils
nous ont aussi permis de suggérer l‟importance de la fraction végétale du régurgitant dans la
réponse de la pomme de terre au doryphore.
 128

Dans l‟article du Chapitre 4, les courbes de réponse au CO2 et les analyses d‟immunodétection
ont montré qu‟en général, l‟application d‟extrait de feuille de pomme de terre induisait une
réponse proche de celle observée suite au traitement « doryphore, » voire plus proche de celle
observée suite à l‟application de régurgitant. Nos résultats montrent par exemple à la Figure 4.4
que les traitements « blessures», « blessures + extrait de feuille » et « doryphore » engendraient
une baisse de la vélocité maximale de carboxylation permise par la rubisco (Vcmax), en
comparaison au traitement témoin, tandis que le traitement « blessures + régurgitant » induisait
une hausse de ce paramètre. Aussi, les blessures mécaniques induisaient une baisse de Vcmax, tout
comme le doryphore. La différence d‟intensité de réponse pour ce paramètre en réponse à ces
deux traitements pourrait s‟expliquer, du moins en partie, par le fait qu‟ils infligent des stress
ayant un motif spatio-temporel différent. Mais alors, quel « facteur » pourrait renverser cette
réponse lorsque du régurgitant est appliqué sur les plaies, sachant que l‟application d‟extrait de
feuille n‟engendre pas ce renversement?

Il est possible que la quantité de régurgitant utilisée soit une cause directe de ces résultats.
Avons-nous utilisé une concentration de régurgitant fidèle aux conditions physiologiques? Les
quantités appliquées étaient basées sur des observations visuelles, mais il est possible que les
3 µL de matériel appliqués sur les coupures de 1 cm soient beaucoup plus que ce que l‟insecte
régurgite en conditions naturelles (Peiffer and Felton 2009). Peut-être qu‟à des concentrations
anormalement élevées, d‟autres mécanismes de défense sont activés en réponse au régurgitant,
favorisant alors l‟activation de mécanismes compensatoires. Afin d‟éviter ce genre d‟ambiguïté
dans de prochaines expériences, il serait bon de déterminer la quantité physiologique de
régurgitant appliqué par unité de temps consacré à l‟alimentation ou par unité de surface linéaire
consommée (Peiffer and Felton 2005).

Malgré ces questionnements, nos travaux indiquent que le régurgitant du doryphore est un
facteur important à considérer dans l‟interaction « pomme de terre – doryphore ». Il sera
important, dans les années à venir, de pousser plus loin les recherches afin de déterminer son
« mode d‟action ». De récents travaux ont montré, à cet effet, que le régurgitant du doryphore
 129

contenait un composé d‟une taille entre 10 et 30 kDa, potentiellement une protéine, montrant des
effets éliciteurs sur les réactions de défense de la pomme de terre (Lawrence et al. 2007). Nous
rapportons ici que le régurgitant du doryphore contient plusieurs dizaines de protéines avec un
poids moléculaire compris dans cet intervalle. Il sera alors intéressant, dans les années futures, de
procéder à une analyse protéomique détaillée de la fraction 10-30 kDa du régurgitant du
doryphore, qui pourrait mener à l‟identification d‟éliciteurs potentiels. Nos recherches ont aussi
montré que la fraction protéique du régurgitant du doryphore contient plusieurs protéines
d‟origine végétale qui pourraient servir éventuellement d‟éliciteurs. La reconnaissance du « non-
soi » semble être une stratégie répandue chez les plantes pour détecter l‟herbivorie (Heil 2009). Il
est possible que la pomme de terre ne fasse pas exception à cette « règle », mais seule
l‟élucidation des mécanismes de reconnaissance de l‟herbivorie chez la pomme de terre
permettra de répondre de manière plus éclairée à cette hypothèse.

Somme toute, et malgré une altération marquée de plusieurs protéines et gènes clés de la
photosynthèse, ce processus important dans la plante est demeuré peu affecté dans son ensemble,
sous nos conditions, soulignant l‟induction probable de mécanismes compensatoires et la grande
plasticité du métabolisme primaire en réponse au stress. Cette complexité des mécanismes de
défense des plantes est d‟ailleurs reflétée par l‟absence de consensus dans la littérature
scientifique quant à l‟effet des insectes défoliateurs sur les réponses de leurs plantes hôtes. Dans
cette optique, ce projet n‟apporte pas d‟éléments définitifs sur la question, mais documente en
partie, à tout le moins, l‟origine possible de ces divergences. Davantage de recherches devront
être effectuées, dans les années qui viennent, pour cerner l‟impact réel des insectes défoliateurs
sur le métabolisme de leurs plantes hôtes en conditions contrôlées comme en milieu naturel.
Références

A'Brook, J. and D. A. Benigno (1972). "The transmission of cocksfoot mottle and phleum mottle
viruses by Oulema melanopa and O. lichenis." Annals of Applied Biology. 72: 169-176.
Ahn, J. H. and J. S. Lee (2003). "Sugar acts as a regulatory signal on the wound-inducible
expression of SbHRGP3::GUS in transgenic plants." Plant Cell Reports. 22: 286-293.
Alborn, H. T., M. M. Brennan and J. H. Tumlinson (2003). "Differential activity and degradation
of plant volatile elicitors in regurgitant of tobacco hornworm (Manduca sexta) larvae."
Journal of Chemical Ecology. 29: 1357-1372.
Alborn, H. T., T. V. Hansen, T. H. Jones, D. C. Bennett, J. H. Tumlinson, E. A. Schmelz and P.
E. Teal (2007). "Disulfooxy fatty acids from the American bird grasshopper Schistocerca
americana, elicitors of plant volatiles." Proceedings of the National Academy of Sciences
of the United States of America. 104: 12976-12981.
Alborn, H. T., T. H. Jones, G. S. Stenhagen and J. H. Tumlinson (2000). "Identification and
synthesis of volicitin and related components from beet armyworm oral secretions."
Journal of Chemical Ecology. 26: 203-220.
Alborn, T., T. C. J. Turlings, T. H. Jones, G. Stenhagen, J. H. Loughrin and J. H. Tumlinson
(1997). "An elicitor of plant volatiles from beet armyworm oral secretion." Science. 276:
945-949.
Aldea, M., T. D. Frank and E. H. DeLucia (2006a). "A method for quantitative analysis of
spatially variable physiological processes across leaf surfaces." Photosynthesis Research.
90: 161-172.
Aldea, M., J. G. Hamilton, J. P. Resti, A. R. Zangerl, M. R. Berenba and E. H. DeLucia (2005).
"Indirect effects of insect herbivory on leaf gas exchange in soybean." Plant, Cell and
Environment. 28: 402-411.
Aldea, M., J. G. Hamilton, J. P. Resti, A. R. Zangerl, M. R. Berenbaum, T. D. Frank and E. H.
Delucia (2006b). "Comparison of photosynthetic damage from arthropod herbivory and
pathogen infection in understory hardwood saplings." Oecologia. 149: 221-232.
Badri, M. A., D. Rivard, K. Coenen and D. Michaud (2009). "Unintended molecular interactions
in transgenic plants expressing clinically useful proteins: the case of bovine aprotinin
traveling the potato leaf cell secretory pathway." Proteomics. 9: 746-756.
Baldwin, I. T., Z. P. Zhang, N. Diab, T. E. Ohnmeiss, E. S. McCloud, G. Y. Lynds and E. A.
Schmelz (1997). "Quantification, correlations and manipulations of wound-induced
changes in jasmonic acid and nicotine in Nicotiana sylvestris." Planta. 201: 397-404.
Bergey, D. R., M. Orozco-Cardenas, D. S. de Moura and C. A. Ryan (1999). "A wound- and
systemin-inducible polygalacturonase in tomato leaves." Proceedings of the National
Academy of Sciences of the United States of America. 96: 1756-1760.
Bi, J. L., J. B. Murphy and G. W. Felton (1997). "Antinutritive and oxidative components as
mechanisms of induced resistance in cotton to Helicoverpa zea." Journal of Chemical
Ecology. 23: 97-117.
Bilgin, D. D., J. A. Zavala, J. Zhu, S. J. Clough, D. R. Ort and E. H. DeLucia (2010). "Biotic
stress globally downregulates photosynthesis genes." Plant Cell and Environment. 33:
1597-1613.
Boland, W., Z. Feng, J. Donath and A. Gäbler (1992). "Are acyclic C11 and C16 homoterpenes
plant volatiles indicating herbivory?" Naturwissenschaften. 79: 368-371.
 131

