Vous êtes sur la page 1sur 216

N dordre 348-2009

Anne 2009

THESE DE LUNIVERSITE DE LYON Dlivre par LUNIVERSITE CLAUDE BERNARD LYON 1

ECOLE DOCTORALE E2M2

DIPLOME DE DOCTORAT tel-00482109, version 2 - 29 Feb 2012 (arrt du 7 aot 2006)

soutenue publiquement le 14 dcembre 2009 par

Frdric LEHEMBRE

Rponses adaptatives des microorganismes eucaryotes du sol aux pollutions mtalliques

Directeur de thse : Dr Roland MARMEISSE Co-encadrante: Dr Laurence FRAISSINET-TACHET JURY : Mr Roberto GEREMIA, DR CNRS, HDR, Universit de Grenoble Mr Telesphore SIME-NGANDO, DR CNRS, HDR, Univ. Clermont Ferrand Mr Max MERGEAY, Professeur Honoraire, Univ. Libre de Bruxelles Mr Roland MARMEISSE, CR CNRS, HDR, Universit Lyon1 Mr Bruno COMBOURIEU, Professeur, Universit Lyon1 Rapporteur Rapporteur Rapporteur Examinateur Prsident

UNIVERSITE CLAUDE BERNARD - LYON 1


Prsident de lUniversit Vice-prsident du Conseil Scientifique Vice-prsident du Conseil dAdministration Vice-prsident du Conseil des Etudes et de la Vie Universitaire Secrtaire Gnral

M. le Professeur L. Collet
M. le Professeur J-F. Mornex M. le Professeur G. Annat M. le Professeur D. Simon

M. G. Gay

COMPOSANTES SANTE
tel-00482109, version 2 - 29 Feb 2012

Facult de Mdecine Lyon Est Claude Bernard Facult de Mdecine Lyon Sud Charles Mrieux UFR dOdontologie Institut des Sciences Pharmaceutiques et Biologiques Institut des Sciences et Techniques de Radaptation Dpartement de Formation et Centre de Recherche en Biologie Humaine

Directeur : M. le Professeur J. Etienne Directeur : M. le Professeur F-N. Gilly Directeur : M. le Professeur D. Bourgeois Directeur : M. le Professeur F. Locher Directeur : M. le Professeur Y. Matillon Directeur : M. le Professeur P. Farge

COMPOSANTES SCIENCES ET TECHNOLOGIE


Facult des Sciences et Technologies Directeur : M. Le Professeur F. Gieres

UFR Sciences et Techniques des Activits Physiques et Sportives Directeur : M. C. Collignon Observatoire de Lyon Institut des Sciences et des Techniques de lIngnieur de Lyon Institut Universitaire de Technologie A Institut Universitaire de Technologie B Institut de Science Financire et d'Assurance Institut Universitaire de Formation des Matres Directeur : M. B. Guiderdoni Directeur : M. le Professeur J. Lieto Directeur : M. le Professeur C. Coulet Directeur : M. le Professeur R. Lamartine Directeur : M. le Professeur J-C. Augros Directeur : M R. Bernard

Remerciements
Ce travail a t ralis dans le Laboratoire dEcologie Microbienne (UMR 5557 CNRS-Universit Lyon 1) dirig par Ren Bally, au sein de lquipe Symbiose mycorhizienne. Il a t dirig par Roland Marmeisse et co-encadr par Laurence FraissinetTachet entre novembre 2006 et novembre 2009. Je tiens remercier toutes les personnes qui mont aid, support et soutenu pendant toute ma thse. Mes remerciements vont en priorit Roland Marmeisse et Laurence Fraissinet-Tachet pour mavoir accueilli au sein de leur quipe et pour mavoir transmis tant de connaissances thoriques et techniques qui ont inspir ce travail. Je vous remercie galement pour votre soutien et votre disponibilit tout au long de ces annes. Mes remerciements vont galement Gilles Gay, Delphine Melayah et Patricia Luis pour leurs remarques et leurs ides lors de la prparation de mes prsentations orales. Je tiens remercier les membres de mon comit de pilotage, Damien Blaudez, Jacques Bourguignon et Marc Lemaire pour leurs prcieux conseils et leurs soutiens. Merci Jan Colpaert pour son accueil et sa disponibilit lors des campagnes dchantillonnages en Belgique. Je remercie bien sr toute les personnes qui ont contribu la ralisation de ce projet: Marie-Christine Verner, Elise David, Sandrine Perrotto, Sophie Cros, Laurie Flix, Benjamin Doix, Charlotte Guillarme et Jessica Baude. Merci toutes les personnes de lquipe 2 : Jeanne, Concetta, Coralie, Laurent, Chrisse pour lambiance chaleureuse qui rgnait au Batiment Lwoff. Un grand merci aux tudiants du laboratoire dcologie microbienne qui pour la plupart sont devenus des amis proches. Un grand merci vous tous : Olivier, Vincent, Karima, Edwige, Marie-Lara, Jean, David, Florient, Amel, Lamiae, Bn, Clo, Tony, Steph, Arnaud et tous les autres. Enfin un grand merci ma famille et mes proches pour mavoir fait confiance et mavoir soutenu toutes ces annes.

tel-00482109, version 2 - 29 Feb 2012

Sommaire
Remerciements....2 Sommaire3 Abrviations....5 Rsum....6 Introduction gnrale..7 Synthse bibliographique....9 1. La phylognie10 1.1 La systmatique10 1.2 La notion de biodiversit..10 1.3 Les mthodes de classifications actuelles12 2. Aperu de la phylognie des microorganismes eucaryotes..16 2.1 Larbre du vivant16 2.2 Phylognie et volution...17 2.3 Les microorganismes eucaryotes18 3. La diversit microbienne dans lenvironnement...35 3.1 Lenvironnement sol : un rservoir de diversit microbienne35 3.2 Caractristiques de lenvironnement sol.36 3.3 Accder la diversit des microorganismes du sol36 3.4 La diversit microbienne dans dautres cosystmes.51 3.5 Conclusion..54 4. Impact dune pollution mtallique sur les organismes eucaryotes du sol55 4.1 Les mtaux lourds...55 4.2 Effets au niveau cellulaire..56 4.3 Toxicit et adaptation.60 4.4 Mcanismes microbiens eucaryotes de tolrance aux mtaux...64 4.5 Conclusion.74 Chapitre 1- Molecular diversity of soil eukaryotic communities, different molecules (18S rDNA versus cDNA) tell different stories75 Rsum..80 Introduction...81 Marriels et mthodes...82 Rsultats....85 Discussion.87 Figures et tableaux.95 Chapitre 2- Identification dun nouveau groupe de microorganismes eucaryotes106 1. Analyse des banques ribosomiques 18S.107 2. Analyse spcifique de nouvelles squences ribosomiques 18S .109 2.1 Dessin des amorces spcifiques.109 2.2 Vrification de la spcificit des amorces.109 2.3 Recherche dans dautres environnements..111 3. Discussion..116

tel-00482109, version 2 - 29 Feb 2012

Chapitre 3- Le mtatranscriptome eucaryote dun sol pollu et non pollu aux mtaux lourds...119 1. Sites tudis.120 2. Etude de la diversit taxinomique...121 2.1 Construction des banques ribosomiques 18S eucaryotes..121 2.2 Vrification de la qualit des banques..122 2.3 Rpartition au sein des phyla eucaryotes..124 2.4 Estimation de la richesse taxinomique des Eucaryotes.....132 2.5 Conclusions...135 3. Etude de la diversit fonctionnelle..137 3.1 Construction des banques dADNc...137 3.2 Analyse des banques dADNc par squenage massif.140 3.3 Criblage des banques dADNc par expression htrologue dans la levure..148 3.4 Conclusions...155 4. Discussion...156 Conclusions et Perspectives165 tel-00482109, version 2 - 29 Feb 2012 Matriels et mthodes.169 1. Sols tudis.172 2. Extraction des acides nucliques172 3. Hybridation des ARNm eucaryotes polyadnyls sur billes magntiques-dT25............179 4. Transcription inverse des ARNm...179 5. Amplification par PCR des ADNr 18S partir de lADN de sol et des ARN de sol rtrotranscrits......180 6. Purification de fragments dADN sur gel dagarose...180 7. Banque dADN et dARN ribosomiques182 8. Banque dADN complmentaires...184 9. Mthodes molculaires appliques Escherichia coli...186 10. Extraction et purification dADN plasmidique bactrien.....187 11. Analyse bioinformatique des squences dADNr et dARNr 18S189 12. Analyses statistiques.189 13. Levures..190 Bibliographie...196 Annexe 1.211 Annexe 2.213

Liste des abrviations


AA ADN ADNc ADNr ARN ARNm ARNr ARNt BSA DNase dNTP EDTA EST kb LB min pb PCR rpm RT RT-PCR SEVAG Tris Acides amins Acide dsoxyribonuclique ADN complmentaire ADN ribosomique Acide ribonuclique ARN messager ARN ribosomique ARN de transfert Albumine srique bovine Dsoxyribonuclase 2-doxynucloside 5-trisphosphate Acide Ethylnediamine ttraactique Expressed Sequence Tag kilobase Luria-Bertani minute paire de base Raction de Polymrisation en Chaine rotation par minute Rverse Transcription Rverse Transcription de lARN suivie dune PCR Chloroforme/Alcool isoamylique (24:1) Tris (hydroxymthyl)-aminothane

tel-00482109, version 2 - 29 Feb 2012

Rsum
Les sols pollus par des mtaux lourds sont coloniss par des communauts de microorganismes qui ont dvelopp diffrentes adaptations leur permettant de rsister ces contaminants. Afin d'analyser au niveau molculaire la diversit de ces adaptations, une approche exprimentale innovante base sur l'tude du mtatranscriptome eucaryote des sols a t utilise pour comparer les fonctions exprimes au sein d'une communaut de microorganismes eucaryotes colonisant un sol contamin, anciennement contamin et non contamin par des mtaux lourds. Les banques dADNc eucaryotes construites partir des ARNm extraits directement de ces sols ont t cribles par squenage alatoire de leurs inserts et par complmentation fonctionnelle de mutants de levures sensibles au cadmium. Cette tude a permis didentifier de nouveaux gnes et de nouveaux mcanismes impliqus dans la rsistance au cadmium ainsi quun nombre important de nouvelles protines hypothtiques. Ceci dmontre lintrt appliqu de cette approche pour la recherche de nouveaux biocatalyseurs et molcules bioactives. En parallle, la diversit microbienne eucaryote a t rvle et compare entre les sols par le clonage-squenage du gne codant la petite sous-unit ribosomique 18S. Cette tude a mis en vidence une diversit inattendue de microorganismes eucaryotes dans ces sols et une analyse phylogntique a permis de dcouvrir un nouveau clade de protistes (Rhizaria, Cercozoa). Mots cls: microorganismes eucaryotes, diversit taxinomique, diversit molculaire, mtatranscriptome, mtaux lourds.

tel-00482109, version 2 - 29 Feb 2012

Summary
Heavy metal-polluted soils are colonised by microbial communities which have developed different adaptations that allow them to resist to these pollutants. The objectives of this study were to reveal at the molecular level the diversity of these adaptations. To this aim, we implemented an innovative approach based upon the analysis of soil eukaryotic metatranscriptome to compare resistance mechanisms expressed by eukaryotic microorganisms living in heavy metal contaminated and control non contaminated or formerly-contaminated soils. Eukaryotic cDNA libraries were prepared using mRNA directly extracted from these soils and screened by either systematic sequencing of their inserts or functional complementation of yeast mutants sensitive to cadmium. This study allowed us to characterise novel genes and mechanisms implicated in Cd resistance as well as numerous novel hypothetical proteins. This study also demonstrates the potential of this experimental approach to look for novel biocatalysts as well as novel bio-active molecules. In addition, eukaryotic molecular diversity was studied by the cloning-sequencing of the gene encoding the 18S ribosomal RNA. This study revealed an unexpected diversity of eukaryotic diversity in the studied soils and allowed us to discover a novel clade of protists (Rhizaria, Cercozoa). Key words: eukaryotic microorganisms, taxonomic diversity, molecular diversity, metatranscriptome, heavy metal.

Introduction gnrale
Les cosystmes sont de plus en plus souvent soumis des pressions anthropiques qui perturbent durablement leur fonctionnement. Cest le cas des pollutions dorigine industrielle parmi lesquelles la dposition de mtaux lourds dans les sols. Laccumulation de ces composs chimiques non dgradables et potentiellement toxiques perturbe et modifie les quilibres comptitifs entre espces et conduisent llimination de certaines, limplantation de nouvelles et en dfinitive ventuellement une diminution (ou voire une augmentation) de la diversit biologique (Amaral Zettler et al., 2002). Les pollutions par de trs fortes quantits de polluant conduisent souvent une limination directe de nombreuses espces tel-00482109, version 2 - 29 Feb 2012 sensibles par toxicit aigue. A long terme les cosystmes subissant une pollution chronique leve se trouvent donc coloniss par des espces et des individus dont une des caractristiques principales qui dtermine leur prsence sur ces sites est leur capacit rsister aux toxiques (Blaudez et al., 2000b ; Colpaert et al., 2000). La rsistance aux mtaux peut rsulter dun phnomne de plasticit phnotypique par modification du profil dexpression de gnes ou bien de mutations prsentes potentiellement au sein de populations dorganismes colonisant des milieux non contamins. Des tudes de profils dexpressions de gnes ont permis de reflter la modification de lexpression de gnes dorganismes modles en condition de stress mtallique (Vido et al., 2001 ; Bellion et al., 2006 ;Weber et al., 2006). Le but de mon projet de thse a t dtudier les rponses adaptatives des microorganismes eucaryotes du sol soumis des pollutions chroniques par des mtaux lourds. Ces microorganismes jouent un rle essentiel dans la vie des sols et contribuent leur fertilit. Les champignons sont par exemple les principaux dcomposeurs primaires de la matire organique et ils jouent aussi un rle important en interagissant de faon bnfique (symbiontes mycorhiziens) ou ngative (pathognes) avec les macroorganismes vgtaux ou animaux. Les protistes quant eux sont sans doute parmi les principaux rgulateurs des populations de microorganismes. A limage de beaucoup de bactries, de trs nombreux microorganismes eucaryotes ne sont pas cultivables en condition de laboratoire et de nombreuses espces restent dcrire. Nous nous sommes donc fix comme objectif de vouloir rvler et analyser in situ la diversit des mcanismes mis en uvre par lensemble dune communaut de microorganismes eucaryotes pour rsister aux mtaux lourds et donc leur permettant de

coloniser et dassurer des fonctions essentielles au fonctionnement biologique dun sol pollu. Ce travail ne se limite pas la seule tude dune ou plusieurs espces modles ; il sintresse lensemble des microorganismes eucaryotes dun sol, connus ou inconnus, cultivables ou non cultivables. La ralisation de cet objectif a ncessit la mise en uvre dune approche exprimentale de mtatranscriptomique dveloppe chez les microorganismes procaryotes et qui a rcemment permis de rvler la structure et le fonctionnement de communauts bactriennes des sols (Leininger et al., 2006 ; Urich et al., 2008) et les environnements marins (Poretsky et al., 2005 ; Frias-Lopez et al., 2008 ; Gilbert et al., 2008 ; Poretsky et al., 2009). Cette approche a t utilise au laboratoire pour ltude dune communaut de microorganismes eucaryotes colonisant un sol forestier (Bailly et al., 2007). Dans le cadre de ma thse cette approche a t utilise pour comparer trois communauts microbiennes eucaryotes, lune colonisant un sol fortement contamin par des tel-00482109, version 2 - 29 Feb 2012 mtaux lourds, la seconde un sol anciennement contamin par des mtaux lourds et la troisime un sol tmoin non contamin. Pour chacune de ces communauts une banque dADNc a t ralise dans un plasmide permettant lexpression des gnes clons dans la levure Saccharomyces cerevisiae. Chacune de ces banques a t crible pour des gnes confrant une rsistance au stress mtallique par complmentation fonctionnelle de diffrents mutants de levure sensibles aux mtaux tudis. Les banques du sol non contamin et du sol contamin aux mtaux lourds ont aussi fait lobjet dun squenage systmatique de leurs inserts. La rpartition des gnes dans diffrentes classes fonctionnelles a permis de rvler le profil dexpression global des diffrentes communauts. En parallle, la diversit taxinomique des communauts eucaryotes prsentes dans chacun des sols a t tudie par lanalyse des squences ribosomiques 18S amplifies par PCR partir des ADN et des ARN environnementaux. Dans un premier temps, il sera prsent un bilan succinct de nos connaissances concernant la biodiversit des organismes eucaryotes dans lenvironnement prcd de notions gnrales de phylognie ncessaire leur classification. Un bilan des nouvelles approches de gnomiques environnementales et leurs retombes pour ltude de la diversit taxinomique et fonctionnelle des microorganismes seront ensuite exposs. Pour finir, nous aborderons le thme des pollutions mtalliques et leur impact sur les organismes vivants du sol et nous prsenterons les connaissances acquises sur des organismes eucaryotes modles quant aux mcanismes permettant une rsistance accrue aux mtaux lourds.

tel-00482109, version 2 - 29 Feb 2012

Synthse

bibliographique

1. La phylognie
1.1 La systmatique
Il sagit de la science des classifications. Elle permet didentifier et de dcrire les tres vivants prsents dans la nature prsente et passe. Une fois cet inventaire effectu, elle sattache les classer de faon rendre intelligible leur immense diversit. En biologie, la logique la plus pertinente pour classer les espces est celle de leur parent volutive. Limportance de la systmatique est particulirement bien illustre par les sciences de lenvironnement. En effet, la liste des espces et leur abondance respective dans un milieu donn sont dexcellents indicateurs de ltat de sant de celui-ci (Beeby, 2001). Toutes les dcisions prendre en matire de protection des milieux dpendent troitement dune bonne tel-00482109, version 2 - 29 Feb 2012 connaissance de la biodiversit qui les peuple. De mme, la lutte contre les grandes pidmies parasitaires ne saurait progresser sans une bonne connaissance de la systmatique des parasites et des espces vectrices.

1.2 La notion de biodiversit


La diversit des tres vivants, ou biodiversit, peut tre perue de deux manires. La premire rsulte dune approche du milieu naturel. Par exemple, les espces peuvent tre classes suivant le milieu quelles occupent ou encore suivant leur capacit tolrer un stress environnemental. Ces groupes servent lcologie et aux sciences de lenvironnement, sciences des processus. La seconde perception de la biodiversit se rfre lhistoire pour expliquer sa structure. Cette classification rpond la question, do cela vient-il ? En effet, les contraintes dun mme milieu peuvent engendrer lapparition de structures similaires, convergentes, chez des espces trs loignes phylogntiquement. Si les groupes cologiques servent lanalyse du fonctionnement dun biotope, on ne peut le comprendre compltement sans intgrer son histoire. Or, cette histoire ne saurait tre reconstruite sans loutil phylogntique. Pour qui veut expliquer la biodiversit, la dimension historique est incontournable.

10

D
Anctre Anctre

a. Groupes monophyltiques

tel-00482109, version 2 - 29 Feb 2012

Anctre

b. Groupe paraphyltique

c. Groupe polyphyltique

Figure 1. a : un groupe monophyltique comprend un anctre et tous ses descendants. DE et CDE sont tous deux des groupes monophyltiques. b : Le groupe paraphyltique comprend un anctre et une partie seulement de ses descendants. Lun des membres du groupe (ici D) est plus proche dun taxon hors du groupe (E) quil ne lest de ces collatraux dans le groupe C. c : Le groupe polyphyltique comprend des membres (ici BD) sans anctre commun dans le groupe (daprs Lecointre et Le-Guyader, 2001).

11

1.3 Les mthodes de classifications actuelles


Aujourdhui, il existe des algorithmes de construction darbres partant de squences dADN qui exploitent spcifiquement la similitude globale, ou reposent sur une approche probabiliste. Les premiers, les algorithmes phntiques sont efficaces tant que la dissimilarit reste proportionnelle au degr dapparentement (ce qui nest pas toujours le cas). Les seconds, les algorithmes probabilistes, utilisent des probabilits de changements dun nuclotide en un autre ou dun acide amin en un autre pour calculer la vraisemblance des donnes pour un arbre. Brivement dit, trois grandes familles dalgorithmes sont donc utilises aujourdhui : cladistique, phntique et probabiliste (maximum de vraisemblance). Elles sont toutes pratiques laide de loutil informatique tel-00482109, version 2 - 29 Feb 2012 1.3.1 La cladistique

Lanalyse cladistique vise reconstruire la phylognie dun taxon par distinction, au sein dun caractre, de ltat primitif (plsiomorphe) de ltat driv (apomorphe) (Hennig 1950). Ceci nest valable quau sein dun taxon. On appelle taxon tout groupe dorganismes reconnu et nomm par les taxinomistes, sans niveau prcis (ce peut tre une varit, une espce, un ordre, ou mme un rgne). A ce niveau, seuls les tats de caractres drivs partags (synapomorphies ou innovations du groupe) sont des signes dapparentement exclusif ; les regroupements sur base dtats drivs partags conduisent donc la cration de groupes monophyltiques. Pour que la classification soit strictement phylogntique, elle ne doit contenir que des groupes monophyltiques. Un groupe monophyltique comprend un anctre hypothtique et lensemble de ces descendants (Fig. 1.a). Les groupes paraphyltiques et polyphyltiques sopposent aux groupes monophyltiques en cela quil leur manque quelque chose. Au premier, il manque certains descendants de lanctre commun et au second, il manque lanctre commun (Fig. 1.b et 1.c). Fonder des groupes sur des caractristiques cologiques, adaptatives, lies un progrs ou une augmentation de complexit conduit souvent construire des groupes paraphyltiques. 1.3.2 La phntique

Les mthodes phntiques analysent les donnes dune autre manire. A loppos de la cladistique, elles tentent de quantifier la ressemblance gnrale entre organismes ; pour cela

12

elles calculent un indice de similitude globale entre deux taxons, c'est--dire une distance pour chaque couple de taxons. Dans le cas des squences alignes, cette distance est le nombre de nuclotides diffrents entre deux espces (ou dacides amins diffrents dans le cas de squences protiques), divis par le nombre de sites examins. En somme, il sagit dun pourcentage de diffrences entre les squences de deux espces. Les distances sont inscrites dans une matrice. Il existe plusieurs techniques de construction dun arbre partir dune telle matrice. La plus simple est celle de lUPGMA (Unweighted Pair Group Method using Averages) (Kuhn et al., 1978) qui trouve un seul arbre partir dune matrice, par agglomration successive des espces, des plus proches aux plus loignes. Elle ncessite lhypothse que les squences voluent la mme vitesse dans toutes les branches de larbre, mais ce postulat est rarement vrifi. tel-00482109, version 2 - 29 Feb 2012 Une autre technique, base sur un algorithme plus labor, est celle dite du NeighborJoining (Saitou et Nei, 1987). Elle permet dintroduire un critre de minimisation de la longueur totale de larbre. Elle construit un seul arbre, mais en ne choisissant pas ncessairement ds le dpart dagglomrer les espces les plus proches. A chaque tape dagglomration, elle choisit en revanche dagglomrer les espces dont le regroupement va minimiser la longueur de larbre. De nos jours, les mthodes de distances sont surtout utilises sur des donnes molculaires et non plus sur des donnes morphologiques. Contrairement une ide fausse assez rpandue, les donnes de squences ne doivent pas forcment tre analyses laide de distances et peuvent parfaitement faire lobjet dune approche cladistique. 1.3.3 Les autres mthodes

Hormis ces mthodes les plus couramment utilises, il existe dautres mthodes comme les mthodes probabilistes qui tablissent un modle constitu dun ensemble de paramtres dont le rglage formule diffrentes hypothses. Ces hypothses concernent surtout lvolution des tats de caractres et sont exprimes en termes de probabilits. Comme tout arbre implique des changements dtats de caractres le long de ses branches, toutes les probabilits associes aux transformations impliques par un arbre donn vont se multiplier et fournir une valeur globale de vraisemblance des donnes associes cet arbre. Parmi les arbres possibles, larbre choisi est celui dont la vraisemblance des donnes au vu du modle

13

est maximale. Cette mthode fonctionne sur les caractres molculaires, pour lesquels on peut tablir des modles dvolution des protines et des acides nucliques. 1.3.4 Notions associes ces mthodes

1.3.4.1 Lattraction des branches longues Toutes les mthodes sont sujettes lartefact dattraction des branches longues. Cet artefact provient des ingalits du taux dvolution des caractres entre les lignes analyses. Les espces qui voluent plus vite que les autres ont leur branche propre plus longue. On a pu montrer thoriquement et exprimentalement quau-del dun certain cart de vitesse dvolution entre les espces, les espces qui voluent plus vite ont plus de chance davoir des tel-00482109, version 2 - 29 Feb 2012 tats de caractres communs par hasard que par ascendance commune, et que le nombre de caractres communs ainsi acquis (homoplasie) devenait suprieur aux caractres qui auraient d les sparer. Par consquent, elles sont regroupes ensemble dans larbre indpendamment de leurs parents : cest ce quon appelle lattraction des branches longues. 1.3.4.2 Le bootstrap La robustesse dun arbre phylogntique repose sur la valeur de bootstrap (Felsenstein, 1985). Il sagit de mesurer, sans utiliser dinformations extrieures, le degr avec lequel un jeu de donnes (le plus souvent de squences) supporte un regroupement. Le bootstrap procde un tirage avec remise des caractres, en loccurrence des sites de la squence, jusqu ce que le nombre de sites tirs soit identique au nombre de sites du jeu initial de donnes. Ce processus est rpt un grand nombre de fois (en gnral 1000 fois). On obtient donc un grand nombre darbres, qui reprsentent en fait un grand nombre de regroupements, et dont certains, bien entendu, sont contradictoires. Le rsultat est gnralement reprsent sous forme dun arbre consensus dans lequel figurent tous les regroupements majoritairement apparus. Chaque regroupement (chaque nud) possde alors un pourcentage qui indique la proportion darbres issus des tirages qui le prsentent. Cest la valeur de bootstrap, ou la proportion du bootstrap du nud. On peut aussi prsenter larbre le plus parcimonieux issu dune analyse cladistique standard et poser sur les clades leur valeur de bootstrap.

14

tel-00482109, version 2 - 29 Feb 2012

Figure 2: Un arbre rticul ou en rseau, qui pourrait reprsenter convenablement l'histoire de la vie. (daprs Doolittle, 1999).

15

Il faut souligner que la robustesse nest pas tout. En effet, les indices de robustesse peuvent tre eux aussi victimes dartefact. La robustesse nest pas la fiabilit. Pour quun rsultat phylogntique nouveau puisse tre considr comme fiable, il doit tre rpt plusieurs fois indpendamment, c'est--dire par des chercheurs diffrents et partir de jeux de donnes indpendants.

2. Aperu de la phylognie des microorganismes eucaryotes


2.1 Larbre du vivant
Avant le dveloppement des mthodes molculaires, il tait impossible de connatre les relations phylogniques connectant les tres vivants et donc dlaborer un arbre universel tel-00482109, version 2 - 29 Feb 2012 de lvolution. Whittaker, en 1969, commena dvelopper des mthodes molculaires et classer les tres vivants dans 5 rgnes : les animaux, les plantes, les champignons, les protistes et les bactries. (Whittaker, 1969). Il avait galement diffrenci les eucaryotes, organismes contenant une membrane nuclaire, des procaryotes, prdcesseurs supposs des eucaryotes et dpourvus de membrane nuclaire. La dcouverte qui a remis en question les notions mises prcdemment et qui a permis dordonner la diversit microbienne, et donc la diversit biologique, est apparue avec la mise en vidence de squences molculaires et le concept que ces squences peuvent tre utilises pour relier les organismes. Cette formulation a t fate par Carl Woese (1977) qui, par comparaison des squences dARN ribosomique, a tabli un arbre phylogntique bas sur des squences molculaires qui peut tre utilis pour relier tous les organismes et reconstruire lhistoire de la vie (Woese et Fox, 1977 ; Woese, 1987). Woese articule les 3 lignes primaires de lorigine de lvolution reconnues actuellement, en termes de domaines ou rgnes : eucaryotes, bactriens (appels initialement eubactries) et archaes (appel archaebactrie) (Fig. 2).

16

2.2 Phylognie et volution


2.2.1 LARNr et autres donnes molculaires chronomtres

Les squences dARNr sont considres comme de bons

molculaires de lvolution. Ces molcules sont codes en abondance par tous les organismes vivants et ont une fonction fondamentale essentielle. De plus, elles possdent une structure conserve et universelle qui renferme des parties volution lente et des parties volution rapide. Dautres molcules sont aussi connues pour tre de bons chronomtres molculaires , comme par exemple, le gne de la grande sous unit de lARN polymrase (Hirt et al., 1999) ou les squences protiques du facteur dlongation 2 (Hashimoto et al., 1995) et des tubulines (Edgcomb et al., 2001). tel-00482109, version 2 - 29 Feb 2012 Lanalyse des ARNr et dautres donnes molculaires confirment solidement la notion issue du sicle dernier que les organelles majeures des eucaryotes (mitochondries et chloroplastes des Plantae) proviennent de symbiontes bactriens qui ont subi des spcialisations pendant la covolution avec leurs cellules htes (Margulis, 1975). Des comparaisons de squences confirment que les mitochondries sont des reprsentants de protobactries (groupe incluant Escherichia et Agrobacterium) et que les chloroplastes proviennent des cyanobactries (Synechococcus et Gloeobacter) (Sapp, 1994). Cependant, des arbres bass sur les squences dARNr et dautres molcules montrent que le noyau eucaryote semble tre profondment ancr dans lhistoire de la vie. Les mitochondries et les chloroplastes sont apparus relativement plus tard. Cette volution tardive est vidente par le fait que les mitochondries et les chloroplastes divergent dorganismes libres situs la priphrie de larbre molculaire du vivant. De plus, leucaryote le plus profondment ancr est dpourvu de mitochondrie (Cavalier-Smith, 1993). Ces organismes, peu tudis, comme Giardia, Trichomonas et Vairimorpha, contiennent cependant au moins quelques gnes de type bactrien (Bui et al., 1996). Ces gnes peuvent tre la preuve dune symbiose mitochondriale antrieure qui a t perdue ou dun vnement de transfert de gnes. Par ailleurs, les reprsentants modernes deucaryotes et darchaea partagent beaucoup de proprits qui diffrent fondamentalement des cellules bactriennes. Un exemple de similarit et de diffrence est celui de la machinerie transcriptionnelle. Les ARN polymrases des eucaryotes et des archaea se ressemblent plus entre elles quelles ne ressemblent celles des bactries et, alors que toutes les cellules bactriennes utilisent le facteur sigma pour

17

rguler linitiation de la transcription, les cellules eucaryotes et les archaea utilisent des protines se liant la boite TATA (Rowlands et al., 1994). Le squenage du gnome de larchaea Methanococcus jannaschii montre cependant que la ligne volutive des archaea est indpendante de celles des eucaryotes et des bactries (Bult et al., 1996). Toutes ces donnes ont permis dmettre lhypothse dune origine eucaryote de la vie sur Terre (Pace, 2009). 2.2.2 Limites de la phylognie molculaire classique

La phylognie molculaire base uniquement sur une simple squence de gne ou de protine ne permet pas de dduire les relations les plus profondes dans le domaine des eucaryotes. Cette approche souffre dun manque de rsolution cause du faible nombre de tel-00482109, version 2 - 29 Feb 2012 sites informatifs analyss, de lhtrognit de la composition des squences tudies et des problmes lis lattraction des longues branches (Stiller et Hall, 1999 ; Philippe et Germot, 2000 ; Dacks et al., 2002). De plus, dans quelques cas, le gne analys peut tre transfr latralement entre les lignes tudies (Andersson, 2005). Rcemment, la disponibilit de quantits normes de donnes de squenage de gnome et de projets dEST (Expressed Sequence Tag) sur une vaste gamme d'eucaryotes a permis deffectuer une valuation phylogntique partir de "supermatrices" dun plus ou moins grand nombre de gnes (Baldauf et al., 2000 ; Simpson et al., 2006 ; Bapteste et al., 2002 ; Arisue et al., 2005 ; Rodriguez-Ezpeleta et al., 2007 ; Patron et al., 2007 ; Burki et al., 2007). Malgr tout, quelques erreurs peuvent persister comme lattraction des longues branches (Bapteste et al., 2002 ; Rodriguez-Ezpeleta et al., 2007). Des analyses rcentes emploient donc des approches objectives de filtrage de donnes qui isolent et enlvent les sites ou les taxa qui contribuent le plus ces erreurs systmatiques (Rodriguez-Ezpeleta et al., 2007 ; Brinkmann et al., 2005).

2.3 Les microorganismes eucaryotes


La phylognie et donc la classification des eucaryotes est aujourdhui en pleine phase de dfrichage, pour ne pas dire en dchiffrage. Les phylognies molculaires nous rvlent des parents insouponnes, une fois vacus les artefacts de reconstruction phylogntique.

18

Notre comprhension de la biologie des eucaryotes est domine par ltude des plantes terrestres, des animaux et des champignons. Cependant, la majorit des eucaryotes en termes de taxons majeurs et probablement aussi en nombre de cellules pures, est compos exclusivement ou principalement de phylums unicellulaires. Un nombre important de ces phylums est encore mal caractris. 2.3.1 La cellule eucaryote

Les eucaryotes sont par dfinition des organismes cellules complexes. Mme "les plus simples" ont des noyaux avec de la chromatine fortement structure, des introns et de grands complexes de spliceosomes pour les exciser (Collins et Penny, 2005). Ils contiennent aussi des pores membranaires complexes pour contrler le trafic interne et externe (Jkely, 2005). tel-00482109, version 2 - 29 Feb 2012 Le cytoplasme est structur par un vaste cytosquelette facilitant le trafic intracellulaire, lendo-et exocytose et la locomotion amibode (Cavalier-Smith, 2002). La cellule eucaryote est galement composes d'organelles incluant, au minimum, une mitochondrie ou un driv de mitochondrie (Embley et Martin, 2006) et un appareil de Golgi pour synthtiser et recycler les protines (Mironov et al., 2007). Les flagelles des eucaryotes sont de grandes structures extracellulaires complexes ancres dans le cytoplasme sans rapport avec les structures bactriennes plus simples du mme nom (Pazour et al., 2005). Enfin, les cellules eucaryotes ont souvent des formes multiples fortement distinctes, incluant parfois des complexes multicellulaires. D'autre part, les eucaryotes sont assez uniformes mtaboliquement. Ceci, contraste avec les bactries, dont la diversit mtabolique est norme et probablement en grande partie inconnue (Frias-Lopez et al., 2008). Les eucaryotes dpendent danciennes bactries endosymbiotiques pour leur production dATP (mitochondrie et chloroplaste). Ces anciens symbiontes sont probablement universels parmi les eucaryotes existant, bien qu'ils aient t rduits fonctionnellement de multiples fois (Embley et Martin, 2006). 2.3.2 Classification des organismes eucaryotes

Notre comprhension de la phylognie des eucaryotes a commenc s'unir autour des donnes de projets de squenage grande chelle (Burki et al., 2007 ; Hackett et al., 2007 ; Rodriguez-Ezpeleta et al., 2005). Cependant, beaucoup de groupes d'eucaryotes, y compris des divisions majeures entires, ne sont que trs peu connus (Adl et al., 2005). De plus, la

19

tel-00482109, version 2 - 29 Feb 2012

Figure 3: Schma phylogntique de larbre de vie base sur les connaissances molculaires actuelles (petite sous unit de lARNr et autres donnes molculaires). Les triangles verts reprsentent les phyla, les divisions ou les groupes de haut rang taxonomique pour lesquels un membre a t cultiv et/ou dcrit correctement (par exemple, beaucoup d'espces de protistes). Les triangles rouges reprsentent les divisions ou les lignes fortement divergentes sans espces cultives/dcrites (daprs Lopz-Garcia et Moreira, 2008).

20

Figure 4: Photos dorganismes appartenant au phylum des Opisthokonta. Les lignes des Metazoa (1 3), des Choanoflagellida (4), des Nucleariidae (5) et des Fungi (6) sont reprsentes. tel-00482109, version 2 - 29 Feb 2012

Lignes Fungi Metazoa Nucleariidae Ichtyosporea Choanoflagellida Autres

Nombre de gnes 18S rfrencs dans GenBank 52444 152977 14 48 57 26

Nombre de gnomes squencs 34 44 0 0 1 0

Nombre de gnomes en cours de squenage 225 75 0 0 0 1

Tableau 1: Aperu du nombre de gnes 18S rfrencs dans GenBank (http://www.ncbi.nlm.nih.gov/) et du nombre de gnomes squencs et en cours de squenage (http://www.genomesonline.org/) de quelques lignes dOpisthokonta, la date du 21/09/2009.

21

comprhension de la diversit cryptique des eucaryotes, suppose norme, reste trs faible (Slapeta et al., 2005). Enfin, nous commenons tout juste dcouvrir lnorme diversit des pico et nano-eucaryotes, de taille bactrienne, dcouverts dans des banques de clones obtenues par amplification par PCR d'ADN environnemental (Moreira et Lopz-Garcia, 2002). Les eucaryotes les mieux tudis peuvent maintenant tre assigns un des sept ou huit phyla dfinis par Lopz-Garcia et Moreira, en 2008 (Fig. 3). 2.3.2.1 Les Opisthokonta Ce grand phylum regroupe des organismes htrotrophes, unicellulaires ou pluricellulaires. Les animaux et les champignons reprsentent les groupes taxinomiques les tel-00482109, version 2 - 29 Feb 2012 mieux tudis (Steenkamp et al., 2006). Chaque ligne a au moins 2 taxons unicellulaires frres ; les ichtyospores et les choanoflagells dans le cas des animaux, et les nuclariides et les rozellida dans le cas des champignons (Lara et al., 2009) (Fig. 4 et Tableau 1). Ces taxons regroupent des organismes dont le caractre ancestral commun est un flagelle unique postrieur. Les premires branches des champignons sont celles du groupe paraphyltique des chytridiomyctes (James et al., 2006). Il sagit dorganismes unicellulaires aquatiques formant des pseudohyphes. Ce sont les seuls champignons avec des flagelles. Les autres champignons sont des organismes multicellulaires hyphes ou unicellulaires (levures) avec une nutrition par absorption et peuvent produire des fructifications multicellulaires. Les champignons mycorhiziens sont parmi les plus tudis. Leur symbiose avec les plantes terrestres est probablement apparue trs tt dans lvolution et a probablement jou un rle important dans linvasion du milieu terrestre par les plantes (Wang et Qiu, 2006). Bien que l'arbre phylogntique fongique soit maintenant clair, le nombre d'espces non dcouvertes est probablement immense et est estim 95 % de toute les espces existantes (Vandenkoornhuyse et al., 2002 ; James et al., 2006). Les ichtyospores sont des parasites ou des symbiontes et possdent un flagelle et une forme amibode (cellule dformable et mettant des pseudopodes). Les choanoflagells, sont des organismes flagells aquatiques connu pour leur ressemblance avec les cellules collerettes (choanocytes) des ponges (Porifera). Ils codent des protines lies au dveloppement chez les mtazoaires (King et al., 2008).

22

6 6

tel-00482109, version 2 - 29 Feb 2012

Figure 5: Photos dorganismes appartenant au phylum des Amoebozoa. Les lignes des Flabellinea (1), des Mycetozoa (2), des Lobosea (3 et 4), des Archamoebae (5) et des Centramoebida (6) sont reprsentes.

Lignes

Nombre de gnes 18S rfrencs dans GenBank 136 131 40 626 346

Nombre de gnomes squencs 0 0 1 0 1

Nombre de gnomes en cours de squenage 0 0 2 2 5

Lobosea Flabellinea Archamoebae Centramoebida Mycetozoa

Tableau 2: Aperu du nombre de gnes 18S rfrencs dans GenBank (http://www.ncbi.nlm.nih.gov/) et du nombre de gnomes squencs et en cours de squenage (http://www.genomesonline.org/) des diffrentes lignes dAmoebozoa, la date du 21/09/2009.