Bouchard, E., C. Cloutier and D. Michaud (2003). "Oryzacystatin I expressed in transgenic

potato induces digestive compensation in an insect natural predator via its herbivorous
prey feeding on the plant." Molecular Ecology. 12: 2439-2446.
Braam, J. and R. W. Davis (1990). "Rain-, wind-, and touch-induced expression of calmodulin
and calmodulin-related genes in Arabidopsis." Cell. 60: 357-364.
Brunelle, F., C. Cloutier and D. Michaud (2004). "Colorado potato beetles compensate for
tomato cathepsin D inhibitor expressed in transgenic potato." Archives of Insect
Biochemistry and Physiology. 55: 103-113.
Brunelle, F., B. Nguyen-Quoc, C. Cloutier and D. Michaud (1999). "Protein hydrolysis by
colorado potato beetle, Leptinotarsa decemlineata, digestive proteases: the catalytic role
of cathepsin D." Archives of Insect Biochemistry and Physiology. 42: 88-98.
Chen, H., E. Gonzales-Vigil, C. G. Wilkerson and G. A. Howe (2007). "Stability of plant defense
proteins in the gut of insect herbivores." Plant Physiology. 143: 1954-1967.
Chevalier, F. (2010). "Highlights on the capacities of "Gel-based" proteomics." Proteome
Science. 8: 23.
Cui, J., A. K. Bahrami, E. G. Pringle, G. Hernandez-Guzman, C. L. Bender, N. E. Pierce and F.
M. Ausubel (2005). "Pseudomonas syringae manipulates systemic plant defenses against
pathogens and herbivores." Proceedings of the National Academy of Sciences of the
United States of America. 102: 1791-1796.
Damerval, C., D. de Vienne, M. Zivy and H. Thiellement (1986). "Technical improvements in
two-dimensional electrophoresis increase the level of genetic variation detected in wheat-
seedling proteins." Electrophoresis. 7: 52-54.
de Bruxelles, G. L. and M. R. Roberts (2001). "Signals regulating multiple responses to
wounding and herbivory." Critical Reviews in Plant Sciences. 20: 487-521.
De Hoff, P. L., L. M. Brill and A. M. Hirsch (2009). "Plant lectins: the ties that bind in root
symbiosis and plant defense." Molecular Genetics and Genomics. 282: 1-15.
De Moraes, C. M. and M. C. Mescher (2004). "Biochemical crypsis in the avoidance of natural
enemies by an insect herbivore." Proceedings of the National Academy of Sciences of the
United States of America. 101: 8993-8997.
Delaney, K. J., F. J. Haile, R. K. D. Peterson and L. G. Higley (2008). "Impairment of leaf
photosynthesis after insect herbivory or mechanical injury on common milkweed,
Asclepias syriaca." Environmental Entomology. 37: 1332-1343.
Delphia, C. M., M. C. Mescher, G. W. Felton and C. M. De Moraes (2006). "The role of insect-
derived cues in eliciting indirect plant defenses in Tobacco, Nicotiana tabacum." Plant
Signaling & Behavior. 1: 243-250.
Douglas, A. E. (1993). "The nutritional quality of phloem sap utilized by natural aphid
populations." Ecological Entomology. 18: 31-38.
Duceppe, M.-O. (2004). Étude protéomique de l'induction des mécanismes de défense chez la
pomme de terre (Solanum tuberosum L.). Université Laval. 156 pp.
Duceppe, M. O., C. Cloutier and D. Michaud (2010a). "Host plant proteins in the larval
regurgitant of Colorado potato beetle, Leptinotarsa decemlineata Say." Chapter 3, this
thesis: soon to be published.
Duceppe, M. O., C. Cloutier and D. Michaud (2010b). "Wounding, beetle leaf feeding and aphid
phloem feeding differentially alter the potato leaf proteome." Chapter 2, this thesis: soon
to be published.
 132

Eichenseer, H., M. C. Mathews, J. L. Bi, J. B. Murphy and G. W. Felton (1999). "Salivary

glucose oxidase: multifunctional roles for Helicoverpa zea?" Archives of Insect
Biochemistry and Physiology. 42: 99-109.
Eichenseer, H., J. B. Murphy and G. W. Felton (2002). "Sequestration of host plant carotenoids
in the larval tissues of Helicoverpa zea." Journal of Insect Physiology. 48: 311-318.
Eng, J. K., A. L. McCormack and J. R. I. Yates (1994). "An approach to correlate tandem mass
spectral data of peptides with amino acid sequences in a protein database." Journal of the
American Society for Mass Spectrometry. 5: 976-989.
Farmer, E. E. and C. A. Ryan (1990). "Interplant communication: airborne methyl jasmonate
induces synthesis of proteinase inhibitors in plant leaves." Proceedings of the National
Academy of Sciences of the United States of America. 87: 7713-7716.
Farquhar, G. D., S. v. Caemmerer and J. A. Berry (1980). "A biochemical model of
photosynthetic CO2 assimilation in leaves of C3 species." Planta. 149: 78-90.
Felton, G. W. (2008). Caterpillar secretions and induced plant responses. Induced Plant
Resistance to Herbivory. A. Schaller, Springer: 369-387.
Felton, G. W. and S. S. Duffey (1991). "Protective action of midgut catalase in lepidopteran
larvae against oxidative plant defenses." Journal of Chemical Ecology. 17: 1715-1732.
Felton, G. W. and H. Eichenseer (1999). Herbivore saliva and its effects on plant defense against
herbivores and pathogens. Induced plant defenses against pathogens and herbivores. A.
A. Agrawal, S. Tuzun and E. Bent. Minnesota, The American Phytopathological Society:
19-36.
Felton, G. W. and K. L. Korth (2000). "Trade-offs between pathogen and herbivore resistance."
Current Opinion in Plant Biology. 3: 309-314.
Felton, G. W. and J. H. Tumlinson (2008). "Plant-insect dialogs: complex interactions at the
plant-insect interface." Current Opinion in Biology. 11: 457-463.
Fidantsef, A. L. and R. M. Bostock (1998). "Characterization of potato tuber lipoxygenase
cDNAs and lipoxygenase expression in potato tubers and leaves." Physiologia Plantarum.
102: 257-271.
Fidantsef, A. L., M. J. Stout, J. S. Thaler, S. S. Duffey and R. M. Bostock (1999). "Signal
interactions in pathogen and insect attack: expression of lipoxygenase, proteinase
inhibitor II, and pathogenesis-related protein P4 in the tomato, Lycopersicon esculentum."
Physiological and Molecular Plant Pathology. 54: 97-114.
Fournier, D., J. M. Bride, M. Poirie, J. B. Berge and F. W. Plapp, Jr. (1992). "Insect glutathione
S-transferases. Biochemical characteristics of the major forms from houseflies susceptible
and resistant to insecticides." Journal of Biological Chemistry. 267: 1840-1845.
Francis, F., F. Guillonneau, P. Leprince, E. De Pauw, E. Haubruge, L. Jia and F. L. Goggin
(2010). "Tritrophic interactions among Macrosiphum euphorbiae aphids, their host plants
and endosymbionts: investigation by a proteomic approach." Journal of Insect
Physiology. 56: 575-585.
Franco, O. L., D. J. Rigden, F. R. Melo and M. F. Grossi-de-Sá (2002). "Plant α-amylase
inhibitors and their interaction with insect α-amylases." European Journal of
Biochemistry. 269: 397-412.
Gagnon, R., M. Drouin and D. Peters (2007). Les pommes de terre : situation et tendances de la
production canadienne en 2006-2007. A. e. A. Canada: 42.
Gaquerel, E., A. Weinhold and I. T. Baldwin (2009). "Molecular interactions between the
specialist herbivore Manduca sexta (Lepidoptera, Sphigidae) and its natural host
 133

Nicotiana attenuata. VIII. An unbiased GCxGC-ToFMS analysis of the plant's elicited

volatile emissions." Plant Physiology. 149: 1408-1423.
Gergerich, R. C., R. A. Scott and J. P. Fulton (1983). "Regurgitant as a determinant of specificity
in the transmission of plant viruses by beetles." Phytopathology. 73: 936-938.
Girard, C., D. Rivard, A. Kiggundu, K. Kunert, S. C. Gleddie, C. Cloutier and D. Michaud
(2007). "A multicomponent, elicitor-inducible cystatin complex in tomato, Solanum
lycopersicum." New Phytologist. 173: 841-851.
Giri, A. P., H. Wunsche, S. Mitra, J. A. Zavala, A. Muck, A. Svatos and I. T. Baldwin (2006).
"Molecular interactions between the specialist herbivore Manduca sexta (Lepidoptera,
Sphingidae) and its natural host Nicotiana attenuata. VII. Changes in the plant's
proteome." Plant Physiology. 142: 1621-1641.
Goulet, C., M. Benchabane, R. Anguenot, F. Brunelle, M. Khalf and D. Michaud (2010a). "A
companion protease inhibitor for the protection of cytosol-targeted recombinant proteins
in plants." Plant Biotechnology Journal. 8: 142-154.
Goulet, C., M. C. Goulet and D. Michaud (2010b). "2-DE proteome maps for the leaf apoplast of
Nicotiana benthamiana." Proteomics. 10: 2536-2544.
Hajduch, M., R. Rakwal, G. K. Agrawal, M. Yonekura and A. Petrova (2001). "High-resolution
two-dimensional electrophoresis separation of proteins from metal-stressed rice (Oriza
sativa L.) leaves: drastic reduction/fragmentation of ribulose-1, 5-biphosphate
carboxylase/oxygenase and induction of stress-related proteins." Electrophoresis. 22:
2824-2831.
Halitschke, R., K. Gase, D. Hui, D. D. Schmidt and I. T. Baldwin (2003). "Molecular
interactions between the specialist herbivore Manduca sexta (Lepidoptera, Sphingidae)
and its natural host Nicotiana attenuata. VI. Microarray analysis reveals that most
herbivore-specific transcriptional changes are mediated by fatty acid-amino acid
conjugates." Plant Physiology. 131: 1894-1902.
Halitschke, R., U. Schittko, G. Pohnert, W. Boland and I. T. Baldwin (2001). "Molecular
interactions between the specialist herbivore Manduca sexta (Lepidoptera, Sphingidae)
and its natural host Nicotiana attenuata. III. Fatty acid-amino acid conjugates in
herbivore oral secretions are necessary and sufficient for herbivore-specific plant
responses." Plant Physiology. 125: 711-717.
Hall, D. E., K. B. MacGregor, J. Nijsse and A. W. Bown (2004). "Footsteps from insect larvae
damage leaf surfaces and initiate rapid responses." European Journal of Plant Pathology.
110: 441-447.
Hankamer, B., J. Barber and E. J. Boekema (1997). "Structure and membrane organization of
photosystem II in green plants." Annual Review of Plant Physiology and Plant Molecular
Biology. 48: 641-671.
Heibges, A., H. Glaczinski, A. Ballvora, F. Salamini and C. Gebhardt (2003). "Structural
diversity and organization of three gene families for Kunitz-type enzyme inhibitors from
potato tubers (Solanum tuberosum L.)." Molecular Genetics and Genomics. 269: 526-
534.
Heil, M. (2009). "Damaged-self recognition in plant herbivore defence." Trends in Plant Science.
14: 356-363.
Hermsmeier, D., U. Schittko and I. T. Baldwin (2001). "Molecular interactions between the
specialist herbivore Manduca sexta (Lepidoptera, Sphingidae) and its natural host
 134

Nicotiana attenuata. I. Large-scale changes in the accumulation of growth- and defense-

related plant mRNAs." Plant Physiology. 125: 683-700.
Hirayama, T. and K. Shinozaki (2010). "Research on plant abiotic stress responses in the post-
genome era: past, present and future." Plant Journal. 61: 1041-1052.
Howard, R. W. and J. E. Baker (2004). "Stage-specific surface chemicals of Plodia
interpunctella: 2-acyl-1,3-cyclohexanediones from larval mandibular glands serve as
cuticular lipids." Comparative Biochemistry and Physiology. 2004. 138: 193-206.
Howe, G. A. (2004). "Jasmonates as signals in the wound response." Journal of Plant Growth
Regulation. 23: 223-237.
Hui, D., J. Iqbal, K. Lehmann, K. Gase, H. P. Saluz and I. T. Baldwin (2003). "Molecular
interactions between the specialist herbivore Manduca sexta (Lepidoptera, Sphingidae)
and its natural host Nicotiana attenuata: V. Microarray analysis and further
characterization of large-scale changes in herbivore-induced mRNAs." Plant Physiology.
131: 1877-1893.
Izaguirre, M. M., A. L. Scopel, I. T. Baldwin and C. L. Ballare (2003). "Convergent responses to
stress. Solar ultraviolet-B radiation and Manduca sexta herbivory elicit overlapping
transcriptional responses in field-grown plants of Nicotiana longiflora." Plant
Physiology. 132: 1755-1767.
Jensen, O. N., M. Wilm, A. Shevchenko and M. Mann (1999). "Sample preparation methods for
mass spectrometric peptide mapping directly from 2-DE gels." Methods in Molecular
Biology. 112: 513-530.
Kaloshian, I., W. H. Lange and V. M. Williamson (1995). "An aphid-resistance locus is tightly
linked to the nematode-resistance gene, Mi, in tomato." Proceedings of the National
Academy of Sciences of the United States of America. 92: 622-625.
Kang, J., L. Wang, A. Giri and I. T. Baldwin (2006). "Silencing threonine deaminase and JAR4
in Nicotiana attenuata impairs jasmonic acid-isoleucine-mediated defenses against
Manduca sexta." Plant Cell. 18: 3303-3320.
Karban, R. and I. T. Baldwin, Eds. (1997). Induced responses to herbivory. Chicago, Chicago
University Press. 319 pp.
Kessler, A. and I. T. Baldwin (2002). "Plant responses to insect herbivory: the emerging
molecular analysis." Annual Review of Plant Biology. 53: 299-328.
Korth, K. L. and R. A. Dixon (1997). "Evidence for chewing insect-specific molecular events
distinct from a general wound response in leaves." Plant Physiology. 115: 1299-1305.
Kreft, S., M. Ravnikar, P. Mesko, J. Pungercar, A. Umek, I. Kregar and B. Strukelj (1997).
"Jasmonic acid inducible aspartic proteinase inhibitors from potato." Phytochemistry. 44:
1001-1006.
Kruzmane, D., L. Jankevica and G. Ievinsh (2002). "Effect of regurgitant from Leptinotarsa
decemlineata on wound responses in Solanum tuberosum and Phaseolus vulgaris."
Physiologia Plantarium. 115: 577-584.
Laemmli, U. K. (1970). "Cleavage of structural proteins during the assembly of the head of
bacteriophage T4." Nature. 227: 680-685.
Lawrence, S. D., N. G. Novak and M. B. Blackburn (2007). "Inhibition of proteinase inhibitor
transcripts by Leptinotarsa decemlineata regurgitant in Solanum lycopersicum." Journal
of Chemical Ecology. 33: 1041-1048.
Lawrence, S. D., N. G. Novak, C. J. Ju and J. E. Cooke (2008). "Potato, Solanum tuberosum,
defense against Colorado potato beetle, Leptinotarsa decemlineata (Say): microarray
 135

gene expression profiling of potato by Colorado potato beetle regurgitant treatment of