23

2.3.2.2 Les Amoebozoa Les Amoebozoa incluent plusieurs divisions damibes libres (Fig. 5 et Tableau 2) telles que les Mycetozoa (par exemple, Dictyostelium: vie libre, mitochondriale) et les Archamoebae (par exemple, Entamoeba: parasite de lHomme, amitochondriale et Mastigamoeba: vie libre, amitochondriale) (Bapteste et al., 2002). Le faible nombre dorganismes isol et le peu de donnes molculaires disponibles sur ces organismes, rend leur phylognie incertaine. Les Amoebozoa ont une forme amibode et ont tendance avoir des pseudopodes en forme de tube, un noyau simple et des mitochondries tubulaires sillon (Adl et al., 2005). Des formes amibodes sont par ailleurs retrouves dans plusieurs autres super-groupes (Parfrey et al., 2006). Leur taille varie entre quelques microns et plusieurs tel-00482109, version 2 - 29 Feb 2012 millimtres, et plusieurs petites formes restent probablement dcouvrir. La formation de kyste pour survivre la dessiccation ou pour envahir lhte parasit est rpandue. La plupart des taxa sont sous forme libres dans les sols o ils jouent un rle de prdateurs bactriens. Les amibes communes du sol, appartenant la famille des Arcellinidae (division des Lobosea, genre Tubulinea), sont les seules amibes tests ( coquilles), lesquels sont construits partir de matriel organique. Les Opisthokontes et les Amoebozoa font partis des Unikonts c'est--dire des eucaryotes uniflagells. (Cavalier-Smith, 2002) 2.3.2.3 Les Plantae Egalement appel Archaeplastida, il sagit du groupe deucaryotes dans lequel la photosynthse est apparue en premier (Adl et al., 2005). Toutes les espces de ce groupe sont photosynthtiques l'exception de quelques lignes parasites ou htrotrophes mineures. On distingue 3 lignes distinctes, les rhodophytes, les glaucophytes et les chloroplastides (Fig. 6 et Tableau 3). Tous les autres eucaryotes photosynthtiques ont acquis leurs plastes par absorption dun organisme de ce groupe (endosymbiose secondaire), sauf une exception rcente (Nowack et al., 2008), et plusieurs preuves montrent que les chloroplastes des Plantae sont monophyltiques (Reyes-Prieto et al., 2007). La monophylie de leurs gnomes nuclaires est plus ambige (Rodriguez-Ezpeleta et al., 2005), probablement en raison de lanciennet du

24

Figure 6: Photos dorganismes appartenant au phylum des Plantae. Les lignes des Chloroplastida (1 et 2), des Glaucophyta (3 et 4) et des Rhodophyta (5 et 6) sont reprsentes. tel-00482109, version 2 - 29 Feb 2012

Lignes

Nombre de gnes 18S rfrencs dans GenBank 101882 16 3203

Nombre de gnomes squencs 13 0 1

Nombre de gnomes en cours de squenage 55 1 2

Chloroplastida Glaucophyta Rhodophyta

Tableau 3: Aperu du nombre de gnes 18S rfrencs dans GenBank (http://www.ncbi.nlm.nih.gov/) et du nombre de gnomes squencs et en cours de squenage (http://www.genomesonline.org/) des diffrentes lignes de Plantae, la date du 21/09/2009.

25

groupe et/ou de l'chantillonnage molculaire extrmement rare des taxa de rhodophytes et de glaucophytes. Les glaucophytes sont des organismes unicellulaires de forme variable. Ils peuvent tre biflagells et en forme de coque ou non-flagell et en forme de palme. Leur plaste (cyanelle) ressemble ceux des algues rouges. Ces dernires possdent des phycobiliprotines et des thylacodes non entasss et sont dpourvus de chlorophylle b. Les rhodophytes, plus communment appels algues rouges, sont pour la plupart des organismes marins et multicellulaires. Certaines de ces grandes algues sont capables de produire une enveloppe extracellulaire de carbonate de calcium qui, l'il nu, leur donne un aspect de roche. Deux sous-groupes majeurs sont reconnus, Bangiophyta et Florideophyta, qui ont probablement tous deux invent la multicellularit indpendamment. Les chloroplastides regroupent les plantes terrestres et la plupart des algues vertes. Ils tel-00482109, version 2 - 29 Feb 2012 incluent les Chlorophyta, les Ulvophyta, les Prasinophyta et les Strepsystera. La multicellularit est apparue plusieurs fois chez les chloroplastides. Les Chlorophyta, les Ulvophyta et les Strepsystera sont composs dorganismes uni et multicellulaires. 2.3.2.4 Les Rhizaria Une grande partie de ces organismes, mais pas tous, sont de forme amibode. Ces derniers ont tendance avoir des pseudopodes (filose) dirigs et des coquilles (des tests) constitues de matriels divers. Les divisions les plus connues sont les Radiolaires, les Foraminifres et les Cercozoaires (Pawlowski et Burki, 2009) (Fig. 7 et Tableau 4). Les Radiolaires sont des amibes exclusivement marines possdant "des squelettes" minraliss internes dont sont mis des filopodes semblables des bras (axopodia). Les Foraminifres sont largement distribus dans tous types denvironnements marins, deaux douces et terrestres. Ils sont de formes amibodes et possdent des pseudopodes rticuls avec un flux cytoplasmique bidirectionnel. Beaucoup construisent aussi des tests, qui sont organiques ou calcaires et avec une ou plusieurs loges. Les squelettes des foraminifres et des radiolaires ont considrablement contribu leur conservation depuis le cambrien. Ces tests fossiliss sont utiliss en micropalontologie comme des marqueurs biostratigraphiques et en palo-ocanographie comme des indicateurs de lge et de la profondeur des ocans et des anciennes tempratures de leau (Habura et al., 2004b). Le reste des Rhizaria forme un grand assemblage htrogne: les Cercozoa. Ce sont des amibes et des flagells htrotrophes. Certains ont acquis la photosynthse par 26

Figure 7: Photos dorganismes appartenant au phylum des Rhizaria. Les lignes des Radiolaria (1 et 2), des Foraminifera (3 et 4) et des Cercozoa (5 et 6) sont reprsentes. tel-00482109, version 2 - 29 Feb 2012

Lignes Radiolaria Foraminifera Cercozoa

Nombre de gnes 18S rfrencs dans GenBank 149 928 486

Nombre de gnomes squencs 0 0 0

Nombre de gnomes en cours de squenage 0 0 2

Tableau 4: Aperu du nombre de gnes 18S rfrencs dans GenBank (http://www.ncbi.nlm.nih.gov/) et du nombre de gnomes squencs et en cours de squenage (http://www.genomesonline.org/) de quelques lignes de Rhizaria, la date du 21/09/2009.

27

endosymbiose secondaire d'une algue verte (Archibald, 2005). Les Cercozoa incluent aussi des espces d'eau douce et/ou terrestre commune, comme les euglyphides, les haplosporides (endoparasites d'invertbrs d'eau douce et marine) et les plasmodiophorides (endoparasites importants de plantes ou dalgues stramnopiles) (Cavalier-Smith et Chao, 2003). 2.3.2.5 Les Stramnopiles (ou Heterokonta) Les stramnopiles sont caractriss par des flagelles avec des poils tripartites (stramnopiles) en ranges rigides, qui changent compltement le flux autour du flagelle pour permettre la cellule de se trainer en avant. La plupart possde aussi un second flagelle, plus court, et lisse (do le nom alternatif "htrokonte"). C'est un groupe extraordinairement divers incluant de nombreuses lignes tel-00482109, version 2 - 29 Feb 2012 dunicellulaires htrotrophes (bicosoecides), de parasites plasmodiales (oomyctes) comme Phytophthora infestans, responsable du mildiou de la pomme de terre, dalgues unicellulaires ubiquistes (diatomes et ochromonades) et de grandes algues multicellulaires gantes (xanthophytes et phaephytes) (Fig. 8 et Tableau 5). L'chantillonnage environnemental suggre lexistence de divisions majeures supplmentaires dans ce groupe, comprenant en grande partie, voir entirement, des espces trs petites (pico et nano-eucaryotes) (Moreira et Lopz-Garcia, 2002). 2.3.2.6 Les Alvolaires Ils incluent les cilis, les dinoflaglls et les apicomplexes. Ils sont caractriss par la prsence dalvoles corticales la base de leur membrane plasmique (Fig. 9 et Tableau 6). Les cilis sont trs riches en espces unicellulaires aquatiques caractrises par une abondance de flagelles et un noyaux dimorphe, le micronoyau (germinatif) et le macronoyau (Prescott, 2000). Ce sont des organismes htrotrophes pouvant se trouver sous forme libre (Paramecium sp.), parasite ou symbiotique. Les dinoflagells sont un groupe vari, principalement composs dorganismes unicellulaires avec des plaques caractristiques et deux flagelles ingaux qui provoquent un mouvement de nage rotatoire unique. Bien que le groupe soit originellement photosynthtique, seulement environ la moiti des espces existantes lest toujours. Les dinoflagells sont des symbiontes importants du corail et d'autres hydrozoaires et sont la principale source defflorescence d'algues nuisibles (mares rouges), 28

Figure 8: Photos dorganismes appartenant au phylum des Stramnopiles. Les lignes des Bicosoecida (1), des Oomycota (2), des Bacillariophyta (3), des Ochromonadaceae (4), des Xantophyceae (5) et des Phaeophyceae (6) sont reprsentes. tel-00482109, version 2 - 29 Feb 2012

Lignes Bicosoecida Oomycota Bacillariophyta (Diatoms) Ochromonadaceae (ochromonads) Xantophyceae Phaeophyceae Autres

Nombre de gnes 18S rfrencs dans GenBank 53 1431 1112 207 180 947 794

Nombre de gnomes squencs 0 3 2 0 0 0 0

Nombre de gnomes en cours de squenage 0 4 3 2 0 0 7

Tableau 5: Aperu du nombre de gnes 18S rfrencs dans GenBank (http://www.ncbi.nlm.nih.gov/) et du nombre de gnomes squencs et en cours de squenage (http://www.genomesonline.org/) de quelques lignes de Stramnopiles, la date du21/10/09

29

tel-00482109, version 2 - 29 Feb 2012

Figure 9: Photos dorganismes appartenant au phylum des Alveolata. Les lignes des Apicomplexa (1 et 2), des Cilita (3 et 4) et des Dinoflagellates (5 et 6) sont reprsentes.

Lignes

Nombre de gnes 18S rfrencs dans GenBank 2652 1348 2519 176

Nombre de gnomes squencs 9 2 0 0

Nombre de gnomes en cours de squenage 30 3 1 1

Apicomplexa Ciliata Dinoflagellates Autres

Tableau 6: Aperu du nombre de gnes 18S rfrencs dans GenBank (http://www.ncbi.nlm.nih.gov/) et du nombre de gnomes squencs et en cours de squenage (http://www.genomesonline.org/) de quelques lignes dAlveolata, la date du 21/09/2009.

30

Figure 10: Photos dorganismes appartenant au phylum des Cryptophyta (1 3) et des Haptophyta (4 6). tel-00482109, version 2 - 29 Feb 2012

Lignes Cryptophyta Haptophyta

Nombre de gnes 18S rfrencs dans GenBank 180 307

Nombre de gnomes squencs 2 0

Nombre de gnomes en cours de squenage 1 3

Tableau 7: Aperu du nombre de gnes 18S rfrencs dans GenBank (http://www.ncbi.nlm.nih.gov/) et du nombre de gnomes squencs et en cours de squenage (http://www.genomesonline.org/) des diffrentes lignes de Cryptophyta/Haptophyta, la date du 21/09/2009.

31

qui produisent quelques unes des plus puissantes neurotoxines connues. Ils possdent aussi quelques uns des plus grands gnomes nuclaires connus (entre 3000 et 215000 Mb), avec de grandes quantits de squences d'ADN rpt (Hackett et al., 2005). Les apicomplexes sont le groupe frre des dinoflagells et incluent quelques uns des plus importants agents pathognes dinvertbrs et de vertbrs. Presque tous sont des parasites obligatoires intracellulaires, comme les agents responsables de la malaria (Plasmodium spp.) et de la toxoplasmose (Toxoplasma sp.). Leur nom est tir des caractristiques de leur complexe apical, qui permet l'attachement et la pntration initiale de la cellule hte. Toutes les espces conservent un plaste rudimentaire (apicoplaste), trs probablement originaire dune algue rouge (Fast et al., 2001). 2.3.2.7 Les Haptophytes et les Cryptophytes tel-00482109, version 2 - 29 Feb 2012 Il sagit principalement dalgues chlorophylle c. Cependant, bien que leurs plastes partagent clairement une origine commune avec les plastes des stramnopiles, il y a peu de preuves que leurs gnomes nuclaires en aient une. Le groupe des Cryptophytes et des Haptophytes, sil sagit dun groupe, est potentiellement trs grand. Deux nouvelles lignes majeures ont rcemment t dcouvertes. (Shalchian-Tabrizi et al., 2007 ; Not et al., 2007). Les Haptophytes sont nomms ainsi pour leur haptonme, un appendice antrieur utilis pour la capture de proies et ladhsion. Ils incluent les coccolithophorides, qui sont des organismes unicellulaires couverts dcailles de carbonate de calcium (coccolithes). Les Cryptophytes sont des organismes unicellulaires relativement petits (entre 2 et 10 m de diamtre) et principalement retrouvs dans les eaux froides ou profondes. Ils sont abondants et ubiquistes et sont gnralement impliqus dans des endosymbioses provisoires (Patron et al., 2007) (Fig. 10 et Tableau 7). 2.3.2.8 Les Excavs Les taxa classs comme excavs sont reprsents par des organismes unicellulaires possdant un grand sillon creux au niveau de leur extrmit antrieure dans lequel ils prennent au pige des particules de nourriture en suspension laide dun flagelle (Simpson, 2003). Leur phylognie est complexe, puisquils ont tendance avoir des taux d'volution molculaire extrmement rapides. Cependant, la monophylie de ce groupe a t rcemment

32

tel-00482109, version 2 - 29 Feb 2012

Figure 11: Photos dorganismes appartenant au phylum des Excavata. Les lignes des Euglenozoa (1 et 2), des Heterolobosea (3), des Jakobida (4 et 5) et des Fornicata (6) sont reprsentes.

Lignes Euglenozoa Heterolobosea Jakobida Fornicata

Nombre de gnes 18S rfrencs dans GenBank 1039 349 16 74

Nombre de gnomes squencs 4 0 0 1

Nombre de gnomes en cours de squenage 4 1 0 3

Tableau 8: Aperu du nombre de gnes 18S rfrencs dans GenBank (http://www.ncbi.nlm.nih.gov/) et du nombre de gnomes squencs et en cours de squenage (http://www.genomesonline.org/) de quelques lignes des Excavata, la date du 21/09/2009.

33

dmontr (Hampl et al., 2009). Par commodit, ils sont diviss en "excavs avec mitochondries", ce qui inclut les Euglenozoa, les Heterolobosea et les Jakobida et en "excavs sans mitochondries" (Simpson et al., 2006). 2.3.2.8.1 Les excavs avec mitochondries

Les Euglenozoa sont de petites cellules uni- ou biflagelles, dont beaucoup sont des parasites comme les agents responsables de la maladie du sommeil (Trypanosoma sp.) et des leishmanioses (Leishmania sp.). Certains euglnes ont une forme de vie libre et sont capables dingrer des cellules eucaryotes entires. Lespce Euglena gracilis a ainsi acquis un chloroplaste dalgue verte. Les Heterolobosea sont surtout des amibes nues. Ils sont abondants, ubiquistes et leur tel-00482109, version 2 - 29 Feb 2012 importance cologique est mal comprise, mais probablement trs importante. Ce sont des prdateurs bactriens du sol ou d'eau douce, et parfois des pathognes facultatifs de lhomme (Naegleria fowleri) (Maclean et al., 2004). Les Jakobides sont de petits prdateurs de bactries forme de vie libre et sont particulirement rputs pour leur morphologie mitochondriale variable (Lara et al., 2006) (Fig. 11 et Tableau 8). 2.3.2.8.2 Les excavs sans mitochondries

On connat cet immense groupe, probablement ancestral, seulement comme des unicellulaires vivants dans des habitats anarobique ou micro-arobiques, souvent comme commensaux ou parasites. Leur structure cellulaire interne simplifie et le manque apparent de mitochondries ou dorganelles drivs de mitochondries ont suscit l'hypothse dArchaezoa, suggrant que ceux-ci taient les restes des premires lignes deucaryotes prmitochondries (Cavalier-Smith et Chao, 1996). Cependant, des gnes ancestraux mitochondriaux ont t trouvs dans leurs gnomes nuclaires et des vestiges de mitochondries fortement rduites ont rcemment t dcouverts dans beaucoup de ces organismes (Embley et Martin, 2006). Ainsi l'hypothse des Archaezoa est maintenant oublie. Nanmoins, ces taxa apparaissent toujours comme les toutes premires branches dans les arbres molculaires enracins (Arisue et al., 2005). Ce positionnement est souvent interprt comme un artefact d'attraction des longues branches (Philippe et Germot, 2000).

34

2.3.2.9 Position incertaine En 1999, 230 protistes cultivs avaient un positionnement incertain. En 2005, ce nombre a diminu 204 (Adl et al., 2005). La plupart d'entre eux sont des petits flagells htrotrophes ou des amibes vie libre, ou des parasites de diverses sortes. Plusieurs seront sans doute classs dans un ou plusieurs groupes dcrits ci-dessus. Cependant, des tudes de PCR suggrent l'existence de lignes majeures deucaryotes non dcouvertes (Moreira et LopzGarcia, 2002), dont beaucoup sont composes probablement de nano-et pico-eucaryotes. Mme soi-disant connues, des espces peuvent tre les reprsentants uniques de lignes majeures non souponnes. Par exemple, des tudes rcentes de PCR montrent que les Apusomonades forment un grand groupe divers pouvant tre le groupe frre des Opisthokontes (Kim et al., 2006). tel-00482109, version 2 - 29 Feb 2012

3. La diversit microbienne dans lenvironnement


3.1 Lenvironnement sol : un rservoir de diversit microbienne
Le sol est probablement le plus intressant de tous les environnements naturels pour les microbiologistes, en ce qui concerne la taille de la communaut microbienne et la diversit d'espces prsentes. Un gramme de sol de fort contient environ 4.107 bactries, tandis quun gramme de sol cultiv ou de prairie contient environ 2.109 bactries (Paul et Clark, 1989). Les champignons constituent galement une fraction trs importante de la biomasse microbienne. Cest par exemple le cas des forts tempres ou borales dans lesquels la biomasse des seuls champignons symbiotiques a pu tre estime 1/3 de la biomasse microbienne totale (Hgberg et Hgberg, 2002). En se basant sur la cintique de rassociation de lADN, le nombre de gnomes bactriens distincts a t estim entre 2000 et 18000 gnomes par gramme de sol (Torsvik et al., 1998; Torsvik et Ovreas, 2002 ; Doolittle, 1999). Ce nombre est une sous estimation. En effet, il se peut que des gnomes ne soient pas rcuprs, notamment les gnomes reprsentant des espces rares, et soient exclus de ces analyses. Lextrme htrognit spatiale, la nature polyphasique (incluant les gaz, leau et le matriel solide), et les proprits chimiques et biologiques complexes de lenvironnement sol contribuent la diversit microbienne prsente dans un chantillon de sol.

35

3.2 Caractristiques de lenvironnement sol


Le sol est constitu de particules minrales de tailles, de formes et de caractristiques chimiques diffrentes, ainsi que dorganismes vivants (biota) et de composs organiques diffrent stades de dcomposition. La formation de complexes dargile et de matire organique et la stabilisation des particules dargiles, de sables et de limons par la formation dagrgats sont les caractristiques structurales dominantes de la matrice sol. Ces agrgats peuvent stendre sur environ 2 mm ou plus (macro-agrgats) jusqu des fractions de lordre du micromtre pour les bactries et les particules collodales. Les microorganismes du sol adhrent ou sadsorbent souvent fortement sur les particules du sol comme les grains de sables ou les complexes dargiles et de matire organique. Leurs micro-habitats sont la surface des agrgats et les espaces complexes (pores) entre et lintrieur des agrgats tel-00482109, version 2 - 29 Feb 2012 (Foster, 1988). Le mtabolisme et la survie des microorganismes du sol et donc la composition de la communaut microbienne est galement fortement influence par la disponibilit en eau et en nutriments et par d'autres facteurs exognes comme le pH, la disponibilit en oxygne ou la temprature. Le sol est galement un important rservoir de carbone organique. Il est le sige de la transformation de la plupart de la matire organique, issue des plantes, des animaux et des microorganismes, en humus par une combinaison de processus microbiologiques et abiotiques. Nanmoins, des substances humiques stables restent rcalcitrantes au processus de dcomposition microbien ; la demi-vie de ces complexes stables de matire organique est approximativement de 2000 ans (Paul et Clark, 1989).

3.3 Accder la diversit des microorganismes du sol


Les approches directes de mise en culture ou indirecte molculaire peuvent tre utilises pour explorer la diversit microbienne prsente dans un sol. La mise en culture et lisolement de microorganismes est la mthode traditionnelle mais, seulement 0,1% 1% des bactries du sol sont cultivables en utilisant des mthodes de mise en culture standard (Torsvik et Ovreas, 2002 ; Amann et al., 1995). La diversit microbienne du sol reste principalement inexplore et seule une infime portion a t caractrise en utilisant la mise en culture et lisolement.

36

Pour contourner les limites des approches de mise en culture, des mthodes molculaires indirectes bases sur lisolement et lanalyse des acides nucliques (ADN et ARN) ont t dveloppes partir dchantillons de sol sans mise en culture des microorganismes. Plusieurs protocoles disolement de lADN microbien du sol ont t publis (Ogram et al., 1987 ; Steffan et al., 1988 ; Zhou et al., 1996 ; Miller et al., 1999 ; Hurt et al., 2001). Suivant lapproche utilise, le degr dinformation stend de la simple squence gnomique lensemble des gnes rellement exprims par une communaut de microorganismes du sol. 3.3.1 tel-00482109, version 2 - 29 Feb 2012 Lapproche de clonage et squenage

Des tudes phylogntiques peuvent tre effectues par amplification par PCR du gne de lARNr 16S et 18S, en utilisant des amorces universelles bactriennes ou eucaryotes. Les squences de gnes dARNr 16S et 18S obtenues sont confrontes celles rfrences dans les bases de donnes (GenBank, Ribosomal Database Project, etc) afin de leur assigner une appartenance une espce ou un groupe taxinomique. Des seuils de similarit sont dfinis pour les diffrents marqueurs gntiques possibles. Pour lARNr 18S, ce seuil est gnralement situ 97 %. Cette mthode a permis de mettre en vidence une modification de la composition dune communaut de micro-organismes eucaryotes dans des sols sous une vgtation soumise des concentrations leves en CO2 atmosphrique (Lesaulnier et al., 2008). Elle a galement permis de dcouvrir, partir de sols archivs, de nombreuses squences de cercozoa et du super-groupe des Amoebozoa, dont douze sont disperses dans divers clades (Moon-van der Staay et al., 2006). Cependant, la majorit des travaux sintressant la diversit eucaryote dans les sols se restreint des groupes taxinomiques prcis, comme les champignons (Fierer et al., 2007 ; O'Brien et al., 2005 ; Porter et al., 2008 ; Yergeau et al., 2007), les nmatodes (Yergeau et al., 2007) et les cercozoa (Bass et Cavalier-Smith, 2004). Ces tudes suggrent que la diversit et labondance des microorganismes eucaryotes est encore largement sous-estime, et plus particulirement pour les champignons puisque trs peu despces fongiques sont communes deux sols diffrents (Fierer et al., 2007)

37

Dautres tudes de classification et de comparaison de la diversit microbienne dans diffrents habitats de sol ont mis en vidence des changements de la structure de la communaut bactrienne suivant limpact de facteurs environnementaux (Smit et al., 2001 ; Zhou et al., 2002b). Aucune tude de ce type na t ralise sur les communauts de microorganismes eucaryotes. 3.3.2 Les profils lectrophortiques : empreintes molculaires

Ces mthodes qualitatives et semi-quantitatives sont bases sur llectrophorse. Il sagit de la DGGE/TGGE (lectrophorse en gradient dnaturant linaire chimique ou thermique, respectivement) ou encore de la technique RFLP, qui permet un crible pralable des diffrents taxa avant le squenage. Elles sont assez rsolutives car elles tel-00482109, version 2 - 29 Feb 2012 rvlent les taxa spcifiques et abondants dans certaines conditions (Moon-van der Staay et al., 2006) qui peuvent tre identifis par excision et squenage des fragments spars par lectrophorse. Cependant, les taxa rares peuvent tre masqus, dans la mesure o la bande correspondante peut se confondre avec dautres, plus intenses. Ces approches sont particulirement appropries ltude de modifications de la diversit des communauts en fonction de variables environnementales. Lawley et al., 2004 ont ainsi tudi la diversit des micro-eucaryotes dans diffrents chantillons de sol de lantarctique par squenage des bandes dintrt suite une analyse de polymorphisme des fragments de restriction (RFLP) ou ARDRA (analyse de restriction des fragments dADNr) lorsquil sagit de lADNr. Cette tude montre que des espces provenant de tous les supergroupes eucaryotes sont reprsentes, bien que le nombre dunits taxinomiques oprationnelles (OTU) rvl par profil RFLP puisse sous-estimer la diversit. 3.3.3 Limites des mthodes molculaires classiques

Lutilisation des ARNr a permis de rvler non seulement de nouvelles espces mais aussi de nouveaux phylums dont aucun reprsentant na t isol ce jour. Cependant, lestimation de la diversit gntique des microorganismes reste incertaine en raison de plusieurs biais (problmes de squenage des ARNr, obtention de squences chimriques, interprtation errone de squences volution rapide). On estime que 9% des squences dARNr 16S rpertories dans les banques prsentent des anomalies (Ashelford et al., 2006).

38

tel-00482109, version 2 - 29 Feb 2012

Figure 12: Les diffrentes tapes de lapproche mtagnomique (daprs Daniel, 2005). L'ADN de sol est rcupr soit par la sparation des cellules des particules de sol suivie par la lyse des cellules et lisolement de lADN, soit par la lyse directe des cellules contenues dans le sol. L'ADN rcupr est fragment et insr dans un vecteur de clonage (plasmide, cosmide, fosmide ou BAC). Aprs l'introduction des vecteurs recombinants dans un hte de clonage bactrien appropri, des stratgies de slection peuvent tre conues pour identifier ces clones qui pourraient contenir de nouveaux gnes dintrt.

39

Par ailleurs, la quantification des organismes prsents dans un chantillon environnemental partir de donnes bases sur la squence du gne de lARNr reste difficile en raison de la variation du nombre de copies gnomiques de ce gne suivant lorganisme (Ribosomal RNA Operon Copy number Database, http://rrnbdb.cme.msu.edu, Klappenbach 2000). Enfin, ces approches molculaires ne donnent que trs peu dinformations sur le rle et les fonctions assures par lensemble des communauts microbiennes dans lenvironnement. Elles ne permettent donc pas destimer la diversit fonctionnelle in situ de ces microorganismes. 3.3.4 tel-00482109, version 2 - 29 Feb 2012 Lapproche mtagnomique

La mtagnomique, dfinie comme l'analyse gnomique indpendante de la mise en culture de tous les microorganismes prsents dans une niche environnementale particulire (Handelsman et al., 1998), a t dveloppe afin de dcouvrir la diversit microbienne d'environnements naturels (Fig. 12). Cette approche de plus en plus sophistique repose sur l'isolement direct d'ADN d'un habitat dfini, suivi par un clonage (dans un hte comme Escherichia coli) des gnomes complets de toute la communaut microbienne prsente dans cet habitat. La banque d'ADN rsultante est alors analyse pour des fonctions et des squences d'intrt. La mtagnomique permet soit une analyse base sur la squence, soit une analyse base sur la fonction des microorganismes non cultivs. La mtagnomique fonctionnelle implique le criblage de banques mtagnomiques pour un phnotype particulier, par exemple la tolrance au sel, la production dantibiotique ou l'activit d'enzymes et ensuite l'identification de lorigine phylogntique de l'ADN clon (Dinsdale et al., 2008). Dautre part, les approches bases sur la squence impliquent un criblage des clones pour les gnes dARNr 16S (Liles et al., 2003 ; Rondon et al., 2000) ou 18S (Grant et al., 2006 ; Bailly et al., 2007 ; Urich et al., 2008) fortement conservs afin de rechercher lorigine taxinomique des microorganismes composant la communaut de lcosystme tudi. La construction et le criblage de banques mtagnomiques drives du sol dpendent de plusieurs facteurs : de la composition de lchantillon de sol ; de lchantillonnage et du stockage des chantillons de sol ; de la mthode dextraction dADN utilise pour rcuprer de lADN de haute qualit ; de la reprsentativit des ADN de la communaut microbienne

40

prsente dans lchantillon de sol ; du systme vecteur-hte utilis pour le clonage et de la stratgie de criblage (Daniel, 2005). 3.3.4.1 Isolement dADN partir du sol La construction de banques mtagnomiques commence par la collecte des chantillons. Comme les chantillons de sol sont htrognes, les caractristiques physiques, chimiques et biotiques comme la taille des particules, le type de sol, la teneur en eau, le pH, la temprature et le couvert vgtal sont utiles pour l'valuation et la comparaison des rsultats des tudes bases sur le sol. Comme les populations microbiennes sont grandes, les volumes des chantillons peuvent tre petits (infrieur 500g dans la plupart des tudes) (Miller et al., 1999 ; Henne et al., 1999 ; Rondon et al., 2000). La perturbation du sol lors de tel-00482109, version 2 - 29 Feb 2012 lchantillonnage pourrait changer la composition des communauts microbiennes du sol, par consquent le temps de stockage et de transport dun chantillon doit tre court. Les mthodes dextraction dADN peuvent tre divises en deux catgories : par lyse directe des cellules contenues dans lchantillon suivie par une sparation de lADN partir de la matrice et des dbris cellulaires (initi par Ogram et al., 1987) ; ou par sparation des cellules partir de la matrice sol suivie dune lyse des cellules (initi par Holben et al., 1988). L'ADN brut rcupr par les deux mthodes est purifi selon des procdures standards. Une plus grande quantit d'ADN est rcupre en utilisant des approches de lyses directes, par exemple, Gabor et al. (2003) enregistrent une rduction de 10 100 fois du rendement d'ADN extrait en utilisant l'approche de sparation cellulaire compare avec l'approche de lyse directe. De plus, 61 93% de lADN extrait par lyse directe tait dorigine eucaryote, alors que plus de 92% de lADN extrait par lyse indirecte tait bactrien (Gabor et al., 2003). Ce rsultat sexplique par la plus grande taille des gnomes eucaryotes (compris entre 3 et 215000 Mb) par rapport aux gnomes bactriens (compris entre 0,6 et 9,5 Mb) (Vellai et Vida, 1999). Enfin, l'ADN rcupr par lyse indirecte semble tre moins contamin par des composs matriciels comme les substances humiques et prsente une taille moyenne plus grande que celle typiquement obtenue par lapproche de lyse directe (Courtois et al., 2001). La lyse indirecte semble tre la plus approprie pour la construction de banques de grands inserts.

41

3.3.4.2 Systmes vectoriels Le choix d'un vecteur de clonage dpend de la qualit de l'ADN de sol isol, de la taille moyenne des inserts de la banque, du nombre de copies du vecteur exig, de l'hte et de la stratgie de criblage qui sera utilise, donc tout dpend du but de l'tude (Daniel, 2005). Les banques de petits inserts sont utile pour l'isolement de gnes seuls ou de petits oprons codant de nouvelles fonctions mtaboliques (Henne et al., 1999 ; Henne et al., 2000 ; Majernik et al., 2001 ; Knietsch et al., 2003b; Yun et al., 2004; Riesenfeld et al., 2004b). Elles sont gnralement construites dans des plasmides. Les banques de grands inserts sont plus appropries pour rcuprer des voies complexes qui sont codes par des grands groupes de gnes ou pour la caractrisation des gnomes de microorganismes de sol non cultivs (Rondon et al., 2000 ; Courtois et al., 2003). tel-00482109, version 2 - 29 Feb 2012 Lutilisation de vecteur de type BAC (chromosome bactrien artificiel), cosmide ou fosmide est recommande. 3.3.4.3 Criblage des banques mtagnomiques Plusieurs techniques ont t utilises pour identifier et rcuprer des gnes partir de banques de sol. cause de la complexit du mtagnome du sol, des mthodes de criblages haut dbit et sensibles sont exiges. En principe, les cribles de banques peuvent tre bass soit sur la squence nuclotidique (approches bases sur la squence), soit sur l'activit mtabolique (approches bases sur la fonction). 3.3.4.3.1 Approches bases sur la squence

La PCR est plus communment utilise pour un criblage des banques dADN du sol base sur la squence (Zhou et al., 2002b ; Courtois et al., 2001 ; Courtois et al., 2003 ; Liles et al., 2003 ; Precigou et al., 2001). Lhybridation cible utilisant des sondes spcifiques a aussi servi cribler des banques (Knietsch et al., 2003a ; Demaneche et al., 2009). Ces deux approches ncessitent des sondes et des amorces appropries obtenues partir de rgions conserves de gnes connus et de produits de gne. Leur application est limite lidentification de nouveaux membres de familles de gnes connues. Cette approche a t utilise pour identifier des gnes codant lARNr 16S (Liles et al., 2003 ; Rondon et al., 2000) et des enzymes avec des domaines fortement conservs comme les polyktides synthases 42

(Courtois et al., 2003), les acides gluconiques rductases (Eschenfeldt et al., 2001) et les nitrile hydratases (Precigou et al., 2001). Le squenage alatoire de banques issues de sol est une autre approche pour caractriser l'cosystme sol un niveau gnomique, mais la richesse en espces prsentes exige des efforts de squenage et dassemblage norme. La technologie de puce ADN a t utilise pour analyser le mtagnome du sol et pour dfinir le profil des banques mtagnomiques (Wu et al., 2001 ; Zhou et Thompson, 2002a ; Sebat et al., 2003 ; Pathak et al., 2009). Par exemple, les gnes codant des ractions clefs dans le cycle de lazote ont t dtects en utilisant des puces ADN partir dchantillons de sol. Des informations sur la composition et l'activit de la communaut microbienne complexe du sol ont t obtenues (Wu et al., 2001). Cependant, les mthodes de puces ADN pour la dtection de gnes sont 100 10000 fois moins sensibles que la PCR tel-00482109, version 2 - 29 Feb 2012 (Zhou et Thompson, 2002a). Cette diffrence pourrait empcher l'analyse de squences de microorganismes peu abondants dans le sol. L'amlioration de la sensibilit et de la spcificit de ces puces ADN est un enjeu pour lanalyse des ADN et des ARN du sol. 3.3.4.3.2 Approches bases sur la fonction

La plupart des mthodes de criblage pour isoler des gnes ou des groupes de gnes codant de nouveaux biocatalyseurs ou la synthse de petites molcules sont bases sur la dtection de l'activit des clones contenus dans la banque. Comme les informations de squences ne sont pas exiges, c'est la seule stratgie qui a le potentiel didentifier de nouvelles classes de gnes qui codent des fonctions connues ou inconnues. Cette approche a t valide par l'isolement de nouveaux gnes qui codent des hydrolases (Henne et al., 1999 ; Rondon et al., 2000 ; Lee et al., 2004 ; Gupta et al., 2002 ; Yun et al., 2004 ; Mayumi et al., 2008 ; Kim et al., 2008), des protines de rsistance au mtaux (Mirete et al., 2007), des enzymes de rsistance aux antibiotiques (Riesenfeld et al., 2004a) et des antibiotiques (Gillespie et al., 2002; Courtois et al., 2003). La plupart des biomolcules rcupres par criblage fonctionnel de banques de sol sont faiblement proches ou entirement sans rapport avec celles rpertories dans les bases de donnes. Cela confirme que la quantit d'ADN de sol qui a t clone et examine reprsente seulement la partie visible de l'iceberg en ce qui concerne la dcouverte de nouveaux produits naturels partir du mtagnome du sol.

43

Une mthode est deffectuer des tests directs sur colonies pour une fonction spcifique. Par exemple, des colorants chimiques et des substrats denzymes insolubles ou drivs de chromophores peuvent tre incorpors dans le milieu de croissance solidifi avec de lagar pour contrler les fonctions enzymatiques des clones individuels. La sensibilit de ces cribles permet de dtecter des clones rares (Knietsch et al., 2003b ; Gupta et al., 2002). Une autre technique permettant la dtection de clones fonctionnels est l'utilisation de souches htes ou des mutants de souches htes qui exigent une complmentation htrologue pour crotre dans des conditions slectives. Un exemple est la complmentation dune souche dE. coli dficiente pour un transporteur Na+/H+ avec une banque de sol, qui a men l'identification de deux nouveaux gnes codant des transporteurs Na+/H+ partir dune banque contenant 1.480.000 clones (Majernik et al., 2001). Bien que les cribles bass sur la fonction aboutissent d'habitude l'identification de gnes complet (et donc des produits de gnes tel-00482109, version 2 - 29 Feb 2012 fonctionnels), cette approche est limite par l'expression du gne clon et par le fonctionnement de la protine code dans un hte tranger. Dans la plupart des tudes, E. coli a t utilis avec succs comme hte pour des cribles fonctionnels. Rcemment, d'autres htes bactriens comme Streptomyces ou des souches de Pseudomonas ont t utiliss pour tendre la gamme de gnes dtectables par des cribles fonctionnels (Wang et al., 2000 , Courtois et al., 2003). Comme l'expression dans des htes bactriens est d'habitude limite aux gnes bactriens et que l'ADN mtagnomique de sol, selon la mthode d'extraction, contient une quantit importante dADN eucaryote (Gabor et al., 2003), lutilisation dhtes eucaryotes pourrait aussi tre envisage pour les cribles fonctionnels de banques de sol. 3.3.4.4 Augmenter la frquence de dtection de gnes Le nombre de clones qui doit tre cribl pour rcuprer les gnes d'intrt est dtermin par la frquence des organismes de lchantillon de sol qui contiennent les gnes dsirs. Pour augmenter cette frquence, des tapes d'enrichissement en microorganismes hbergeant les caractristiques dsires ont t utilises avant la construction de certaine banque (Gabor et al., 2004 ; Voget et al., 2003). Dans la plupart des tudes, des sources de carbone ou dazote slectives pour l'espce microbienne contenant les gnes dintrts ont t utilises comme substrats de croissance. Un inconvnient de ltape d'enrichissement est la perte de diversit microbienne, puisque les individus croissance rapide et cultivables du consortium microbien sont d'habitude choisis. Nanmoins, une combinaison d'enrichissement 44

traditionnel et de technologie mtagnomique est un moyen efficace pour augmenter la quantit de clones positifs dans un crible et pour isoler de nouvelles biomolcules quand des chantillons d'habitats complexes tel que le sol sont utiliss comme matriel de dpart (Daniel, 2004). Une autre mthode, la SIP (stable isotope probing), a t utilise pour enrichir les gnomes des individus mtaboliquement actifs de la communaut microbienne du sol avant la construction de banques (Radajewski et al., 2003 ; Wellington et al., 2003). Cette technique a permis didentifier une nouvelle methane monooxygenase partir dune banque mtagnomique de sol forestier (Dumont et al., 2006). 3.3.4.5 Optimisation de la mtagnomique du sol tel-00482109, version 2 - 29 Feb 2012 Les mthodes bioinformatiques qui permettent des comparaisons statistiques de banques sont ncessaires pour dterminer si les diffrences entre banques sont des artefacts d'chantillonnage et de construction de banques ou sont causes par des changements de la composition de la communaut. Les diffrentes mthodes de criblage de banque du sol ont fourni un aperu de la diversit des communauts microbiennes et ont permis didentifier de nouvelles biomolcules, mais ces approches ont des forces et des faiblesses. Pour prendre en compte l'norme diversit de microorganismes du sol, une combinaison d'approches bases sur la squence et sur la fonction et diffrents types de banques devrait tre utilise pour explorer le mtagnome du sol. Une troisime stratgie de criblage haut dbit, qui est base sur l'expression de gnes clons induite par le substrat (SIGEX) a t prsente pour l'identification et la rcupration de gnes qui codent des voies cataboliques (Uchiyama et al., 2005). Cette mthode repose sur le clonage alatoire d'ADN metagnomique en amont du gne gfp (codant une protine fluorescente verte), plaant ainsi l'expression de ce gne sous le contrle de promoteurs prsents dans l'ADN mtagnomique. Les clones influenant l'expression de la gfp par addition du substrat d'intrt peuvent tre isols par triage des cellules fluorescentes. 3.3.4.6 Problmes lis aux eucaryotes Pour diffrentes raisons, lapproche mtagnomique dveloppe pour les Procaryotes qui est base sur le clonage de grands fragments dADN gnomique napparat pas la plus 45

adapte ltude des gnomes eucaryotes. En effet, leurs tailles sont trs suprieures celles des gnomes de bactries et darchaea et leur densit en gnes est bien plus faible. Ceci rend ncessaire ltude dun nombre important de clones pour assurer une bonne reprsentativit des diffrents organismes eucaryotes au sein de banques de gnes. De plus, la prsence dintrons dans de nombreux gnes eucaryotes et la non-conservation de la machinerie de transcription et des modes de maturation des protines (glycosylation, scrtion) entre Eucaryotes et Procaryotes nautorise pas un criblage direct (phnotypique) des clones bactriens recombinants pour la production de mtabolites ou denzymes. Enfin, seule une fraction des gnes est exprime de faon constitutive. 3.3.5 tel-00482109, version 2 - 29 Feb 2012 Lapproche mtatranscriptomique

Tandis que les disciplines de gnomique et de mtagenomique tudient, respectivement, le potentiel gnomique d'un organisme particulier ou dune communaut microbienne, la transcriptomique et la mtatranscriptomique sintressent au sous-ensemble de gnes qui sont transcrits dans certaines conditions environnementales. En consquence, la transcriptomique et la mtatranscriptomique sont des outils puissants pour capturer instantanment les gnes essentiels pour la survie dans des niches cologiques particulires. De nombreuses tudes de profils d'expression ont t effectues au cours des dernires dcennies pour aborder des questions centrales en microbiologie, fournissant un aperu prcieux dans la comprhension de la corrlation entre certains phnotypes, comme la rsistance aux radiations, la pathognie ou la rsistance aux chocs thermiques, et l'expression de gnes (Qiu et al., 2008 ; Liu et al., 2003 ; Audia et al., 2008). Lintrt des chercheurs pour les gnes transcrits sous des conditions environnementales spcifiques les a conduits faire des efforts substantiels pour dvelopper des mthodes danalyses. Des techniques d'extraction directes dARNm de bactries, darchaea et deucaryotes partir dchantillons environnementaux ont t rcemment publies (Bailly et al., 2007; Poretsky et al., 2005). Dans les deux tudes, des banques dADNc gnrs partir dARN environnementaux ont t construites et 119 et 400 clones ont t respectivement squencs. La plupart des squences obtenues n'avaient aucune similarit avec n'importe quelle squence de protine prcdemment dpose dans les bases de donnes publiques. Ainsi, ces tudes dmontrent le potentiel de dcouvrir de nouvelles protines. En outre, une capacit moindre de squenage est exige pour lanalyse des transcrits en comparaison avec les analyses d'ADN gnomique ou mtagnomique. Ceci est particulirement vrai pour la 46

Sol

Extraction directe des acides nucliques

ADNr tel-00482109, version 2 - 29 Feb 2012 PCR ADNr 18S

ARNr RT-PCR ARNr 18S

ARNm RT ADNc

Squenage
Construction de la banque dADNc

Criblage

Diversit taxinomique

Diversit fonctionnelle

Figure 13: Les diffrentes tapes de lapproche mtatranscriptomique.