wounded leaves." Journal of Chemical Ecology. 34: 1013-1025.
Leon, J., E. Rojo and J. J. Sanchez-Serrano (2001). "Wound signalling in plants." Journal of
Experimental Botany. 52: 1-9.
LI-COR (2004). Using the LI-6400 v5.3. Lincoln, Nebraska, USA. 1038 pp.
Li, Q., Q. G. Xie, J. Smith-Becker, D. A. Navarre and I. Kaloshian (2006). "Mi-1-Mediated
aphid resistance involves salicylic acid and mitogen-activated protein kinase signaling
cascades." Molecular Plant-Microbe Interactions. 19: 655-664.
Liu, F., L. W. Cui, D. Cox-Foster and G. W. Felton (2004). "Characterization of a salivary
lysozyme in larval Helicoverpa zea." Journal of Chemical Ecology. 30: 2439-2457.
Logemann, J., J. Schell and L. Willmitzer (1987). "Improved method for the isolation of RNA
from plant tissues." Analytical Biochemistry. 163: 16-20.
Luhring, H., V. D. Nguyen, L. Schmidt and U. S. Rose (2007). "Caterpillar regurgitant induces
pore formation in plant membranes." FEBS Letters. 581: 5361-5370.
Macedo, T. B., C. S. Bastos, L. G. Higley, K. R. Ostlie and S. Madhavan (2003). "Photosynthetic
responses of soybean to soybean aphid (Homoptera: Aphididae) injury." Journal of
Economic Entomology. 96: 188-193.
Madhusudhan, V. V. and P. W. Miles (1998). "Mobility of salivary components as a possible
reason for differences in the responses of alfalfa to the spotted alfalfa aphid and pea
aphid." Entomologia Experimentalis et Applicata. 86: 25-39.
Maischak, H., P. A. Grigoriev, H. Vogel, W. Boland and A. Mithöfer (2007). "Oral secretions
from herbivorous lepidopteran larvae exhibit ion channel-forming activities." FEBS
Letters. 581: 898-904.
Mattiacci, L., M. Dicke and M. A. Posthumus (1995). "beta-Glucosidase: an elicitor of
herbivore-induced plant odor that attracts host-searching parasitic wasps." Proceedings of
the National Academy of Sciences of the United States of America. 92: 2036-2040.
Mazzucotelli, E., A. M. Mastrangelo, C. Crosatti, D. Guerra, A. M. Stanca and L. Cattivelli
(2008). "Abiotic stress response in plants: when post-transcriptional and post-
translational regulations control transcription." Plant Science. 174: 420-431.
McCloud, E. S. and I. T. Baldwin (1997). "Herbivory and caterpillar regurgitants amplify the
wound-induced increases in jasmonic acid but not nicotine in Nicotiana sylvestris."
Planta. 203: 430-435.
Merkx-Jacques, M. and J. C. Bede (2004). "Caterpillar salivary enzymes: "eliciting" a response."
Phytoprotection. 85: 33-37.
Michaud, D. and A. Asselin (1995). "Application to plant proteins of gel electrophoresis
methods." Journal of Chromatography A. 698: 263-279.
Michaud, D., N. Bernier-Vadnais, S. Overney and S. Yelle (1995). "Constitutive expression of
digestive cysteine proteinase forms during development of the colorado potato beetle,
Leptinotarsa decemlineata Say (Coleoptera: Chrysomelidae)." Insect Biochemistry and
Molecular Biology. 25: 1041-1048.
Miles, P. W. (1987). "Plant-sucking bugs can remove the contents of cells without mechanical
damage." Experientia. 43: 937-939.
Miles, P. W. (1999). "Aphid saliva." Biological Review. 74: 41-85.
Mithofer, A., G. Wanner and W. Boland (2005). "Effects of feeding Spodoptera littoralis on
lima bean leaves. II. Continuous mechanical wounding resembling insect feeding is
 136

sufficient to elicit herbivory-related volatile emission." Plant Physiology. 137: 1160-

1168.
Mitra, S. and I. T. Baldwin (2008). "Independently silencing two photosynthetic proteins in
Nicotiana attenuata has different effects on herbivore resistance." Plant Physiology. 148:
1128-1138.
Mitra, S., H. Wunsche, A. P. Giri, V. Hivrale and I. T. Baldwin (2008). "Silencing 7 herbivory-
regulated proteins in Nicotiana attenuata to understand their function in plant-herbivore
interactions." Functional Ecology. 22: 606-615.
Moran, P. J., Y. Cheng, J. L. Cassell and G. A. Thompson (2002). "Gene expression profiling of
Arabidopsis thaliana in compatible plant-aphid interactions." Archives of Insect
Biochemistry and Physiology. 51: 182-203.
Moran, P. J. and G. A. Thompson (2001). "Molecular responses to aphid feeding in Arabidopsis
in relation to plant defense pathways." Plant Physiology. 125: 1074-1085.
Mori, N., H. T. Alborn, P. E. A. Teal and J. H. Tumlinson (2001). "Enzymatic decomposition of
elicitors of plant volatiles in Heliothis virescens and Helicoverpa zea." Journal of Insect
Physiology. 47: 749-757.
Musser, R. O., E. Farmer, M. Peiffer, S. A. Williams and G. W. Felton (2006). "Ablation of
caterpillar labial salivary glands: technique for determining the role of saliva in insect-
plant interactions." Journal of Chemical Ecology. 32: 981-992.
Musser, R. O., S. M. Hum-Musser, H. Eichenseer, M. Peiffer, G. Ervin, J. B. Murphy and G. W.
Felton (2002). "Herbivory: caterpillar saliva beats plant defences." Nature. 416: 599-600.
Musser, R. O., H. S. Kwon, S. A. Williams, C. J. White, M. A. Romano, S. M. Holt, S.
Bradbury, J. K. Brown and G. W. Felton (2005). "Evidence that caterpillar labial saliva
suppresses infectivity of potential bacterial pathogens." Archives of Insect Biochemistry
and Physiology. 58: 138-144.
Nabity, P. D., J. A. Zavala and E. H. DeLucia (2008). "Indirect suppression of photosynthesis on
individual leaves by arthropod herbivory." Annals of Botany. 103: 655-663.
Nault, L. R. (1997). "Arthropod transmission of plant viruses: a new synthesis." Annals of the
Entomological Society of America. 90: 521-541.
Nelson, N. and A. Ben-Shem (2004). "The complex architecture of oxygenic photosynthesis."
Nature Reviews Molecular Cell Biology. 5: 971-982.
Nguyen, T. T. A., D. Michaud and C. Cloutier (2007). "Proteomic profiling of aphid
Macrosiphum euphorbiae responses to host-plant-mediated stress induced by defoliation
and water deficit." Journal of Insect Physiology. 53: 601-611.
Nicot, N., J.-F. Hausman, L. Hoffmann and D. Evers (2005). "Housekeeping gene selection for
real-time RT-PCR normalization in potato during abiotic stress." Journal of Experimental
Botany. 56: 2907-2914.
Noronha, C., R. S. Vernon and C. Vincent (2008). "Les insectes ravageurs importants de la
pomme de terre au Canada." Cahiers Agricultures. 17: 375-381.
O'Donnell, P. J., C. Calvert, R. Atzorn, C. Wasternack, H. M. O. Leyser and J. Bowles (1996).
"Ethylene as a signal mediating the wound response of tomato plants." Science. 274:
1914-1917.
Obokata, J., K. Mikami, N. Hayashida, M. Nakamura and M. Sugiura (1993). "Molecular
heterogeneity of photosystem I (psaD, psaE, psaF, psaH, and psaL are all present in
isoforms in Nicotiana spp.)." Plant Physiology. 102: 1259-1267.
 137