47

faible densit de squences codantes contenue dans les gnomes eucaryotes. Cependant, un effort de squenage important est effectu afin dtre quantitatif et didentifier des transcrits rares. 3.3.5.1 Synthse dADNc et construction de banques mtatranscriptomiques La prparation des ADNc pour le squenage implique essentiellement trois tapes aprs avoir rcupr lchantillon environnemental: lextraction des ARN totaux, llimination des ARNr et donc lenrichissement en ARNm et la synthse dADNc. Comme avec l'approche mtagnomique, le choix de lchantillon est crucial pour la dcouverte d'enzymes. Idalement, l'habitat partir duquel l'chantillon a t rcupr doit reprsenter un enrichissement naturel en organismes effectuant l'activit d'intrt. Des tel-00482109, version 2 - 29 Feb 2012 prcautions supplmentaires sont prendre en ce qui concerne les ARN. Ces derniers sont notamment trs sensibles la dgradation par des ribonuclases ubiquistes. Quelques transcrits ont un temps de vie de moins d'une minute (Poretsky et al., 2005). En consquence, les chantillons doivent tre immdiatement congels ou stocks dans un tampon prservant lARN. Les mthodes de lyse directe de Hurt et al. (2001) ou de Bailly et al. (2007) qui permettent le recouvrement simultan de lADN et de l'ARN partir de sols de compositions diffrentes sont bien adaptes ce type dapproche. Aprs lextraction de lARN, l'enrichissement en ARNm est souhaitable puisqu'ils ne reprsentent quun faible pourcentage de lARN total contenu dans une cellule (de 1 5% chez les bactries ; McGrath et al., 2008). Plusieurs stratgies denrichissement en ARNm et damplification des transcrits existent (Poretsky et al., 2005 ; Bailly et al., 2007 ; Gilbert et al., 2008 ; Frias-Lopez et al., 2008). Les ARNm eucaryotes peuvent tre spcifiquement slectionns car ils sont poly-adnyls leur extrmit 3 (Grant et al., 2006; Bailly et al., 2007). Les ADNc sont ensuite synthtiss par transcription rverse et, suivant le criblage effectu, lis dans un vecteur (plasmide) et clons dans un hte bactrien (E. coli) (Grant et al., 2006 ; Bailly et al., 2007 ; McGrath et al., 2008) (Fig. 13).

48

Plateforme Sanger (ABI 3730xl) Pyrosquenage 454-Roche (GS-FLX-Titanium) Squenage Illumina (GAII) Squenage ABI SOLiD3

Million de pb/ run 0,07 400 2.000 20.000

Cot/ base ($ US) 0,1 0,003 0,0007 n.d

Longueur moyenne lue (pb) 700 400 35 35

Tableau 9: Rsum des technologies de squenage disponibles actuellement (daprs Hugenholtz et Tyson, 2008). tel-00482109, version 2 - 29 Feb 2012

49

3.3.5.2 Criblage des banques mtatranscriptomiques Une faon de cribler des banques mtatranscriptomiques consiste utiliser la PCR ou lhybridation cible, mais comme pour lapproche mtagnomique leur application est limite lidentification de gnes connus ou de nouveaux membres de familles de gnes connues. Une approche originale, ralise pour la premire fois par Bailly et al. en 2007, consiste exprimer des ADNc environnementaux dans un hte htrologue eucaryote. Ces ADNc ont pralablement t lis dans un vecteur plasmidique binaire. Une complmentation fonctionnelle dun mutant de levure (Saccharomyces cerevisiae) auxotrophe pour lhistidine avec des EST (Expressed Sequence Tag) environnementales dorigine fongique a ainsi pu tre ralise. tel-00482109, version 2 - 29 Feb 2012 Une approche complmentaire consiste effectuer un squenage alatoire massif des banques gnres. Des efforts de squenage et dassemblage moins consquents, par rapport lapproche mtagnomique, sont ncessaires pour recouvrir linformation contenue dans ces banques dADNc. Un progrs considrable a t ralis pour l'analyse efficace des profils d'expression plus complexes avec le dveloppement de technologies de squenage de nouvelle gnration (par exemple, 454 de Roche, SOLEXA de Illumina et SOLiD3 de ABI). Ces nouvelles technologies ne permettent pas seulement le squenage direct d'ADN ou mme dADNc sans aucune tape de clonage (Medini et al., 2008), mais aussi daugmenter le dbit du nombre de paires de base squences par run et de diminuer le cot par base squence (Tableau 9). Le premier rapport d'utilisation du pyrosquenage 454 pour tudier le mtatranscriptome d'une communaut microbienne complexe a t publi en 2006 (Leininger et al., 2006). En utilisant cette technologie de squenage Leininger et al., (2006) ont montr que les transcrits darchaea codant l'enzyme clef de loxydation de lammoniaque (amoA) taient plus abondants dans les sols que ceux de la version bactrienne, suggrant ainsi que les archaea sont dominants numriquement dans le sol pour oxyder lammoniaque. Les 25 Mb de donnes de squences obtenues partir de ce transcriptome ont ensuite t analyses par Urich et al. (2008). Ils ont annonc que 8 % des transcrits suprieurs 250 pb pourraient tre identifis comme des ARNm. Cette tude a dmontr comment des technologies de squenage haut dbit peuvent tre appliques facilement pour avoir accs aux informations stockes dans des transcrits connues et inconnues qui ont t isoles directement d'environnements complexes comme le sol. 50

3.4 La diversit microbienne dans dautres cosystmes


Les approches molculaires et plus particulirement lapproche mtagnomique et mtaranscriptomique ont galement t utilises pour tudier la diversit microbienne des milieux aquatiques et de lappareil gastro-intestinal des vertbrs et des invertbrs (LopzGarcia et Moreira, 2008). 3.4.1 Lintestin dinsecte

Plusieurs tudes de mtagnomique ont t effectues sur lintestin postrieur de termites suprieures salimentant de bois. Les termites sont connues comme des organismes conomiquement importants pour dgrader le bois et ayant des rles tel-00482109, version 2 - 29 Feb 2012 environnementaux essentiels dans le recyclage du carbone et comme sources ventuelles de catalyseurs biochimiques qui peuvent tre utiliss dans la conversion du bois en biocarburants (Warnecke et al., 2007). Des donnes significatives ont rcemment suggr que les bactries symbiotiques rsidant dans lintestin postrieur des termites jouent un rle fonctionnel dans l'hydrolyse de la cellulose et du xylane (Tokuda et Watanabe, 2007). Pour mieux apprcier la grande diversit des mcanismes biologiques responsables de la dgradation de la lignocellulose, une analyse mtagnomique du microbiota de lintestin postrieur de lespce consommatrice de bois Nasutitermes a t effectue afin didentifier le jeu complexe de gnes bactriens gnralement utiliss pour lhydrolyse de la cellulose et du xylane (Warnecke et al., 2007). L'ADN de la communaut microbienne contenue dans lintestin postrieur a t extrait, clon et squenc. Un total de 1750 gnes dARNr bactriens a t amplifi par PCR et l'identification a permis de rpartir les bactries dans 12 phyla et 216 phylotypes. Aprs PCR, le genre Treponema comprenant le taxon Fibrobacter est le plus frquemment rcupr, avec 68 % de gnes squencs dont 13% appartiennent aux phylotypes Fibrobacters. Une analyse conservatrice base sur des techniques d'alignement global a permis didentifier plus de 100 modules de gne analogues aux domaines catalytiques des glycosides hydrolases. Cette tude a aussi illustr d'autres fonctions potentiellement importantes de la population microbienne de lintestin postrieur des termites suprieures salimentant de bois, comme le mtabolisme de lhydrogne, lactognse rductrice du dioxyde de carbone et la fixation d'azote (Warnecke et al., 2007).

51

3.4.2

Lintestin de lhomme

Les communauts microbiennes occupent toutes les surfaces du corps humain avec un nombre de cellules microbienne total environ 10 fois suprieure celui de cellules humaines (Kurokawa et al., 2007). Le colon distal a t identifi comme l'cosystme bactrien naturel le plus peupl, englobant plus de cellules bactriennes que toutes nos communauts microbiennes combines (Frank et Pace, 2008). Il est alors vident que le microbiota gastrointestinal humain est essentiel; il confre des fonctions mtaboliques qui sont absentes chez l'hte, comme les stratgies pour amliorer la rcolte d'nergie des produits alimentaires ingrs, la synthse de vitamines essentielles et la dgradation de polysaccharides complexes de plantes (Kurokawa et al., 2007). En effet il n'est pas rare que des dsquilibres de la structure de la communaut microbienne intestinale soient induits et/ou causent des maladies tel-00482109, version 2 - 29 Feb 2012 comme la maladie de Crohn (inflammation de lintestin), des allergies, l'obsit et des cancers (Kurokawa et al., 2007). Le premier effort dexploration du mtagnome de lintestin humain a t entrepris en 2005 par les membres du laboratoire Relman et l'Institut pour la Recherche Gnomique (TIGR) dans le but de dcouvrir la diversit de la microflore gastro-intestinale (Eckburg et al., 2005). Afin d'identifier les caractristiques gnomiques communes tous les microbiomes dintestins humains, Kurokawa et al. (2007) ont rcemment effectu une analyse mtagnomique comparative partir d'chantillons fcaux de 13 individus sains d'ges divers, y compris des enfants en bas ge non sevrs. Lanalyse du mtagnome de lintestin humain sinscrit dans la continuit du projet de squenage du gnome humain. Beaucoup de rsultats sont prvus pour le Projet de Microbiome Humain (HMP), y compris l'identification de nouveaux biomarqueurs pour la sant et la mdecine, de nouvelles enzymes capables de dgrader les xnobiotiques, et en fin de compte une comprhension plus complte des besoins nutritionnelles de lhomme (Turnbaugh et al., 2007). 3.4.3 Les milieux aquatiques

De nombreuses tudes molculaires bases sur la petite sous unit de lARNr 18S ont permis de rvler de nouvelles units taxinomiques eucaryotes fonctionnelles (Moon-van der Staay et al., 2001 ; Lopez-Garcia et al., 2001 ; Dawson et Pace, 2002 ; Stoeck et al., 2006 ; Stoeck et al., 2003 ; Habura et al., 2004a ; Johnson et al., 2004). Certaines reprsentent une

52

nouvelle diversit dans des groupes dj connus alors que dautres ne semblent relis aucune ligne dj dcrite. Le premier projet de squenage grande chelle (ou squenage massif alatoire ou random shotgun sequencing) a t effectu par lInstitut Craig J. Venter en 2004 dans lequel les fragments d'ADN squencs ont t rcuprs partir de la communaut microbienne de la mer des Sargasses, une rgion intensivement tudie de l'Ocan Atlantique prs des Bermudes et limite en substance nutritive (Venter et al., 2004). Un squenage alatoire de plus de 1,6 milliards de paires de base d'ADN a men la dcouverte de 1,2 millions de nouveaux gnes. 794.061 gnes ont t assigns comme tant des protines hypothtiques conserves dont les fonctions sont inconnues. La mer des Sargasses a t choisie pour l'analyse mtagnomique parce qu'il a t suppos quelle possdait une communaut relativement simple. Cela sest avr ne pas tre le cas. En effet, lanalyse a rvl la prsence tel-00482109, version 2 - 29 Feb 2012 de 1800 espces bactriennes, dont 148 appartiennent de nouveaux phylotypes. La communaut n'tait pas assez simple pour permettre d'assembler les gnomes microbiens. Tyson et al. (2004) ont pour leur part choisi dtudier une communaut beaucoup plus simple, celle du systme dcoulement deau acide dune mine du Richmond (La Montagne de Fer, Californie), un des environnements les plus extrmes sur Terre. Dans cet environnement le microbiota existe sous forme de biofilms roses qui se forment sur la surface de leau de la mine. Le biofilm a un pH de 0,83, une temprature de 43C et contient de hautes concentrations de fer, de zinc et de cuivre (Tyson et al., 2004). Une approche de squenage massif alatoire a rvl 384 gnes dARNr 16S dont les extrmits 5 et 3 ont t squences (Baker et al., 2003). La simplicit de la structure de la communaut a permis Tyson et al. (2004) de squencer presque toute la microflore. L'analyse mtagnomique de la communaut AMD a abouti la reconstruction presque complte des gnomes de Leptospirillum du groupe II et de Ferroplasma de type II. Quelques annes auparavant, Bj et al. (2001) avaient dj ralis une tude de lenvironnement marin par construction dune banque mtagnomique dans un vecteur fosmidique. Des tudes phylogntiques des gnes dARNr 16S et un squenage complet des fosmides ont t raliss. De cette faon, ils ont dcouvert l'existence d'une nouvelle fonction dans une bactrie non cultive. En effet, un clone de la banque possdait le gne dARNr 16S de SAR86 (un groupe de squences retrouves dans beaucoup d'ocans, mais sans reprsentant en culture axnique) et un gne codant pour une protine semblable lhalorhodopsine a t trouv dans le mme clone. Une tude approfondie a montr que cette protine (nomm protorhodopsine) utilise la lumire pour produire un gradient de proton 53

travers la membrane cellulaire. Ainsi, il a t montr quun groupe inconnu de bactries, SAR86, possdait une nouvelle fonction (la phototrophie) (Bj et al., 2001). En 2008, Friaz-Lopez et al. ont produit plus de 50 Mb dADNc par pyrosquenage 454 (Frias-Lopez et al., 2008). Gilbert et al. suivirent peu aprs avec plus de 300 Mb de donnes de squences en utilisant la deuxime gnration de pyrosquenage appele GSFLX (Gilbert et al., 2008). Finalement, si des banques mtagnomiques ou mtatranscriptomiques de deux ou plusieurs communauts diffrentes sont disponibles, elles peuvent tre utilises pour comparer l'abondance relative des gnes avec des fonctions donnes et relier cela aux conditions particulires de chaque environnement. Ceci a t ralis par Tringe et al. (2005), qui ont compar les banques de la Mer des Sargasses celle de carcasses de baleines reposant plus de 500m de profondeur dans deux ocans diffrents et celle dun sol agricole du Minnesota. tel-00482109, version 2 - 29 Feb 2012 Cette comparaison a immdiatement suggr des hypothses cologiques intressantes concernant le chimiotactisme (Tringe et al., 2005). Rcemment, Poretsky et al. (2009) ont pu obtenir des informations dtailles sur les rponses mtaboliques et biogochimiques d'une communaut al., 2009). microbienne la contrainte solaire en comparant des donnes mtatranscriptomiques deau de surface du Pacifique prleve le jour et la nuit (Poretsky et

3.5 Conclusion
Il est clair que le petit nombre denvironnements jusquici tudi avec des mthodes molculaires ne permet quune comprhension rudimentaire du monde microbien naturel. Cependant, les mthodes bases sur les squences fournissent maintenant une faon d'examiner la biodiversit rapidement et sous tous les aspects. Si nous voulons comprendre le monde vivant qui nous entoure (la biosphre), il est important, mme essentiel, dentreprendre une tude reprsentative de la diversit microbienne dans l'environnement. Une classification complte du biotope microbien de la Terre est inutile et, bien sr, impossible. Nanmoins, un aperu reprsentatif pourrait tre ralis avec un effort modeste au vue des nouvelles technologies de squenage automatis. L'analyse de 1000 clones (pour dtecter les types de gnome les plus abondants) de 100 environnements chimiquement diffrents serait comparable un effort de squenage de l'ordre dun simple gnome microbien. Dernirement, un consortium international, Terragenome (Vogel et al., 2009), fdre les

54

efforts de recherche afin daboutir au squenage complet du gnome de tous les microorganismes du sol. Les questions sont importantes et nombreuses: avec quels types dorganismes partageons-nous cette plante et en quoi dpendons-nous deux? Quels modles devrionsnous choisir pour les tudes des processus environnementaux au laboratoire? Comment pouvons-nous tirer des informations et des ressources de ce vaste fond de biodiversit? Pouvons-nous utiliser la distribution des microbes pour cartographier et contrler la chimie de la Plante? Y a t-il des embranchements plus profonds dans l'arbre de la vie que les lignes que nous connaissons? (Pace, 1997). Les opportunits de dcouverte de nouveaux organismes et le dveloppement de ressources bases sur la diversit microbienne sont plus grandes que jamais auparavant. Les tel-00482109, version 2 - 29 Feb 2012 squences molculaires ont finalement donn aux microbiologistes une faon de dfinir leurs sujets, par la phylognie molculaire. Les squences sont aussi la base des outils qui permettront aux microbiologistes d'explorer la distribution et les rles des organismes dans l'environnement. La microbiologie peut maintenant tre une science entire; l'organisme peut tre tudi dans l'cosystme (Pace, 1997).

4. Impact

dune

pollution

mtallique

sur

les

organismes

eucaryotes du sol
4.1 Les mtaux lourds
Les mtaux sont dfinis comme des lments qui conduisent llectricit, avec un aspect mtallique, mallable et formant des cations et des oxydes basiques (Atkins et Jones, 1997). Usuellement, les termes mtal et mtal lourd sont utiliss en rfrence llment pur et toutes les formes chimiques (spciation) dans lesquelles llment peut exister (Duffus, 2002). Le terme mtal lourd fait rfrence aux lments mtalliques ou dans certains cas aux mtallodes caractriss par une grande masse atomique (>100) ou une densit suprieure 5g.cm-3 (Adriano, 1986) et qui sont frquemment associs une toxicit ou une pollution. Cette dfinition correspond 54 lments du tableau priodique, mais ils nont pas tous une importance biologique. En se basant sur leur solubilit sous conditions physiologiques, 17 de ces mtaux peuvent tre disponibles pour les cellules vivantes et ont

55

une influence sur les plantes et les cosystmes en gnral. Parmi ces mtaux, le fer, le zinc, le cuivre, le molybdne et le manganse ont une grande ou une faible importance comme lments traces. Quelques lments, comme le cadmium, nont pas de fonctions physiologiques connues et sont toxiques pour les plantes et les microorganismes (Schutzendubel et Polle, 2002) Le terme mtal lourd est trs approximatif (bas sur la densit, la masse atomique, le numro atomique ou dautres proprits chimiques) et est souvent mal employ comme un synonyme despce mtallique toxique et nuisible, supposant que les termes lourd et toxique sont identiques. Lusage du terme mtaux lourds a t srieusement dbattu cause de certains mtaux toxiques qui ne sont pas particulirement lourds (par exemple laluminium), et de quelques mtaux lourds qui sont indispensables la vie en faible quantit (Cu, Zn, Ni, Co). Dautres lments hautement toxiques ne sont mme pas des mtaux tel-00482109, version 2 - 29 Feb 2012 strictement parler, mais des mtallodes (Arsenic) ou des semi mtaux (Slnium). Pour ces raisons, le terme lment trace a t propos comme alternative (Fergusson, 1990). Cependant, nous utiliserons le terme mtal lourd car il est bien tabli dans la littrature biologique et parce que le travail ralis dans cette thse porte sur le Zn et le Cd.

4.2 Effets au niveau cellulaire


La plupart des mtaux sont des lments de transition formant des cations avec une haute capacit se lier aux atomes doxygne, dazote et de soufre (Nieboer et Richardson, 1980) et en particulier aux rsidus cystines, inhibant les activits de nombreuses enzymes (Van-Assche et Clijsters, 1990). Les mtaux lourds peuvent bloquer les groupes fonctionnels de molcules biologiques importantes ; dplacer et/ou replacer des ions essentielles dans les biomolcules ; ils peuvent induire un changement de la conformation, la dnaturation et linactivation denzymes et la disruption de tous les types de membranes cellulaires (Ochiai, 1987). Les mtaux sont aussi impliqus dans la production despces ractives de loxygne (ROS) (Schutzendubel et Polle, 2002), qui causent des dommages pour une grande gamme de biomolcules.

56

tel-00482109, version 2 - 29 Feb 2012

Figure 14: Origine des diffrents radicaux libres et espces ractives de loxygne impliqus en biologie. En dplaant le Fe2+ des protines, le Cd amplifie la production de ces composs (daprs Favier, 2003).

Figure 15: Mcanisme de la peroxydation des acides gras polyinsaturs et nature des produits terminaux forms (daprs Favier, 2003). MDA, malonedialdhyde. 57

4.2.1

Altrations des membranes cellulaires

La condition pralable la toxicit dun mtal est son contact avec les composants cellulaires. Il apparat donc clairement que la membrane plasmique est le premier site daction. Les membranes sont affectes de diffrentes manires. Le Cd inhibe de faon comptitive les ATPases dpendantes du magnsium en formant un complexe avec lATP, privant ainsi lenzyme de son substrat. Cette inhibition peut affecter lefflux dions H+ ainsi que le potentiel transmembranaire. La fluidit et la composition des lipides membranaires sont galement affectes, ce qui a des effets directs sur la permabilit membranaire (Garcia et al., 2005). Enfin, le Cd est susceptible de dplacer et de librer les ions Fe2+ des protines qui vont pouvoir gnrer, via des ractions de type Fenton, la formation despces ractives de loxygne tel que le peroxyde dhydrogne, les ions superoxydes et les radicaux hydroxyles tel-00482109, version 2 - 29 Feb 2012 (Stohs et Bagchi, 1995) (Fig. 14). Le radical hydroxyle (OH.) initie le processus de peroxydation membranaire. Les acides gras insaturs des membranes sont alors transforms en produits comportant des radicaux et des groupements hydroperoxydes qui, leur tour, vont favoriser les ractions radicalaires au niveau dautres constituants cellulaires (Fig. 15). Ces dommages cellulaires causs par les ROS sont regroups sous le terme de stress oxydant (ou stress oxydatif). 4.2.2 Interactions avec les acides nucliques

En gnral les mtaux interagissent indirectement avec les acides nucliques. Dune part, en gnrant des espces ractives de loxygne qui vont induire des msappariements entre les deux brins de lADN, provoquer des cassures de lADN simple brin, ainsi que leur dgradation (Waisberg et al., 2003; Liu et al., 2009) (Fig. 16). Dautres part, en agissant sur le fonctionnement denzymes impliques dans le mtabolisme des acides nucliques par remplacement dions comme le Ca2+, le Zn2+ et le Fe2+, ils vont conduire indirectement une altration de linformation gntique en influant sur la fidlit de la rplication (Kunkel et Loeb, 1979). Ces exemples deffets au niveau cellulaire ont t observs chez des cellules de mammifres (souris et homme) suite une intoxication aigue au cadmium. Dautres consquences biologiques ont galement t observes sur ce type de cellules (Fig. 17). Ces effets sont en partie retrouvs chez dautres organismes eucaryotes prsents dans le sol, tels

58

tel-00482109, version 2 - 29 Feb 2012

Figure 16: Lsions de lADN induites par attaque radicalaire. Les bases puriques et pyrimidiques sont modifies par les radicaux libres (encadr) (daprs Favier, 2003).

Figure 17: Rsum des effets causs par le cadmium chez les mammifres (daprs Waisberg et al., 2003).

59

que les plantes, les champignons et les protistes (Deckert, 2005 ; Ruotolo et al., 2008 ; Gallego et al., 2007 ; Watanabe et Suzuki, 2002).

4.3 Toxicit et adaptation


Lextrme toxicit gnre par une pollution mtallique induit une forte pression de slection, entranant ladaptation de certaines populations dorganismes tolrantes aux mtaux. Ce phnomne a bien t dcrit pour les procaryotes (Mergeay et al., 2003) et les eucaryotes (Colpaert et al., 2000; Blaudez et al., 2000b). 4.3.1 tel-00482109, version 2 - 29 Feb 2012 Toxicit et biodisponibilit des mtaux

La toxicit dun mtal dpend de sa biodisponibilit, c'est--dire de sa capacit tre transfr du compartiment sol un organisme vivant sous forme ionique (Juste, 1988). La biodisponibilit est influence par la concentration en mtal, par les facteurs physicochimiques du sol (pH, taux de matire organique, taux dargile) et par des facteurs biologiques propres chaque organisme vivant (capacit de biosorption, bioaccumulation, solubilisation). Il est donc important de mesurer la quantit biodisponible, extractible plutt que la quantit totale de mtaux prsente dans le sol. Mais, la biodisponibilit reste rarement mesure et rend les rsultats difficilement comparables. 4.3.2 Toxicit et adaptation chez les plantes

Les premires tudes sintressant des populations dorganismes eucaryotes tolrantes aux mtaux ont t ralises chez les plantes (Bradshaw et McNeilly, 1981 ; AlHiyali et al., 1990). La capacit survivre sur des sols mtallifres nest pas trs rpandue dans le rgne des plantes (Antonovics et al., 1971) et il est remarquable de constater que dans une large zone gographique les mmes espces de plantes dveloppent des populations mtallophytes, mme quand diffrents mtaux sont responsables de la toxicit. Ceci est bien connue pour quelques plantes monocotyldones, notamment chez les plantes herbaces (Schat et al., 2000). Cette volution sexpliquerait par la prsence de 0,1 0,5% dindividus tolrants aux mtaux dans les populations de plantes herbaces non adaptes (Al-Hiyali et al., 1993),

60

probablement d un taux de reproduction lev et une production de nombreux descendants. Les plantes ligneuses ne sont pas considres comme des colonisateurs primaires des sols pollus aux mtaux (Schat et al., 2000). Leurs longs cycles de reproduction, ne leurs permettraient pas davoir un potentiel adaptatif suffisamment fort pour la tolrance aux mtaux (Meharg et Cairney, 2000). De plus, les arbres dpendent beaucoup plus de leurs champignons ectomycorhiziens (ECM) associs que les herbaces de leur symbiontes mycorhiziens arbuscules, indpendamment de la pollution du sol. En effet, quand les champignons ectomycorhiziens se font rares, les plantes ligneuses colonisent plus lentement lenvironnement (Nara, 2006a ; Nara, 2006b). Cependant, des espces darbres symbiose ectomycorhizienne, comme les bouleaux, les pins et les saules, sont capable de coloniser des sites fortement pollus par des mtaux. Par consquent, les arbres rsistent cette toxicit tel-00482109, version 2 - 29 Feb 2012 cause de leur grande plasticit phnotypique et travers leur association avec un partenaire fongique ectomycorhizien bien adapt (Wilkinson et Dickinson, 1995). De nombreux champignons (mycorhiziens ou pas) et bactries de la rhizosphre tolrants aux mtaux sont connus pour augmenter la fitness des plantes sur un sol contamin aux mtaux (Vivas et al., 2006 ; Kozdroj et al., 2007). 4.3.3 Toxicit et adaptation chez les champignons

Comme pour les plantes, les carpophores de certaines espces de champignons sont de moins en moins abondants lorsque le degr de pollution augmente, alors que dautres espces ne sont pas affectes et labondance de leurs carpophores augmente (Rhling et Sderstrm, 1990). Des tudes rcentes (Colpaert et al., 2000) ont aussi montr des variations gntiques aussi bien aux niveaux inter- quintraspcifiques pour la tolrance des champignons ectomycorhiziens au Cd. Ces mmes tudes ont montr que des isolats de Suillus luteus issus dun sol contamin au Cd taient gnralement plus rsistants ce mtal que ceux issus dun sol non contamin. Nanmoins, chez Paxillus involutus, des isolats tolrants ont pu tre prlevs partir de sols non contamins et aucune corrlation entre le niveau de tolrance et le degr de contamination du sol dorigine na pu tre observe (Blaudez et al., 2000b). Les champignons sont capables daccumuler du Cd dans leurs carpophores en quantit variable suivant lespce (jusqu 5.7 g.g-1 de poids sec pour S. luteus). Des tudes ont montr que le rapport de concentration en Cd dans la biomasse fongique divise par celle du sol peut varier de 2 1000 suivant lespce (maximum pour Amanita muscaria) (Gast et al., 61

1988). En condition axnique, o le mtal est ajout sous forme de sel soluble, ce rapport atteint 200 et 80 pour des isolats de Suillus bovinus non tolrants et tolrants au Cd, respectivement (Colpaert et Van-Assche, 1992). Dans ce cas, la tolrance semble donc se traduire par lacquisition dune capacit accrue exclure le Cd de la cellule. Ainsi une forte capacit daccumulation ne reflte pas ncessairement une forte tolrance. Cependant, lanalyse des carpophores ne reflte pas toujours lactivit des mycliums souterrains et dautres indicateurs de lactivit fongique en prsence de Cd sont utiliss, comme les mesures dmission de CO2 dchantillons de sol refltant lactivit biologique globale, ou le dosage de lergostrol (marqueur du groupe des champignons). Mais aucune variation de ces indicateurs en rponse la prsence de mtaux na t observe (BarajasAceves et al., 2002). Ces rsultats sexpliqueraient par le remplacement des mycliums despces non tolrantes par ceux despces tolrantes. tel-00482109, version 2 - 29 Feb 2012 4.3.4 Toxicit et adaptation chez les protistes

Trs peu dtudes portent sur la toxicit des mtaux sur les protistes dans les sols (Bowers et al., 1997 ; Campbell et al., 1997 ; Diaz et al., 2006). Dans chaque cas, des espces de cilis du genre Colpoda, bien reprsentes dans les sols, ont t utiliss. Des tudes ont montr des variations intraspcifiques de sensibilit aux mtaux (Xu et al., 1997) et des variations suivant la localisation gographique. Les diffrences de tolrance aux polluants toxiques parmi des souches ou mme des individus et des clones dune mme espce sont des phnomnes bien connus (Forbes, 1998), et illustrent l'importance de linteraction gnotypeenvironnement dans les rponses aux toxiques. Une autre donne importante concerne la diminution de la toxicit du Cd en prsence de Zn en concentration faible ou modre (Diaz et al., 2006). Ceci a galement t dmontr chez lespce de protiste deau douce Tetrahymena pyriformis (Chapman et Dunlop, 1981). Dans tous les cas, un antagonisme entre le Zn et le Cd a t suggr. Toutefois, Diaz et al. (2006) ont dmontr que les protistes du sol taient plus rsistants au Cd et au Zn que ceux dautres habitats, probablement parce quils sont adapts un habitat dans lequel la pollution mtallique persiste. Les protistes sont donc des organismes actifs dans les sols pollus par des mtaux et contribuent leur fertilit. Ils sont en effet connus pour tre des prdateurs directs de bactries et de champignons et des proies de nmatodes (Ekelund et al., 2002), mais galement capables daugmenter la capture dazote par les plantes et ainsi daugmenter leur biomasse (Bonkowski, 2002). 62

tel-00482109, version 2 - 29 Feb 2012

Figure 18: Mcanismes cellulaires et molculaires potentiellement impliqus dans la tolrance mtallique chez le champignon ectomycorhizien Paxillus involutus (Bellion et al., 2006). Me, mtal ; MT, mtallothionine ; GSH, glutathion ; MnSOD, superoxyde dismutase manganse-dpendant (daprs Lanfranco, 2007).

63

La comprhension des interactions complexes entre les microorganismes et les plantes dans les sols pollus par des mtaux lourds devraient augmenter le rendement de phytormdiation des mtaux.

4.4 Mcanismes microbiens eucaryotes de tolrance aux mtaux


Les termes de tolrance et rsistance sont utiliss de faon interchangeable et sans distinction claire dans la littrature. Ils sont souvent bass sur les capacits dun organisme crotre sur un milieu de culture contenant une concentration biologiquement active en mtal. De nombreuses tudes se rapportant au sujet, et dtailles ci-dessous, ont montr que seul un petit nombre de gnes majeurs impliqus dans ces mcanismes ont t mis en vidence bien tel-00482109, version 2 - 29 Feb 2012 que sans doute de nombreux autres gnes mineurs pourraient aussi tre impliqus (Hall, 2002) Les mcanismes de tolrance ont t tudis en dtail chez des modles tels que les levures Saccharomyces cerevisiae et Schizosacchomyces pombe, ainsi que chez la plante Arabidopsis thaliana. Rcemment, la prsence de mcanismes extra-et intracellulaires complexes a clairement t dmontre par une combinaison d'approches microbiologiques, biochimiques et de biologie molculaire principalement appliques des systmes modles, comme Paxillus involutus (Blaudez et al., 2000a), aprs une exposition aux ions de cadmium (Fig. 18). Ces mcanismes impliquent la liaison non spcifique aux parois cellulaires, des systmes intracellulaires de chlation du mtal, des rponses au stress oxydatif et la modulation d'expression de gnes (Bellion et al., 2006). Quelques donnes sont galement disponibles pour les protistes (Diaz et al., 2006). 4.4.1 Complexation et prcipitation extracellulaire De nombreux composs extracellulaires peuvent se complexer ou prcipiter avec les mtaux lourds. Le mcanisme essentiel par lequel les plantes sont capables de tolrer laluminium implique lexcrtion racinaire dacide organique tel que lacide oxalique (Ma et al., 2001). Les oxalates daluminium non toxiques sont ensuite accumuls dans les feuilles de la plante. Lors dune exposition au Cd, la levure S. cerevisiae augmente la synthse denzymes impliqus dans le mtabolisme des carbohydrates (Vido et al., 2001). Ce rsultat

64

Figure 19: Structure du chlat dun ion mtallique avec des acides organiques ; exemple du malate.

tel-00482109, version 2 - 29 Feb 2012

Figure 20: Influence de lpaisseur de la paroi cellulaire sur ladsorption du Cd. Coupes de parois cellulaires de 2 souches de Saccharomyces cerevisiae observes au microscope lectronique transmission. Une souche paroi paisse (A) adsorbe mieux le Cd quune souche paroi fine (B) (daprs Park et al., 2003) 65

suggre que lactivation des enzymes du mtabolisme nergtique (glycolyse, cycle de Krebs) doit tre ncessaire pour garantir la production et lexcrtion dacides organiques (Fig. 19). Les champignons ectomycorhiziens sont connus pour excrter des acides di- et tricarboxyliques. Dans de nombreuses tudes, laugmentation de lefflux dacide oxalique est corrle la tolrance aux mtaux chez les champignons ECM (Fomina et al., 2005 ; AhonenJonnarth et al., 2000 ; Cumming et al., 2001). Cependant, ce mcanisme nest pas retrouv chez toutes les espces dECM et est dpendant du mtal (Meharg, 2003). Par ailleurs, dautres composs comme la glomaline, une protine synthtise et excrte par un champignon mycorhizien arbuscule (Gonzalez-Chavez et al., 2004) est capable de squestrer des ions mtalliques, comme le Cu, le Pb et le Cd, prsents en forte concentrations dans des sols pollus. tel-00482109, version 2 - 29 Feb 2012 4.4.2 Fixation aux parois cellulaires

La paroi cellulaire est le premier site dinteraction entre les mtaux et la cellule microbienne. Les interactions physico-chimiques (change ionique, adsorption, complexation, prcipitation, et cristallisation) responsables de lassociation des espces mtalliques aux parois cellulaires portent le nom de biosorption. La paroi des champignons est compose de polymres comprenant des glucanes, de la chitine et des polymres de galactosamines ainsi que quelques protines. Elle possde donc un grand nombre de sites de liaison potentiels pour les mtaux tels que des groupes carboxyles, amines, hydroxyles, phosphates et thiols. Chez S. cerevisiae, la biosorption du Cd a pu tre mise en vidence par microscopie lectronique transmission ou balayage et analyse par spectroscopie nergie dispersive. Certaines souches rsistantes aux mtaux prsentent souvent un paississement de leur paroi corrl positivement leur capacit dadsorption du Cd (Park et al., 2003) (Fig. 20). Turnau et al., (1994) ont rvl que la tolrance des champignons ectomycorhiziens aux mtaux tait associe la formation de pigments paritaux. Jacob et al., (2004) ont montr une augmentation (de 3.9 fois) des transcrits de laccase (enzyme catalysant la synthse de mlanine partir de substrats phnoliques) chez Paxillus involutus lors dune exposition au Cd. Cette augmentation favoriserait ainsi la squestration du mtal sur les pigments de la paroi.