Pandey, D. M. and U. D. Yeo (2008). "Stress-induced degradation of D1 protein and its

photoprotection by DCPIP in isolated thylakoid membranes of barley leaf." Biologia
Plantarum. 52: 291-298.
Paré, P. W. and J. H. Tumlinson (1998). "Cotton volatiles synthesized and released distal to the
site of insect damage." Phytochemistry. 47: 521-526.
Parthasarathy, R. and K. P. Gopinathan (2005). "Comparative analysis of the development of the
mandibular salivary glands and the labial silk glands in the mulberry silkworm, Bombyx
mori." Gene Expression Patterns. 5: 323-339.
Pearce, G., D. Strydom, S. Johnson and C. A. Ryan (1991). "A polypeptide from tomato leaves
induces wound-inducible proteinase inhibitor proteins." Science. 253: 895-897.
Peiffer, M. and G. W. Felton (2005). "The host plant as a factor in the synthesis and secretion of
salivary glucose oxidase in larval Helicoverpa zea." Archives of Insect Biochemistry and
Physiology. 58: 106-113.
Peiffer, M. and G. W. Felton (2009). "Do caterpillars secrete "oral secretions"?" Journal of
Chemical Ecology. 35: 326-335.
Pena-Cortes, H., J. J. Sanchez-Serrano, R. Mertens, L. Willmitzer and S. Prat (1989). "Abscisic
acid is involved in the wound-induced expression of the proteinase inhibitor II gene in
potato and tomato." Proceedings of the National Academy of Sciences of the United
States of America. 86: 9851-9855.
Perez-Bueno, M. L., J. Rahoutei, C. Sajnani, I. Garcia-Luque and M. Baron (2004). "Proteomic
analysis of the oxygen-evolving complex of photosystem II under biotec stress: studies
on Nicotiana benthamiana infected with tobamoviruses." Proteomics. 4: 418-425.
Perkins, D. N., D. J. Pappin, D. M. Creasy and J. S. Cottrell (1999). "Probability-based protein
identification by searching sequence databases using mass spectrometry data."
Electrophoresis. 20: 3551-3567.
Peterson, R. K. D., C. L. Shannon and A. W. Lenssen (2004). "Photosynthetic responses of
legume species to leaf-mass consumption injury." Environmental Entomology. 33: 450-
456.
Philippe, R. N., S. G. Ralph, C. Kulheim, S. I. Jancsik and J. Bohlmann (2009). "Poplar defense
against insects: genome analysis, full-length cDNA cloning, and transcriptome and
protein analysis of the poplar Kunitz-type protease inhibitor family." New Phytologist.
184: 865-884.
Pierpoint, W. S., P. J. Jackson and R. M. Evans (1990). "The presence of a thaumatin-like
protein, a chitinase and a glucanase among the pathogenesis-related proteins of potato
(Solanum tuberosum)." Physiological and Molecular Plant Pathology. 36: 325-338.
Pohnert, G., V. Jung, E. Haukioja, K. Lempa and W. Boland (1999). "New fatty acid amides
from regurgitant of Lepidopteran (Noctuidae, Geometridae) caterpillars." Tetrahedron.
55: 11275-11280.
Pozzo, T., J. L. Pasten, E. N. Karlsson and D. T. Logan (2010). "Structural and functional
analyses of beta-glucosidase 3B from Thermotoga neapolitana: a thermostable three-
domain representative of glycoside hydrolase 3." Journal of Molecular Biology. 397:
724-739.
Pringle, J. W. S. (1938). "Proprioception in insects: I. A new type of mechanical receptor from
the palps of the cockroach." Journal of Experimental Biology. 15: 101-113.
Rakwal, R., G. K. Agrawal and M. Yonekura (1999). "Separation of proteins from stressed rice
(Oryza sativa L.) leaf tissues by two-dimensional polyacrylamide gel electrophoresis:
 138

induction of pathogenesis-related and cellular protectant proteins by jasmonic acid, UV

irradiation and copper chloride." Electrophoresis. 20: 3472-3478.
Rakwal, R. and S. Komatsu (2000). "Role of jasmonate in the rice (Oryza sativa L.) self-defense
mechanism using proteome analysis." Electrophoresis. 21: 2492-2500.
Ramagli, L., S. and L. V. Rodriguez (1985). "Quantitation of microgram amounts of protein in
two-dimensional polyacrylamide gel electrophoresis sample buffer." Electrophoresis. 6:
559-563.
Reinbothe, S., B. Mollenhauer and C. Reinbothe (1994). "JIPs and RIPs: the regulation of plant
gene expression by jasmonates in response to environmental cues and pathogens." Plant
Cell. 6: 1197-1209.
Reymond, P., H. Weber, M. Damond and E. E. Farmer (2000). "Differential gene expression in
response to mechanical wounding and insect feeding in Arabidopsis." Plant Cell. 12: 707-
720.
Rhoades, J. D., J. F. Thain and D. C. Wildson (1996). "The pathway for systemic electrical
signal conduction in the wounded tomato plant." Planta. 200: 50-57.
Ribeiro, J. M. C. (1995). Insect saliva: function, biochemistry, and physiology. Regulatory
mechanisms in insect feeding. R. F. Chapman and G. de Boer. New York, Chapman &
Hall: 74-97.
Rivard, D., R. Anguenot, F. Brunelle, L. Van Quy, L. P. Vezina, S. Trepanier and D. Michaud
(2006). "An in-built proteinase inhibitor system for the protection of recombinant
proteins recovered from transgenic plants." Plant Biotechnology Journal. 4: 359-368.
Rivard, D., C. Cloutier and D. Michaud (2004). "Colorado potato beetles show differential
digestive compensatory responses to host plants expressing distinct sets of defense
proteins." Archives of Insect Biochemistry and Physiology. 55: 114-123.
Roda, A., R. Halitschke, A. Steppuhn and I. T. Baldwin (2004). "Individual variability in
herbivore-specific elicitors from the plant's perspective." Molecular Ecology. 13: 2421-
2433.
Rossi, M., F. L. Goggin, S. B. Milligan, I. Kaloshian, D. E. Ullman and V. M. Williamson
(1998). "The nematode resistance gene Mi of tomato confers resistance against the potato
aphid." Proceedings of the National Academy of Sciences of the United States of
America. 95: 9750-9754.
Ryan, C. A. (2000). "The systemin signaling pathway: differential activation of plant defensive
genes." Biochimica et Biophysica Acta. 1477: 112-121.
Ryan, M. F. and O. Byrne (1988). "Plant-insect coevolution and inhibition of
acetylcholinesterase." Journal of Chemical Ecology. 14: 1965-1975.
Schenk, P. M., K. Kazan, I. Wilson, J. P. Anderson, T. Richmond, S. C. Somerville and J. M.
Manners (2000). "Coordinated plant defense responses in Arabidopsis revealed by
microarray analysis." Proceedings of the National Academy of Sciences of the United
States of America. 97: 11655-11660.
Schittko, U., D. Hermsmeier and I. T. Baldwin (2001). "Molecular interactions between the
specialist herbivore Manduca sexta (Lepidoptera, Sphingidae) and its natural host
Nicotiana attenuata. II. Accumulation of plant mRNAs in response to insect-derived
cues." Plant Physiology. 125: 701-710.
Schmelz, E. A., M. J. Carroll, S. LeClere, S. M. Phipps, J. Meredith, P. S. Chourey, H. T. Alborn
and P. E. Teal (2006). "Fragments of ATP synthase mediate plant perception of insect
 139

attack." Proceedings of the National Academy of Sciences of the United States of

America. 103: 8894-8899.
Schmelz, E. A., S. LeClere, M. J. Carroll, H. T. Alborn and P. E. Teal (2007). "Cowpea
chloroplastic ATP synthase is the source of multiple plant defense elicitors during insect
herbivory." Plant Physiology. 144: 793-805.
Schwachtje, J. and I. T. Baldwin (2008). "Why does herbivore attack reconfigure primary
metabolism?" Plant Physiology. 146: 845-851.
Schwachtje, J., P. E. Minchin, S. Jahnke, J. T. van Dongen, U. Schittko and I. T. Baldwin (2006).
"SNF1-related kinases allow plants to tolerate herbivory by allocating carbon to roots."
Proceedings of the National Academy of Sciences of the United States of America. 103:
12935-12940.
Sharkey, T. D., C. J. Bernacchi, G. D. Farquhar and E. L. Singsaas (2007a). "Fitting
photosynthetic carbon dioxide response curves for C3 leaves." Plant Cell and
Environment. 30: 1035-1040.
Sharkey, T. D., C. J. Bernacchi, G. D. Farquhar and E. L. Singsaas (2007b). In practice: fitting
photosynthetic carbon dioxide response curves for C3 leaves. Plant, Cell and
Environment. 30: XX-XX.
Shulaev, V., D. Cortes, G. Miller and R. Mittler (2008). "Metabolomics for plant stress
response." Physiologia Plantarium. 132: 199-208.
Singh, M. (2000). "Turnover of D1 protein encoded by psbA gene in higher plants and
cyanobacteria sustains photosynthetic efficiency to maintain plant productivity under
photopinhibitory irradiance." Photosynthetica. 38: 161-169.
Somssich, I. E. and K. Hahlbrock (1998). "Pathogen defense in plant - a paradigm of biological
complexity." Trends in Plant Science. 3: 86-90.
Srivastava, U. S. (1959). "The maxillary glands of some Coleoptera." Proceedings of the Royal
Entomological Society of London. Series A, General Entomology. 34: 57-62.
Stitt, M. and U. Sonnewald (1995). "Regulation of metabolism in transgenic plants." Annual
Review of Plant Physiology and Plant Molecular Biology. 46: 341-368.
Stout, M. J., A. L. Fidantsef, S. S. Duffey and R. M. Bostock (1999). "Signal interactions in
pathogen and insect attack: systemic plant-mediated interactions between pathogens and
herbivores of the tomato, Lycopersicon esculentum." Physiological and Molecular Plant
Pathology. 54: 115-130.
Stratmann, J. W. and C. A. Ryan (1997). "Myelin basic protein kinase activity in tomato leaves
is induced systemically by wounding and increases in response to systemin and
oligosaccharide  elicitors." Proceedings of the National Academy of Sciences of the
United States of America. 94: 11085-11089.
Taiz, L. and E. Zeiger, Eds. (1998). Plant physiology. Sunderland, Massachusetts, Sinauer
Associates, Inc. 792 pp.
Taiz, L. and E. Zeiger, Eds. (2002). Plant physiology. (3ième edition). Sunderland,
Massachusetts, Sinauer Associates, Inc. 690 pp.
Tang, J. Y., R. E. Zielinski, A. R. Zangerl, A. R. Crofts, M. R. Berenbaum and E. H. Delucia
(2006). "The differential effects of herbivory by first and fourth instars of Trichoplusia ni
(Lepidoptera: Noctuidae) on photosynthesis in Arabidopsis thaliana." Journal of
Experimental Botany. 57: 527-536.
Thaler, J. S., M. A. Farag, P. W. Pare and M. Dicke (2002). "Jasmonate-deficient plants have
reduced direct and indirect defences against herbivores." Ecology Letters. 5: 764-774.
 140

Thie, N. M. R. and J. G. Houseman (1990). "Identification of cathepsin B, D and H in the larval

midgut of Colorado potato beetle, Leptinotarsa decemlineata Say (Coleoptera:
Chrysomelidae)." Insect Biochemistry. 20: 313-318.
Thivierge, K., A. Prado, B. T. Driscoll, E. Bonneil, P. Thibault and J. C. Bede (2010).
"Caterpillar- and salivary-specific modification of plant proteins." Journal of Proteome
Research.
Thompson, G. A. and F. L. Goggin (2006). "Transcriptomics and functional genomics of plant
defence induction by phloem-feeding insects." Journal of Experimental Botany. 57: 755-
766.
Thomson, V., S. Cunningham, M. Ball and A. Nicotra (2003). "Compensation for herbivory by
Cucumis sativus through increased photosynthetic capacity and efficiency." Oecologia.
134: 167-175.
Tjallingii, W. F. and T. Hogen Esch (1993). "Fine structure of aphid stylet routes in plant tissues
in correlation with EPG signals." Physiological Entomology. 18: 317-328.
Truitt, C. L. and P. W. Pare (2004). "In situ translocation of volicitin by beet armyworm larvae to
maize and systemic immobility of the herbivore elicitor in planta." Planta. 218: 999-
1007.
Truitt, C. L., H. X. Wei and P. W. Pare (2004). "A plasma membrane protein from Zea mays
binds with the herbivore elicitor volicitin." Plant Cell. 16: 523-532.
Trumble, J. T., D. M. Kolodny-Hirsch and J. P. Ting (1993). "Plant compensation for arthropod
herbivory." Annual Review of Entomology. 38: 93-119.
Tumlinson, J. H. and C. G. Lait (2005). "Biosynthesis of fatty acid amide elicitors of plant
volatiles by insect herbivores." Archives of Insect Biochemistry and Physiology. 58: 54-
68.
Turlings, T. C., J. H. Tumlinson and W. J. Lewis (1990). "Exploitation of herbivore-induced
plant odors by host-seeking parasitic wasps." Science. 250: 1251-1253.
Turlings, T. C. J., H. T. Alborn, J. H. Loughrin and J. H. Tumlinson (2000). "Volicitin, an
elicitor of maize volatiles in oral secretion of Spodoptera exigua: isolation and
bioactivity." Journal of Chemical Ecology. 26: 189-202.
Urano, K., Y. Kurihara, M. Seki and K. Shinozaki (2010). "'Omics' analyses of regulatory
networks in plant abiotic stress responses." Current Opinion in Plant Biology. 13: 132-
138.
Valueva, T. A. and V. V. Mosolov (2004). "Role of inhibitors of proteolytic enzymes in plant
defense against phytopathogenic microorganisms." Biochemistry (Mosc). 69: 1305-1309.
van Breusegem, F., E. Vranova, J. F. Dat and D. Inze (2001). "The role of active oxygen species
in plant signal transduction." Plant Science. 161: 405-414.
Veen, B. W. (1985). "Photosynthesis and assimilate transport in potato with top-roll disorder
caused by the aphid Macrosiphum euphorbiae." Annals of Applied Biology. 107: 319-
323.
Voelckel, C. and I. T. Baldwin (2003). "Detecting herbivore-specific transcriptional responses in
plants with multiple DDRT-PCR and substractive library procedures." Physiologia
Plantarum. 118: 240-252.
Voelckel, C. and I. T. Baldwin (2004). "Generalist and specialist lepidopteran larvae elicit
different transcriptional responses in Nicotiana attenuata, which correlate with larval
FAC profiles." Ecology Letters. 7: 770-775.
 141

Walling, L. L. (2000). "The myriad plant responses to herbivores." Journal of Plant Growth
Regulation. 19: 195-216.
Wei, Z., W. Hu, Q. Lin, X. Cheng, M. Tong, L. Zhu, R. Chen and G. He (2009). "Understanding
rice plant resistance to the Brown Planthopper (Nilaparvata lugens): a proteomic
approach." Proteomics. 9: 2798-2808.
Winz, R. A. and I. T. Baldwin (2001). "Molecular interactions between the specialist herbivore
Manduca sexta (Lepidoptera, Sphingidae) and its natural host Nicotiana attenuata. IV.
Insect-induced ethylene reduces jasmonate-induced nicotine accumulation by regulating
putrescine N-methyltransferase transcripts." Plant Physiology. 125: 2189-2202.
Wroniszewska, A. (1966). "Mandibular glands of the wax moth larva, Galleria mellonella (L.)."
Journal of Insect Physiology. 12: 509-514, IN511-IN512, 515-522.
Wu, J. and I. T. Baldwin (2010). "New insights into plant responses to the attack from insect
herbivores." Annual Review of Genetics. 44.
Yan, S. P., Q. Y. Zhang, Z. C. Tang, W. A. Su and W. N. Sun (2006). "Comparative proteomic
analysis provides new insights into chilling stress responses in rice." Molecular &
Cellular Proteomics. 5: 484-496.
Yuan, J. S., D. W. Galbraith, S. Y. Dai, P. Griffin and C. N. Stewart, Jr. (2008). "Plant systems
biology comes of age." Trends in Plant Science. 13: 165-171.
Zangerl, A. R., J. G. Hamilton, T. J. Miller, A. R. Crofts, K. Oxborough, M. R. Berenbaum and
E. H. de Lucia (2002). "Impact of folivory on photosynthesis is greater than the sum of its
holes." Proceedings of the National Academy of Sciences of the United States of
America. 99: 1088-1091.
Zhao, Y., R. Thilmony, C. L. Bender, A. Schaller, S. Y. He and G. A. Howe (2003). "Virulence
systems of Pseudomonas syringae pv. tomato promote bacterial speck disease in tomato
by targeting the jasmonate signaling pathway." Plant Journal. 36: 485-499.
Zhu-Salzman, K., D. S. Luthe and G. W. Felton (2008). "Arthropod-inducible proteins: broad
spectrum defenses against multiple herbivores." Plant Physiology. 146: 852-858.
Annexe I Notions de base sur les mesures de photosynthèse
 143

La photosynthèse

Au cours de la phase photochimique, la chlorophylle absorbe préférentiellement les longueurs

d‟onde bleues et rouges (Figure A.1). Lorsqu‟elle absorbe un photon, cette molécule passe à un
niveau transitoire de haute énergie, où elle est relativement instable. Dans le cas où la
chlorophylle absorbe de la lumière bleue, les électrons de valence atteignent un degré
d‟excitation supérieur extrêmement instable, en raison de la somme importante d‟énergie
incidente associée à sa faible longueur d‟onde. La molécule perd alors très rapidement une partie
de son énergie nouvellement acquise sous forme de chaleur pour atteindre un niveau d‟excitation
moins élevé, appelé niveau d‟excitation intermédiaire. Dans le cas où la chlorophylle absorbe de
la lumière rouge, moins énergétique, les électrons de valence sont propulsés directement au
niveau d‟excitation intermédiaire (Taiz and Zeiger 1998).