66

4.4.3

Transport et homostasie

Le phnomne de tolrance rsultant dune augmentation de la capacit dadsorption des mtaux nest pas une caractristique universelle. Certaines souches de levure rsistantes au Cd peuvent aussi accumuler lintrieur de la cellule des quantits considrables de Cd probablement grce des mcanismes de squestration intracellulaire trs efficaces. Un autre mcanisme de tolrance consiste aussi en lefflux de cations mtalliques vers le milieu extrieur. Des tudes menes chez les levures S. cerevisiae et Candida albicans ont montr que les transporteurs membranaires CAD2 et CaCRP1 appartenant la famille de pompes CPx-ATPases (retrouvs chez de nombreuses bactries) sont impliqus dans lefflux de Cd et confrent une rsistance au Cd (Shiraishi et al., 2000 ; Weissman et al., 2000). Dans le cas de Paxillus involutus, la diminution de laccumulation et de la distribution tel-00482109, version 2 - 29 Feb 2012 du 109Cd dans les diffrents compartiments intracellulaires basse temprature suggre que le transport du Cd travers les membranes est un processus actif (Blaudez et al., 2000a). Dans cette tude, lutilisation dun protonophore, dpolarisant la membrane cellulaire, inhibe partiellement la capture du Cd. Par contre, linhibition de canaux K+ ne diminue pas laccumulation et la compartimentation du Cd dans le mycelium de Paxillus involutus, tout comme linhibition des H+/ATPase. Ces rsultats dmontrent que le systme de transport du Cd ne dpend pas du gradient de K+ et exclut limplication de H+/ATPase dans lefflux de protons. Enfin, linhibition de canaux Ca2+ diminue laccumulation de Cd ; ces canaux pourraient donc jouer un rle dans le transport du Cd travers les membranes. 4.4.4 Les thiols cellulaires

Une fois entr dans la cellule, le Cd se lie des composs essentiels des voies de dtoxication prsents chez de nombreux organismes (animaux, vgtaux, microorganismes). Il sagit de thiols cellulaires non protiques, tel que le glutathion rduit (GSH), les phytochlatines (PCs) et des thiols cellulaires protiques, tel que les mtallothionines (MTs). 4.4.4.1 Le glutathion rduit Le GSH est le compos thiol le plus abondant dans les cellules eucaryotes. Son potentiel rdox trs bas (-240mV) fait de lui un excellent rducteur de radicaux libres. La nature nuclophile du groupement SH lui permet aussi de chlater les ions mtalliques. Des 67

tel-00482109, version 2 - 29 Feb 2012

Figure 21: Vue gnrale du mtabolisme du glutathion et ses rles chez les organismes vivants.

68

tudes menes chez S. cerevisiae ont montr une relation entre lexposition au Cd et laugmentation de la transcription denzymes impliqus dans la voie dassimilation des sulfates et dans la biosynthse de la cystine prcurseur du glutathion (Vido et al., 2001). Fauchon et al., (2002) ont aussi dmontr que des cellules de levure, en condition de stress au Cd, taient capables de rguler lutilisation des acides amins soufrs (Cys et Met) en synthtisant et en utilisant prfrentiellement des isoformes de certains enzymes de la glycolyse dont les squences sont naturellement pauvres en ces deux acides amins afin sans doute de les conomiser pour la synthse de GSH (Fig. 21). Des tudes menes chez des champignons ectomycorhiziens comme Paxillus involutus et Laccaria laccata ont montr une augmentation de la concentration en glutathion et en ses prcurseurs biosynthtiques (-GluCys) lors dun stress au Cd (Courbot et al., 2004). Toutefois, linduction de lexpression de la cystine synthase na pas t observe chez P. tel-00482109, version 2 - 29 Feb 2012 involutus lors dun stress au Cd. Il sagit dun enzyme cl de la voie de biosynthse de la cystine dont une forte activit amplifie la synthse de molcules squestrant le Cd tels que le GSH ou les PCs. Par contre, une diminution de lactivit dautres enzymes utilisant la cystine (cystathionine synthase) et une diminution de la synthse de protines riches en cystines (hydrophobines) ont t observes (Jacob et al., 2004). Ce mcanisme alternatif permettrait de rediriger les cystines vers la production de molcules pigeant le Cd. 4.4.4.2 Les phytochlatines Les phytochlatines constituent une famille de petits peptides riches en cystines capables de fixer les ions de mtaux lourds via leurs groupes SH. La structure gnrale des PCs est [-GluCys]n-Gly (n = 2 5) (Fig. 22). Les PCs sont synthtises de faon enzymatique, par la phytochlatine synthase, partir de -glutamylcystine qui est un compos intermdiaire de la voie de biosynthse du GSH et qui possde des proprits propres de chlation des mtaux (Cruz-Vasquez et al., 2002). Les PCs se rencontrent chez les plantes, les algues, quelques espces de champignons ainsi que chez des invertbrs. Les premires PCs fongiques ont t isoles de la levure Schizosaccharomyces pombe expose un stress au Cd (Murasugi et al., 1981). Ces molcules nexistent pas chez S. cerevisiae. Une squence similaire au gne cad1, codant la PC synthase chez Arabidopsis, a t trouve dans le gnome de S. pombe et la dltion de cette squence conduit une dficience en PCs et une sensibilit au Cd (Murasugi et al., 1981).

69

Figure 22: Structure primaire dune phytochlatine (n = 2-5). tel-00482109, version 2 - 29 Feb 2012

Figure 23: Vue shmatique dune mtallothionine animale. Les 2 domaines de la protine (fragments alpha et bta) sont capables de lier respectivement 4 et 3 atomes de Cd (en bleu) par coordination avec les groupements thiolates des cystines (en rouge).

70

4.4.4.3 Les mtallothionines Les mtallothionines quant elles sont des peptides de faible masse molculaire (25 60 acides amins) issus de la traduction dun ARN messager (Cobbett et Goldsbrough, 2002). Elles sont riches en cystine et chlatent les ions mtalliques par coordination avec les thiolates. Les mtallothionines ont t classes en diffrentes familles sur la base de leur squence protique et plus particulirement suivant le motif dessin par larrangement de leurs rsidus cystines (http:// www.expasy.org/cgi-bin/lists?Metallo.txt) (Fig. 23). Dun point de vue volution, les MTs ou les polypeptides ressemblant aux MTs ont t trouvs dans toutes les branches de l'arbre de vie, avec une remarquable conservation de la structure fonctionnelle travers les phyla. Une hypothse suggre que les structures des MT tel-00482109, version 2 - 29 Feb 2012 ancestrales ont volu sous la pression slective denvironnement dans lequel des mtaux toxiques et des radicaux libres taient particulirement abondants (Coyle et al., 2002). Lorigine polyphyltique des MTs modernes sexpliquerait par leur spcialisation, au cours de lvolution, en termes de fonction et de capacit de liaison aux mtaux dans chaque forme de vie pour s'adapter aux diffrentes niches environnementales et/ou aux conditions mtaboliques endognes spcifiques. Deux groupes principaux de MTs ont t proposs sur la base de leur capacit de liaison aux mtaux: les Cu-thionines et les Zn-thionines. Chez S. cerevisiae, les deux gnes codant les MTs (cup1 et crs5) ne sont exprims quen prsence de Cu, la prsence de Cd ninduit pas leur synthse (Culotta et al., 1994, Vido et al., 2001). Rcemment, Crs5 a t caractris comme tant capable de lier le Zn mieux que le Cu (Pagani et al., 2007). De mme, un gne pouvant coder une MT, appel zym1, a t clon chez Schizosaccharomyces pombe et semble tre exprim en prsence de Cu et de Zn mais pas de Cd (Borrelly et al., 2002). Il semblerait que le rle des MTs dans la dtoxication du Cd serait dune importance moindre compar celui des PCs. Toutefois, la surexpression de MTs dans S. cerevisiae lui confre bien une rsistance au Cd (Kuroda et Ueda, 2006). De plus, un champignon, Candida glabatra, connu pour produire la fois des PCs et des MTs pour la dtoxication des mtaux, produit seulement des PCs en rponse un stress au Cd (Mehra et Winge, 1991). Il y a trs peu dinformations concernant le rle des MTs chez les champignons mycorhiziens. Des gnes codant pour des MTs putatives ont t dcouverts lors de squenages systmatiques de gnes exprims chez les champignons ectomycorhiziens

71

Pisolithus tinctorius (Voiblet et al., 2001) et endomycorhiziens Glomus intraradices (Stommel et al., 2001) et Gigaspora margarita (Lanfranco et al., 2002). De mme, les donnes concernant les MTs de protistes sont rares. Elles concernent exclusivement des espces du genre Tetrahymena, chez lesquelles deux principales sousfamilles de MTs ont t caractrises (Diaz et al., 2007); la sous-famille 7a qui inclut 6 Cdthionines et la sous-famille 7b constitue par 3 Cu-thionines. Les deux sous-familles diffrent par leur profil d'induction par des mtaux lourds (principalement par le Cd ou le Cu, mais pas exclusivement) (Boldrin et al., 2002 ; Diaz et al., 2007; Dondero et al., 2004 ; Shang et al., 2002) et par le motif dessin par leurs rsidus cystines (Diaz et al., 2007). Les MTs de cilis prsentent des caractristiques exclusives par rapport aux MTs classiques . Ce sont des protines plus longues (96-181 acides amins, 10-19 kDa), avec un contenu en rsidus Cys plus important (22-54) et contenant pour plusieurs dentres elles des acides amins tel-00482109, version 2 - 29 Feb 2012 aromatiques et des rsidus histidine (Diaz et al., 2007). 4.4.5 Compartimentation vacuolaire

La compartimentation joue un rle essentiel dans les mcanismes de tolrance et de dtoxication des mtaux lourds en vitant leur libre circulation dans le cytoplasme et en les concentrant dans un espace rduit o ils ninduisent pas de stress biologique . Chez S. cerevisiae, le Cd est transport et squestr dans les vacuoles sous forme de Cd-(GSH)2 par la permase spcifique YCF1. Il sagit dun transporteur de type ABC, prsentant des homologies avec les protines de la famille des MRP (multi-drug resistanceassociated protein) animales (Li et al., 1997). Limportance de ce systme de dtoxication est dmontre par lhypersensibilit au Cd de S. cerevisiae conscutive la dltion du gne ycf1 (Wemmie et al., 1994). Un homologue de ce transporteur membranaire a t identifi dans les vacuoles dun mycelium de Paxillus involutus comme tant impliqu dans la translocation (et la squestration physique) de complexes Cd-(GSH)2 (ou Cd-( -GluCys)2) dans les vacuoles (Courbot et al., 2004). Dans les conditions de pH acide de la vacuole (environ 5,4), il est vraisemblable que ces complexes soient dissocis et que les molcules de GSH et de GluCys soient dgrades par des hydrolases, ce qui permet la cellule de rcuprer des cystines sous forme rduite. Les acides amins rsultants de cette dgradation sont redirigs vers le cytoplasme. Les mtaux quant eux sont alors pris en charge par des acides

72

organiques comme le citrate, le malate ou loxalate et sont rendus inactifs en formant des cristaux par complexation (Sanit-di-Toppi et Gabbrielli, 1999). Trois transporteurs intracellulaires potentiels de zinc ont t identifis chez S. cerevisiae. Ces transporteurs sont trois membres de la famille CDF (cation diffusion facilitator), il sagit de Zrc1, Cot1 et Msc2. Le gne zrc1 a t dfini comme un dterminant de rsistance au zinc ; la surexpression de zrc1 aboutit la capacit accrue des cellules tolrer de hautes concentrations de zinc (Kamizono et al., 1989). Le gne cot1 a t isol d'une faon semblable zrc1, c'est--dire, comme suppresseur de la toxicit au cobalt et, plus tard, pour confrer une rsistance au zinc (Conklin et al., 1992 ; Conklin et al., 1994). La dltion de zrc1 ou cot1 aboutit une plus grande sensibilit un excs de zinc, supportant le rle potentiel de ces gnes dans la compartimentation du zinc. tel-00482109, version 2 - 29 Feb 2012 Enfin, la sensibilit au Zn de mutants de levures H+-ATPase prouve que lacidification de la vacuole est ncessaire la compartimentation vacuolaire du Zn et que son transport dpend dun antiporteur Zn2+/H+ (Eide et al., 1993 ; Nishimura et al., 1998). 4.4.6 Systme de dtoxication antioxydatif

La plupart des cellules est quipe de systmes antioxydatifs efficaces composs la fois de mcanismes non enzymatiques (GSH, acide ascorbique) et enzymatiques (peroxydase, superoxyde dismutase et catalase). Vido et al., (2001) ont montr que des souches de S. cerevisiae dltes pour les superoxydes dismutases cytosolique et mitochondriale (SOD1 et SOD2) sont hypersensibles au Cd. Ils ont galement observ que plusieurs systmes antioxydatifs reprsents par les gnes ahp1 (alkyl hydroperoxyde rductase) et tsa (thioperoxydase) sont induits par le Cd. Le Cd peut aussi contribuer indirectement au stress oxydatif en affectant lquilibre thiol-rdox cellulaire. Il est capable de se fixer sur les thiordoxines (TRX), probablement au niveau du site actif dithiol, ce qui inhibe lactivit de ces dernires. Lanalyse de la rponse protomique de S. cerevisiae un stress au Cd, a rvl que les deux systmes cellulaires de maintien du statut redox, glutathion et thiordoxine, taient significativement induits (Vido et al., 2001). De plus, les souches dltes la fois pour les gnes de 2 thiordoxines cytosoliques (TRX1 et TRX2) ou pour la thiordoxine rductase (TRR1) sont hypersensibles au Cd (Vido et al., 2001). Enfin, le rgulateur transcriptionnel YAP-1 de S. cerevisiae, dont la dltion entrane une hypersensibilit au Cd (Lee et al., 1999) et dont la surexpression 73

entrane une hyper-rsistance ce mtal (Wu et Moye-Rowley, 1994), est impliqu dans le contrle de plusieurs gnes de rponse au mtal tels que ycf1 et gsh1, et galement dans linduction de gnes de dfense antioxydants tels que trx et ccp1. Lensemble de ces mcanismes pourrait se rencontrer chez les champignons filamenteux. En effet, Jacob et al., (2001 ; 2004) ont montr non seulement une induction de la SOD en rponse au Cd chez P. involutus, refltant une augmentation du taux de O2-. mais aussi que AP-1, homologue de YAP-1, est surexprim chez P. involutus lors dun stress au Cd.

4.5 Conclusion
La toxicit directe (altration membranaire, enzymatique) et indirecte (stress oxydant) tel-00482109, version 2 - 29 Feb 2012 des mtaux, et en particulier du Cd, sur les microorganismes eucaryotes induit de nombreux mcanismes capables dy remdier. Ces mcanismes, dits de tolrance, prennent en charge ce compos toxique tous les niveaux cellulaires, depuis sa complexation extracellulaire jusqu sa squestration intra-vacuolaire. Cette rponse, inne ou adaptative, entrane la slection despces rsistantes ou tolrantes et est susceptible de modifier la biodiversit des microorganismes eucaryotes des sols pollus aux mtaux lourds. Les microorganismes eucaryotes se dveloppant dans les sols pollus constituent donc un rservoir de biodiversit encore peu exploit. Leur tude, par des approches mtagnomique et mtatranscriptomique, pourrait permettre didentifier des mcanismes ou des gnes nouveaux impliqus dans la dtoxication et ouvre potentiellement une nouvelle voie pour la biormdiation des sols pollus par les mtaux lourds.

74

-Chapitre 1tel-00482109, version 2 - 29 Feb 2012

Molecular diversity of soil eukaryotic communities, different molecules (18S rDNA versus cDNA) tell different stories

75

Ce chapitre fait lobjet dune publication soumise la revue Applied and Environmental Microbiology. Le but de cette publication est destimer et de comparer la diversit taxinomique et fonctionnelle des microorganismes eucaryotes prsents dans 5 sols forestiers, dune part, par lanalyse des squences partielles dADNr et dARNr 18S obtenues par une approche de clonage/squenage et dautre part, par lanalyse des ARNm poly-adnyls rtrotranscits obtenues par une approche mtatranscriptomique. Il sagit de la premire tude comparative de la diversit eucaryote des sols base sur ces approches. Un regard critique a ainsi pu tre port sur les rsultats gnrs et notamment sur les proportions relatives des diffrents groupes taxinomiques au sein de chaque jeu de squences. tel-00482109, version 2 - 29 Feb 2012 Cette publication incorpore une partie de mes travaux de thse mais aussi une partie de la thse de Coralie Damon (co-auteur), qui tudie les consquences de pratiques forestires, et plus particulirement limpact du couvert vgtal (htre versus pica) sur la diversit taxinomique et fonctionnelle de communauts de microorganismes eucaryotes du sol. Des donnes de la thse de Julie Bailly (Bailly et al., 2007), qui sintressait la diversit taxinomique et fonctionnelle des microorganismes eucaryotes prsents dans un sol sous pin maritime, sont aussi incluses dans cette publication. Ma contribution ce travail concerne lanalyse de deux sols prlevs sous des pins sylvestres, lun non contamin, lautre anciennement contamin par des mtaux lourds (durant prs dun sicle). Ces deux sols font lobjet danalyses complmentaires prsentes dans le chapitre 3. Quelques dtails concernant le protocole dextraction des acides nucliques du sol, qui ne figurent pas dans cette publication, sont dcrits ci-dessous. En effet, ltape cl de ces approches concerne lextraction et la purification des acides nucliques (ADN et ARN) partir de sols afin dobtenir des ADN et des ARN en quantit et de qualit suffisante pour effectuer des manipulations de biologie molculaire (rtrotranscription, amplification par PCR, clonage, construction de banques mtatranscriptomiques). Un protocole dextraction mis au point prcdemment au laboratoire (Bailly et al., 2007) a t test et optimis. Les diffrents essais effectus ont confirm que le broyage pralable du sol sec dans de lazote liquide laide dun broyeur de roches pralablement 76 ribosomiques et

Matire organique (g/kg) Paal Lommel Balen 4,9 15,9 30,9

SDS 1,85 % 1,7 % 1,6 %

Guanidine isothiocyanate 100 M 400 M 600 M

Tableau 10: Quantit de matire organique contenue dans les chantillons de sols prlevs sur les sites de Paal, Lommel et Balen et quantits de SDS et de guanidine isothiocyanate utilises lors de lextraction des acides nucliques.

tel-00482109, version 2 - 29 Feb 2012

Figure 24: Extraction des acides nucliques du sol de Lommel avec (d-f) ou sans (a-c) broyage pralable du sol laide dun broyeur de roche. 20 L dextrait sont dposs dans chaque puits. a: extraction partir d1g de sol avec 1,7% de SDS et 400 M de guanidine isothiocyanate. b: extraction partir d1g de sol avec 1,8% de SDS et 200 M de guanidine isothiocyanate. c: extraction partir de 0,5g de sol avec 1,7% de SDS et 400 M de guanidine isothiocyanate. d: extraction partir de 0,5g de sol avec 1,85% de SDS et 100 M de guanidine isothiocyanate. e: extraction partir de 0,5g de sol avec 1,8% de SDS et 200 M de guanidine isothiocyanate. f: extraction partir de 0,5g de sol avec 1,7% de SDS et 400 M de guanidine isothiocyanate. M: marqueur de poids molculaire T: extrait dARN dHebeloma cylindrosporum.

77

refroidi -70C permettait daugmenter de manire significative les rendements dextraction des acides nucliques (Fig. 24). Une dure de broyage de 3 minutes semble optimale pour les 5 sols de natures physico-chimiques diffrentes. Une autre amlioration a port sur la quantit de sol utilise par extraction, rduite 0,5 g au lieu de 1 g afin de favoriser lhomognisation du sol dans le tampon dextraction (Fig. 24). De plus, la seconde tape de broyage, laide de billes de verres et dun broyeur billes (microdismembrator, Braun Biotech), permet galement daugmenter la surface de contact entre la matrice sol et le tampon dextraction et donc damliorer le rendement dextraction. Loptimisation la plus flagrante concerne la composition du tampon dextraction. Suivant le type de sol, des volumes diffrents de tampon de lyse (contenant du SDS) et de solution dnaturante (contenant de la guanidine isothiocyanate) ont t utiliss (Fig. 24). Une corrlation entre la quantit de matire organique contenue dans lchantillon de sol et la quantit de guanidine isothiocyanate tel-00482109, version 2 - 29 Feb 2012 utilise a pu tre mise en vidence (Tableau 10). Enfin, lajout dune tape supplmentaire de prcipitation au chlorure de lithium pendant une nuit permet daugmenter significativement le rendement dextraction des ARN. Cependant, tous les acides nucliques extraits des diffrents sols ne se prtent pas immdiatement des manipulations de biologie molculaire. En effet, comme le suggre la couleur brune de certains extraits, une partie des acides humiques contenus dans certains chantillons de sol sont vraisemblablement co-extraits avec les acides nucliques et inhibent les ractions enzymatiques effectues ultrieurement. Une tape de purification sur une micro-colonne dexclusion de taille contenant du Sephadex G-50 (ProbeQuant, Amersham) sest montre particulirement efficace pour liminer une bonne partie de ces inhibiteurs. Toutefois, lutilisation dun mime molculaire de lADN comme la BSA (Bovin Serum Albumin) est indispensable lors des tapes de rtro-transcription et damplification par PCR afin de piger les inhibiteurs enzymatiques restant. Toutes ces optimisations ont permis de construire 5 banques ribosomiques dADNr et dARNr 18S et 5 banques dADNc environnementales partir de 5 sols forestiers dont lanalyse et la comparaison sont prsentes dans cette publication. Cette mthode a galement permis la construction dune banque dADNr et dARNr 18S et dune banque dADNc environnementale partir dun sol forestier pollu par des mtaux lourds. Lanalyse de ces banques de sol pollu est dcrite dans le chapitre 3.

78

Molecular diversity of soil eukaryotic communities, different molecules (18S rDNA versus cDNA) tell different stories.

Frdric Lehembre,1 Coralie Damon,1 Julie Bailly,1 Elise David,1 Jacques Ranger,2 Jan Colpaert,3 Laurence Fraissinet-Tachet1 and Roland Marmeisse1*

Ecologie Microbienne, UMR CNRS, USC INRA, Universit de Lyon, Universit Lyon 1, 69622 Villeurbanne, France,1 Biogochimie des Ecosystmes Forestiers, INRA centre de Nancy, 54280 Champenoux, France,2 and Universiteit Hasselt, Centrum voor Milieukunde, 3590 Diepenbeek, Belgium3 tel-00482109, version 2 - 29 Feb 2012

These two authors contributed equally to the work

Present address: Laboratoire d'Eco-Toxicologie, Unit de Recherche Vigne et Vins de Champagne, Stress et Environnement, Universit de Reims Champagne-Ardenne, Reims, France

* Corresponding author, mailing address: Ecologie Microbienne, UMR CNRS, USC INRA, Universit de Lyon, Universit Lyon 1, Btiment Lwoff, 43 Boulevard du 11 Novembre 1918, 69622 Villeurbanne Cedex, France. Phone: +33 472448047. Fax: +33 472431643; E-mail: roland.marmeisse@univ-lyon1.fr

Running title: MOLECULAR DIVERSITY OF SOIL EUKARYOTES

79

ABSTRACT Diversity of microbial communities is estimated by sequencing neutral markers such as ribosomal genes amplified from DNA extracted from environmental samples. This approach has rarely been applied to soil eukaryotes and does not give access to the functional diversity of these organisms, which play important roles in biogeochemical cycles. We compared the taxonomic diversity of different sets of eukaryotic nucleic acid sequences retrieved from five forest soils. Two sets were composed of partial 18S ribosomal genes, amplified from either soil-extracted DNA (rDNA) or reverse-transcribed RNA (rRNA). The third set was obtained following a metatranscriptomic approach. Soil polyadenylated mRNAs were converted into cDNAs which were sequenced. All major eukaryotic phyla were represented within the rDNA and rRNA datasets and the 94 to 157 sequences obtained from each soil did not saturate the true diversity at each of the sites. Preliminary phylogenetic analyses suggested the presence of tel-00482109, version 2 - 29 Feb 2012 potentially new, deep-branching, phyla in the amebozoa and the cercozoa. In contrast, almost all cDNA sequences were attributed either to fungi, animals or plants. The almost complete absence of cDNA sequences from unicellular eukaryotes is likely an artefact resulting from the scarcity of protein sequences from these organisms in databases. The relative proportions of each sequence dataset vary unpredictably across taxonomic groups and forest sites. Despite these pitfalls, with nearly 50% of the soil cDNA sequences encoding proteins of known functions, the metatranscriptomic approach appears promising to study at the molecular level key soil biological process and how they respond to environmental changes.

80

INTRODUCTION
Amplification and sequencing of the nuclear small subunit ribosomal gene (18S gene) using DNA extracted from various environments has revealed an unexpected diversity of unicellular eukaryotes. Molecular surveys carried out using "universal" or phylum-specific 18S PCR primers have, in particular, revealed the existence of novel and yet widespread deepbranching phyla of unicellular eukaryotes Lopez-Garcia et al., 2001; Moon-van der Staay et al., 2001; Not et al., 2007 and also a higher than expected species diversity within known phyla Bass et Cavalier-Smith, 2004; Cavalier-Smith et von der Heyden, 2007; Porter et al., 2008; Viprey et al., 2008. These molecular surveys also point to a high diversity of eukaryotes in environments traditionally considered as hostile to eukaryotic life, such as deepsea hydrothermal vents Edgcomb et al., 2001, anoxic basins Stoeck et al., 2006 or hypersaline tel-00482109, version 2 - 29 Feb 2012 waters Fomina et al., 2005. Finally, these molecular surveys have also been used to rank taxonomic and trophic groups according to their relative abundance thus highlighting the importance of sometime underestimated mechanisms such as parasitism in ecosystem functioning Guillou et al., 2008; Lefevre et al., 2008. Most of these studies, which made use of "universal 18S primers", have been conducted in aquatic environments either marine or continental and very few of them on soils. Indeed, soil biologists tend to specialize on specific eukaryotic groups and very seldom try to appreciate and to quantify the global soil eukaryotic diversity. There is for example, a very large body of data specifically reporting, using phylum-specific primers, on the molecular diversity of e.g. soil fungi O'Brien et al., 2005; Porter et al., 2008; or nematodes Floyd et al., 2002. On the opposite, other major eukaryotic phyla known to thrive in soils (such as the cercozoa or the excavates) are largely ignored if we except the studies specifically dealing with their taxonomy. One possible reason, which refrains soil microbiologists from studying microbial eukaryotic communities as a whole is that it is not possible to easily separate soil microorganisms sensu stricto, by eg filtration, from fine plant roots and metazoa in the millimetre range. Therefore, as indeed illustrated by the few studies on the subject, studies on the global soil eukaryotic communities encompass the entire eukaryotic domain, including the phyla with multicellular organisms O'Brien et al., 2005; Tringe et al., 2005; Lesaulnier et al., 2008; Urich et al., 2008. Global studies on soil eukaryotic diversity seem necessary to compare basic biological processes between soils and how they are impacted by various environmental factors. One emerging experimental approach used to address functional diversity of complex microbial 81

communities is metatranscriptomic. This technique relies on the extraction of labile, shortlived "environmental RNA" and their conversion into cDNA which are sequenced. Distribution of the cDNAs by phylogenetic origin and into functional groups reflects "who is doing what" within the studied microbial community. Initial examples of this approach did not attempt to separate prokaryotic from eukaryotic microorganisms. cDNAs from the eukaryotic origin were recovered in all studies but they always represented a very small fraction of the sequences, thus preventing a detailed analysis of eukaryote activities in the studied environments Frias-Lopez et al., 2008; Gilbert et al., 2008; Poretsky et al., 2009. Metatranscriptomic analysis of a given environment can however be limited to eukaryotes thanks to the polyadenylation of the 3'-end of their mRNA which allows their specific isolation from a mixture of prokaryotic and eukaryotic RNA. Synthesis of "environmental eukaryotic cDNAs" was initially reported by Grant et al. Grant et al., 2006 for tel-00482109, version 2 - 29 Feb 2012 aquatic and activated sludge samples and by Bailly et al. Bailly et al., 2007 for a forest soil. In the latter study, the taxonomic distribution of the three studied DNA molecules (18S rDNA amplified from either soil DNA or reverse-transcribed soil rRNA and cDNA from reverse transcribed mRNA) did not match, with for example an almost complete absence of cDNA attributed to unicellular eukaryotes which were otherwise abundantly represented among the 18S rDNA sequence dataset. The main objectives of the present study were (i) to extend the eukaryotic metatranscriptomic approach to different forest soils which differed with respect to e.g. plant cover and organic matter content and (ii) to determine whether the discrepancies between the distribution of different DNA molecules (rDNA vs cDNAs) between taxonomic groups obey to foreseeable specific rules. This latest issue is of importance for the interpretation and evaluation of metatranscriptomic data in the context of ecosystem functioning. MATERIALS AND METHODS Study sites and soil sampling. Five forest stands located in four different places in France (Truc Vert and Breuil sites) and Belgium (Lommel Sahara and Paal sites) were sampled. The Truc Vert (TV) site is a monospecific Pinus pinaster stand located in South West France (44 43 N, 1 15 W) on a stabilized coastal sand dune. More details about this site and the sampling procedure are given in Bailly et al. Bailly et al., 2007. The Breuil site, located in the Morvan region in the centre of France (47 18 N, 4 4 E) was planted in 1976 by different and separate monospecific stands of coniferous and broadleaved tree species. Soil sampling was performed in a spruce (Picea abies) (BS) and a beech (Fagus sylvatica) (BB) stands. The 82

Lommel Sahara (LS, 51 14 N, 5 15 E) and Paal (PZ, 51 04 N, 5 10 E) sites are Pinus sylvestris (with a few Betula sp. trees) stands on poor sandy soils from the Campine region in North East Belgium (Limburg province). The LS site, reforested in 1975, was contaminated by heavy metals dispersed by a now-dismantled pyrometallurgical zinc smelter Vangronsveld et al., 1995. These five study sites differ with respect to climate, substratum, vegetation, humus types and soil physico-chemical features (Table 1). In each site, between 14 and 27 soil samples were collected, sieved (2 mm mesh size) to eliminate coarse litter and root fragments and pooled to form composite samples which were stored frozen at -70C. In TV, soil samples (10x10x20 cm lxLxh) were collected underneath the fruit bodies of 25 different species of saprotrophic or symbiotic basidiomycetes Bailly et al., 2007. In the LS and PZ stands, cores (5 cm in diameter X ca 20 cm in depth) were regularly collected along two ca 20 m transects. In the BB and BS stands, 8 tel-00482109, version 2 - 29 Feb 2012 cm in diameter cores were collected every meter on a regular sampling grid. In these last two stands only the most organic-rich upper layer (5-8 cm) was collected. Nucleic acid extraction and purification. Nucleic acid (DNA and RNA) extraction from soil was performed as described in Bailly et al. Bailly et al., 2007 with some minor modifications. Modifications concerned the final concentration of guanidine isothiocyanate and SDS in the extraction buffer which varied between 100-600 M and 1.6-1.85% respectively depending on the soil. Soil DNA was recovered by ethanol precipitation from the supernatant of the LiCl solution used to precipitate the RNA. Polyadenylated eukaryotic mRNA was purified from total soil RNA by affinity capture on paramagnetic beads coated with poly-dT oligonucleotides as described in the Dynabeads Oligo (dT) kit instruction manual (Dynal). Ribosomal RNA, which did not bind to the beads, was recovered by ethanol precipitation. Construction of the cDNA libraries. First and second strand cDNAs were synthesized from purified polyadenylated mRNA using the SMART cDNA Library Construction Kit (Clontech). PCR-amplified cDNAs were size-fractionated to remove cDNA smaller than 400pb (CHROMA SPIN-400 DEPC-H2O Columns, Clontech), digested by Sfi1 and ligated into the Sfi1-digested pDNR-LIB plasmid vector (Clontech) for the PZ, LS, BB and BS soils or into pYESfi-URA3 plasmid for the TV soil cDNAs Bailly et al., 2007. Amplification and cloning of the 18S rDNA A ca 520 bp-long fragment located at the 5end of the eukaryotic 18S rDNA gene was amplified by PCR from both soil DNA and reverse-transcribed soil 18S rRNA using primers Euk1A (CTGGTTGATCCTGCCAG) and Euk516R (ACCAGACTTGCCCTCC) described by Diez et al. Diez et al., 2001. Amplification using Taq-DNA polymerase and cloning of the 18S rDNA from the TV soil 83

were described in Bailly et al. Bailly et al., 2007. For the four others soils, the PCR mixtures (25L) contained 200nM of each primer, 200M of each dNTP, 1mM MgCl2, 0.25mg.mL-1 of bovine serum albumin, 0.625U of Pfu DNA polymerase and the appropriate buffer (Fermentas). Each amplification using 10-100 ng of soil DNA or 50 ng of reversed transcribed soil rRNA was performed for the lowest number of cycles (between 23 and 27) to minimise PCR artefacts. Amplification products of the expected size from eight different PCR tubes were pooled and isolated from an agarose gel (Nucleospin Extract kit, Macherey-Nagel), ligated in the plasmid pCR-Blunt II-TOPO (Zero Blunt TOPO PCR Cloning kit, Invitrogen) that was used to transform electro-competent DH10B E. coli cells (Invitrogen). Sequencing and sequence analysis. Sequencing and sequence analysis of clones from the different TV rDNA and cDNA libraries were performed as described by Bailly et al. Bailly et tel-00482109, version 2 - 29 Feb 2012 al., 2007. In the present study, we generated and analysed an additional 68 cDNA sequences from the TV site. Sequencing of LS, PZ, BB and BS libraries was performed by Agowa Company (Berlin, Germany) using universal primers M13-20F or M13Rev for the 18S rDNA inserts cloned in pCR-Blunt II-TOPO and primer M13-21F for the cDNA inserts cloned in pDNR-LIB. Sequence accession No. are given in Table 1. Sequences were manually corrected and edited. BLAST (blastn or blastx) searches Altschul et al., 1997 were performed against various sequence databases at NCBI (http://www.ncbi.nlm.nih.gov/). 18S rDNA were analyzed with the rRNA Database Project CHECK_CHIMERA program (http://rdp8.cme.msu.edu/). Potential chimeras were further analysed by blasting separately the two dissimilar segments of the sequences against GenBank. Functional and taxonomic annotation of protein coding sequences was performed manually on the basis of the Blastx searches by looking not only at the best hit but at the different best hits that can correspond to sequences from different taxonomic groups and also by considering different criteria: expect value, percents of identity and similarity, length of the alignment. Multiple alignments of rDNA sequences were performed using the rRNA Database of the SILVA Project Pruesse et al., 2007 using SINA (http://www.arb-silva.de/aligner/) and edited using SeaView Galtier et al., 1996. Phylogenetic trees were computed and drawn using one of the method implemented in Phylo_win Galtier et al., 1996. Data analysis. Rarefaction curves for the 18S rDNA sequences were computed using S. Hollands Analytical Rarefaction version 1.3 software (http://www.uga.edu/strata/software/). The abundance-based richness estimators SChao1 and SACE were computed for different 84

subsamples of different sizes drawn from the entire 18S rDNA data set as described by Kemp & Aller Kempf et Aller, 2004 and as implemented at http://www.aslo.org/lomethods/free/2004/0114a.html. Pearsons Chi-square statistical test was used to test differences between proportions of the different molecular markers (rDNA, rRNA and mRNA) within a taxonomic group in each of the sites. RESULTS Taxonomic affiliation of environmental sequences. Total soil RNA was successfully extracted from between 90 and 250 g of soil from the five forest sites, with yields ranging from 0.36 g.g-1 of soil (TV site) to 1.1 g.g-1 of soil (BB, BS and PZ sites). PolyA-mRNA were converted into cDNAs which were cloned to give cDNA libraries whose titre ranged from 9.6 105 colony forming units (cfu, BB site) to 15 106 cfu (LS site). Between 116 and 189 tel-00482109, version 2 - 29 Feb 2012 cDNAs were sequenced from their 5' end for each library; none of the sequences were homologous to rDNA ones. Partial 18S ribosomal sequences were amplified from soil DNA (referred to as rDNA) as well as from reverse-transcribed 18S soil rRNA (referred to as rRNA). ca 96 cloned 18S rDNA and 96 cloned rRNA were sequenced for each soil. Unexpectedly, between 17% and 34% of the rDNA and between 10% and 24% of the rRNA sequences turned out not to be 18S rDNA genes. Several of these sequences were homologous to bacterial protein-coding genes. Each sequence (either cDNA, rDNA or rRNA), was affiliated to one of 8 large Eukaryotic phyla as defined in e.g. Lopez-Garcia & Moreira Lopz-Garcia et Moreira, 2008: fungi, metazoa, plantae, amoebozoa, alveolata, heterokonta, rhizaria and excavata (the last 5 groups are sometime collectively referred to as protists in the text) (Fig. 1). Two additional categories were created for the cDNAs. Those which coded for proteins having similar levels of identity/similarity to proteins from different phyla were binned in a "multiple affiliation category", while those that were homologous to prokaryotic protein-coding genes were binned in the "bacteria" category. The latter sequences may represent genuine bacterial genes cloned by chance or, eukaryotic genes whose homologous sequences have, at present, only been reported from prokaryotes. If we do not consider plant sequences, whose abundance reflect the amount of fine roots which passed through the sieve, for all five sites the sequence dataset was dominated by sequences from fungi and animals (Fig. 1). The two best-represented protist groups were the rhizaria (with sequences from cercozoa exclusively) and the alveolata (ciliates, apicomplexa, perkinsea and dinoflagelates) while sequences from heterokonta (e.g. oomycetes) and excavata (euglenozoa exclusively) were rare or even absent from several 85

datasets. This global trend should however be nuanced as, for example, in the case of the BB site, 18S rDNA sequences from alveolata were 3.6 times more abundant that those from fungi. On the contrary at the PZ site 18S rDNA sequences from alveolata were absent from the dataset. The relative proportions of each of the three studied sequences (18S rDNA, 18S rRNA and cDNA) in each of the different phyla were usually different but no clear systematic pattern was observed except for systematic excess of cDNA relative to 18S sequences in the fungi and a deficit in the metazoa (for statistical supports, see Fig. 1). Concerning the 18S rDNA/rRNA ratio, for a particular phylum in a specific site it can either be close to one or alternatively high (eg for the rhizaria in LS or the metazoa in BB) or low (eg the fungi in BB). The most striking result was the almost complete absence of cDNA attributed to protists except for the amoebozoa. tel-00482109, version 2 - 29 Feb 2012 Diversity of eukaryotic communities. 18S sequences (both rDNA and rRNA) were clustered using both 96% and 98% identity threshold to define molecular operational taxonomic units (MOTUs; Table 2). As illustrated for the fungi (Fig. 2), the 18S dataset was globally characterised by a low level of redundancy. At the 98% threshold, within sites, between 6% (TV) and 13% (PZ) of the MOTUs were represented by both rDNA and rRNA sequences. For the three most represented phyla, fungi, animals and cercozoas, the percentage of MOTUs represented by both rDNA and rRNA sequences was greater for animals (6-38%) and lower for the cercozoas (0% in 4 of the sites, 14% at TV). Globally, only 17 % of the MOTUs were represented by 3 or more sequences (either DNA or RNA) in the different sites and the percentage was again highest for the animals (30%). Altogether, these data resulted in rarefaction curves that clearly did not reach an asymptotic value (Fig. 3) thus indicating that we undersampled both the global soil eukaryotic diversity and the diversity of each of the different eukaryotic phyla at the different sites. Based on the calculation of richness estimators SACE and SChao1 we could estimate that we observed between 31% (in TV, considering the value of SACE) and 53% (in BB, considering SChao1) of the 18S phylotypes present in the soil samples (Table 2). Sequences from each MOTU were ranked according to their percentage of identity to the most similar sequence present in GenBank (either annotated or not). The distribution of these figures differed markedly between eukaryotic phyla (Table 3). For fungi and metazoas, three quarters of the sequences found a homologue in GenBank with more than 95% of identity. This figure was significantly lower in the case of the protist phyla as exemplified by