Figure A.1 Niveaux d‟excitation de la chlorophylle en fonction de la longueur d‟onde des

photons incidents et voies de dissipation de l‟énergie.
Tiré de Taiz et al. (2002).
 144

La chlorophylle excitée perd rapidement l‟énergie d‟excitation, soit (1) en produisant de la

chaleur, soit (2) en réémettant un photon de moindre énergie par fluorescence, soit (3) en
transférant cette énergie à une autre molécule par résonance inductive, ou soit (4) en utilisant
cette énergie pour créer une réaction chimique, dite photochimique (Taiz and Zeiger 1998).

En pratique, il est possible, en mesurant la fluorescence émise, de déterminer l‟efficacité

photosynthétique d‟une plante sous différentes conditions, et par le fait même de déterminer son
état physiologique. Dans le cadre du présent projet, des mesures d‟échange gazeux et de
fluorescence ont été réalisées avec le système de photosynthèse portable LI-6400 (LI-COR
Biosciences, Lincoln, É.-U.), muni d‟un détecteur de fluorescence. Cet appareil permet d‟évaluer
simultanément une multitude de paramètres; les plus importants dans le cadre d‟une étude sur
l‟impact des insectes herbivores sur la photosynthèse sont résumés dans le Tableau A.1 et la
Figure A.2, ci-dessous.
 145

Tableau A.1 Paramètres photosynthétiques mesurés pour déterminer l‟état physiologique d‟une
plante soumise à différents traitements.

Paramètre Description1

φPSII Efficacité quantique, ou efficacité photochimique du PSII; fraction de l‟énergie

des photons absorbés utilisée pour produire des réactions photochimiques, pour
une feuille adaptée à la lumière.
Fv/Fm Efficacité photochimique maximale; fraction de l‟énergie des photons absorbés
utilisée pour produire des réactions photochimiques, pour une feuille adaptée à
l‟obscurité.
Fv‟/Fm‟ Efficacité photochimique du centre réactionnel oxydé du PSII, pour une feuille
adaptée à la lumière.
ETR Taux de transport des électrons (Electron transport rate, ETR) du PSII.
qP Quenching (dissipation) photochimique de la fluorescence.
qN Quenching non photochimique de la fluorescence.
NPQ Quenching non photochimique de la fluorescence (similaire à qN).
Fo Fluorescence minimale.

1
Les descriptions sont tirées du manuel d‟utilisation du LI-6400 (LI-COR 2004).
 146

Figure A.2 Paramètres de fluorescence, tels que mesurés par le LI-6400.

Les paramètres Fo et Fm sont mesurés sur des feuilles adaptées à la noirceur. Les paramètres Fo‟,
Fm‟ et Fs sont mesurés sur des feuilles adaptées à la lumière. Les mesures sont faites par l‟action
d‟une série d‟impulsions lumineuses très rapides. Tiré du manuel d‟utilisation du LI-COR 6400
(LI-COR 2004).

L‟efficacité quantique (φPSII) peut aussi être déterminée en mesurant la pente initiale d‟une
courbe de réponse lumineuse (voir plus loin). Une diminution de la valeur des paramètres ETR,
Fv/Fm, Fv‟/Fm‟ et qP suite à un traitement de stress, de même qu‟une augmentation de la valeur
des paramètres qN et NPQ et Fo, indiquent un fonctionnement non optimal de l‟appareil
photosynthétique de la plante. Pour une intensité lumineuse donnée, la valeur qN augmente
lorsqu‟une des composantes de la photosynthèse est affectée de façon négative. Le surplus
d‟énergie emmagasinée dans les photosystèmes, engendré par un ralentissement du transport
dans la chaîne d‟électrons, doit alors être dissipé. Cette dissipation de l‟énergie emmagasinée se
fait principalement sous forme de dégagement de chaleur par le cycle de photoprotection des
xanthophylles (Taiz and Zeiger 1998).
 147

La prise de mesures ponctuelles de photosynthèse (échanges gazeux et fluorescence) est aussi

intéressante pour comparer des plantes soumises à différents traitements. Il est toutefois possible
de tirer davantage d‟information sur l‟état physiologique des plantes en effectuant des courbes de
réponse lumineuse et des courbes de réponse au CO2.

Les courbes de réponse lumineuse et la fluorescence

Générer une courbe de réponse lumineuse consiste à mesurer le taux d‟assimilation du CO 2 (ou
le taux de photosynthèse) à différentes intensités lumineuses. De cette courbe, il est possible de
dériver cinq paramètres qui traduisent l‟état de santé général de la photosynthèse (Figure A.3).

Figure A.3 Paramètres dérivés d‟une courbe de réponse lumineuse.

Voir le texte pour plus de détails sur les différents paramètres.
 148

En absence de lumière, les cellules de la plante restent actives et il est possible de mesurer le
taux de respiration (Resp.) des cellules photosynthétiques. Une valeur élevée de ce paramètre
signifie une activité métabolique intense.

Après une période d‟adaptation à l‟obscurité, les premiers photons absorbés par les feuilles sont
utilisés avec une efficacité maximale. À ce moment, le taux de photosynthèse augmente de façon
linéaire avec l‟intensité lumineuse. La pente de la courbe correspond alors à l‟efficacité
maximale photosynthétique, qu‟on appelle aussi efficacité quantique.

Le point de compensation lumineuse (Point de comp.) est atteint lorsque le flux quantique
absorbé induit un taux de photosynthèse égal au taux de respiration (bilan énergétique nul). Il
varie donc en fonction de taux de respiration et de l‟efficacité quantique.

Alors que l‟intensité lumineuse augmente, l‟efficacité photosynthétique diminue

progressivement. Le point de saturation lumineuse (Point de sat.) est atteint lorsqu‟une
augmentation de l‟intensité lumineuse n‟engendre plus d‟augmentation de la photosynthèse. À ce
moment, la phase photochimique (phase « claire ») produit davantage d‟énergie (ATP et
NADPH) que ce dont le cycle de Calvin (phase « sombre ») peut utiliser. Le point de saturation
lumineuse varie ainsi en fonction de l‟efficacité quantique et du taux de photosynthèse (ou
d‟assimilation) maximal (Amax). Conséquemment, une valeur plus faible que normale du point de
saturation lumineuse (ou de Amax) suggèrera une efficacité réduite du cycle de Calvin.

Passé une certaine intensité lumineuse, une diminution du taux de photosynthèse est observée, un
signe de « photodommages ». À ce moment, le surplus d‟énergie absorbé par les photosystèmes
ne peut être dissipé sous la forme d‟une réaction photochimique, de chaleur ou de fluorescence et
il y a formation de molécules réactives nocives pour les cellules, qui perturbent l‟intégrité
structurale de l‟appareil photosynthétique.
 149

Dans le contexte où une plante est attaquée par un insecte défoliateur, plusieurs scénarios sont
possibles quant à la réponse des différents paramètres dérivés de la courbe de réponse lumineuse.
La Figure A.4, ci-dessous, illustre quatre de ces possibilités.

Figure A.4 Comportement de la courbe de réponse lumineuse en fonction de l‟état

physiologique de la plante.
Quatre scénarios possibles (A à D) advenant un stress sont représentés (voir le texte pour les
détails).

Il est possible qu‟une plante qui montre des signes évidents de stress à l'échelle biochimique
ait une courbe de réponse lumineuse similaire à une plante témoin non stressée (Figure A.4A).
 150

De tels résultats seraient possiblement dus à la mise en place de mécanismes de compensation

chez la plante, malgré l‟importance des « dommages » biochimiques occasionnés suite au stress.

Il est aussi possible que le taux de photosynthèse maximal reste constant, mais que la pente de la
courbe de réponse lumineuse chez la plante stressée soit différente de celle du plant témoin
(Figure A.4B). Ce type courbe signifierait que l‟efficacité de la carboxylation n‟était pas affectée
par le stress (taux de photosynthèse maximal comparable), mais que tout le processus de
captation et de transfert de l‟énergie était affecté de façon négative (pente plus faible). On peut
envisager dans ce cas la déstabilisation d‟une ou plusieurs composantes structurales et
fonctionnelles de la phase photochimique de la photosynthèse. Une pente supérieure pourrait
aussi être observée chez la plante stressée; cette situation pourrait indiquer que les tissus
photosynthétiques surcompensent pour les surfaces disparues.

Il est probable par ailleurs que la pente initiale de la courbe demeure inchangée suite au
traitement de stress, mais que sa valeur maximale soit différente de celle retrouvée chez les
plants non stressés (Figure A.4C). Dans ce cas, ce serait plutôt la phase thermochimique qui
serait affectée. Une diminution de l‟activité rubisco pourrait être induite par une répression de sa
synthèse, de son assemblage ou de son activation, par exemple, se traduisant par une valeur
d‟Amax inférieur chez les plantes stressées.

Enfin, une combinaison des deux effets pourrait être notée (Figure A.4D). Dans ce cas, les
mesures de fluorescence devraient prendre des valeurs extrêmes. Il est à noter dans ce cas que
des mécanismes compensatoires de la plante puissent être activés dans la plante, mais non
suffisants pour maintenir un état physiologique « stable ». Il est à envisager que tout changement
de la courbe de réponse lumineuse observé suite à l‟un des traitements de stress aura un impact
sur les paramètres de fluorescence (mesurés et dérivés). Le Tableau A.2 présente deux cas
possibles.
 151

Tableau A.2 Impact de la variation de la pente et du taux d‟assimilation maximal (Amax) de la

courbe de réponse lumineuse sur les différents paramètres de fluorescence mesurés et dérivés.
Les paramètres peuvent diminuer (↓), augmenter (↑) ou rester inchangés (↔) en réponse au
stress.

Paramètres Pente stable Pente plus faible

Amax plus faible Amax stable
φPSII ↓ ou ↔ ↓
Fv/Fm ↓ ou ↔ ↓
Fv‟/Fm‟ ↓ ou ↔ ↓
ETR ↓ ou ↔ ↓
qP ↓ ou ↔ ↓
qN ↑ ou ↔ ↑
NPQ ↑ ou ↔ ↑
Fo ↑ ou ↔ ↑

En somme, les courbes lumineuses et les mesures de fluorescence sont de bons indicateurs de la
santé générale de l‟appareil photosynthétique des plantes et peuvent nous indiquer s‟il y a un
problème au sein de la chaine de transport des électrons (phase photochimique). Elles nous
renseignent aussi sur l‟efficacité globale de cycle de Calvin.

Les courbes de réponse au CO2

D‟autres mesures photosynthétiques peuvent être effectuées en complément aux mesures

ponctuelles de photosynthèse et de fluorescence et aux courbes de réponse lumineuse. En
particulier, les courbes de réponse au CO2, aussi appelées courbes ACi, mesurent le taux
d‟assimilation du CO2 (A) en fonction de la concentration intercellulaire de CO2 (Ci). En
 152

comparaison aux courbes de réponse lumineuse, qui nous informent sur l‟efficacité des processus
reliés à la captation de l‟énergie solaire, les courbes ACi permettent d‟apporter un diagnostic plus
précis à propos de l‟efficacité de la phase thermochimique de la photosynthèse.

Chez des plantes C3 comme la pomme de terre, le modèle de Farquhar et al. (1980) est le plus
souvent utilisé pour modéliser la réponse de la photosynthèse aux perturbations du milieu. Selon
ce modèle, les réactions biochimiques associées à la photosynthèse peuvent se trouver dans deux
états différents. Le premier état est rencontré lorsque les concentrations en CO2 sont faibles
(pression en CO2 inférieure à 20 Pa). Le taux de photosynthèse est alors dicté par les propriétés
de la rubisco (ribulose 1,5-biphosphate carboxylase/oxygénase), en tenant pour acquis que le
ribulose 1,5-bisphosphate (RuBP), substrat primaire de l‟enzyme, est présent en quantité
saturante. Le deuxième état est atteint lorsque la pression en CO2 est supérieure à 30 Pa. Le taux
de photosynthèse est alors prédit par le taux de régénération du RuBP. Comme le RuBP y est
utilisé à taux constant, cette phase de la photosynthèse est limitée par le taux de régénération du
RuBP, qui lui-même est dépendant des autres enzymes du cycle Calvin (Figure A.5). Entre 20 et
30 Pa de CO2 se trouve une zone de transition où la photosynthèse est limitée par l‟une ou l‟autre
de ces deux conditions biochimiques. Un troisième état peut également survenir lorsque la
productivité des chloroplastes est supérieure à la capacité des cellules à utiliser les produits des
chloroplastes, principalement les trioses phosphates. Dans ces conditions, la photosynthèse ne
répond plus à l‟augmentation de concentration en CO2 et le taux d‟assimilation maximum,
dépendant de l‟utilisation des trioses phosphates, peut être déterminé (Sharkey et al. 2007a). Cet
état n‟est rencontré que très rarement en conditions naturelles.
 153

Figure A.5 Vue schématique du cycle de Calvin.

Seules les principales étapes sont illustrées.

En pratique, il suffit de mesurer le taux de photosynthèse sous plusieurs concentrations de CO 2

dans chacun des états pour estimer plusieurs paramètres photosynthétiques et nous renseigner sur
l‟état physiologique de la plante (courbe ACi, Figure A.6). Lorsque la photosynthèse est limitée
par la rubisco (ligne rouge), il est possible de déterminer la vélocité maximale de la
carboxylation permise par la rubisco (Vcmax), égale à la pente initiale de la courbe. On peut aussi
connaître le taux de respiration diurne (Rd), qui correspond à l‟endroit où la courbe rejoint l‟axe
des ordonnées. Le paramètre Rd indique la perte nette de carbone associée au métabolisme de
base, une mesure de l‟activité cellulaire associée à la respiration mitochondriale. Lorsque la
photosynthèse est limitée par la régénération du RuBP (ligne verte), il est possible de calculer le
taux de transport d‟électrons servant à la réduction du NADP+ dans le cycle de Calvin (J),
essentiel à la régénération du RuBP. En présence de conditions saturantes de CO2 (ligne jaune),
l‟utilisation des trioses phosphates (TPU) peut être déterminée. Sharkey et al. (2007b) ont publié
un outil bioinformatique permettant de calculer ces différents paramètres à partir de données de
courbes ACi. Cet outil permet aussi d‟estimer la conductance du mésophylle (gm), qui influence
la disponibilité du CO2 dans les chloroplastes.
 154

Figure A.6 Paramètres dérivés des courbes ACi.

Les mesures de photosynthèse (Aobs) sont effectuées à des concentrations en CO2 qui déplacent
les réactions biochimiques dans les trois différents états, tels que décrits dans le texte. Tiré de
Sharkey et al. (2007b).

Ces cinq paramètres (Vcmax, Rd, J, TPU et gm) permettent de décrire la courbe ACi et, par
conséquent, de détecter tout changement que pourrait induire un traitement spécifique sur les
capacités photosynthétiques de la plante hôte. Par exemple, plusieurs études ont montré que la
transcription et la teneur spécifique en rubisco, ainsi que son activation, sont affectées
négativement en réponse aux stress (Hajduch et al. 2001; Hermsmeier et al. 2001; Giri et al.
2006; Mitra and Baldwin 2008). Une telle réponse pourrait facilement affecter le taux de
photosynthèse sous de faibles concentrations de CO2, c‟est-à-dire lorsque la photosynthèse est
limitée par la rubisco.
 155

En résumé

En adoptant une approche intégrée où les données des courbes de réponse lumineuse, des
courbes ACi et de fluorescence sont analysées conjointement, nous pouvons avoir une bonne idée
de l‟état physiologique de plantes soumises à différents stress. La complémentarité de ces
mesures permet de cibler les composantes déficientes du système, le cas échéant.