86

the amoebozoa for which, on the contrary, almost three quarters of the sequences found a homologue in GenBank with less than 95% of identity. Although the amplified fragment of the 18S rDNA gene does not allow for the construction of robust molecular phylogenies with highly supported branches, most of our environmental sequences could be placed within clades which grouped together annotated sequences from organisms belonging to the same phylum. Therefore, despite some low percentages of identity to known sequences, most of the 18S environmental sequences generated in this study do not probably identify new very deep-branching eukaryotic phyla. Potential exceptions are two groups of three and four phylotypes within the amoebozoa (Fig. 4) which cluster exclusively with additional environmental sequences from soil or fresh water. Another exception is a group of 8 phylotypes which define a well supported clade affiliated to the cercozoas (supplementary figure S1). tel-00482109, version 2 - 29 Feb 2012 Annotation of environmental cDNA sequences. Based on Blastx searches, cDNA sequences were classified as coding for (i) proteins of known functions, (ii) for proteins of unknown functions with homologues in databases or (iii) for new hypothetical proteins. After excluding short (<400bp) sequence reads to minimise the contribution of non-coding 3' UTRs and of short, poorly-conserved C-terminal polypeptide ends, the latter category was equally represented (ca 30%) in four of the cDNA libraries (Fig. 5). In the library from BS it represented ca 40% of the cDNAs. On the opposite, cDNA encoding proteins of known functions consistently represented ca 50% of the five datasets. DISCUSSION The results obtained demonstrate that a metatranscriptomic approach focussing specifically on eukaryotic organisms, with a low background contamination with prokaryotic mRNA, is feasible on a wide range of soils, including organic matter-rich horizons of temperate forest soils. Eukaryote-specific metatranscriptomic analysis will be important to study, at the gene level, major soil processes that are essentially carried out by soil eukaryotic microbes such as plant-derived organic matter degradation. In addition, eukaryote-specific metatranscriptomic analysis will also facilitate the analysis of functions expressed by low-abundance soil eukaryotic taxonomic (e.g. the Oomycetes) or functional groups whose mRNA will not be diluted further by prokaryotic ones. In this study we cloned the cDNAs and sequenced them using the Sanger chemistry. This strategy presents the advantage of having at our disposal the cDNA clones which, if

87

containing full-length ORF, can be used to produce the corresponding proteins for functional studies. The protocol can however certainly be adapted for pyrosequencing by following for example the strategy described by Frias-Lopez et al. Frias-Lopez et al., 2008 who amplified antisense mRNA using T7-RNA polymerase prior to the synthesis of cDNAs by random priming. We found that ca 50% of the cDNA clones coded for proteins of known functions. This figure suggests that moderate to deep sequencing of eukaryotic metatranscriptomes could indeed be very informative to decipher the biological processes carried out by these organisms directly in soils. This figure can be explained by the fact that eukaryotic metatranscriptomes, as for eukaryotic transcriptomes in general, are enriched in conserved housekeeping proteins which can be identified even in poorly studied phylogenetic lineages. Another potential reason is that soil eukaryotic biota are dominated by animals and fungi, two intensively tel-00482109, version 2 - 29 Feb 2012 studied eukaryotic groups on which concentrate most of the current genome sequencing efforts (see the Genome Online Database: http://www.genomesonline.org/gold.cgi). In this respect, it is likely that the sequencing of metatranscriptomes from aquatic microbial assemblages enriched in representatives from e.g. the stramenopiles, the alveolates, the cercozoas or the euglenids Stoeck et al., 2006; Lefevre et al., 2008 could result in far higher percentages of gene falling in the category "new hypothetical proteins" due to the current low coverage of these phyla in term of genome sequences available. The current paucity, or almost complete absence (eg for the cercozoas), of protist protein sequences deposited in databases contrasts to the abundance of data for fungi, metazoas and plants. This certainly explains, for a large part, the almost complete absence of cDNA sequences attributed to the former groups although these groups were systematically detected among the 18S rDNA sequences. cDNA sequences from protists, if present, must therefore have been wrongly placed in the other taxonomic categories (Fig. 1). This hypothesis is however not sufficient to explain other discrepancies in the sequence data set. One discrepancy concerns the within-clade differences between rDNA and rRNA datasets. In microbial ecology, PCR amplification from reverse-transcribed rRNA extracted from environmental samples has been proposed to better describe the diversity of the metabolically active organisms within a community Muttray et Mohn, 1999; Mills et al., 2005. The situation could be more complex with eukaryotes as the number of rDNA gene copies varies widely between taxa as does the number of nuclei per unit of cytoplasm. Furthermore, we observed that for a given clade (eg, the fungi, Fig. 1) the relative proportions

88

of 18S rRNA and of cDNAs do not always vary in the same direction, a phenomenon not expected for two classes of molecules supposed to both describe physiological activities. Another obvious discrepancy concerns the almost systematic under-representation of the metazoa among the cDNAs although they are abundantly represented in the rDNA and rRNA dataset (Fig. 1). We could tentatively attribute this observation to a phylum-specific feature; the molar ratio 18S rRNA over mRNA could be systematically higher in animals than in fungi. Apart from this hypothesis, which needs to be tested, another possible explanation is that the primer set used to amplify the 18S sequences could preferentially amplify sequences from specific taxonomic groups to the detriment of others. This may not only result from mismatches at the 18S PCR primer binding sites, but also from length variations and the occurrence of secondary structures which could affect amplification yield. Due to extensive variations in the sequence of the 18S gene across the eukaryotic domain Nickrent et Sargent, tel-00482109, version 2 - 29 Feb 2012 1991; Choe et al., 1999; Van de Peer et al., 2000, it appears that a single PCR primer set that amplify a segment or most of the sequence may not indeed accurately describe the full diversity of eukaryotic communities Jeon et al., 2008. In term of global taxonomic diversity, for almost all of the studied soils, we recovered 18S sequences from the different major eukaryotic phyla with a clear dominance of the opistokonts (fungi plus animals). All animal sequences were related to taxonomic groups typical of the micro- mesofauna (nematodes, acari, collembolas, millipedes, Supplementary Fig. S2) while basidiomycete sequences dominated the fungal sequence pool as already observed in temperate forest soils colonised by ectomycorrhizal plants O'Brien et al., 2005. For the "protist" groups, sequences from the alveolates (essentially ciliates and parasitic apicomplexas; Supplementary Fig. S3) and the rhizaria (cercozoas only; Supplementary Fig. S1) dominated while heterokonta and excavata (euglenozoas) were the least represented. As expected for soils, sequences from major photosynthetic phyla (eg chlorophyta, diatoms) were undetected although unicellular algae do occur on the soil surface. Similarly, we did not detect sequences from oomycetes (stramenopiles), which include numerous soil-borne and widespread plant parasites. Different parameters, such as the absence of overlap between the rDNA and rRNA sequence data and the shape of the rarefaction curves indicate that additional sequencing effort combined with the use of group-specific PCR primers are needed to fully describe the extent of eukaryotic diversity in the five studied soils. As pointed out in the introduction, soil is a neglected environment in term of global surveys of its eukaryotic diversity. We could therefore envisage that it hosts new, yet

89

undescribed, lineages which have evolved to adapt to soil specific features such as periodic desiccation. Despite the limited phylogenetic information contained in the portion of the 18S gene that we sequenced, some of our sequences in the cercozoas and the amoebozoas are potential candidates for such lineages. These sequences have low similarities (down to ca 7075 % identity) to sequences from known organisms and cluster together as well as with other environmental sequences in the case of the amoebozoa (Fig. 4) in phylogenetic analyses. Furthermore, they have been amplified independently from different soils, thus excluding the fact that they could represent PCR artefacts such as chimeras. These short sequences can be used as templates to design group-specific oligonucleotides which, in combination with universal primers will be used to amplify the full-length 18S rDNA gene or even the fulllength rDNA nuclear cluster for the construction of robust molecular phylogenies Porter et al., 2008. These phylogenies should confirm the affiliation of these divergent clusters of tel-00482109, version 2 - 29 Feb 2012 sequences to either the cercozoas or the amoebozoas. Group-specific oligonucleotides can also be used as probes for FISH to characterise morphologically these new microbes Simon et al., 1995; Massana et al., 2006.

ACKNOWLEDGEMENT
This study was supported by grants from the PNETOX programme of the French ministry for ecology and sustainable development; the ANR Ecoger programme (project microger); the ANR Biodiversity programme (project 2006 Fundiv) and the ANR Blanc programme (project 2006 EUMETATOX). Sampling in Belgium was facilitated by a FranceFlanders region Tournesol bilateral exchange programme. We would like to thank the DTAMB platform of the Institut Fdratif de Recherche 41 and Jrme Briolay for access to specific equipments and helpful advices as well as to MarieChristine Verner for excellent technical help.

90

REFERENCES 1. Alexander, E., A. Stock, H. W. Breiner, A. Behnke, J. Bunge, M. M. Yakimov, and T. Stoeck. 2009. Microbial eukaryotes in the hypersaline anoxic L'Atalante deepsea basin. Environ. Microbiol. 11:360-81. 2. Altschul, S. F., T. L. Madden, A. A. Schaffer, J. Zhang, Z. Zhang, W. Miller, and D. J. Lipman. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25:3389-402. 3. Bailly, J., L. Fraissinet-Tachet, M. C. Verner, J. C. Debaud, M. Lemaire, M. Wesolowski-Louvel, and R. Marmeisse. 2007. Soil eukaryotic functional diversity, a metatranscriptomic approach. Isme J. 1:632-42. 4. tel-00482109, version 2 - 29 Feb 2012 Bass, D., and T. Cavalier-Smith. 2004. Phylum-specific environmental DNA analysis reveals remarkably high global biodiversity of Cercozoa (Protozoa). Int. J. Syst. Evol. Microbiol. 54:2393-404. 5. 6. Cavalier-Smith, T., and S. von der Heyden. 2007. Molecular phylogeny, scale evolution and taxonomy of centrohelid heliozoa. Mol. Phylogenet. Evol. 44:1186-203. Choe, C. P., U. W. Hwang, and W. Kim. 1999. Putative secondary structures of unusually long strepsipteran SSU rRNAs and its phylogenetic implications. Mol. Cells 9:191-9. 7. Diez, B., C. Pedros-Alio, and R. Massana. 2001. Study of genetic diversity of eukaryotic picoplankton in different oceanic regions by small-subunit rRNA gene cloning and sequencing. Appl. Environ. Microbiol. 67:2932-41. 8. Edgcomb, V. P., D. T. Kysela, A. Teske, A. de Vera Gomez, and M. L. Sogin. 2002. Benthic eukaryotic diversity in the Guaymas Basin hydrothermal vent environment. Proc. Natl. Acad. Sci. USA 99:7658-62. 9. 10. Floyd, R., E. Abebe, A. Papert, and M. Blaxter. 2002. Molecular barcodes for soil nematode identification. Mol. Ecol. 11:839-50. Frias-Lopez, J., Y. Shi, G. W. Tyson, M. L. Coleman, S. C. Schuster, S. W. Chisholm, and E. F. Delong. 2008. Microbial community gene expression in ocean surface waters. Proc. Natl. Acad. Sci. USA 105:3805-10. 11. Galtier, N., M. Gouy, and C. Gautier. 1996. SEAVIEW and PHYLO_WIN: two graphic tools for sequence alignment and molecular phylogeny. Comput. Appl. Biosci. 12:543-8.

91

12.

Gilbert, J. A., D. Field, Y. Huang, R. Edwards, W. Li, P. Gilna, and I. Joint. 2008. Detection of large numbers of novel sequences in the metatranscriptomes of complex marine microbial communities. PLoS One 3:e3042.

13.

Grant, S., W. D. Grant, D. A. Cowan, B. E. Jones, Y. Ma, A. Ventosa, and S. Heaphy. 2006. Identification of eukaryotic open reading frames in metagenomic cDNA libraries made from environmental samples. Appl. Environ. Microbiol. 72:13543.

14.

Guillou, L., M. Viprey, A. Chambouvet, R. M. Welsh, A. R. Kirkham, R. Massana, D. J. Scanlan, and A. Z. Worden. 2008. Widespread occurrence and genetic diversity of marine parasitoids belonging to Syndiniales (Alveolata). Environ. Microbiol. 10:3349-65.

15. tel-00482109, version 2 - 29 Feb 2012

Jeon, S., J. Bunge, C. Leslin, T. Stoeck, S. Hong, and S. S. Epstein. 2008. Environmental rRNA inventories miss over half of protistan diversity. BMC Microbiol. 8:222.

16. 17.

Kempf, P., and J. Aller. 2004. Estimating prokaryotic diversity: when are 16S rDNA libraries large enough? Limnology and Oceanography: Methods 2:114-125. Lefevre, E., B. Roussel, C. Amblard, and T. Sime-Ngando. 2008. The molecular diversity of freshwater picoeukaryotes reveals high occurrence of putative parasitoids in the plankton. PLoS One 3:e2324.

18.

Lesaulnier, C., D. Papamichail, S. McCorkle, B. Ollivier, S. Skiena, S. Taghavi, D. Zak, and D. van der Lelie. 2008. Elevated atmospheric CO2 affects soil microbial diversity associated with trembling aspen. Environ. Microbiol. 10:926-41.

19. 20.

Lopz-Garcia, P., and D. Moreira. 2008. Tracking microbial biodiversity through molecular and genomic ecology. Research in Microbiology 159:67-73. Lopez-Garcia, P., F. Rodriguez-Valera, C. Pedros-Alio, and D. Moreira. 2001. Unexpected diversity of small eukaryotes in deep-sea Antarctic plankton. Nature 409:603-7.

21.

Massana, R., R. Terrado, I. Forn, C. Lovejoy, and C. Pedros-Alio. 2006. Distribution and abundance of uncultured heterotrophic flagellates in the world oceans. Environ. Microbiol. 8:1515-22.

22.

Mills, H. J., R. J. Martinez, S. Story, and P. A. Sobecky. 2005. Characterization of microbial community structure in Gulf of Mexico gas hydrates: comparative analysis of DNA- and RNA-derived clone libraries. Appl. Environ. Microbiol. 71:3235-47.

92

23.

Moon-van der Staay, S. Y., R. De Wachter, and D. Vaulot. 2001. Oceanic 18S rDNA sequences from picoplankton reveal unsuspected eukaryotic diversity. Nature 409:607-10.

24.

Muttray, A., and W. Mohn. 1999. Quantitation of the population size and metabolic activity of a resin acid degrading bacterium in activated sludge using slot-blot hybridization to measure the rRNA:rDNA ratio. Microbial Ecology 38:348-357.

25.

Nickrent, D. L., and M. L. Sargent. 1991. An overview of the secondary structure of the V4 region of eukaryotic small-subunit ribosomal RNA. Nucleic Acids Res. 19:227-35.

26.

Not, F., K. Valentin, K. Romari, C. Lovejoy, R. Massana, K. Tobe, D. Vaulot, and L. K. Medlin. 2007. Picobiliphytes: a marine picoplanktonic algal group with unknown affinities to other eukaryotes. Science 315:253-5.

tel-00482109, version 2 - 29 Feb 2012

27.

O'Brien, H. E., J. L. Parrent, J. A. Jackson, J. M. Moncalvo, and R. Vilgalys. 2005. Fungal community analysis by large-scale sequencing of environmental samples. Appl. Environ. Microbiol. 71:5544-50.

28.

Poretsky, R. S., I. Hewson, S. Sun, A. E. Allen, J. P. Zehr, and M. A. Moran. 2009. Comparative day/night metatranscriptomic analysis of microbial communities in the North Pacific subtropical gyre. Environ. Microbiol. 11:1358-75.

29.

Porter, T. M., C. W. Schadt, L. Rizvi, A. P. Martin, S. K. Schmidt, L. ScottDenton, R. Vilgalys, and J. M. Moncalvo. 2008. Widespread occurrence and phylogenetic placement of a soil clone group adds a prominent new branch to the fungal tree of life. Mol. Phylogenet. Evol. 46:635-44.

30.

Pruesse, E., C. Quast, K. Knittel, B. M. Fuchs, W. Ludwig, J. Peplies, and F. O. Glockner. 2007. SILVA: a comprehensive online resource for quality checked and aligned ribosomal RNA sequence data compatible with ARB. Nucleic Acids Res. 35:7188-96.

31.

Schadt, C. W., A. P. Martin, D. A. Lipson, and S. K. Schmidt. 2003. Seasonal dynamics of previously unknown fungal lineages in tundra soils. Science 301:135961.

32.

Simon, N., N. LeBot, D. Marie, F. Partensky, and D. Vaulot. 1995. Fluorescent in situ hybridization with rRNA-targeted oligonucleotide probes to identify small phytoplankton by flow cytometry. Appl. Environ. Microbiol. 61:2506-13.

93

33.

Stoeck, T., B. Hayward, G. T. Taylor, R. Varela, and S. S. Epstein. 2006. A multiple PCR-primer approach to access the microeukaryotic diversity in environmental samples. Protist 157:31-43.

34.

Tringe, S. G., C. von Mering, A. Kobayashi, A. A. Salamov, K. Chen, H. W. Chang, M. Podar, J. M. Short, E. J. Mathur, J. C. Detter, P. Bork, P. Hugenholtz, and E. M. Rubin. 2005. Comparative metagenomics of microbial communities. Science 308:554-7.

35.

Urich, T., A. Lanzen, J. Qi, D. H. Huson, C. Schleper, and S. C. Schuster. 2008. Simultaneous assessment of soil microbial community structure and function through analysis of the meta-transcriptome. PLoS One 3:e2527.

36. tel-00482109, version 2 - 29 Feb 2012

Valster, R. M., B. A. Wullings, G. Bakker, H. Smidt, and D. van der Kooij. 2009. Free-living protozoa in two unchlorinated drinking water supplies, identified by phylogenic analysis of 18S rRNA gene sequences. Appl. Environ. Microbiol. 75:4736-46.

37.

Van de Peer, Y., S. L. Baldauf, W. F. Doolittle, and A. Meyer. 2000. An updated and comprehensive rRNA phylogeny of (crown) eukaryotes based on rate-calibrated evolutionary distances. J. Mol. Evol. 51:565-76.

38.

Vangronsveld, J., F. Van Assche, and H. Clijsters. 1995. Reclamation of a bare industrial area contaminated by non-ferrous metals: in situ metal immobilization and revegetation. Environ. Pollut. 87:51-9.

39.

Viprey, M., L. Guillou, M. Ferreol, and D. Vaulot. 2008. Wide genetic diversity of picoplanktonic green algae (Chloroplastida) in the Mediterranean Sea uncovered by a phylum-biased PCR approach. Environ. Microbiol. 10:1804-22.

94

Site vegetation type

BB

BS

LS

PZ

TV Pinus pinaster,

Fagus sylvatica

Picea abies

Pinus sylvestris

Pinus sylvestris

Arbutus unedo, grasses nutrient poor, non calcareous sand 5.5 0.5 ND nov-04 ND 27 2000 11 AM409570-635a AM409518-569a AM409636-755a FN431234-1314

soil texture soil pH % of organic matter C/N date of sampling soil moisture % No. of samples volume of samples (cm ) Soil temperature (C) 18S rDNA accession Nos.
3

sandy clayey 3.9


b b b

sandy clayey 3.9


b b b

poor podzolized poor podzolized sandy soil 4.7 1.58 20 nov-06 4 20 2000 11 FN3947324802 FN3964226515 sandy soil 4.7 0.49 24.3 nov-06 4.8 20 2000 11 FN394803-73 FN3948744964

13.4 19.2

22.2 20.2 34 b 14 750 ND

juil-07 37.5 b 16 750 ND FN3932223276 FN3931803221 FN4321542328

juil-07

FN3932773322 FN3933233380 FN4313151660

tel-00482109, version 2 - 29 Feb 2012

18S rRNA accession Nos. cDNA accession Nos.

Table 1: Sites description, sampling characteristics and sequence accession numbers.


a

From Bailly et al. Bailly et al., 2007 Data corresponding to the top organic layer of soil. ND: not determined
b

Site % identity Number of clones in library Number of phylotypes observed Predicted value of SACE Predicted value of SChao1 Observed phylotypes / predicted SACE Observed phylotypes / predicted SChao1

LS 157 86 216 179 0.4 0.5 157 82 186 164 0.4 0.5

PZ 156 88 214 176 0.4 0.5 156 80 166 158 0.5 0.5

TV 121 81 232 159 0.3 0.5 121 71 138 122 0.5 0.6

BS 106 56 142 130 0.4 0.5 106 52 131 141 0.4 0.4 94 45

BB 94 43 84 69 0.5 0.6

98% 96% 98% 96% 98% 96% 98% 96% 98% 96%

108 84 0.4 0.5

Table 2: Richness estimators SChao1 and SACE from18S rDNA dataset, for each soil, with either 96 % and 98 % of identity cut-off value.

95

% Identity Fungi Metazoa Rhizaria Alveolata Amoebozoa Excavata

100 - 98 51 % 46 % 27 % 18 % 11 % 0%

97 - 95 25 % 23 % 25 % 52 % 16 % 0%

94 - 90 24 % 20 % 29 % 26 % 47 % 67 %

<90 0% 11 % 19 % 4% 26 % 33 %

tel-00482109, version 2 - 29 Feb 2012

Table 3: Distribution of the percentages of nucleotide sequence identity between the 18S sequences of the different phylotypes and their "best hit" in GenBank. The GenBank sequences can themselves be environmental ones. Analyses performed during the first semester of 2009.

96

percent of sequences

70 60 50 40 30 20 10 0 70 60 50 40 30 20 10 0 70 60 50 40 30 20 10 0

p < 0.0001 p=0.0002

LS

18S rDNA N=72 18S rRNA N=85 cDNA N=135

percent of sequences

p=0.0008 p < 0.0001 18S rDNA N=67 18S rRNA N=89 cDNA N=137

PZ

percent of sequences

p=0.16 18S rDNA N=64 18S rRNA N=56 cDNA N=119

Lehembre et al, Figure 1

p=0.07

TV

tel-00482109, version 2 - 29 Feb 2012

percent of sequences

70 60 50 40 30 20 10 0

p < 0.0001 18S rDNA N=45 18S rRNA N=60 cDNA N=189

p < 0.0001

BS

p < 0.0001

percent of sequences

70 60 50 40 30 20 10 0

p< 0.0001 18S rDNA N=55 18S rRNA N=42 cDNA N=116

BB

FIG. 1. Taxonomic assignment of the different categories of sequences (18S rDNA, 18S rRNA and cDNA). Pearsons Chi-square test was used to test differences between proportions of the different molecular markers (rDNA, rRNA and mRNA) within fungi and metazoa in each of the sites. The "other" category includes 18S sequences attributed to minor taxonomic groups such choanozoa or Ichthyosporea. cDNAs which displayed in Blastx searches similar e-values and percent of identity/similarity to sequences from several taxonomic groups were placed in the "multiple affiliation" category. For each site, the total No. of sequences used for the calculations is given.

fu ng i m et az oa am oe bo zo a al ve ol at a rh iz ar he ia te ro ko nt a ex ca va ta pl an ta e ot he rs m ba ul ct tip er le ia af fil ia tio n

97

0.02 substitution/site 100 98

100

FN393360 X1 AM409577 X1 AM409532 X1 FN394813 X2 X1 X1 X1 100

AM409594 AM409599 AM409535 AM409593 X1 98

X1 X1 X4 X7

FN393337

FN394877 X1

AM409580 X2 AM409584 X1 AM409583 X1 FN393282 X1 X2 FN393221 X1 FN393284 X1 X1 FN394867 X1 X1 X1 X1 AM409525 X1 AM409527 X2 FN393359 X2 FN393352 X2 FN394751 X 4 FN394894 X1 FN394895 X1 FN394944 X1 X1 X1 FN394890 X1 X4 X1 FN394964 X1 AM409526 X1 FN393215 X2 FN393201 X1 FN394791 X1 FN394759 X1 AM409585 X2 FN393297 X2 X3 FN394889 X1 FN394911 X1 FN394818 X3 FN394811 X2 X1 X1 AM409590 X2 AM409531 X1 FN394765 X1 X2 FN394901 X2 X2 X1 X1 FN393361 X1 X1 X1 FN394882 X1 FN394961 X2 FN394879 X1 FN394881 X1 FN393186 X1 FN393196 X2 AM409592 X1 FN394950 X1 FN394936 X1 X1 X1 FN394780 X1 X1 AM409572 X1 91 FN393184 X1 FN393350 X1 AM409575 X1 AM409571 X1 X1 AM409573 X1 FN393202 X1 AM409574 X1 FN394918 X2 X1 X2 X1 FN396490 X1 FN394907 X1 X1 FN393182 X2 FN394861 X1 FN396427 X1 X2 FN394943 X1 95 FN393364 X1 AM409521 X1 FN396467 X1

X1

Basidiomycota

FN393218 X1

tel-00482109, version 2 - 29 Feb 2012

Site DNA RNA PZ LS TV BS BB

90

Ascomycota

99

AM409578 X2 FN393373 FN393349 X1 FN393362 X1

X1
FN393226 X1 FN393348 X1 AM409576 X1 FN394768 X1 AM409524 X1

99 91

FN394962 X2

FN396473 X1 FN394732 X1 FN394783 X1 FN394857 X1 X1 FN394844 X2

Zygomycota + Chytridiomycota + Glomeromycota

FN396422 X3 FN394874 X1

Lehembre et al, Figure 2

FIG. 2. Phylogenetic distribution of partial 18S fungal ribosomal sequences amplified from soil DNA (squares) or reverse-transcribed soil RNA (triangles). This tree illustrates that (i) a majority of the sequences were recovered only once and that (ii) there is little overlap between the rDNA and rRNA datasets and also between the different forest sites (a distinct colour has 98

been assigned to each site). The tree was constructed using the BioNJ distance method starting from an alignment which included the different environmental sequences plus their three most similar sequences retrieved from the ARB database using SINA. A first tree was computed with all sequences to define the different fungal phyla. Reference sequences were subsequently removed for legibility. Figures give the number of time a sequence was found in a particular dataset. Only bootstrap values (1000 replicates) above 90% are indicated. The use of PhyML gave an identical topology.

tel-00482109, version 2 - 29 Feb 2012

99

100 90 No. of phylotypes 80 70 60 50 40 30 20 10 0 5 30 55 80 105 130 155 No. of 18S sequences BS 98% BS 96% PZ 98% PZ 96%

Lehembre et al, Figure 3


tel-00482109, version 2 - 29 Feb 2012 FIG. 3. Rarefaction curves determined for the 18S gene libraries generated for the PZ and BS forest sites. All 18S gene sequences were pooled irrespective of their origin (soil DNA or RNA) and taxonomic affiliation. For each library clustering of the sequences was performed using either a 98% or a 96% identity threshold.

100

0.02 substitution/site 98 FN396445 X2 FN394913 X2 Neoparamoeba pemaquidensis AY183887 100 100 100 99 Korotnevella stella AY183893 FN396442 X2 FN396469 X1 AM409548 X2 AM409549 X1 Acanthamoeba sp. AF132134 FN394737 X1 100 Acanthamoeba sp. AY026245 Acanthamoeba sp. AF132136 Balamuthia mandrillaris AF477022 FN396432 X1 EF024417 100 98 EF024320 FN393366 X1 FN393205 X1 FN396498 X1 FN394941 X2 Leptomyxa reticulata AF293898 Ripidomyxa sp AY549563 Ripidomyxa sp. AY549564 100 99 EF023499.1 EU646945.1 100 EU646943.1 Hartmannella abertawensis DQ190241 AM409546 98 100 100 Hartmannella sp. AY680841 Hartmannella cantabrigiensis AY294147 FN396481 X1 100 100 100 AB257667 Saccamoeba limax AF293902 Hartmannellidae sp. AY145442 FN393355 X1 100 98 FN394859 X1 X1 X1 X1 New phylum FN393264 X1 Tubulinea Site DNA RNA PZ LS TV BS BB New phylum Centramoebida Flabellinea

tel-00482109, version 2 - 29 Feb 2012

98 100

Glaeseria mira AY294146

FN394937 EU860909 100 EU860905 100 FN393371 X1

100 Dictyostelium aureostipes AM168095 Dictyostelium delicatum AM168093 Dictyostelium sp. AM168080

Mycetozoa

Lehembre et al, Figure 4

FIG. 4. Phylogenetic distribution of partial 18S amoebozoan ribosomal sequences amplified from soil DNA (squares) or reverse-transcribed soil RNA (triangles). The tree was constructed using the BioNJ distance method starting from an alignment which included the different environmental sequences plus their three most similar sequences retrieved from the 101

ARB or GenBank databases. Sequences from the present study are in bold. This tree illustrates that many soil amoebozoan sequences appear distantly related to sequences from characterised amoebae as well as other environmental sequences. Two well-supported clusters (in red) include only environmental sequences from different sites and from other studies; EF024320 and EF024417 are from forest soils Lesaulnier et al., 2008; EU860909 and EU860905.1 are from fresh water Valster et al., 2009. Figures give the number of time a sequence was found in a particular dataset. Only bootstrap values (1000 replicates) above 90% are indicated. The use of PhyML gave an identical topology.

60 50

tel-00482109, version 2 - 29 Feb 2012

percent of sequences

40 30 20 10 0 new conserved hypothetical hypothetical proteins proteins annotated proteins

LS PZ TV BB BS

Lehembre et al, Figure 5

FIG. 5. Annotation of the cDNA sequences longer than 400bp from the five forest soils. Annotated proteins correspond to proteins with a known biological function. Conserved hypothetical proteins correspond to proteins of unknown function deposited in public sequence databases. New hypothetical proteins correspond to the fraction of the cDNA which, when searching public sequence databases, did not return any significant Blastx hit.

102

0.02 substitution/site 90 AM409608 X3 FN394798 X4 FN394766 X1 FN394792 X1 AM409604 X1 AM409605 X1 FN394866 X2 FN394747 X2

New phylum

100

100

EU050975 FN394744 X2

EF023126 AM114815 Polymyxa graminis AF310898 FN393295 X1 FN394854 X1 AY620332 Spongomonas minima AF411281 FN394745 X1 X1

Plasmodiophorida

AY620261 AF372740 FN394739 91 FN394794

X1

FN394819 X2 EF024801 FN394849 X1 90 FN394871 X1 Cercomonas alexieffi AF411267 EF025030 FN394837 X1 AM409611 X1 AY620270 DQ243994 FN394956 X1 DQ243993 FN396476 X1 EF023802 AY620264 93 EF024682 91 FN394841 X1 X1 95 Cercomonas sp. AF534712 AY965859 EF023582 FN396428 X3 EF024663 FN394951 X1 EF024626 FN396438 X1 EF024999 AM409610 X1 EF023787 EF023593 96 FN393328 X1 AM114805 Heteromita sp. AY905499 FN394738 X2 X1 X1 Rigidomastix -like sp. AF411279 AM409601 X1 FN394863 X1 X1 X2 AY620300 AM409541 X1 AY620294 FN394756 X1 FN394775 X2 FN394785 X1 EF024879 FN394816 X1 FN396448 X1 AM409603 X1 X2 AM409545 X2 AY620304 EF023712 EF025021 EF024010 FN394789 X1 FN394870 X4 X1 X1 X1 EF024139 Euglypha filifera AJ418786 Euglypha rotunda AJ418783 FN394763 X1

FN394804

X1

Site DNA RNA PZ LS TV BS BB Cercomonadida

tel-00482109, version 2 - 29 Feb 2012

Silicofilosea

Lehembre et al, Figure S1

FIG. S1. Phylogenetic distribution of environmental partial 18S cercozoa (rhizaria) ribosomal sequences amplified from soil DNA (squares) or reverse-transcribed soil RNA (triangles). The tree was constructed using the BioNJ distance method starting from an alignment which included the different environmental sequences plus their three most similar sequences retrieved from ARB or GenBank. A well-supported cluster (in red) only includes environmental soil sequences from the TV, PZ and LS sites. For an explanation of the symbols, see legend of Fig. 4.

103

0.02 substitution/site 100 FN393270 FN393234 X1 X1 FN393285 98 FN396435 FN393239 100 99 FN393293 X1 X1 X1 X1 X1 X1 X1 X1 X1 X1 X2 X1 Nematoda FN394880 X2 X1

FN393354 FN396423 X2 FN393317 98 FN393372 FN393267 FN393233

100 100

X4 X2 X2 X1 X1

X1 X1

98 99

AM409622 FN393228

X2

X1

X1 FN394820 X1 FN393203 AM409619 AM409559 FN394938 FN394899 FN393188 100

X1 X2 X4 X1 X3 X1 FN396439 FN393290 X1 X1 X3 X1 Site DNA RNA PZ LS TV BS BB X9 X7 X1 X1 X1

Arthropoda (Hexapoda, Arachnida)

FN393250

X2 X2

tel-00482109, version 2 - 29 Feb 2012

FN394916 FN394810 100 X4

X1

FN394868 FN393217 92 X2

AM409626 FN393257 FN393358

X2

X4 X2

X1 FN393197 X4

X3 X1 X2 X2

X4 X1 X16

X1 Nematoda

AM409624 93 FN394884 FN396485 FN394952 FN394883 AM409563 AM409564 FN393266 X1

X1 AM409621 X1 Annelida Tardigrada

100

X1 X2 X1 X1 X1 X2

FN393330 X1

AM409633 FN393301 FN393334 FN393222 X2 X5 X1

FN396443 X2

Platyhelminthes X1

Arthropoda (Myriapoda) X21

Lehembre et al, Figure S2

FIG. S2. Phylogenetic distribution of partial 18S metazoan ribosomal sequences amplified from soil DNA (squares) or reverse-transcribed soil RNA (triangles). The tree was constructed using the BioNJ distance method starting from an alignment which included the different environmental sequences plus their three most similar sequences retrieved from the ARB database using SINA. A first tree was computed with all sequences to define the different metazoan phyla. Reference sequences were subsequently removed for legibility. Figures give the number of time a sequence was found in a particular dataset. Only bootstrap values (1000 replicates) above 90% are indicated. Variable rates of molecular evolution within the arthropoda and the nematoda could explain sequence grouping in different clusters. The use of PhyML gave an identical topology.

104

95

0.02 substitution/site FN394736 X1 FN396506 X1 98 Perkinsea DQ244038 EU162629 DQ244031 EF527111 Glenodinium inaequale EF058237 EF526856 Dinoflagellates 93 Gloeodinium montanum EF058238 FN394742 X1 Peridinium polonicum AY443017 Cyclidium glaucoma Z22879 99 100 DQ103857 FN396515 X1 FN394959 X1 AM409615 X1 FN396511 X1 EF024475 FN394934 X1 EF024921 FN394958 X1 Halteria grandinella AF194410 EF024472 Amphisiella magnigranulosa AM412774 FN393306 X1 99 Cyrtohymena citrina AF164135 Paraurostyla weissei AF164127 Stylonychia lemnae AJ310496 Stylonychia mytilus AF164123 Hemiurosoma terricola AY498651 AY829526 90 EU162618 EF527059 FN394946 X1 FN394878 X1 X4 X2 X1 Bryometopus atypicus EU039886 98 Ciliates Bursaria truncatella BTU82204 EF023864 AM409550 X1 Site DNA RNA EF024426 PZ FN394891 X1 LS 97 FN396468 X1 TV AM409551 X1 DQ244029 BS 98 AJ130861 BB 94 EU446317 EU446414 FN394927 X1 X1 Pseudocyrtolophosis alpestris EU264564 EF024647 100 FN393332 X1 Spathidium sp. Z22931 100 AM114813 FN396436 X5 FN396466 X1 Spathidium stammeri AM409612 X1 DQ411862 100 AJ130850 EF023121 EF024929 FN393200 X1 93 Adelina dimidiata DQ096835 FN396460 X1 FN393319 X11 X1 DQ310324 AY665063 EU780627 100 EF024809 Apicomplexans 100 FN393277 Apicomplexan acarus AY490099 X2 Ascogregarina taiwanensis DQ462454 AM409616 X1 AM409617 X1

tel-00482109, version 2 - 29 Feb 2012

Lehembre et al, Figure S3

FIG. S3. Phylogenetic distribution of environmental partial 18S alveolata ribosomal sequences amplified from soil DNA (squares) or reverse-transcribed soil RNA (triangles). The tree was constructed using the BioNJ distance method starting from an alignment which included the different environmental sequences plus their three most similar sequences retrieved from ARB or GenBank. For an explanation of the symbols, see legend of Fig. 4. 105

-Chapitre 2tel-00482109, version 2 - 29 Feb 2012

Identification dun nouveau groupe de microorganismes eucaryotes

106

Lobjectif de cette partie a t deffectuer une analyse phylogntique plus robuste de certaines squences dADNr 18S dtectes dans les banques ribosomiques de Truc Vert, Lommel et Paal (cf Chapitre 1) comme tant trs divergentes de squences de cercozoaires prsentes dans les bases de donnes. Ces banques dADNr avaient t construites aprs amplification du premier tiers du gne codant la petite sous unit ribosomale 18S. Par consquent, le faible nombre de sites informatifs analyss engendre un manque de rsolution des analyses phylogntiques et donc une affiliation incertaine de ces squences. Dans ce chapitre, je prsente une analyse phylogntique ralise sur les rsultats de phylognie molculaire obtenus avec la totalit du gne 18S qui a permis didentifier un nouveau clade de microorganismes eucaryotes appartenant au groupe des Cercozoa (Rhizaria) ainsi que leur rpartition dans diffrents environnements travers le monde. tel-00482109, version 2 - 29 Feb 2012

1. Analyse des banques ribosomiques 18S


Lanalyse phylogntique des banques ribosomiques 18S construites avec le premier tiers du gne 18S (cf Chapitre 1) conduit deux cas de figures illustrs pour le phylum des Rhizaria, exclusivement reprsent par des squences appartenant au groupe des cercozoa (Fig. S1). La plupart des squences affilies ce phylum sont trs similaires aux squences prsentes dans les bases de donnes et issues pour la plupart d'organismes dcrits et rpertoris. Cependant, une minorit de squences trs divergentes des squences dj rpertories ont t obtenues indpendamment et prsentent une forte similarit entre elles. Ce rsultat permet daffirmer que ces squences ne reprsentent pas des artfacts de PCR. Pour cette raison nous avons dcid dtudier de faon plus approfondi ces squences et le nouveau clade de cercozoaires quelles identifient. Pour cela, une premire tape a t dobtenir la squence 18S complte afin daffiner nos analyses phylogntiques.

107

tel-00482109, version 2 - 29 Feb 2012

Figure 25: Alignement de squences du premier tiers du gne 18S obtenues partir des sols de Lommel, Paal et Truc Vert avec le couple damorces Euk1A/Euk516 avec des squences de quelques cercozoaires rpertories dans les bases de donnes. Ces squences environnementales identifient le nouveau clade de cercozoaires. La squence encadre en noir reprsente lamorce 5 (Cerco1F) dessine pour identifier spcifiquement ce nouveau clade.

Figure 26: Alignement de squences de la totalit du gne 18S obtenues partir des sols de Lommel, Paal et Truc Vert avec le couple damorces Cerco1F/18R avec des squences de quelques cercozoaires rpertories dans les bases de donnes. Ces squences environnementales identifient le nouveau clade de cercozoaires. La squence encadre en noir reprsente lamorce 3 (Cerco1R) dessine pour identifier spcifiquement ce nouveau clade.

108

2. Analyse spcifique de nouvelles squences ribosomiques 18S


2.1 Dessin des amorces spcifiques
A partir de lalignement des squences de rfrence de cercozoa et des squences du potentiel nouveau clade (Fig. 25), une amorce spcifique (Cerco1F) a pu tre dessine en 5 du gne codant la petite sous unit ribosomale 18S (Tableau 11). Une amplification par PCR a ensuite t ralise partir de lADN mtagnomique des sols de Lommel, Paal et Truc Vert (Bailly et al., 2007) laide de cette amorce spcifique et dune amorce universelle (18R) shybridant lextrmit 3 de lADNr 18S (Tableau 11). Des fragments denviron 1700 pb ont t obtenus pour chaque sol. A lissue du clonage, 1 2 tel-00482109, version 2 - 29 Feb 2012 inserts de chaque sol ont t squencs et, aprs une analyse phylogntique, identifis comme tant spcifiques de ce nouveau clade . A partir de lalignement de ces nouvelles squences (Fig. 26), une autre amorce spcifique (Cerco1R) a pu tre dessine en 3 du gne codant la petite sous unit ribosomale 18S (Tableau 11).

2.2 Vrification de la spcificit des amorces


Ce couple damorces spcifiques (Cerco1F et 1R) a tout dabord t test sur les clones contenant les squences 18S gnres avec le couple damorces Cerco1F/18R partir de lADN mtagnomique des sols de Lommel, Paal et Truc Vert. Chaque squence amplifie par PCR avec ce couple damorces a t squence. Aprs une analyse phylogntique, 100% des squences obtenues se sont bien rvles affilies ce nouveau clade . Certaines sont identiques entre elles et ont t regroupes, permettant aussi de dfinir des phylotypes. Ensuite, une amplification par PCR partir de lADN mtagnomique des sols de Lommel, Paal et de Truc Vert (Bailly et al., 2007) laide de ce couple damorce spcifique (Cerco1F/Cerco1R) a t ralise. Aucun signal na pu tre dtect. Une tape pralable consistant amplifier la totalit du gne 18S avec le couple damorces universelles (18F/18R) a t effectue. Les squences 18S obtenues ont ensuite t r-amplifies avec le couple damorces spcifique (Cerco1F/Cerco1R) par une PCR embote. Un signal a ainsi pu tre dtect et comme prcdemment, lissue du clonage/squenage des fragments

109

Squences cibles 18S

Amorces 18F 18R Cerco1F Cerco1R

Squences nuclotidiques de lamorce 5-ACCTGGTTGATCCTGCCAG-3 5-TGATCCTTCYGCAGGTTCAC-3 5'-CCTTATCTCAGTTAGGATGT-3' 5-CTCACTAATCCATTCCATCG -3

Tm (C) 56

Rfrences Moon-van der Staay et al., 2001 Lehembre

18S

55

Tableau 11: Squences des amorces PCR utilises pour lamplification universelle du gne 18S de tous les eucaryotes (18F/18R) et pour lamplification spcifique du nouveau clade de cercozoaires (Cerco1F/Cerco1R).

tel-00482109, version 2 - 29 Feb 2012

110

damplification (1500-1600 pb), toutes les squences amplifie par PCR avec ce couple damorces spcifiques se sont bien rvles comme appartenant ce nouveau clade (Fig. 27). Ltablissement dune phylognie molculaire dun groupe taxinomique ncessite une connaissance approfondie de ce groupe, notamment pour choisir un jeu de squences reprsentatif des diffrents clades reconnus. Par ailleurs, dans le cas des eucaryotes unicellulaires il existe un grand nombre de squences non encore publies et dont la non inclusion dans une analyse phylogntique peut affecter le rsultat final. Pour ces raisons, pour la suite des analyses, nous avons pris contact avec deux spcialistes reconnus des Rhizaria (auxquels appartiennent les cercozoaires) : Jan Pawlowski (Universit de Genve) et David Bass (Natural History Museum, Londres). Ils ont confirm que ces squences environnementales identifient bien un nouveau clade tel-00482109, version 2 - 29 Feb 2012 chez les cercozoaires et constituent un groupe monophyltique (Fig. 28). Par ailleurs, au vu des longues branches qui soutiennent ces squences, ils supposent que ce groupe dorganismes a volu rapidement et avancent lhypothse dun groupe dorganismes parasites.

2.3 Recherche dans dautres environnements


Une fois la spcificit du couple damorces et lauthenticit des squences quelles amplifient tablie, une amplification par PCR embote a t ralise partir des ADN mtagnomiques des sols de Breuil (Morvan) prlevs sous htre et pica (prsents dans le chapitre 1) et partir de lADN mtagnomique du sol de Balen pollu aux mtaux lourds (prsent dans le chapitre 3). Des squences affilies ce nouveau clade ont t identifies dans chacun de ces 3 sols (Fig. 29). Afin de connatre plus prcisment lcologie de ce groupe dorganismes, nous avons entrepris une recherche dans des environnements aquatiques. Des ADN extraits dchantillon deau douce et deau de mer nous ont t fournis par David Bass. Lamplification par PCR a t ralise dans les mmes conditions que prcdemment. Des squences affilies ce nouveau clade ont ainsi pu tre identifies dans des chantillons deau dun tang (Priest Pot) et dun lac (Cumbria) en Angleterre et dun sol tropical du Prou (Fig. 29). Aucune squence appartenant ce nouveau clade na pu tre, jusqu prsent, identifie dans des chantillons deau de mer.

111

tel-00482109, version 2 - 29 Feb 2012

Figure 27: Distribution phylogntique des squences 18S totales du nouveau clade de cercozoa (en rouge) amplifies partir de lADN mtagnomique du sol de Lommel (LScerco), Paal (Pcerco) et Truc Vert (CercoTVF). Les astrisques correspondent au nombre de squences identiques identifies dans chaque chantillon. Larbre a t construit en utilisant la mthode du Neighbor Joining et des p-distances partir dun alignement qui inclut nos diffrentes squences environnementales et leurs 3 squences les plus similaires retrouv dans GenBank (en bleu). Seules les valeurs de bootstrap (1000 rpliques) suprieur 80% sont indiques. Lutilisation de la mthode du maximum de vraisemblance (PhyML) donne une topologie identique.

112

tel-00482109, version 2 - 29 Feb 2012

Figure 28: Distribution phylogntique des squences 18S totales du nouveau clade de cercozoa (en jaune) amplifies partir de lADN mtagnomique du sol de Lommel (LScerco), Paal (Pcerco) et Truc Vert (CercoTVF) laide du couple damorces Cerco1F/Cerco1R. Larbre a t construit partir dun alignement qui inclut nos squences environnementales, des squences de cercozaoires rfrencs et des squences non publies rpertories par Jan Pawlowski.

113

tel-00482109, version 2 - 29 Feb 2012

Figure 29: Distribution phylogntique des squences 18S totales du nouveau clade de cercozoa (en rouge) amplifies partir de lADN mtagnomique du sol de Lommel (LS), Paal (PZ), Truc Vert (TVF), Breuil sous htre (BrH), Breuil sous pica (BrE), Balen (BA) et du Prou (PE) et partir dADN dchantillon deau de Priest Pot (PP) et de Cumbria (CU). Les astrisques correspondent au nombre de squences identiques identifies dans chaque chantillon. Larbre a t construit en utilisant la mthode du Neighbor Joining et des pdistances partir dun alignement qui inclut nos diffrentes squences environnementales et leurs 3 squences les plus similaires retrouv dans GenBank (en bleu). Seules les valeurs de bootstrap (1000 rpliques) suprieur 90% sont indiques. Lutilisation de la mthode du maximum de vraisemblance (PhyML) donne une topologie identique.

114

tel-00482109, version 2 - 29 Feb 2012

Figure 30: Schma reprsentant les diffrentes tapes de lhybridation fluorescente in situ ou FISH.

115

Larbre phylogntique obtenu rvle une grande diversit dorganismes au sein de ce nouveau clade. Au final, sur les 38 squences obtenues, 21 phylotypes ont pu tre dfinis sur une base didentit de squences de 100%. Le regroupement des squences sur une base de 99% didentit entre elles permet de dfinir 16 phylotypes distincts. Les deux squences identifies dans leau et une squence identifie dans le sol pollu de Balen se regroupent dans un mme phylotype. Par ailleurs, deux phylotypes regroupent au moins deux squences provenant de 2 sols distants gographiquement (Prou et Breuil pour lun, Breuil et Truc Vert pour lautre). Tous les autres phylotypes sont constitus de squences provenant dun seul lieu. Au vue des rsultats obtenus, une tude supplmentaire didentification morphologique de ce groupe dorganismes t suggre. Une technique permettant didentifier un tel-00482109, version 2 - 29 Feb 2012 microorganisme non cultivable dans son environnement est lhybridation fluorescente in situ (ou FISH: Fluorescent In Situ Hybridization) de sondes dessines partir de la squence dARNr (Moter et Gobel, 2000) (Fig. 30). Cependant, cette technique est difficilement ralisable sur une matrice complexe telle que le sol. Les expriences de FISH sur des chantillons deau sont actuellement en cours dans le laboratoire de David Bass.

3. Discussion
Ces dernires annes, le nombre dtudes sintressant la diversit microbienne eucaryote dans diffrents environnements aquatiques na cess daugmenter (par exemple, Moon-van der Staay et al., 2001; Lopez-Garcia et al., 2001; Moreira et Lopz-Garcia, 2002; Stoeck et al., 2003). Toutes ces tudes, bases sur la construction et lanalyse de banques de gnes 18S environnementaux, ont rvl une diversit de lignes de microorganismes eucaryotes jusquici inconnues. Dans les sols, les tudes molculaires de la diversit globale des microorganismes eucaryotes sont plus rares (Moon-van der Staay et al., 2006 ; Bailly et al., 2007 ; Lesaulnier et al., 2008). Elles sont souvent restreintes des groupes taxinomiques prcis comme les champignons (O'Brien et al., 2005; Fierer et al., 2007; Yergeau et al., 2007), les nmatodes (Yergeau et al., 2007) et les cercozoa (Bass et Cavalier-Smith, 2004). Lemploi damorces spcifiques certains groupes a permis de mettre en vidence de nombreuses nouvelles espces et montre que la diversit et labondance des microorganismes eucaryotes dans les sols est encore largement sous-estime.

116

Lanalyse globale de nos banques de gnes 18S (cf Chapitre 1 Rsultats) a rvl une grande diversit eucaryote principalement reprsente par des squences de champignons et danimaux (micro/mso-faune). Pour certains de nos sols, un nombre important de squences dADNr 18S affilies certains groupes de protistes comme les rhizaria (exclusivement reprsent par le groupe des cercozoa) et les alveolata (principalement reprsent par le groupe des ciliata) ont galement t retrouves. Ces groupes de protistes sont connus pour tre les plus abondants dans les sols (Ekelund et Patterson, 1997) et ont une importance cologique majeure. Ils sont notamment connus pour tre des prdateurs de bactries et de champignons (Ekelund, 1998) et pour tre les proies des nmatodes et des vers de terres (Ekelund et Patterson, 1997). Les cercozoa ont t le premier groupe dorganismes majeurs tre identifi par un rsultat de phylognie molculaire avant dtre caractris morphologiquement (Cavaliertel-00482109, version 2 - 29 Feb 2012 Smith, 1996/7). Ils sont dcrits comme des flaglls htrotrophes ou des amibes tests prsentant une grande diversit, estime entre 1000 et 10.000 lignes distinctes (Bass et Cavalier-Smith, 2004) soit autant que certains groupes de protistes mieux caractriss comme les cilis et les foraminifres (Finlay, 2002). Les tudes visant mieux caractriser leur diversit sont bases sur lutilisation damorces spcifiques au groupe. Elles ont permis de construire des banques de gnes 18S spcifiques aux cercozoa partir de diffrents environnements, principalement aquatiques, et didentifier de nombreuses nouvelles lignes (par exemple, Bass et Cavalier-Smith, 2004; Bass et al., 2009). Notre tude de phylognie molculaire a galement permis didentifier de nouvelles lignes de cercozoa dans diffrents environnements, principalement des sols, laide damorces spcifiques dfinies partir de squences divergentes obtenues par une analyse globale de la diversit eucaryotes dans les sols. La construction darbres phylogntiques suivant une mthode phntique (NeighBor Joining,) et suivant une mthode probabiliste (Maximum de vraisemblance) a dmontr que ces squences environnementales identifient bien un nouveau clade chez les cercozoa et constituent un groupe monophyltique. Par ailleurs, au vue des longues branches qui soutiennent ces squences, il semble que ce groupe dorganisme ait volu rapidement et lhypothse dun groupe dorganismes parasites peut tre avance. En effet, les cercozoa sont galement connus pour tre des endoparasites dinvertbrs deau douce et marine, de plantes et dalgues (Cavalier-Smith et Chao, 2003). Enfin, la rpartition des squences de ce nouveau clade, mais galement dautres clades (Bass et Cavalier-Smith, 2004), dans diffrents environnements et/ou dans des sites gographiquement distants ne permet pas dtablir une distribution cologique et 117

gographique pour ce groupe dorganismes. Des efforts dchantillonnage et de squenage sont donc effectuer afin de mieux caractriser leur diversit et leur cologie, notamment dans les sols o une diversit cryptique semble exister. Dernirement, une exprience dhybridation fluorescente in situ (FISH), de sondes nuclotidiques dfinies partir de squences environnementales de cercozoa, a permis didentifier des cercozoa capables de se nourrir de pico et de nano-plancton ou de parasiter des diatomes (Mangot et al., 2009).

tel-00482109, version 2 - 29 Feb 2012

118

-Chapitre 3tel-00482109, version 2 - 29 Feb 2012

Le mtatranscriptome eucaryote dun sol pollu et non pollu aux mtaux lourds

119

Lobjectif de cette partie est danalyser et de comparer la diversit taxinomique et fonctionnelle dune communaut de microorganismes eucaryote prsente dans des chantillons de sols prlevs sur 3 sites distincts. Il sagit dun sol contamin par des mtaux lourds (site de Balen), anciennement contamin par ces mmes mtaux lourds (site de Lommel) et non contamin (site de Paal). Quelques rsultats obtenus partir du sol anciennement contamin (Lommel) et non contamin (Paal) ont t dcrits dans la partie rsultats chapitre 1 . Pour atteindre cet objectif, nous avons valu la diversit taxinomique eucaryote par lanalyse des squences dADNr et dARNr 18S suivant une approche de clonage et de squenage. La diversit fonctionnelle a t estime par lanalyse de banques dADNc construites partir des ARNm polyadnyls directement extraits des chantillons de sols suivant une approche mtatranscriptomique. Ces banques dADNc ont fait lobjet dun tel-00482109, version 2 - 29 Feb 2012 squenage alatoire (approche base sur la squence) et dun criblage par expression htrologue dans la levure (approche base sur la fonction).

1. Sites tudis
Les sites de Balen, Paal et Lommel sont situs dans un primtre denviron 60 km dans la Province du Limbourg en Belgique. Les chantillons de sol prlevs sur ces sites ont une origine gologique commune et ont tous t rcolts proximit de lespce vgtale Pinus sylvestris, commune aux 3 sites. Il sagit de sols sableux qui diffrent par leur pH, leur capacit dchange cationique, leur humidit et leur taux de matire organique. Ces paramtres physico-chimiques sont globalement plus levs pour le site de Balen, sur lequel une vgtation (herbaces, bryophytes) plus importante a t observe (cf Tableau 22 et 23 Matriels et mthodes). Ces sites diffrent galement par leur concentration en mtaux lourds. Le site de Balen, situ proximit de la plus grande fonderie de zinc europenne toujours en activit, prsente des concentrations totales, disponibles et biodisponibles en zinc, cadmium et plomb plus leves que celles doses sur les sites de Lommel et Paal. Ce site fait lobjet dtudes de phytormdiation depuis une dizaine dannes (van der Lelie et al., 2001) et reprsente donc un site contamin dintrt pour notre tude. Le site de Lommel est situ proximit dune ancienne fonderie de zinc construite la fin du 19me sicle et dmantele dans les annes 1960. Ce site, rebois en 1975, est considr comme anciennement contamin car une contamination quivalente celle de Balen tait

120

encore observe en 1998 (Jan Colpaert, communication personnelle) mais nest plus prsente aujourdhui sans doute par lessivage des mtaux. Le site de Paal est relativement loign de toute industrie mtallurgique et son sol possde des caractristiques physico-chimiques proches de celles de Lommel, except le taux de matire organique. Toutefois, la concentration biodisponible en cadmium dose dans les aiguilles de pins Paal est suprieure celle communment retrouve dans les aiguilles de pins de sites non contamins (en gnral infrieure 0,5 ppm) (Dmuchowski et Bytnerowicz, 1995 ; Yilmaz et Zengin, 2004) alors quaucune trace de cadmium na t dtecte dans les chantillons de ce sol. Ce rsultat peut sexpliquer par lacidit de ce sol, qui facilite le passage des mtaux sous formes ioniques, et par la capacit des pins accumuler les mtaux. Il y a une dizaine dannes, les sites de Lommel et de Paal (site tmoin) ont fait lobjet de nombreuses tudes cotoxicologiques par le centre de sciences environnementales de tel-00482109, version 2 - 29 Feb 2012 luniversit de Hasselt (Belgique) (Vangronsveld et al., 1995 ; Vangronsveld et al., 1996).

2. Etude de la diversit taxinomique


Aprs avoir vrifie la qualit des diffrentes banques ribosomiques construites, une comparaison de la diversit taxinomique a t effectue suivant diffrents paramtres : le sol tudi, la portion du gne 18S cible et la molcule (ADN ou ARN) analyse. La richesse taxinomique des eucaryotes a galement tait estime et compare pour ces 3 variables.

2.1 Construction des banques ribosomiques 18S eucaryotes


La diversit taxinomique des eucaryotes du sol contamin aux mtaux lourds (Balen) et du sol non contamin (Paal) a t estime par lanalyse du premier et du dernier tiers de la squence du gne codant lARNr 18S. La diversit taxinomique du sol anciennement pollu (Lommel) a t value uniquement par lanalyse du premier tiers du 18S (cf Chapitre 1). Pour chaque sol et chaque portion du gne 18S analys, une banque dADNr et une banque dARNr rtrotranscrit ont t construites et analyses.

121

2.1.1

Les banques dADN ribosomiques

Lors de lextraction des acides nucliques de chacun des sols, une partie aliquote de 100L a t prleve avant ltape de digestion la DNaseI. Les ADN contenus dans ces fractions ont t purifies sur colonne Sephadex G50 puis re-prcipites. A partir de lADN ainsi obtenu, une deux portions (suivant le sol) du gne codant lARNr 18S des Eucaryotes a t amplifie par 25 cycles de PCR laide des amorces Euk1A-Euk516 (premier tiers du gne) et S12.2-SB (dernier tiers du gne) (cf Matriels et mthodes, Tableau 24, Fig. 51). Les fragments de 500 pb (premier tiers) et de 700 pb (dernier tiers) obtenus et purifis partir de 8 rptitions de la raction de PCR ont t utiliss pour construire les banques dADN ribosomiques dans le vecteur plasmidique pCR4Blunt-TOPO (Invitrogen). tel-00482109, version 2 - 29 Feb 2012 2.1.2 Les banques dARN ribosomiques Les banques dARN ribosomiques ont t construites selon le mme principe. Les ARNr recueillis lors de ltape de purification des ARNm sur billes magntiques ont t soumis une tape de transcription inverse. Trois rptitions de cette raction ont t ralises en prsence de 500 ng dARNr avec lamorce Euk516, ou lamorce SB ou un mlange dhexanuclotides alatoires comme oligonuclotide damorage. Pour chaque condition, les produits des 3 rptitions ont t rassembls et 2% de la quantit finale ont t utiliss pour chaque rptition damplification par PCR. Une deux portions (suivant le sol) de la molcule dARNr rtrotranscrite a t amplifie par 25 cycles de PCR avec les amorces Euk1A-Euk516 (premier tiers) et S12.2-SB (dernier tiers). Les fragments de 500 pb (premier tiers) et de 700 pb (dernier tiers) obtenus et purifis partir de 8 rptitions de la raction de PCR ont t utiliss pour construire les banques dADN ribosomiques dans le vecteur plasmidique.

2.2 Vrification de la qualit des banques


2.2.1 Vrification des inserts

A lissue du clonage, les squences dADNr et dARNr obtenues ont t compares aux squences de la base de donnes GenBank laide du programme BLASTn

122

Site Nombre de squences initiales Nombre dartfacts Balen Nombre de chimres Nombre de squences finales Nombre de squences initiales Nombre dartfacts Paal tel-00482109, version 2 - 29 Feb 2012 Nombre de chimres Nombre de squences finales Nombre de squences initiales Nombre dartfacts Lommel Nombre de chimres Nombre de squences finales

ADNr 5 ARNr 5 ADNr 3 ARNr 3 274 3 5 266 348 14 1 333 93 22 0 71 275 1 1 273 371 7 6 358 95 2 1 92 246 1 3 242 273 0 4 269 nd nd nd nd 244 2 3 239 271 14 3 254 nd nd nd nd

Tableau 12: Analyse des squences 18S: nombre de squences obtenues, nombre dartfacts et de chimres, et nombre de squences finales utilises pour les analyses de diversit. La taille moyenne de chaque jeu de squences est indique en paires de bases (pb). Le terme 5 dsigne le premier tiers de lARN ribosomique 18S et 3 le dernier tiers. nd : non dtermin

123

(http://www.ncbi.gov/BLAST) et aux squences de la base de donnes Silva SSU par lintermdiaire du serveur MG-RAST (http://metagenomics.nmpdr.org/). Les squences ne prsentant pas didentit avec des squences ribosomiques 18S ont t considres comme des artfacts et limines des jeux de squences. 2.2.2 Dtection des squences chimriques

Les squences chimriques sont des artfacts de la PCR qui sont constitues en gnral par lassociation dau moins deux squences provenant dorganismes diffrents. Il est ncessaire didentifier ces chimres qui contribuent augmenter artificiellement la richesse phylogntique et spcifique des communauts microbiennes tudies. Compte tenu du fait que les squences ribosomiques 18S sont fortement conserves et que nos banques ont t tel-00482109, version 2 - 29 Feb 2012 construites partir de produits de PCR, nous avons vrifi lventuelle prsence de telles squences au sein de chaque banques laide du logiciel Check Chimera (http://rdp8.cme.msu.edu/cgis/chimera.cgi?su=SSU) du ribosomal database project II . Les squences chimriques identifies ont t limines des jeux de squences pour la suite des analyses (tableau 12).

2.3 Rpartition au sein des phyla eucaryotes


Chaque squence a t affilie un des 8 grands phyla eucaryotes dfinis par LopezGarcia et Moreira (2008). Il sagit des fungi, des metazoa, des plantae, des amoebozoa, des alveolata, des heterokonta, des rhizaria et des excavata (les 5 derniers groupes peuvent tre rassembls sous le terme protistes ). A lissue du BLAST contre la base de donnes GenBank, les squences prsentant plus de 95% didentit avec une squence appartenant un organisme isol ont t directement classes dans le phylum auquel appartient cet organisme. Les squences prsentant moins de 95% didentit avec un organisme isol ou prsentant une plus ou moins forte identit avec une squence environnementale ont fait lobjet danalyses phylogntiques. Pour cela nous avons incorpor des squences provenant dorganismes reprsentatifs des grands phyla eucaryotes. Ces squences proviennent gnralement dtudes de phylognie molculaire faisant rfrence dans leur domaine, ceci

124

tel-00482109, version 2 - 29 Feb 2012

Fungi CHI-2 Balen/Paal CHI-2 Balen/Lommel CHI-2 Paal/Lommel

Metazoa

Amoebozoa

Alveolata

Rhizaria

Heterokonta

Excavata

Plantae

Autres

b a a

a a b

b b b

b a a

b a a

b b b

b a a

a b a

b b b

Figure 31: Affiliation taxinomique des squences reprsentant le premier tiers (5) de lADNr et de lARNr ribosomiques 18S obtenues partir des sols de Paal, Balen et Lommel. Le nombre de squences (N) correspond la somme des ADNr et des ARNr 18S. La catgorie autres inclut des squences 18S appartenant des groupes taxinomiques mineurs tels ques les choanozoa, les ichtyosporeae ou les nucleariidae. Un test de Chi-2 comparant labondance de chacun des phylums entre chaque site dtude a t effectu ; les valeurs numriques exactes sont indiques en annexe. La lettre (a) signifie que la diffrence entre les 2 jeux de donnes est significative (p<0,05). La lettre (b) signifie que la diffrence entre les 2 jeux de donnes nest pas significative (p0,05).

125

pour minimiser les risques derreur didentification de phyla. A partir de ce nouveau jeu de squences, des arbres phylogntiques ont t construits. Lalignement des squences a t ralis avec le logiciel ClustalW (http://www.ebi.ac.uk/) et les arbres ont t construits pour chaque phylum avec le logiciel PhyloWin en utilisant le modle du Neighbour Joining et les p-distances . Malgr ces diffrentes prcautions, un certain nombre de squences nont pas pu tre affilies un phylum avec certitude. Il est probable que ces problmes rsultent du fait que nous analysons des squences courtes (500 et 700 pb) qui ne contiennent pas toute linformation ncessaire la sparation claire de certains phyla eucaryotes. Lattribution de certaines squences un phylum donn doit donc parfois tre considre comme conditionnelle. tel-00482109, version 2 - 29 Feb 2012 2.3.1 Analyse globale du premier tiers (en 5) de lARN ribosomique 18S

Les squences dADNr et dARNr disponibles pour les 3 sols tudis ont tout dabord t tudies dans leur ensemble (Fig. 31). Tous les phyla eucaryotes sont reprsents dans les jeux de squences des 3 sites. A lexception des squences affilies aux Metazoa et aux Plantae, les profils daffiliations taxinomiques du site de Balen, contamin par des mtaux lourds, et du site de Paal, non contamin, ne prsentent pas de diffrences significatives. Pour ces 2 sites, les jeux de squences sont domins par les squences de champignons et danimaux (Fig. 31). Les groupes de protistes les mieux reprsents sont les rhizaria (exclusivement reprsents par les cercozoa), les amoebozoa et les alveolata. Le profil daffiliation taxinomique des squences ribosomiques de Lommel prsente plus de diffrences significatives avec les profils de Paal et de Balen (Fig. 31). Le jeu de squences du site de Lommel est lgrement domin par les squences danimaux. La principale diffrence par rapport aux 2 autres sites concerne le faible nombre de squences appartenant aux champignons quivalent au nombre de squences appartenant aux phyla des rhizaria et des alveolata, apparemment mieux reprsentes dans ce site. Les squences de plantes obtenues appartiennent majoritairement au genre Pinus prsent sur les 3 sites dtudes. Elles refltent la quantit des racines fines qui sont passes travers le tamis lors de lchantillonnage. Aprs avoir exclu les squences de plantes des jeux de squences, un regroupement des squences prsentant 97% didentit entre elles, considres comme appartenant un mme 126

164

14 7

tel-00482109, version 2 - 29 Feb 2012

65

11

150

Figure 32: Nombres de phylotypes dfinis par les squences dADNr et dARNr ribosomiques 18S 5 prsentant 97% didentit entre elles, spcifiques de chacun des sites et communs 2 ou 3 sites. Le site de pollu (P) de Balen est reprsent en rose, le site anciennement pollu (AP) de Lommel en vert et le site non pollu (NP) de Paal en bleu.

127

tel-00482109, version 2 - 29 Feb 2012

Figure 33: Affiliation taxinomique des squences reprsentant le dernier tiers (3) de lADNr et de lARNr ribosomiques 18S obtenues partir des sols de Paal et Balen. Le nombre de squences (N) correspond la somme des ADNr et des ARNr 18S. La catgorie autres inclut des squences 18S appartenant des groupes taxinomiques mineurs tels que les choanozoa, les ichtyosporeae ou les nucleariidae. Un test de Chi-2 comparant labondance de chacun des phylums entre chaque site dtude a t effectu ; les valeurs numriques exactes sont indiques en annexe. La lettre (a) signifie que la diffrence entre les 2 jeux de donnes est significative (p<0,05). La lettre (b) signifie que la diffrence entre les 2 jeux de donnes nest pas significative (p0,05).

128

phylotype, a t effectu pour chaque jeu de squences laide du logiciel RapidOTU (http://genome.jouy.inra.fr/rapidotu/). Nous avons ensuite dtermin le nombre de phylotypes communs entre les diffrents sites en ralisant un diagramme de Venn laide du logiciel BioVenn (http://www.cmbi.ru.nl/cdd/biovenn/) (Fig. 32). La majorit des phylotypes (92%) est spcifique de chaque site. Seul 1,7% des phylotypes sont communs aux 3 sites. Ces derniers appartiennent aux phylums des champignons (3 phylotypes) et des metazoa (4 phylotypes). 2.3.2 Analyse globale du dernier tiers (en 3) de lARN ribosomiques 18S

Pour cette portion, nous disposons seulement des squences dADNr et dARNr pour les sols de Balen et de Paal (Fig. 33). tel-00482109, version 2 - 29 Feb 2012 Comme prcdemment, tous les phyla eucaryotes sont reprsents dans les jeux de squences des deux sites. Les profils daffiliations taxinomiques prsentent plus de diffrences significatives que prcdemment (Fig. 33). Les jeux de squences sont trs nettement domins par les squences de champignons. Les groupes de protistes les mieux reprsents sont nouveau les rhizaria (exclusivement reprsent par les cercozoa), les amoebozoa et les alveolata. Ces deux derniers phyla semblent tre mieux reprsents que dans les jeux de squences du premier tiers de lARN ribosomique. Cependant, la principale diffrence avec lanalyse prcdente concerne la quasi disparition des squences affilies au phylum des metazoa. Les squences de plantes obtenues appartiennent aussi majoritairement au genre Pinus prsent sur les sites dtudes. Aprs avoir exclu les squences de plantes et regroup les squences prsentant 97% didentit entre elles en phylotype, la construction dun diagramme de Venn a permis de mettre en vidence que 7,5% des phylotypes tait communs au deux sites contre 6% pour les phylotypes 5 (Fig. 34). Parmi ces phylotypes, 61,5% sont dorigine fongique (contre 62% en 5), 23% appartiennent au phylum des rhizaria (contre 9,5% prcdemment) et 15,5% sont affilis aux alveolata (contre 0% en 5). 2.3.3 ADN versus ARN

La comparaison des jeux de squences dADNr et dARNr 18S pour chaque phylum met en vidence des diffrences significatives et des similitudes suivant le site et la portion du 129

tel-00482109, version 2 - 29 Feb 2012

Figure 34: Nombres de phylotypes, dfinis par les squences dADNr et dARNr ribosomiques 18S 3 prsentant 97% didentit entre elles, spcifique de chacun des sites et communs aux 2 sites tudis. Le site de pollu (P) de Balen est reprsent en rose et le site non pollu (NP) de Paal en bleu.

130

tel-00482109, version 2 - 29 Feb 2012

Figure 35: Affiliation taxinomique des squences reprsentant le premier (5) et le dernier tiers (3) de lADN et de lARN ribosomiques 18S obtenues partir des sols de Paal, Lommel et Balen. La catgorie autres inclut des squences 18S appartenant des groupes taxinomiques mineurs tels que les choanozoa, les ichtyosporeae ou les nucleariidae. Un test de Chi-2 comparant labondance de chacun des phylums entre chaque site dtude a t effectu ; les valeurs numriques exactes sont indiques en annexe. La lettre (a) signifie que la diffrence entre les 2 jeux de donnes est significative (p<0,05). La lettre (b) signifie que la diffrence entre les 2 jeux de donnes nest pas significative (p0,05).

131

gne 18S analyss (Fig. 35). Par ailleurs, la rpartition spare ou cumule de ces squences dans chaque phylum donne des profils daffiliations relativement semblables. Les champignons, phylum le mieux reprsent Balen et Paal, prsentent en gnral un ratio ADNr/ARNr suprieur un (sauf en 5 Balen) (Fig. 35). Les metazoa, quasi absents de lanalyse de la portion 3, ont un ratio ADNr/ARNr infrieur un (sauf en 5 Balen) (Fig. 5). Concernant les groupes de protistes majoritaires, on saperoit que le ratio ADNr/ARNr des rhizaria est toujours suprieur un pour la portion 5 et proche de un en ce qui concerne la portion 3 indpendamment du site tudi. Les amoebozoa sont quant eux mieux reprsents par leurs squences ARN quel que soit la portion du gne 18S analyse, lexception du site de Balen o le ratio ADNr/ARNr est toujours gal un. Les alveolata sont autant reprsents par leurs squences dADNr que dARNr sauf Lommel (Fig. 35). En gnral, les diffrents phyla sont reprsents aussi bien par des squences dADNr que tel-00482109, version 2 - 29 Feb 2012 dARNr quel que soit la portion du gne 18S analyse (sauf pour les hterokonta de Lommel et les metazoa et les excavata de Paal). Cependant, aprs avoir dfini des phylotypes avec les squences dADNr et dARNr de chaque portion et de chaque site, on saperoit que le nombre de phylotypes dfinis par les ARN est toujours suprieur celui des ADN et quil y a trs peu de redondance entre les banques dADNr et dARNr construites. En effet, seulement 10 20% des phylotypes ont t identifis la fois via les ADN et les ARN quel que soit la portion du gne analyse et le site tudi (tableau 13).

2.4 Estimation de la richesse taxinomique des Eucaryotes


Lobjectif est destimer le nombre total de phylotypes eucaryotes prsents dans ces sols afin de dterminer le nombre despces dont les gnes exprims contribuent aux banques dADNc environnementales analyse dans les paragraphes suivants. Diffrents outils analytiques ont t utiliss. Les courbes de rarfaction indiquent si le panel de squences obtenu couvre la diversit relle des communauts. Diffrents estimateurs de richesse spcifique ont aussi t calculs. 2.4.1 Courbes de rarfaction Les courbes de rarfactions ont t construites laide du logiciel Analytical rarefaction 1.3 de S. Holland (http://www.uga.edu/strata/software/). Quel que soit le site tudi et la

132

Balen 5 Nombre de phylotype ADNr Nombre de phylotype ARNr Nombre de phylotype commun Pourcentage de phylotype commun tel-00482109, version 2 - 29 Feb 2012 73 92 17 9,3%

Balen 3 94 123 21 8,8%

Paal 5 66 96 21 11,5%

Paal 3 45 66 25 18,4%

Lommel 5 27 49 9 10,5%

Tableau 13: Nombres de phylotypes identifis sur chacun des 3 sites tudis et pour chacune des portions du gne 18S analyses. Il sagit des phylotypes reprsents soit par des squences dADNr, soit par des squences dARNr et soit par les deux.

Figure 36: Courbes de rarfaction des phylotypes 18S de champignons, danimaux et de protistes obtenus pour les 3 sites tudis partir des squences environnementales dADNr et dARNr 18S cumules reprsentant le premier (5) et le dernier (3) tiers du gne 18S.

133

Balen
Molcules analyses Nombre de squences Phylotypes observs SACE SChao1 Phylotypes observs / SACE Phylotypes observs / SChao1

ADN 5 220 90 165 159 0,57 0,59

ARN 5 225 109 241 244 0,46 0,46

Total 5 444 187 369 363 0,51 0,52

ADN 3 231 115 320 289 0,37 0,40

ARN 3 236 144 421 424 0,36 0,37

Total 3 467 241 613 606 0,41 0,41

tel-00482109, version 2 - 29 Feb 2012

Tableau 14: Estimation de la richesse en microorganismes eucaryotes (champignons, protistes et animaux) prsents dans les chantillons de sols prlevs Balen par calcul des indices SChao1 et SACE partir des squences environnementales dADNr, dARNr et dADNr + ARNr reprsentant le premier (5) et le dernier (3) tiers du gne 18S.

Paal
Molcules analyses Nombre de squences Phylotypes observs SACE SChao1 Phylotypes observs / SACE Phylotypes observs / SChao1

ADN 5 307 87 150 143 0,59 0,59

ARN 5 344 118 277 227 0,44 0,53

Total 5 649 182 366 327 0,52 0,56

ADN 3 238 70 126 117 0,55 0,59

ARN 3 249 91 174 168 0,54 0,55

Total 3 487 137 264 261 0,55 0,56

Tableau 15: Estimation de la richesse en microorganismes eucaryotes (champignons, protistes et animaux) prsents dans les chantillons de sols prlevs Paal par calcul des indices SChao1 et SACE partir des squences environnementales dADNr, dARNr et dADNr + ARNr reprsentant le premier (5) et le dernier (3) tiers du gne 18S.

134

portion du gne 18S analyse, les courbes natteignent pas une valeur asymptotique (Fig.36) ce qui signifie que les jeux de squences analyss ne dcrivent pas totalement les richesses spcifiques des communauts de microorganismes eucaryotes tudies. Ces courbes permettent, cependant, de prdire que la diversit de microorganismes eucaryotes prsente Balen est plus importante qu Lommel et Paal, quelle que soit la portion du gne 18S analyse. 2.4.2 Estimation des indices de richesse des communauts

Diffrentes approches statistiques permettent destimer la richesse spcifique dune communaut partir dun chantillon de celle-ci. Nous avons choisi deux estimateurs Schao1 et SACE tous deux bass sur labondance des taxons. Ils ont t calculs grce au logiciel tel-00482109, version 2 - 29 Feb 2012 dvelopp par Kemp et Aller (2004) (http://www.also.org/lomethods/free/2004/0114a.html). Pour chaque site et chaque portion du gne 18S analys, la valeur des estimateurs est toujours plus importante pour les molcules dARNr par rapport celle des molcules dADNr (tableau 14, 15 et 16). Cependant, les valeurs obtenues avec les donnes cumules (ADNr + ARNr) sont nettement suprieures et montrent que le nombre de squences obtenues a permis de recouvrir entre 40 et 55% de la diversit taxinomique quel que soit le site et la portion du gne analyss (tableau 14, 15 et 16). Enfin ces rsultats corroborent ceux obtenus avec la construction des diagrammes de Venn et des courbes de rarfaction montrant que le site de Balen contamin par des mtaux lourds contient une plus grande diversit taxinomique de microorganismes eucaryotes que le site de Paal non pollu et le site de Lommel anciennement pollu.

2.5 Conclusions
Lanalyse bioinformatique de centaines de squences 18S de banques dADNr et dARNr construites partir des diffrents sols a permis de montrer : - que ces banques sont de bonne qualit puisquelles contiennent trs peu dartfacts (chimres, autres squences que 18S, squences 18S tronques). - que les sols tudis contiennent une grande diversit dorganismes eucaryotes puisque tous les phyla eucaryotes y sont reprsents et que la redondance entre ARNr 18S et ADNr 18S est trs faible, quel que soit la portion du gne 18S analyse.

135

Lommel
Molcules analyses Nombre de squences Phylotypes observs SACE SChao1 Phylotypes observs / SACE

ADN 5 58 36 105 71 0,32 0,47

ARN 5 86 58 172 157 0,37 0,40

Total 5 144 85 246 205 0,36 0,44

ADN 3 n.d n.d n.d n.d n.d n.d

ARN 3 n.d n.d n.d n.d n.d n.d

Total 3 n.d n.d n.d n.d n.d n.d

tel-00482109, version 2 - 29 Feb 2012

Phylotypes observs / SChao1

Tableau 16: Estimation de la richesse en microorganismes eucaryotes (champignons, protistes et animaux) prsents dans les chantillons de sols prlevs Lommel par calcul des indices SChao1 et SACE partir des squences environnementales dADNr, dARNr et dADNr + ARNr reprsentant le premier (5) tiers du gne 18S.

Figure 37: Profil dlectrophorse des ADNc gnrs avec le kit SMART cDNA Library Construction (Clontech) partir des ARNm extraits du champignon Hebeloma cylindrosporum (utiliss comme tmoins) et des diffrents sols tudis.

136

- que chaque sol prsente une diversit taxinomique spcifique. Peu de phylotypes communs 2 ou 3 sols ont t dtects. - que la richesse spcifique de la communaut de microorganismes eucaryotes du sol contamin aux mtaux lourds semble quivalente (portion 5) voire plus importante (portion 3) que celle dun sol tmoin non contamin ou anciennement contamin par des mtaux lourds.

3. Etude de la diversit fonctionnelle


La diversit fonctionnelle des sols de Balen et Paal a t estime de faon globale par lanalyse bioinformatique de plusieurs milliers de squences dADNc squences par le tel-00482109, version 2 - 29 Feb 2012 Genoscope (Evry, France). Les squences prsentant des homologues de fonction connue dans les bases de donnes ont t rparties en groupes fonctionnels. Les banques dADNc de Balen, Paal et Lommel ont aussi t cribles par expression htrologue dans des mutants de levures sensibles au cadmium en vue destimer la diversit des mcanismes eucaryotes de rsistance aux mtaux au sein dune communaut prsente dans un sol contamin, anciennement contamin et non contamin aux mtaux lourds.

3.1 Construction des banques dADNc


3.1.1 Purification des ARNm et synthse des ADNc

Les ARNm polyadnyls eucaryotes ont t purifis par affinit sur billes magntiques recouvertes doligo-(dT)25 partir des ARN totaux issus des sols de Paal, Lommel et Balen. La transcription inverse des ARNm en ADNc a t effectue avec le kit SMART cDNA Library Construction (Clontech) (cf Matriels et mthodes, Fig. 52). Lamplification des ARNm rtrotranscrits par PCR avec des amorces fournies par le kit a gnr des ADNc de tailles comprises entre 0,1 et 2 kb pour les 3 sols (Fig. 37). Ces ADNc sont bords par les sites de restriction Sfi A et Sfi B permettant leur clonage directionnel dans un vecteur possdant ces 2 sites.

137

3.1.2

Les vecteurs de clonage

Deux vecteurs plasmidiques ont t utiliss. Le plasmide pDNR-LIB, fourni par le kit SMART cDNA Library Construction, a t utilis pour la construction des banques qui ont t squences de faon systmatique par le Gnoscope. Le plasmide pFL61 (Minet et al., 1992), modifi au laboratoire par insertion des sites Sfi A et Sfi B (cf Matriels et mthodes, Fig. 53), a t utilis pour construire les banques cribles par expression htrologue dans des mutants de levure sensibles au cadmium. Il sagit dun plasmide navette possdant un gne de rsistance lampicilline permettant sa slection dans E. coli et le gne URA-3 pour sa slection dans S. cerevisiae. Il possde aussi un promoteur fort constitutif (PGK) permettant lexpression dans la levure des ADNc clons. tel-00482109, version 2 - 29 Feb 2012 Pour permettre le clonage directionnel dADNc gnrs par le kit SMART cDNA Library Construction (Clontech) il a t ncessaire dintroduire les deux sites de restrictions Sfi A et Sfi B en aval du promoteur PGK au niveau des sites Not dj prsents dans pFL61. Le squenage de la rgion modifie a permis de vrifier la bonne insertion des sites Sfi A et Sfi B. Afin de vrifier la fonctionnalit de ce nouveau vecteur de clonage pour lexpression htrologue dADNc dans S. cerevisiae, un gne HIS3 codant une imidazole glycrol phosphate dshydratase et bords par les sites Sfi A et Sfi B (Bailly et al., 2007) a t insr par ligation dans les sites Sfi A et Sfi B du plasmide pFL61 modifi. Le plasmide pFL61HIS3 ainsi obtenu a t introduit par transformation dans la souche de S. cerevisiae BY4741 (ura-, his-). Soixante transformants ont t isols sur milieu slectif YNB + glucose dpourvu duracile et dhistidine et le gne HIS3 a pu tre amplifi par PCR et squenc partir des ADN extraits de levures recombinantes. La croissance de ces levures transformes sur un milieu de culture dpourvu dhistidine montre que le gne HIS3 sexprime correctement et que le vecteur dexpression pFL61 modifi est donc fonctionnel.

3.1.3

Clonage des ADNc

Les ADNc gnrs (Fig. 37) ont t digrs par lenzyme de restriction Sfi I et fractionns sur une colonne dexclusion. Les ADNc de tailles infrieures 400pb ont t limins. Les autres ont t clons dans les deux vecteurs de clonage pDNR-LIB et pFL61 modifi. 138

Titre de la banque dans : Plasmides Paal Lommel Balen pDNR 13.106 15.106 1,5.106 pFL61 3.105 5.106 3,5.106

Tableau 17: Titres (nombre total dADNc clons) des banques dADNc construites partir des diffrents sols dans les 2 vecteurs de clonage utiliss.

tel-00482109, version 2 - 29 Feb 2012

Balen Nombre de squences analyses Nombre de squences uniques Nombre de contigs

Paal

7101

8372

5405 592

8075 87

Tableau 18: Nombre de contigs et de squences uniques dtects par le logiciel Basic CAP3 dans les jeux de squences dADNc de Balen et de Paal.

139

Les ADNc ont t introduits par transformation dans la souche lectrocomptente DH10B dE. coli. Les cellules transformes ont t slectionnes sur un milieu slectif et un dnombrement des clones a t effectu afin de dterminer le titre des banques dADNc ainsi gnres pour chaque sol dans les 2 vecteurs de clonage (Tableau 17).

3.2 Analyse des banques dADNc par squenage massif


Les banques dADNc construites dans le vecteur pDNR (Clontech) partir du sol de Balen (1,5.106 clones) et du sol de Paal (13.106 clones) ont fait lobjet dun squenage massif par le Gnoscope (Evry, France) suivant la mthode Sanger (ABI 3730). Un programme de squenage de 30.000 inserts dADNc de chaque banque est en cours de ralisation. tel-00482109, version 2 - 29 Feb 2012 Actuellement, nous disposons de 7101 squences dADNc pour le sol de Balen et de 8372 squences dADNc pour le sol de Paal. Ces squences nous tant parvenues tardivement en cours de rdaction de ce manuscrit, les analyses ci-dessous restent prliminaires et devront tre compltes et affines. 3.2.1 Dtection des squences redondantes ou chevauchantes Les squences redondantes ou chevauchantes ont t dtectes laide du logiciel Basic CAP3 (https://www.genome.clemson.edu/cgi-bin/cugi_cap3?advanced=1). Les squences prsentant 98% didentit sur une longueur minimale de 100 pb ont t regroupes en contigs (Tableau 18). La plupart des contigs identifis sont composs de squences identiques. Seuls quelques uns sont constitus de squences qui se chevauchent sur un minimum de 100 pb avec 98% didentit et permettent de former une squence consensus. Les squences dfinissant des contigs reprsentent 3,5% du jeu de squences dADNc de Paal et 24% du jeu de squences de Balen (tableau 18). Plus de 90% des contigs des 2 jeux de squences sont constitus au maximum de 5 squences (Fig. 38 et 39). Seuls quelques rares contigs contiennent plus de 10 squences. Deux contigs de Balen contiennent 33 et 265 squences dADNc codant respectivement une saccharopine deshydrognase et une protine hypothtique. Deux contigs de Paal contiennent 24 et 51 squences dADNc qui codant respectivement une sous unit de lATP synthase et un ARNr 18S.

140

tel-00482109, version 2 - 29 Feb 2012

Figure 38: Nombre de contigs en fonction du nombre de squences dADNc par contigs identifis pour le sol de Balen. Deux contig, non reprsents, contenant respectivement 33 et 265 squences dADNc ont galement t identifis.

Figure 39: Nombre de contigs en fonction du nombre de squences dADNc par contigs identifis pour le sol de Paal. Deux contig, non reprsents, contenant respectivement 24 et 51 squences dADNc ont galement t identifis.

141

tel-00482109, version 2 - 29 Feb 2012

Figure 40: Courbes de rarfactions des squences dADNc eucaryotes uniques obtenues pour le site de Balen et le site de Paal partir des ARNm polyadnyls.

142

tel-00482109, version 2 - 29 Feb 2012

Figure 41: Distribution des squences dADNc de Balen et de Paal selon leurs tailles.

143

3.2.2

Estimation de la diversit molculaire

La complexit molculaire de ces jeux de squences dADNc se traduit par des courbes de rarfaction qui non seulement natteignent pas de valeurs asymptotiques et mais qui aussi ne prsentent quune trs faible inflexion visible pour le jeu de donnes de Balen (Fig. 40). 3.2.3 Analyse bioinformatique des squences dADNc et rpartition en groupes fonctionnels Toutes les squences dADNc de chaque site ont t compares, laide du serveur danalyse mtagnomique MG-RAST (http://metagenomics.nmpdr.org/), la base de donnes tel-00482109, version 2 - 29 Feb 2012 SEED (http:/www.theSEED.org) via un BLASTX. Cette analyse permet de distribuer les squences dans diffrentes catgories fonctionnelles dfinies par ce serveur. Tout dabord, une rpartition des squences dADNc suivant leur taille a t ralise (Fig. 10). Le jeu de squences de Balen est constitu de squences de plus petites tailles (420 pb en moyenne) que celui de Paal (480 pb en moyenne) (Fig. 41). Ensuite, les squences ont t classes soit en squences codant des protines annotes (de fonctions connues) dans les bases de donnes, soit en squences codant des protines hypothtiques conserves, soit en squences sans homologues dans les bases de donnes (evalue > 1e-5). Cette dernire catgorie reprsente les nouvelles protines hypothtiques potentielles identifies par lapproche mtatranscriptomique (Fig.42). Pour chacune de ces 3 catgories, des diffrences significatives ont t observes entre les deux jeux de donnes. Un nombre plus important de nouvelles protines hypothtiques est observ Balen. Cependant, au vu du plus grand nombre de squences de petites tailles contenues dans cette banque, il se peut que des squences tronques, trop courtes pour tre identifies, soient comptabilises comme de nouvelles protines hypothtiques. Enfin, les 1080 squences dADNc de Balen et les 1569 de Paal codant des protines annotes dans les bases de donnes ont t rparties dans 15 groupes fonctionnels laide du serveur MG-RAST (Fig. 43). Le nombre de squences analyses jusqu prsent a permis de mettre en vidence des diffrences significatives entre sites concernant les pourcentages de protines impliques dans la respiration, le mtabolisme des acides anims, des lipides et le mtabolisme secondaire (Fig. 43). Aucune diffrence significative concernant le nombre de protines impliques dans la rponse au stress na t observe. Toutefois, un plus grand 144

tel-00482109, version 2 - 29 Feb 2012

Figure 42: Distribution des ADNc des sites de Balen et Paal selon la nature des protines potentiellement codes. Protines annotes: protines prsentant une fonction biologique connue ; protines hypothtiques conserves: protines de fonctions inconnues dposes dans les bases de donnes ; nouvelles protines hypothtiques: ADNc sans homologues (Blastx) dans les bases de donnes publiques (e-value > 1e-5). Un test de Chi-2 comparant les proportions de chacune de ces catgories entre les 2 sols tudis a t effectu ; les valeurs numriques sont indiques en annexe. La lettre (a) signifie que la diffrence entre les 2 jeux de donnes est significative (p<0,05).

145

tel-00482109, version 2 - 29 Feb 2012

Figure 43: Rpartition des squences protiques dduites des ADNc annots au sein de groupes fonctionnels dfinis par le serveur MG-RAST. A, mtabolisme des acides nucliques ; B, mtabolisme des protines ; C, mtabolisme des acides amins et drivs ; D, mtabolisme des acides gras et des lipides ; E, mtabolisme des glucides ; F, mtabolisme secondaire ; G, autres mtabolismes (K, N, S) ; H, cofacteurs, vitamines, groupes prosthtiques, pigments ; I, trafic cellulaire ; J, contrle du cycle cellulaire ; K, respiration ; L, rponses au stress ; M, virulence ; N, paroi cellulaire ; O, autres fonctions. Un test de Chi-2 comparant les proportions de chacune de ces catgories entre les 2 sols tudis a t effectu ; les valeurs numriques sont indiques en annexe. La lettre (a) signifie que la diffrence entre les 2 jeux de donnes est significative (p<0,05). La lettre (b) signifie que la diffrence entre les 2 jeux de donnes nest pas significative (p0,05).

146

Balen
Choc froid
-Cold shock protein CspD -Cold shock protein CspC

Paal
-Cold shock protein CspE -Cold shock protein CspE -Cold shock protein CspG -Cold shock protein CspA -Aquaporin Z

Stress osmotique
-Glutathione synthetase -Glutathione S-transferase -Glutathione S-transferase -Glutathione S-transferase -Glutathione S-transferase -Glutathione S-transferase -Peroxidase -Peroxidase -Peroxidase -Peroxidase -Peroxidase -Peroxidase -Peroxidase -Peroxidase -Peroxidase -Peroxidase -Alkyl hydroperoxide reductase subunit C-like protein -Cytochrome c551 peroxidase -Cytochrome c551 peroxidase -Poly [ADP-ribose] polymerase-1 -Poly [ADP-ribose] polymerase-1 -Poly [ADP-ribose] polymerase-1 -NAD-dependent deacetylase

tel-00482109, version 2 - 29 Feb 2012

Stress oxydatif

-Superoxide dismutase [Cu-Zn] precursor -Superoxide dismutase [Cu-Zn] precursor -Superoxide dismutase [Fe] -Superoxide dismutase [Mn] -Superoxide dismutase [Mn] -Superoxide dismutase [Mn] -Catalase -Rubrerythrin -Alkyl hydroperoxide reductase subunit C-like protein -Alkyl hydroperoxide reductase subunit C-like protein -Glutathione peroxidase -5-oxoprolinase -Poly[ADP-ribose] polymerase-1

Autres

-Carbon storage regulator -Multicopper oxidase -Putative diheme cytochrome c-553 -Cytochrome c-type biogenesis protein CcmG/DsbE -Copper-translocating P-type ATPase -Ornithine aminotransferase -NG,NG-dimethylarginine dimethylaminohydrolase 1

-Arginine decarboxylase -Carbon storage regulator -Multicopper oxidase -Protein arginine N-methyltransferase 1 -FKBP-type peptidyl-prolyl cis-trans isomerase -FKBP-type peptidyl-prolyl cis-trans isomerase -FKBP-type peptidyl-prolyl cis-trans isomerase -Heat shock protein GrpE -RNA polymerase sigma factor RpoH -RNA polymerase sigma factor RpoH -Signal peptidase-like protein -RNA-binding protein Hfq -Universal stress protein family

Tableau 19: Annotation des protines codes par chacun des ADNc placs dans le groupe fonctionnel rponses au stress . Les protines de mme annotation retrouves Balen et Paal sont en rouge (Classification selon MG-RAST). 147

nombre de protines impliques dans le stress oxydant est observ Balen et la diversit de gnes exprims en rponse un stress semble diffrente au sein de chacun des sols (Tableau 19).

3.3 Criblage des banques dADNc par expression htrologue dans la levure
Les banques mtatranscriptomiques de Balen, Paal et Lommel construites dans le plasmide pFL61 ont t cribles par complmentation fonctionnelle de deux mutants de levures sensibles au cadmium. Ces mmes banques ont fait lobjet dun criblage par complmentation fonctionnelle dun mutant de levure sensible au zinc par nos partenaires nancens (Didier Doillon, Damien Blaudez et Michel Chalot ; Unit Interactions Arbrestel-00482109, version 2 - 29 Feb 2012 Microorganismes, INRA Universit Nancy1). 3.3.1 Complmentation fonctionnelle du mutant Ycf1

Le mutant Ycf1 (Mat a ; his31 ; leu20 ; met150 ; ura30; Ycf1::kanMX4) de la souche BY4741 de Saccharomyces cerevisiae est dlt du gne ycf1 codant pour un transporteur vacuolaire du glutathion de type ABC (ATP-binding cassette). Par consquent, le mutant obtenu nest plus capable de transporter le complexe glutathion-Cd du cytoplasme vers la vacuole et accumule des concentrations toxiques de Cd dans le cytoplasme. La complmentation fonctionnelle de ce mutant par la banque de Balen (1,33.108 transformants cribls, soit 38 fois la taille initiale de la banque) a conduit isoler 567 transformants sur milieu W0 + Cd (40M). Aprs re-isolement de ces transformants par stries dpuisement sur le mme milieu puis limination du plasmide par lacide 5-fluoro-orotique et test de la sensibilit au Cd des souches sur milieu W0 + Cd (40M) + uracile, 130 vrais transformants rsistants au Cd ont t conservs. Par la suite, sur la base de tests en gouttes, seulement 16 transformants se sont rvls capables de crotre au moins autant que la souche sauvage et mieux que le mutant sur le milieu slectif (Fig. 44). Enfin, aprs extraction du plasmide contenant linsert dADNc responsable de la complmentation fonctionnelle et retranformation du mutant Ycf1, le test en goutte de confirmation a aboutit la slection de 9 gnes confrant une rsistance au Cd.

148

tel-00482109, version 2 - 29 Feb 2012

Figure 44: Les diffrentes tapes de slection dun clone rsistant au mtal par complmentation fonctionnelle dun mutant de levure sensible au mtal avec une banque mtatranscriptomique eucaryote. Le transformant primaire rsistant au mtal est risol par stries dpuisement sur milieu W0 + mtal ansi que sur milieu W0 + Uracile + 5FOA afin dliminer le plasmide. 1, gne de rsistance ; 2, vecteur vide ; 3, gne de rsistance limin ; 4, souche originelle de levure sensible au mtal.

149

ADNc Ycf1
Protine hypothtique 1 Protine hypothtique 1 Protine hypothtique 1 Protine hypothtique 1

ADNc Ycf1 vs ADNc Gnoscope Balen


265

ADNc Ycf1 vs ADNc Gnoscope Paal


0

Balen

Protine hypothtique 2 Protine hypothtique 3 Protine hypothtique 4 Zn-binding alcohol dehydrogenase (bactrie) Mtallothionine (mollusque)

0 0 0 0 0

1 0 0 1 0

tel-00482109, version 2 - 29 Feb 2012

Nouvelle MT 1 Nouvelle MT 1 Nouvelle MT 1 Nouvelle MT 1 Nouvelle MT 2 Nouvelle MT 2 Nouvelle MT 2 Nouvelle MT 3 Nouvelle MT 3 Nouvelle MT 3 Nouvelle MT 4 Nouvelle MT 4 Nouvelle MT 4 Nouvelle MT 4 Nouvelle MT 4 Nouvelle MT 5 MT (champignon) 2 20 0 7

Lommel

Paal

Nouvelle MT 4

Tableau 20: Annotation des squences dADNc des banques mtatranscriptomiques de Balen, Lommel et Paal complmentant le phnotype du mutant de levure Ycf1 sensible au cadmium. Une recherche de ces squences dans les jeux de squences dADNc de Balen et de Paal fournis par le Gnoscope a t effectue laide du programme TBLASTN. MT, mtallothionine.

150

La mme dmarche exprimentale a t suivie pour les banques de Paal et de Lommel. Dans le cas de Paal, sur 8,1.105 transformants obtenus (2,7 fois la taille de la banque), 100 poussaient sur milieu slectif. A la suite des diffrents tests, seul 1 gne confrant une rsistance avre au Cd a t retenu. Pour Lommel, sur 6,1.106 transformants obtenus (1,2 fois la taille de la banque), 124 poussaient sur milieu slectif. A la suite des diffrents tests, 17 gnes confrant une rsistance avre au Cd ont t slectionns. 3.3.2 Analyse des squences dADNc restaurants le phnotype Ycf1 Les squences dADNc capables de restaurer le phnotype de sensibilit au cadmium du mutant Ycf1 ont t compares laide du programme BLASTX la base de donnes tel-00482109, version 2 - 29 Feb 2012 GenBank nr qui ne contient pas les squences dEST. Certaines squences, notamment celles ne montrant aucune homologie avec des squences connues ont ensuite t analyses laide du programme TBLASTX permettant la comparaison avec les donnes issues dEST (http://www.ncbi.nlm.nih.gov/BLAST). Une fois annotes, ces squences ont t recherches dans les jeux de squences dADNc de Balen et de Paal fournis par le Gnoscope (transforms en bases de donnes laide du programme formatdb) laide du programme TBLASTN. Lanalyse bioinformatique a montr que 7 des 9 squences dADNc obtenue partir de la banque de Balen correspondent des protines hypothtiques. Parmi ces 7 squences, 4 sont identiques entre elles et aux 265 squences formant un mme contig retrouves dans le jeu de squences dADNc de Balen fourni par le Gnoscope (cf 3.2.1). Un ADNc code la portion Cterminale dune Zn-binding alcohol dehydrogenase , retrouve une fois dans le jeu de squence dADNc de Paal. Cette portion de la protine correspond au domaine de liaison au NADP (domaine dit de NADB-Rossmann). Un autre ADNc code une protine riche en cystine (25%) pouvant correspondre une mtallothionine. Les deux squences les plus similaires correspondent une protine hypothtique de Trichomonas et une mtallothionine de mollusque (Tableau 20). Le criblage de la banque de Lommel a permis didentifier 16 squences homologues entre elles codant des protines hypothtiques riches en cystines, supposes tre de nouvelles mtallothionines (Tableau 20). Il sagit de protines de 110 132 acides amins dont 24 27 rsidus cystines. Lalignement des squences protiques a permis de rpartir ces protines en 5 sous-familles suivant le motif dessin par lenchainement de leurs rsidus cystines. Elles 151

tel-00482109, version 2 - 29 Feb 2012

Figure 45: Alignement des squences protiques hypothtiques riches en cystine obtenues lors du criblage de la banque mtatranscriptomique de Lommel par complmentation fonctionnelle du mutant de levure Ycf1 sensible au cadmium. Les protines ont t rparties en 5 familles suivant le motif dessin par lenchainement de leurs rsidus cystines Une squence protique similaire celles du motif 4 a t obtenue partir de la banque mtatranscriptomique de Paal.

152

prsentent toutes un triplet de cystine lextrmit N-terminale (Fig. 45) et lamplification de leurs squences gnomiques, partir du mtagnome de Lommel, na pas rvl la prsence dintron (Franck Lejzerowicz, communication personnelle). Toutes ces nouvelles mtallothionines ont t retrouves 7 fois dans le jeu de squences dADNc de Paal fourni par le Gnoscope. La dernire protine correspond une mtallothionine de champignon basidiomycte retrouve 2 fois dans le jeu de squences de Balen et 20 fois dans le jeu de squence de Paal (Tableau 20). Enfin, la seule squence dADNc obtenue partir de la banque de Paal correspond une des nouvelles mtallothionines (motif 4) (Fig. 45) trouves Lommel. 3.3.3 tel-00482109, version 2 - 29 Feb 2012 Complmentation fonctionnelle du mutant Yap1

Le mutant Yap1 (Mat a ; his31 ; leu20 ; met150 ; ura30 ; Yap1::kanMX4) de la souche BY4741 de Saccharomyces cerevisiae est dlt du gne yap1 codant un facteur de transcription de type bZIP (basic leucine zipper) impliqu dans la tolrance au stress oxydant. Le mutant nest donc plus capable dactiver la transcription de nombreux gnes impliqus dans la rsistance au stress oxydant tel que les thiordoxines et les peroxyrdoxines. Pour la slection de gnes de rsistance, la mme dmarche exprimentale que celle expose dans le cas du mutant Ycf1 a t suivie sauf que la concentration en cadmium utilise tait de 20 M. Dans le cas de Balen, sur 8.107 transformants obtenus (23 fois la taille de la banque), 899 poussaient sur milieu slectif. A la suite des diffrents tests, 9 gnes confrant une rsistance avre au Cd ont t retenus. Pour Paal, sur 1,4.106 transformants obtenus (4,6 fois la taille de la banque), 162 poussaient sur milieu slectif. A la suite des diffrents tests, 3 gnes confrant une rsistance avre au Cd ont t slectionns. Pour Lommel, sur 2.106 transformants obtenus (0,4 fois la taille de la banque), 158 poussaient sur milieu slectif. A la suite des diffrents tests, aucun gne confrant une rsistance avre au Cd na t slectionn.

153

ADNc Yap1
Protine hypothtique 1 Protine hypothtique 2 Protine hypothtique 3

ADNc Yap1 vs ADNc Gnoscope Balen


0 0 0 42 0 1 33

ADNc Yap1 vs ADNc Gnoscope Paal


0 0 0 10 0 2 1

Balen

Protine hypothtique 4 Protine hypothtique 5 HSP 12 (champignon) HSP 12 (champignon) Saccharopine deshydrogenase (animal) Saccharopine deshydrogenase (animal) Proteine hypothtique 6

tel-00482109, version 2 - 29 Feb 2012

0 8 6

0 5 3

Paal

Protine ribosomale 40S S15 (champignon) Protine ribosomale 60S L3 (plante)

Tableau 21: Annotation des squences dADNc des banques mtatranscriptomiques de Balen, et Paal complmentant le phnotype du mutant de levure Yap1 sensible au cadmium. Une recherche de ces squences dans les jeux de squences dADNc de Balen et de Paal fournis par le Gnoscope a t effectue laide du programme TBLASTN. HSP, Heat Shock Protein.

154

3.3.4

Analyse des squences dADNc restaurants le phnotype Yap1

Comme prcdemment, les squences dADNc capables de restaurer le phnotype de sensibilit au cadmium du mutant Yap1 ont t annotes et recherches dans les jeux de squences dADNc de Balen et de Paal fournis par le Gnoscope. Les squences obtenues par criblage de la banque de Balen correspondent 5 protines hypothtiques diffrentes, 2 saccharopine dshydrogenase dorigine animale identiques et 2 HSP12 (Heat Shock Protein) fongiques identiques. Pour les HSP12 et les saccharopine dshydrogenase les ADNc apparaissent pleine longueur. Certaines de ces squences contiennent des homologues dans les jeux de squences dADNc de Balen et de Paal (Tableau 21). Cest le cas notamment de la protine hypothtique 4 prsente 42 fois dans le jeu de tel-00482109, version 2 - 29 Feb 2012 squence de Balen et 10 fois dans celui de Paal. Cependant, ce groupe de squences identiques ne dfini pas un contig avec les paramtres dassemblage utiliss. En revanche, la saccharopine dshydrogenase est identique aux 33 squences formant un mme contig retrouves dans le jeu de squences dADNc de Balen (cf 2.2.1). Le criblage de la banque de Paal a permis didentifier une protine hypothtique, une protine ribosomale de champignon et une protine ribosomale de plante (Tableau 21). Ces deux dernires protines ont t retrouves plusieurs fois dans les 2 jeux de squences dADNc fournis par le Gnoscope mais ces groupes de squences ne dfinissent pas de contigs avec les paramtres utiliss.

3.4 Conclusions
La construction de banques mtatranscriptomiques et lanalyse de plusieurs milliers de squences dADNc par squenage massif a permis de montrer: que 50 60% des protines codes par ces squences ne prsentent aucuns homologues dans les bases de donnes publiques que les profils de rpartition des protines annotes en groupes fonctionnels sont relativement semblables entre ces sols. Le criblage fonctionnel de banques mtatranscriptomiques par expression htrologue dans des mutants de levure sensibles aux mtaux lourds a permis de montrer :

155

que cette approche permet de dcouvrir de nouvelles protines impliques dans la rsistance aux mtaux que ces nouvelles protines peuvent avoir une fonction connue (MTs, HSP) ou inconnue (saccharopine deshydrogenase, protines hypothtiques) dans la rsistance aux mtaux

que les protines confrant une rsistance aux mtaux peuvent tre prsentent en plusieurs exemplaires dans les banques mtatranscriptomiques que lapproche fonctionnelle permet de slectionner des gnes confrant une rsistance au Cd aussi bien de sols contamins que non contamins par ce mtal.

4. Discussion
tel-00482109, version 2 - 29 Feb 2012 Ltude du mtatranscriptome ou lanalyse des gnes exprims par une communaut dorganismes permet de se rendre compte de ltat physiologique global dans lequel se trouve cette communaut un instant prcis. Sur la base de ce postulat, nous avons entrepris de rvler et danalyser lensemble des gnes exprims par une communaut de microorganismes eucaryotes colonisant un sol contamin aux mtaux lourds (site de Balen) et de les comparer ceux exprims par une communaut de microorganismes eucaryotes colonisant un sol non contamin (site de Paal) ou anciennement contamin (site de Lommel). La construction de banques de gnes environnementaux est soumise diffrents biais lis aux tapes dchantillonnage et dextraction des acides nucliques. Ces biais, propres aux tudes in situ, affectent la reprsentativit des organismes rellement prsents dans un chantillon environnemental. Lchantillonnage du sol sur les sites de Balen, Paal et Lommel a t effectu en 20 points de prlvement sur une surface denviron 40m2. Afin dtre reprsentatif de la diversit biologique prsente et pour dtecter dventuelles espces rares, une grande quantit de sol a t rcupre en chaque point dchantillonnage. Dans le cas dtude molculaire des microorganismes du sol, il est ncessaire de limiter lchantillonnage des macroorganismes (animaux et vgtaux), susceptibles de contaminer les banques de gnes, par un tamisage du sol 2 mm. Toutefois, la contamination de nos jeux de squences par des squences de plantes suprieures et danimaux prouve que de fines racines de plantes (Pinus sylvestris) et des reprsentants de la micro-msofaune des sols (nmatodes, annlides, collemboles,

156

acariens) sont tout de mme capables de passer travers le tamis. Un tamisage plus fin serait ncessaire, mais il engendrerait une plus forte perturbation du sol capable de modifier la composition et le profil dexpression de gnes de la communaut de microorganismes. Enfin, un moyen de limiter la modification du profil dexpression de gnes de la communaut de microorganismes entre lchantillonnage et lextraction des acides nucliques a t deffectuer rapidement une conglation du sol dans de lazote liquide et un stockage -70C. Dautres mthodes comme la lyophilisation du sol et un stockage -20C ou une conglation -80C dans du glycrol sont galement appropries (Sessitsch et al., 2002). Tous les sols ont t prlevs, tamiss, congels et stocks de la mme faon et le plus rapidement possible afin de limiter les biais lis lchantillonnage. Les chantillons de sols congels ont ensuite t rapidement utiliss pour lextraction des acides nucliques des organismes prsents. De nombreuses tudes ont mis en vidence tel-00482109, version 2 - 29 Feb 2012 une corrlation entre la mthode dextraction utilise et la composition de la communaut microbienne rvle, indpendamment des proprits (physico-chimiques, couvert vgtal) du sol tudi et du rendement dextraction obtenu (Martin-Laurent et al., 2001; Sessitsch et al., 2002; Sagova-Mareckova et al., 2008). Ces observations concernent uniquement les bactries et on peut supposer quelles ne sappliquent pas aux microorganismes eucaryotes de plus grande taille et donc plus facilement exposs aux mthodes de lyse cellulaire. De plus, le protocole dextraction utilis dans notre tude (Bailly et al., 2007) fait intervenir deux tapes de broyage dont une sec dans de lazote liquide reconnue pour casser plus efficacement les membranes cellulaires des organismes prsents (Sessitsch et al., 2002). Enfin, cette mthode dextraction a t employe sur plusieurs centaines de grammes de sols (400g pour Paal et Lommel et 250g pour Balen) afin de limiter les biais lis la distribution htrogne des microorganismes dans les sols et dinclure un plus grand nombre dorganismes prsents en faible densit dans les sols, notamment la msofaune. Cette mthode dextraction reproductible et adaptable diffrents types de sols (cf Chapitre 1) a permis la co-extraction des ADN et des ARN partir de nos 3 sols et la construction de banques ribosomiques dADNr et dARNr 18S et de banques dADNc environnementales. Lanalyse de la petite sous unit ribosomique 18S permet de dcrire la diversit des microorganismes eucaryotes dans diffrents environnements. Ces dernires annes, cette approche a notamment t utilise pour rvler la diversit des protistes dans les eaux douces et marines ainsi que dans des sdiments (par exemple, Lopez-Garcia et al., 2001; Dawson et 157

Pace, 2002; Stoeck et al., 2003). Cependant, peu dtudes ont t menes afin destimer la diversit taxinomique de lensemble des microorganismes eucaryotes dans les sols (Lawley et al., 2004; Tringe et al., 2005 ;Moon-van der Staay et al., 2006; Lesaulnier et al., 2008). Ces rares tudes ont montr que lemploi damorces universelles eucaryotes permet didentifier tous les groupes, y compris les plantes et les mtazoaires et pas seulement les microorganismes. Des profils daffiliation taxinomiques variables ont ainsi pu tre obtenus pour chaque sol. La diversit taxinomique eucaryote prsente dans les chantillons de sols prlevs sur les sites de Balen, Paal et Lommel a t value par lanalyse dune ou deux portions du gne codant la petite sous unit ribosomique 18S amplifies par PCR partir de lADN et de lARN environnemental. Le faible pourcentage de squences chimriques (compris entre 0,25 et 1%) dtectes tel-00482109, version 2 - 29 Feb 2012 dans ces diffrentes banques assure de leur bonne qualit. La gnration de tels artfacts, souvent infrieur 10% (Richards et al., 2005; Nikolaev et al., 2006), a certainement t limite en utilisant un faible nombre de cycles damplification et en ralisant plusieurs PCR indpendantes pour la construction de chacune de ces banques. La dtection de ces squences chimriques laide du logiciel Check chimera reste nanmoins trs dlicate et parfois subjective. Il nest pas exclure que dans notre tude, ainsi que dans dautres, certaines chimres soient passes inaperues. A limage des rsultats du chapitre 1, les banques ribosomiques du premier tiers du 18S comprennent des squences de tous les phylums eucaryotes avec une nette dominance des opisthokontes (champignons et animaux). Toutes les squences animales sont affilies des groupes taxinomiques typiques de la micro et de la mso-faune (nmatodes, acariens, collemboles) alors que les squences de basidiomyctes et dascomyctes dominent les squences fongiques comme cela a dj t observ dans les forts tempres (O'Brien et al., 2005). Pour les groupes de protistes , les squences damoebozoa, dalveolata et de rhizaria (exclusivement reprsent par les cercozoa) sont mieux reprsentes que les squences dheterokonta et dexcavata. Concernant les squences du derniers tiers du 18S, une rpartition taxinomique relativement similaire est observe sauf pour le phylum des metazoa. La quasi disparition des squences animales dans ce jeu de donnes tend vrifier lhypothse mise dans dautres tudes quant lutilisation de plusieurs jeu damorces PCR pour recouvrir compltement la diversit des communauts eucaryotes (Stoeck et al., 2006; Jeon et al., 2008).

158

Par ailleurs, mmes si les profils taxinomiques sont relativement semblables entre les diffrents sols quelle que soit la portion du gne 18S analyse (Fig. 31 et 33), des diffrences significatives dabondance de certains phylums entre sites dtude existent. Dautres paramtres, tels que la faible redondance des phylotypes entre sol (Fig 32 et 34) et les valeurs des estimateurs de richesse spcifique (Tableau 14, 15 et 16), indiquent que ces sols abritent des communauts dorganismes eucaryotes diffrentes et que celle du sol contamin aux mtaux lourds (site de Balen) est relativement plus diversifie. Les rares tudes sintressant aux communauts de microorganismes eucaryotes dans des environnements pollus (Amaral Zettler et al., 2002; Aguilera et al., 2006) font tat dune diversit inattendue. Dautres tudes, sintressant des organismes eucaryotes, ont mis en vidence une augmentation de la diversit suite une pollution. Une hypothse plausible serait que la disparition dorganismes majoritaires et sensibles la pollution favorise la colonisation du milieu par une diversit plus tel-00482109, version 2 - 29 Feb 2012 importante dorganismes rsistants. Notre tude reprsente la premire analyse comparative de communaut de microorganismes eucaryotes prsente dans un sol pollu et dans un sol non pollu. Enfin, des diffrences significatives existent entre labondance des squences dADNr et dARNr rparties dans un mme phylum (Fig.35). En cologie microbienne, il est admis que les ARNr dcrivent mieux la diversit des organismes mtaboliquement actifs dans une communaut (Muttray et Mohn, 1999; Mills et al., 2005). Cependant, chez les eucaryotes, le nombre de copies du gne codant lARNr 18S est trs variable entre taxons, tout comme le nombre de noyaux par unit de cytoplasme. Par consquent, afin de mieux dcrire lactivit physiologique des microorganismes eucaryotes, une comparaison des proportions relatives en ADNr 18S, en ARNr 18S et en ADNc de chaque phylum sera effectue une fois le squenage alatoire des banques mtatranscriptomiques termin (cf chapitre 1). Par ailleurs, la faible redondance entre les jeux de squences dADNr et dARNr (Tableau 13) ainsi que la forme des courbes de rarfactions qui natteignent pas de plateaux (Fig. 36) indique que des efforts de squenage supplmentaires combins lutilisation damorces PCR spcifiques certains groupes taxinomiques sont ncessaires pour dcrire compltement la diversit des communauts de microorganismes eucaryotes prsente dans ces 3 sols. Une autre faon dtudier des communauts de microorganismes dans leur environnement est dutiliser lapproche mtatranscriptomique. Cette approche, base sur lanalyse des gnes exprims par lensemble dune communaut dorganismes, a rcemment t dveloppe pour ltude de la structure et de la fonction de communauts bactriennes 159

dans des eaux marines (Poretsky et al., 2005; Frias-Lopez et al., 2008; Gilbert et al., 2008; Poretsky et al., 2009) et dans les sols (Leininger et al., 2006; Urich et al., 2008). Les rsultats obtenus dans ces tudes ont permis de mettre en vidence les fonctions effectues par les organismes actifs dune communaut et de dtecter une diversit de nouveaux gnes susceptibles de coder de nouvelles fonctions. Cette technologie a galement t dvelopper afin de dcrire spcifiquement des communauts de microorganismes eucaryotes dans des boues actives (Grant et al., 2006) et dans un sol forestier (Bailly et al., 2007).. Les banques mtatranscriptomiques construites partir de nos 3 sols ont t analyses suivant deux approches. Dune part, par une approche base sur le squenage alatoire des banques du sol contamin aux mtaux lourds (site de Balen) et du sol non contamin (site de Paal) et dautre part, par une approche base sur le criblage fonctionnel de nos 3 banques dans un hte htrologue eucaryote. tel-00482109, version 2 - 29 Feb 2012 Les donnes partielles du squenage des banques de Balen et de Paal ont t obtenues au cours de la rdaction de ce manuscrit. Lanalyse de ces rsultats est incomplte et nos observations sont prendre au conditionnel. Dans un premier temps, la plus ou moins forte redondance contenue dans chaque jeu de squences (3,5% pour Paal et 24% pour Balen) et la forme des courbes de rarfactions indiquent que le sol non contamin (site de Paal) abriterait une plus grande diversit molculaire que le sol contamin aux mtaux lourds (site de Balen). Toutefois, la taille variable des squences contenues dans chaque banque, en moyenne plus petite pour le sol de Balen (420 pb contre 480 pb pour Paal) peut tre lorigine de cette diffrence. En effet, la mthode de construction de nos banques, faisant intervenir une tape de clonage, est soumise un biais li la dgradation des ARNm et un clonage prfrentiel des petits inserts dADNc. Rcemment, de nouvelles technologies de squenage, dtes de pyrosquenage (par exemple, 454 de Roche, SOLEXA de Illumina et SOLiD3 de ABI) ont vu le jour et permettent le squenage direct d'ADN ou dADNc sans aucune tape de clonage (Medini et al., 2008). Ces technologies permettent aussi daugmenter considrablement le nombre de paires de base squences par run et de diminuer le cot par base squence Ensuite, le fort pourcentage de squences dADNc sans homologues dans les bases de donnes, avoisinant les 60% dans les deux banques, montre que cette approche est susceptible didentifier de nouvelles protines hypothtiques (Fig. 42). L encore, il se peut que des squences tronques, trop courtes pour tre identifies, soient comptabilises comme de nouvelles protines hypothtiques. En effet, les tudes mtatranscriptomiques menes chez les procaryotes et les eucaryotes dans les sols et les boues actives rvlent un pourcentage de 160

squences sans homologues denviron 20% (Grant et al., 2006; Bailly et al., 2007; Urich et al., 2008). De mme, notre annotation manuelle de jeux de squences plus limits (cf Chapitre 1) conduisait un pourcentage de nouvelles squences bien infrieur (de lordre de 30%). A loppos, les banques mtatranscriptomiques construites partir deau marine montrent contiennent entre 50 et 90% de nouvelles squences hypothtiques (Frias-Lopez et al., 2008; Gilbert et al., 2008; Poretsky et al., 2009). Enfin, la rpartition des squences codant des protines de fonctions connues en catgories fonctionnelles indiquent que les communauts prsentent dans les 2 sols ont un profil dexpression gnique relativement identique (Fig. 43). On saperoit cependant que des diffrences existent quant la diversit et labondance de fonctions exprimes lintrieur dune mme catgorie fonctionnelle. Par exemple, au sein de la catgorie fonctionnelle rponses aux stress une abondance et une diversit plus importante de gnes impliqus tel-00482109, version 2 - 29 Feb 2012 dans la rponse au stress oxydant est observe pour le sol contamin aux mtaux lourds (Tableau 19) alors quaucune diffrence significative nest observe entre le jeu de donnes de Balen et de Paal lorsque lon considre cette catgorie de faon globale. Le faible nombre de squences analys, pour linstant, ne permet pas dmettre dhypothses quant aux diffrences de fonctions exprimes entre une communaut de microorganismes eucaryotes colonisant un sol contamin aux mtaux lourds et celle dun sol non contamin. Lanalyse de 20.000 inserts dADNc supplmentaires pour chaque sol est venir. Ces deux banques mtatranscriptomiques ainsi que celle du sol anciennement contamin (site de Lommel) ont galement t exploites par criblage fonctionnel dans la levure Saccharomyces cerevisiae. Cette approche originale, dveloppe dans lquipe, avait permis la complmentation fonctionnelle dun mutant de levure auxotrophe pour lhistidine par une banque dEST environnementales (Bailly et al., 2007). Cette technique avait dj t employe chez les procaryotes par exemple pour la complmentation dune souche dE. coli dficiente pour un transporteur Na+/H+ avec une banque mtagnomique de sol. Cela avait conduit identifier deux nouveaux gnes codant des transporteurs Na+/H+ partir dune banque contenant 1.480.000 clones (Majernik et al., 2001). Le criblage fonctionnel de nos banques a permis de slectionner des gnes capables de complmenter le phnotype de sensibilit au cadmium de deux mutants de levures (Ycf1 et Yap1). Les gnes de rsistance au cadmium ont t obtenus des frquences variables suivant la banque crible et le mutant utilis. Pour aucun des deux mutants utiliss nous navons isol de gnes homologues Ycf1 ou Yap1. 161

La complmentation du phnotype sensible du mutant Ycf1 a conduit isoler majoritairement des protines riches en rsidus cystine nommes mtallothionines. Les mtallothionines sont des peptides de faible masse molculaire (25 60 acides amins) issus de la traduction dun ARN messager (Cobbett et Goldsbrough, 2002). Elles sont riches en cystine et chlatent les ions mtalliques par coordination avec les thiolates. Par consquent, laccumulation des ions cadmium dans le cytoplasme du mutant Ycf1, suite labsence de transport du complexe glutathion-Cd dans la vacuole, est neutralise par lexpression constitutive de ces protines via le vecteur dans lequel la banque dADNc a t construite. Lapproche utilise a permis disoler une mtallothionine fongique (Lommel), une mtallothionine potentiellement apparente celle de mollusques (Balen) et une nouvelle potentielle famille de mtallothionines dcrites par 17 nouvelles squences se rpartissant en 5 sous-familles (Lommel et Paal). En effet, ces nouvelles mtallothionines, classes en tel-00482109, version 2 - 29 Feb 2012 diffrentes sous-familles sur la base de leur squence protique et plus particulirement suivant le motif dessin par larrangement de leurs rsidus cystine, ne sapparentent aucune famille de mtallothionines dcrites dans les bases de donnes. Toutefois, des caractristiques communes avec la seule famille de mtallothionines de protistes (dcrite exclusivement chez des Cilis du genre Tetrahymena) comme leurs grandes tailles (entre 110 et 132 acides amins dont 24 27 rsidus cystines), la prsence dun triplet de cystines leur extrmit N-terminale et labsence dintrons dans leurs squences gnomiques (Franck Lejzerowicz, communication personnelle) permettent davancer lhypothse dune affiliation un groupe de Cilis de ces protines. Deux autres catgories de protines ont pu tre identifies suite au criblage de la banque de Balen. Il sagit dune Zn-binding alcohol dehydrogenase et plus particulirement de sa portion C-terminale correspondant au domaine de liaison au NADP (domaine dit de NADBRossmann). Le NADP est un coenzyme doxydorduction impliqu dans la rgulation du stress oxydant. Il est notamment connu pour tre impliqu dans le fonctionnement de la glutathion rductase responsable de la rduction du glutathion oxyd en glutathion rduit via loxydation du NADPH en NADP. On peut donc supposer que lexpression de cette protine tronque et sa fixation au NADP entraine une diminution de la concentration cytoplasmique en NADP et dplace lquilibre NADP/NADPH. Ce dplacement dquilibre entraine alors une augmentation de loxydation du NADPH en NADP via laction, notamment, de la glutathion rductase et la rduction du glutathion impliqu dans la chlation du Cd. La dernire catgorie de protines identifies par le criblage de la banque de Balen dans le mutant Ycf1 est constitue de 7 protines hypothtiques. Parmi ces 7 squences, 4 sont 162

identiques entre elles et aux 265 squences formant un mme contig retrouves dans le jeu de squences dADNc de Balen fourni par le Gnoscope. Notre approche a permis disoler de nouvelles protines impliques dans la rsistance aux mtaux et qui, pour certaine, semble tre surexprimes par la communaut de microorganismes eucaryotes colonisant un sol contamin par des mtaux lourds. Le criblage des banques par complmentation fonctionnelle du mutant Yap1 a permis didentifier un ensemble de protines plus divers. Il sagit dune part de protines HSP12 (Balen) dorigine fongique connues pour jouer un rle dans le maintien de lintgrit de la membrane plasmique de S. cerevisiae lors dun stress oxydant (Shamrock et Lindsey, 2008) et dautre part, de protines ribosomales (Paal) dont la surexpression chez le champignon basidiomycte Ganoderma lucidum lors dun traitement au Cd a rcemment t dmontre (Chuang et al., 2009). La surexpression de la protine ribosomale L10a de Chlamydomonas tel-00482109, version 2 - 29 Feb 2012 dans la souche Yap1 de S. cerevisiae conduit aussi une meilleure rsistance au stress oxydant par stimulation de la synthse de pigments carotnodes (Mendez-Alvarez et al., 2000). Ce crible a galement permis didentifier 2 saccharopine dshydrognase dorigine potentiellement animale impliques dans la synthse et/ou la dgradation de la lysine via loxydation du NADH en NAD et/ou la rduction du NAD en NADH. Des analyses supplmentaires permettront de mieux caractriser le rle de cette protine dans la rponse au stress oxydant. Par ailleurs, les inserts dADNc codant ces saccharopine dshydrognase sont homologues entre eux et aux 33 squences formant un mme contig retrouves dans le jeu de squences dADNc de Balen. Il semblerait donc que ces protines soient surexprimes par la communaut de microorganismes eucaryotes colonisant un sol contamin par des mtaux lourds. Enfin, comme pour Ycf1, le criblage des banques de Paal et de Balen a permis disoler 6 protines hypothtiques diffrentes susceptibles de coder de nouvelles protines impliques dans la rsistance aux mtaux. Des analyses supplmentaires seront ralises afin de mieux caractriser le rle de ces protines. Lidentification de diffrentes protines de rsistance au cadmium par complmentation fonctionnelle de mutants de levures sensibles ce mtal avec des banques mtatranscriptomiques de sol contamin, anciennement contamin et non contamin au cadmium montre quune diversit de mcanisme de rsistance existe au sein des communauts qui colonisent ces sols et quune capacit rsister aux mtaux prexiste dans un sol non contamin. Des analyses supplmentaires permettront de vrifier la spcificit de 163

ces mcanismes vis--vis du cadmium. Enfin, cette approche semble ouvrir des perspectives intressantes quant son utilisation pour la dtection de gnes dintrt en biotechnologie.

tel-00482109, version 2 - 29 Feb 2012

164

tel-00482109, version 2 - 29 Feb 2012

Conclusions et

Perspectives

165

Le sol est un des environnements sur Terre abritant la plus grande diversit de microorganismes (Torsvik et Ovreas, 2002). Depuis une trentaine danne, de nombreuses tudes dcologie microbienne se sont intresses vouloir identifier les communauts bactriennes du sol et comprendre leurs interactions avec leur environnement sans toutefois prendre en compte toute la diversit de microorganismes eucaryotes prsente. Depuis quelques annes seulement, des tudes de phylognie molculaire ont montr quune norme diversit deucaryotes existe sur Terre et estiment que le sol, encore trs peu tudi par rapport aux environnements aquatiques, recle une diversit cryptique considrable. Notre tude a eu pour objectifs de rvler et danalyser in situ la diversit et les fonctions exprimes par lensemble dune communaut de microorganismes eucaryotes colonisant un sol contamin aux mtaux lourds et des sols tmoins anciennement contamin et non contamin. Ce travail ne sest pas limit pas la seule tude dune ou plusieurs espces tel-00482109, version 2 - 29 Feb 2012 modles mais a permis de mettre en vidence une grande partie de la diversit des microorganismes eucaryotes dun sol, connus ou inconnus, cultivables ou non cultivables. Ltude de la diversit taxinomique via lanalyse du gne codant la petite sous-unit ribosomique 18S montre quun sol contamin semble abriter une diversit de microorganismes eucaryotes plus importante quun sol non contamin de mme origine gologique ou quun sol forestier plus riche en matire organique. Par ailleurs, mme si la diversit eucaryote prsente dans ces diffrents sols na pas t compltement dcrite, tous les phylums deucaryotes connus y ont t identifis et de potentiels nouveaux groupes taxinomiques y ont t rvl. Cela a t confirm par une analyse phylogntique dun ensemble de squences issues de diffrents sols et deaux douces. Celles-ci dcrivent un nouveau clade de microorganismes eucaryotes appartenant au groupe des Cercozoa (Rhizaria) (cf Chapitre 2). Enfin, il semble que notre perception de la diversit des microorganismes eucaryotes dans lenvironnement soit biaise par la nature de la squence nuclique analyse (cf Chapitre 1) voire mme de la portion du gne cible (cf Chapitre 3). La diversit fonctionnelle de ces mmes communauts de microorganismes eucaryotes t entrevue par une approche originale base sur ltude de leur mtatranscriptome (cf Chapitre 3). Une analyse comparative partielle et encore incomplte du squenage alatoire de banques dADNc dun sol contamin et non contamin aux mtaux lourds rvle lexistence dune grande diversit molculaire. La majorit des gnes exprims par les microorganismes prsents dans ces sols semble avoir une fonction inconnue et la classification des gnes annots en catgories fonctionnelles ne permet pas, pour le moment, de constater un effet significatif de la pollution mtallique sur la diversit et labondance des 166

fonctions exprimes par ces communauts. Le criblage de ces banques par complmentation fonctionnelle de mutants de levures sensibles au cadmium a permis de dcouvrir de nouvelles protines impliques dans la rsistance aux mtaux. Aussi bien des protines hypothtiques de fonctions inconnues que des protines de fonctions connues pour tre directement (mtallothionines, HSP) ou indirectement (saccharopine dshydrogenase, protines ribosomales) impliques dans la rsistance au cadmium ont t identifies par cette mthode partir des sols contamin et non contamin aux mtaux lourds.. Tous ces rsultats dmontrent lintrt de lapproche mtatranscriptomique tant pour ltude des cosystmes et la comprhension des interactions entre les microorganismes et leur environnement que pour la comprhension de processus fondamentaux tels que les mcanismes cellulaires permettant une rsistance aux mtaux lourds. Une autre voie dintrt tel-00482109, version 2 - 29 Feb 2012 est ltude du mtatranscriptome pour la recherche de nouveaux biocatalyseurs et molcules actives. De nombreuses perspectives immdiates et long terme sont donc envisageables. En termes de perspectives, dans un premier temps, le donnes partielles de squenage seront complts rapidement par plusieurs milliers de squences supplmentaires et seront analyses avec des outils bioinformatiques et statistiques plus adapts que ceux utiliss jusqu prsent. Ceci permettra daffiner la classification fonctionnelle des protines identifies et surtout deffectuer une affiliation taxinomique chacune dentre elles. La structure et la fonction dune communaut de microorganismes eucaryotes colonisant un sol contamin et non contamin aux mtaux lourds pourront alors tre compares. Nos analyses prliminaires suggrent toutefois que le jeu de donnes de squences dADNc puisse tre trop limit pour aboutir une analyse fonctionnelle des communauts. Des mthodes de squenage trs haut dbit devraient tre utilises pour rpondre ce problme. Dans cette optique, des analyses complmentaires de diversit et de phylognie molculaire seront effectues sur les jeux de donnes dADN et dARN ribosomiques prsentes dans le chapitre 3. La construction darbres phylogntiques sera ralise pour chaque phylum partir des squences des diffrentes portions du gne 18S. De plus, la comparaison dautres paramtres, comme par exemple les indices de Shannon ou le nombre de phylotypes majoritaires, permettront de formuler de nouvelles hypothses quant limpact des mtaux lourds sur la structure dune communaut dorganismes eucaryotes. Les gnes de rsistance isols par le criblage fonctionnel des banques mtatranscriptomique dans des mutants de levures sensibles au cadmium seront compars 167

ceux obtenus, par nos partenaires de Nancy, par le criblage fonctionnel de ces mmes banques dans un mutant de levure sensible au zinc. Leur capacit de rsistance sera teste avec des concentrations plus importantes en mtal. Des tests croiss, avec diffrents mtaux (Cd, Zn, Cu et Co) ainsi quavec un agent oxydant (mnadione), seront raliss afin de vrifier lventuelle spcificit des mcanismes de rsistance vis--vis dun mtal. Dans un second temps, il sera intressant de mieux caractriser la fonction de ces gnes de rsistance par des tests biochimiques plus pousss afin de comprendre le mode daction des diffrentes protines codes. Par ailleurs, le dessin damorces spcifiques partir des squences de ces gnes permettra deffectuer une recherche des copies gnomiques de ces gnes et de leurs squences promotrices par marche chromosomique partir de lADN mtagnomique extrait des sols. Lobtention de telles squences permettra dexprimer ces tel-00482109, version 2 - 29 Feb 2012 gnes dans dautres htes eucaryotes htrologues et de rvler leur mode de rgulation transcriptionnel en rponse un stress mtallique ou oxydant. Nos banques de gnes pourront galement tre cribles par complmentation fonctionnelle de levures mutes pour dautres phnotypes comme par exemple la rsistance la dessiccation ou par expression htrologue chez la levure dans le but didentifier de nouvelles enzymes dintrts. Les jeux de donnes fournis par le Gnoscope pourront aussi faire lobjet dune recherche de nouveaux membres de familles de gnes connues pour participer la dtoxication des mtaux par une approche bioinformatique ou par PCR laide damorces appropries obtenues partir de rgions conserves de gnes connus. Enfin, la diversit taxinomique des microorganismes eucaryotes prsents dans ces sols pourra tre mieux value avec lutilisation de plusieurs jeux damorces universelles ou groupes spcifiques, comme cela a t ralis avec succs au sein du laboratoire pour le groupe des foraminifres (Franck Lejzerowicz, communication personnelle). A limage de ltude de phylognie ralise dans le chapitre 2, des amorces spcifiques pourront galement tre dessines partir de squences divergentes affilies certains phylums, comme les Amoebozoa.

168

tel-00482109, version 2 - 29 Feb 2012

Matriels et

Mthodes

169

Site

pH dans leau 4,68 4,66 5,79

CEC % (mq/kg) Humidit 26 25 3,45 4,8 4 8,7

Carbone (C) Organique (g/ kg) 1,75 9,2 17,9

Azote (N) total (g/kg) 0,0719 0,4 0,932

C/N

MO (g/kg) 4,9 15,8 30,9

Paal Lommel Balen

24,3 20 19,2

Tableau 22: Analyses physico-chimiques des sols prlevs en novembre 2006 et juin 2008. (CEC : Capacit dEchange Cationique ; MO : Matire Organique)

tel-00482109, version 2 - 29 Feb 2012

170

Vgtaux et Lichens Agrostis capillaris Betula sp. Campylopus introflexus Campylopus sp. Cladonia sp. Quercus petraea Pinus sylvestris Polytrichum piliferum Populus nigra

Champignons Amanita muscaria Laccaria sp Lactarius mommensus Lactarius rufus Leccinum sp. Paxillus involutus Scleroderma sp. Xerocomus badius

Paal

tel-00482109, version 2 - 29 Feb 2012

Lommel

Agrostis capillaris Algues vertes Betula sp. Cladonia sp. Deschampsia flexuosa Pinus sylvestris Polytrichum piliferum

Amanita muscaria Amanita rubescens Boletus edulis Laccaria bicolor Laccaria sp. Lactarius rufus Paxillus involutus Scleroderma sp. Suillus bovinus Suillus luteus

Balen

Betula sp. Bromus mollis Bryum sp. Cerastium sp. Ceratodon sp. Holcus lanatus Pinus sylvestris Pleuridiuma acuminatum Rumex acetosella Rumex crispus Rumex scutatus Senecio jacoboea

Hebeloma sp.

Tableau 23: Inventaire des espces vgtales et fongiques identifis visuellement sur les sites de Paal, Lommel et Balen.

171

1. Sols tudis
Les chantillons de sols ont t prlevs dans le nord-est de la Belgique (Province du Limbourg) sur les sites de Lommel Sahara (LS, 51 14 N, 5 15 E), de Paal (PZ, 51 04 N, 5 10 E) et de Balen (BA, 51 10 N, 5 10 E). Il sagit de sols sableux, pauvres en matire organique sur lesquels se dveloppent des pins sylvestres (Pinus sylvestris) et quelques bouleaux (Betula sp.). Le site de Lommel Sahara, rebois en 1975, a t contamin par des mtaux lourds disperss par une ancienne fonderie de zinc (Vangronsveld et al., 1995). Le site de Balen est contamin par des mtaux lourds disperss par une fonderie de zinc, toujours en activit, et est utilis comme site pilote pour des tudes de phytormdiation (van der Lelie et al., 2001). Les prlvements ont t effectus, en novembre 2006 pour les sites LS et PZ et en juin tel-00482109, version 2 - 29 Feb 2012 2008 pour le site BA, en 20 points diffrents de chaque site sur une profondeur de 20 cm et sur 5 cm de diamtre. Les chantillons de sols dun mme site ont t runis et tamiss 2 mm, puis congels dans de lazote liquide et stocks -70C. Les dosages du Zn, du Cd et du Pb ont t raliss par ICP-MS (Inductively Coupled Plasma-Mass Spectrometry) (Trassy et Mermet, 1984) pour chaque point dchantillonnage afin de dterminer leur concentration totale (Fig. 46, 47 et 48) et leur concentration disponible environnementale (soluble dans leau) (Fig. 46, 47 et 48). Leur dosage dans les aiguilles de pins prsents sur ces sites et situs proximit des points dchantillonnage permet de dterminer leur biodisponibilit (Fig. 46, 47 et 48). Le pool des chantillons de sols de chaque site a fait lobjet dune analyse physicochimique (Tableau 22). De plus, tous les carpophores de champignons ainsi que les vgtaux prsents ont t ramasss pour une identification visuelle (Tableau 23) et stocks dans un tampon dextraction pour des analyses molculaires ultrieures.

2. Extraction des acides nucliques


Les extractions ont t ralises sur un minimum de 200g de sol pour chacun des sites (450g pour LS, 450g pour PZ et 200g pour BA). Les sols ont t broys 3 min dans un broyeur de roche en agate pralablement congel -70C. Un gramme de sol est alors plac dans un tube Eppendorf de 2 mL contenant 0,5 g de billes de verre (diamtre 0,1 mm), x L de solution dnaturante (guanidine isothiocyanate 4 M, Tris-HCl 10 mM, Na2EDTA 1mM, pH 8,0), y L de tampon de lyse (Tris-HCl 100 mM,

172

Concentration en zinc (ppm)

250 200 150 100 50 0 50 40 30 20 10 0,007 0 140 120 100 80 60 40 20 0 PZ LS Sites BA 40,498 39,961 0,208 16,926 29,185

197,21

Concentration en zinc (ppm)

tel-00482109, version 2 - 29 Feb 2012

35,193

Concentration en zinc (ppm)

105,04

Figure 46: Dosage du zinc total (A), disponible (B) et biodisponible (C) prsent dans les chantillons de sols (A et B) et daiguilles de pins (C) prlevs en novembre 2006 et juin 2008 sur les sites de Paal (PZ), Lommel (LS) et Balen (BA).

173

Concentration en cadmium (ppm)

5 4 3 2 1 0 0 0

4,42

Concentration en cadmium (ppm)

1 0,8 0,6 0,4 0,2 0 0 0

0,705

tel-00482109, version 2 - 29 Feb 2012

Concentration en cadmium (ppm)

2,45

C
2

1,843

0,925 1

0 PZ LS Sites BA

Figure 47: Dosage du cadmium total (A), disponible (B) et biodisponible (C) prsent dans les chantillons de sols (A et B) et daiguilles de pins (C) prlevs en novembre 2006 et juin 2008 sur les sites de Paal (PZ), Lommel (LS) et Balen (BA).

174

Concentration en plomb (ppm)

200

A
150 100 50 7,925 0 0,25 0,2 0,15 0,1 0,05 0 87,855

152,89

Concentration en plomb (ppm)

0,171

tel-00482109, version 2 - 29 Feb 2012

Concentration en plomb (ppm)

10 8 6 3,396 4 2 0 0 PZ LS Sites BA

6,91

Figure 48: Dosage du plomb total (A), disponible (B) et biodisponible (C) prsent dans les chantillons de sols (A et B) et daiguilles de pins (C) prlevs en novembre 2006 et juin 2008 sur les sites de Paal (PZ), Lommel (LS) et Balen (BA).

175

Na2EDTA 20 mM, NaCl 100 mM, SDS 2%, pH 9,0), 50 L de -mercaptothanol et 4 L dARNt de levure 10 mg.mL-1. Les quantits de SDS et de guanidine isothiocyanate ont t optimises pour chacun des sols (cf Chapitre 1). Le mlange est agit 5 min dans un broyeur Mikro Dismembrator U (B.Braun Biotech International) 1600 agitations.min-1, puis centrifug 5 min 15000 rpm et 4C. Au surnageant est ajout 1 mL de phnol acide (pH 5,0) / CHCl3 / alcool isoamylique (25/24/1 ; vol/vol/vol). Le mlange est agit 1 min au vortex vitesse maximale, puis centrifug 10 min 15000 rpm et 4C. Cette extraction est ralise 2 fois. Aprs transfert de la phase aqueuse dans un nouveau tube, 250 L de CHCl3 / alcool isoamylique (24/1 ; vol/vol) sont ajouts et le mlange est agit manuellement, puis centrifug 10 min 15000 rpm et 4C. A la phase aqueuse sont ajouts 0,1 vol dactate de sodium 3M (pH 5,2) et 2,5 vol dthanol absolu afin de prcipiter les acides nucliques. Aprs une incubation de 20 30 min tel-00482109, version 2 - 29 Feb 2012 70C, le mlange est centrifug 15 min 15000 rpm et 4C. Le culot dacides nucliques est repris dans 40 L deau RNase-free et 65 L de LiCl 4M afin de prcipiter slectivement les ARN. Aprs une nuit 4C, les ARN sont prcipits aprs une centrifugation de 15 min 15000 rpm et les ADN contenus dans le surnageant sont prcipits lthanol et repris dans 100L dH2O UP. Le culot dARN est trait la DNase (7 L de DNase RNase-free (Fermentas) 1 U.L-1 + 2 L de tampon + 11 L dH2O RNase-free) pendant 1h30 37C. Les ARN sont prcipits dans 2 vol disopropanol, centrifugs 8 min 15000 rpm et lavs par 1 vol dthanol 70%. Lextrait brut dARN est sch sous vide puis repris dans 20 50 L deau RNase-free. Une tape de purification supplmentaire sur micro-colonne contenant du Sephadex G-50 (ProbeQuant, Amersham) a t ralise pour les extraits dARN et dADN issus du sol pollu de Balen. Cent L dextrait sont dposs sur la colonne. Lluat obtenu est prcipit par 0,1 vol dactate de sodium 3M (pH 5,2) et 2,5 vol dthanol absolu, lav lthanol 70%, sch et repris dans 20 50 L deau RNase-free. Le kit dextraction RNA Power Soil (Mobio) a galement t utilis pour une partie des chantillons de sol prlevs sur le site pollu. Les ADN et les ARN obtenus aprs extraction sont quantifis par mesure de leur absorbance 260 nm au spectrophotomtre Nanodrop (Fig. 49). Une unit dabsorbance correspond 40 g dARN et 50 g dADN dans 1 ml (Sambrook et al., 1989). La mesure du rapport dabsorbance DO260
nm /

DO280

nm

permet dapprcier le degr de contamination par des

protines. Des rapports gaux 1,8 pour les ADN et des rapports compris entre 1,8 et 2 pour les ARN indiquent labsence de contaminations. 176

4
16S bactrien 18S eucaryote 26+28S marqueur impurets? 16S bactrien 18S eucaryote 26+28S

tel-00482109, version 2 - 29 Feb 2012

marqueur

impurets?

5
16S marqueur marqueur 26S

6
28S 18S

Figure 49: Spectres dabsorbance (1-2) et profils lectrophortiques (3-6) des solutions dARN extraits du sol de Paal (1 et 3) et du sol de Lommel (2 et 4). Les profils 5 et 6 correspondent respectivement aux ARN extraits de souches pures dE. coli et du champignon H. cylindrosporum.

177

ARN totaux

tel-00482109, version 2 - 29 Feb 2012

Homognisation

ARN totaux et billes magntiques

Fixation des ARNm


TTTTTTTTTTTT AAAAAAAAAAAAA-mRNA

lution

TTTTTTTTTTTT

ET
AAAAAAAAAAAAA-mRNA

ARN ribosomiques

Figure 5: Principe de la mthode de purification des ARNm Eucaryotes partir des ARN totaux par lutilisation des billes magntiques (Dynabeads Oligo (dT); Dynal). Les ARNm peuvent shybrider sur les billes magntiques qui pourront tre retenues par un aimant permettant ainsi la purification des ARNm aprs diffrents lavages.

178

La qualit et la quantit dARN ont galement t apprcies aprs sparation par lectrophorse capillaire (Agilent RNA 6000 Nano Kit, Agilent Technologies) (Fig. 49). Les ARN sont marqus par un fluorophore (RNA Nano Dye Concentrate) et sont spars suivant leur taille par lectrophorse au travers dun rseau de capillaires interconnects et remplis dune matrice de polyacrylamide. Le profil obtenu permet notamment de dterminer un rapport entre ARNr 16S procaryotes et ARNr 18S eucaryotes ainsi que la concentration en ARN total.

3. Hybridation des ARNm eucaryotes polyadnyls sur billes magntiques-dT25


tel-00482109, version 2 - 29 Feb 2012 Le volume de lextrait dARN total est rduit 100 L par vaporation sous vide (Speedvac). Les ARN totaux sont mlangs 100 L dune suspension de billes paramagntiques, recouvertes doligo-dT25 dans une solution de concentration saline leve selon le protocole prconis par le fabriquant (Dynabeads mRNA Purification kit, Dynal Biotech) (Fig. 50). Aprs hybridation des ARNm aux oligo-dT , les billes sont attires contre la paroi du tube par un aimant et les ARN non polyadnyls rests en solution sont prlevs et prcipits par 2 vol disopropanol pendant 15 min 4C. Aprs une centrifugation de 15 min 15000 rpm et 4C, le culot dARN non polyadnyls est lav lthanol 70% et repris dans 50 L deau ultra pure RNase-free. Les ARNm polyadnyls sont ensuite lus des billes par 20 L deau ultra pure RNase-free 65-80C pendant 2 min.

4. Transcription inverse des ARNr


Cinq cent ng dARNr sont prlevs et mlangs soit 2L damorce eucaryote universelle Euk 516 ou SB (tableau 24) 10 M, soit 1 L dhexanuclotides alatoires 10M. Le mlange est complt 11 L avec de leau, puis chauff 70C pendant 5 min et immdiatement plac dans la glace. En parallle, un milieu ractionnel est prpar en mlangeant : 4 L de tampon M-MuLV RT concentr 5X (Fermentas) ; 2 L de dNTP 2 mM ; 0,5 L de Ribolock RNase Inhibitor 40 U.L-1 (Fermentas) ; 0,5 L deau ultra pure RNase free et 2 L de BSA 5 mg.mL-1. Ce mlange est plac 25C pendant 5 min puis 1 L denzyme RevertAid M-MuLV RT 200 U.L-1 est ajout. Neuf L de ce milieu ractionnel sont mlangs aux 11 L dchantillon dARNr et ce mlange est plac 10 min 179

25C, puis 1h30 42C et enfin 10 min 72C pour arrter la raction. Les ADNc sont ensuite conservs 20C. Pour chaque extrait dARNr de chacun des sols, un minimum de 3 ractions indpendantes ont t runies.

5. Amplification par PCR des ADNr 18S partir de lADN de sol et des ARN de sol rtrotranscrits
Le couple damorces Euk516/Euk1A (Tableau 24) permet damplifier un fragment denviron 500 pb situ en 5 de la squence du gne 18S des ADNr de tous les eucaryotes (Fig. 51). Le couple damorces S12.2/SB (Tableau 24) permet damplifier un fragment denviron tel-00482109, version 2 - 29 Feb 2012 700 pb situ en 3 de la squence du gne 18S des ADNr de tous les eucaryotes (Fig. 51). Le couple damorces 18F/18R (Tableau 24) permet damplifier un fragment denviron 1800 pb soit la totalit du gne 18S des ADNr de tous les eucaryotes (Fig. 51). Le milieu ractionnel (25 L) est compos de : 14,9 L deau ; 2,5 L de tampon PCR concentr 10X (Tris-HCl 200 mM pH 8 ; KCl 500 mM) (Invitrogen) ; 0,75 L de MgCl2 25 mM; 1,25 L de solution dtergente W 1% (Invitrogen) ; 1,75 L de dNTP (Fermentas) 2 mM ; 0,5 L dun couple damorces 10 M ; 1,25 L de BSA 5 mg.mL-1 et 0,1 L de Taq-DNA polymrase recombinante 5 U.L-1 (Invitrogen). Ce milieu ractionnel, additionn de 2 L dextrait brut ou purifi dADN mtagnomique (10 20 ng) ou de 2 L dARNr rtrotranscrits, est plac dans un thermocycleur PTC-200 et subit le programme suivant : une dnaturation initiale de 5min 95C suivie de 25 cycles damplification composs chacun dune dnaturation de 45 sec 95C, dune hybridation de 1 min 56C et dune longation de 45 sec 72C. Le programme sachve par une longation finale de 10 min 72C. La taille des amplifiats obtenus est vrifie par lectrophorse sur gel dagarose 1%. Pour chaque extrait dADNr ou dARNr rtrotranscrit de chacun des sols, un minimum de huit amplifications indpendantes ont t runies. Les fragments dintrts sont dcoups du gel et purifis laide du kit dextraction sur gel Qiaquick (Qiagen).

6. Purification de fragments dADN sur gel dagarose


Lextraction dADN de gels dagarose a t ralise laide du kit QIAquick Gel extraction de Qiagen selon le protocole du fournisseur. La bande dagarose contenant le 180

Squences cibles 18S 18S 18S

Amorces Euk1A Euk516 S12.2 SB 18F 18R

Squences nuclotidiques des amorces 5-CTGGTTGATCCTGCCAG-3 5-ACCAGACTTGCCCTCC-3 5-GATYAGATACCGTCGTAGTC -3 5TGATCCTTCTGCAGGTTCACCTAC3 5-ACCTGGTTGATCCTGCCAG-3 5-TGATCCTTCYGCAGGTTCAC-3

Tm (C) 56 56 56

Rfrences Diez et al., 2001 Pawlowski, 2000 Moon-van der Staay et al., 2001

Tableau 24: Squences des amorces PCR utilises pour lamplification du gne 18S. tel-00482109, version 2 - 29 Feb 2012

18 S
Euk1A 18F

5,8
S12.2

28 S

18 S
Euk516 SB 18R

Figure 51: Reprsentation schmatique de lADN ribosomique eucaryote et du positionnement des amorces utilises pour lamplification du gne 18S.

181

fragment dADN extraire est rcupre dans un tube Eppendorf de 2ml. 3 volumes de tampon QG sont ajouts au volume de la bande prleve et le mlange est incub 10 min 50C. Lchantillon est ensuite pass sur une colonne de purification selon le protocole du fournisseur. Aprs avoir lav la colonne avec le tampon QG et PE, lADN est lu par 50 l deau ultra-pure strile. Lluat est prcipit par 0,1 volume de Na Actate (3M pH 4,8) et 2,5 volumes dthanol absolu -70C pendant 30 min, puis est repris dans 15 l deau ultra-pure strile. LADN est quantifi par dosage spectrophotomtrique 260 nm au Nanodrop.

7. Banques dADN et dARN ribosomiques


7.1 Banque dADN ribosomiques
tel-00482109, version 2 - 29 Feb 2012 Les fragments de 500 et 700 pb issus des 8 rptitions indpendantes de PCR et purifis ont t utiliss pour construire les deux banques dADN ribosomiques des Eucaryotes dans le vecteur plasmidique pCR4Blunt-TOPO (Invitrogen). La ligation a t ralise en prsence de 1 l dinsert (30 ng/l), 1 l de solution saline, et 1 l de vecteur (10 ng/l) dans un volume ractionnel final de 6 l. Le mlange ractionnel est homognis et incub 30 min temprature ambiante. La dure dincubation est choisie en fonction de la taille des produits PCR et de leur nombre. Un L du mlange de ligation est ajout 25 l de cellules lectrocomptentes dE. coli DH10B-T1R (Invitrogen). Aprs un choc lectrique de 2000 volts, 1 mL de milieu SOC liquide (Annexe) sont ajouts dans les tubes pralablement refroidis dans la glace. Les cellules sont alors incubes 1 heure 37C. La totalit des cellules est tale sur boites de milieu LB solide (Annexe) contenant de la kanamycine (50 g/ml) et du X-Gal (80 mg/mL).

7.2 Banque dARN ribosomiques


Les fragments de 500 et 700 pb issus des 8 rptitions indpendantes de PCR et purifis ont t utiliss pour construire les deux banques dARN ribosomique des Eucaryotes dans le vecteur plasmidique pCR4Blunt-TOPO comme dcrit ci-dessus.

182

5
Synthse du 1er brin SMART IV oligonuclotide (Sfi A) 5 GGG Hybridation

Poly A+ RNA

polyA 3 CDS III Primer (Sfi B)

CCC

polyA 3

Hybride ADN/ARN

tel-00482109, version 2 - 29 Feb 2012

GGG CCC

polyA 3

cDNA pleine longueur

Digestion par Sfi1 Sfi A ATTA TAAT Sfi B GCCT CGGA cDNA contenant les sites Sfi A et Sfi B

Banque dADNc dans le plasmide pDNR

Figure 52: Principe de la technique damplification des ADNc pleine longueur avec le kit SMART (Clontech). Cette technique permet dobtenir des ADNc pleine longueur tout en partant dune quantit infime de matriel. Les ARNm ont t purifis sur billes magntiques recouvertes dOligo(dT). Les ARNm ont t convertis en ADNc simple brin en utilisant la technologie SMART. Les ADNc sont ensuite amplifis par LD-PCR (PCR longue distance). Les ADNc pleine longueur sont digrs par lenzyme Sfi1. La cration de sites asymtriques de part et dautre de lADNc permet de raliser un clonage directionnel dans un vecteur dexpression.

183

8. Banques dADN complmentaires


8.1 Obtention des ADNc
Les ADNc ont t synthtiss en utilisant le kit SMART (Clontech). Cette technologie, base sur une tape de reverse transcription puis des tapes damplification par PCR, a t conue afin dobtenir des ADNc double brin pleine longueur tout en partant dune quantit infime dARNm (Fig. 52). Environ 300 ng dARNm purifis par affinit sur billes magntiques recouvertes doligo (dT) repris dans 3 l deau UP strile sont mlangs 1 l doligonuclotides SMART IV et 1 l damorce CDS III/ 3. Lchantillon est dnatur 2 min 72C et 2 min dans la glace. Sont ensuite ajouts 2 l de tampon appropri, 1 l de DTT, 1 tel-00482109, version 2 - 29 Feb 2012 mM de chaque nuclotide (dATP, dCTP, dGTP, dTTP) et 1 l de PowerScript Reverse Transcriptase. La synthse de cDNA lieu pendant 60 min 42C. La raction est stoppe par le froid (5 min dans la glace). 2 l de la raction de reverse transcription ont t utiliss pour amplifier les ADN complmentaires par PCR longue distance (LD-PCR). Lamplification a t effectue dans un volume final de 100 l en prsence de 10 l du tampon appropri (10X Advantage 2 PCR buffer), 2 l de "5 PCR Primer", 2 l de "CDS III/ 3 PCR Primer", 200 M de chaque nuclotide (dATP, dCTP, dGTP, dTTP), et une unit de DNA polymrase (50X Advantage 2 Polymerase Mix). Aprs une dnaturation initiale de 1 min 95C, lamplification comprend 18 26 cycles du programme suivant : 15s de dnaturation 95C et 6 min dlongation 68C. 50 l des ADNc amplifis sont digrs par 2 l de Protinase K (20 g/l) pendant 20 min 45C afin dinactiver la DNA polymrase. Aprs deux extractions au phnol/SEVAG et une prcipitation au Na actate/ thanol absolu, le culot dADNc est repris dans 79 l deau UP strile. Les ADNc sont ensuite digrs par 10 l denzyme SfiI dans du tampon appropri en prsence de BSA pendant 2 h 50C. Ensuite les ADN complmentaires sont fractionns sur une colonne (CHROMA SPIN-400 ; Clontech). Seules les 4 fractions contenant des fragments suprieurs 400 pb ont t collectes et regroupes. Aprs prcipitation de ces 4 fractions par 0,1 volume de Na actate (3 M ; pH 4,8) et 2,5 volumes dthanol absolu, 14 l dADNc bords chacune des sites Sfi1A & 1B ont t obtenus. La cration de sites SfiI asymtriques de part et dautre de lADNc permet de raliser un clonage directionnel dans un vecteur dexpression de levure pFL61 dans lequel 2 sites de restriction Sfi IA et B ont t

184

Not Sfi A Xho Pst Sfi B Not 5-GGCCGCATGGCCATTACGGCCAGAGCTCGAGAGCTGCAGAGCTGGCCGCCTCGGCCAGC-3 Sfi1PFL Sfi2PFL 3-CGTACCGGTAATGCCGGTCTCGAGCT CTCGACGTCTCGACCGGCGGAGCCGGTCGCCGG-5

Not1

PGK5'

PGK3'

pFL61 modifi
Ampicilline

URA3

5479 bps

tel-00482109, version 2 - 29 Feb 2012

OriC

Figure 53: Carte de restriction du plasmide pFL61 modifi par insertion des squences hybrides Sfi2PFL/Sfi1PFL dans un site Not1. OriC, origine de rplication pour la multiplication dans E. coli ; 2, origine de rplication du plasmide 2 de S. cerevisiae ; Ampicilline, marqueur de slection pour le maintien du plasmide dans E. coli ; URA3, marqueur de slection pour le maintien du plasmide dans S. cerevisiae ; PGK5, PGK3, squences promotrice et terminatrice de la phosphoglycrokinase de S. cerevisiae.

Plasmides pFL61 pDNR pCR4Blunt-TOPO

Amorces PFLU PFLR M13-21 M13-Rev M13-20 M13-Rev

Squences nuclotidiques des amorces 5-CAGCTTCCAATTTCGTCACA-3 5-AAATACGCTGAACCCGAACA-3 5-TGTAAAACGACGGCCAGT-3 5'-CAGGAAACAGCTATGACC-3' 5'-GTAAAACGACGGCCAG-3' 5'-CAGGAAACAGCTATGACC-3'

Tm(C) 60 55 55

Tableau 25: Squences des amorces PCR utilises pour lamplification des inserts contenu dans les plasmides pFL61, pDNR et pCR4Blunt-TOPO. 185

introduits entre le promoteur et le terminateur du gne codant pour la phosphoglycrate kinase (PGK) (Fig. 53).

8.2 Construction des banques dADNc


Les ligations des inserts (ADNc) aux vecteurs linaires pDNR-LIB ou pFL61 (linariss par lenzyme Sfi I) ont t ralises 15C pendant 12 heures dans 0,5 l de tampon de ligation ; 0,5 l dATP et 1 U de T4-DNA ligase (Ozyme) dans un volume total de 5 l. Pour chaque ligation, 100 ng de vecteur sont utiliss et la quantit dinsert est dtermine afin dobtenir un rapport molaire insert/vecteur de 1:3. Les banques ont t propages dans E. coli DH10B"T1R (de gnotype : F- mcrA (mrrhsdRMS-mcrBC) 80lacZ M15 lacX74 recA1 endA1 araD139 (ara, leu)7697 galU galK tel-00482109, version 2 - 29 Feb 2012 rpsL nupG tonA ). Pour les banques dADNc construites dans pFL61, les bactries ont t tales sur milieu slectif raison de ca 65 c.f.u./cm2. Aprs croissance 37C, les clones ont t rcuprs dans du milieu LB par grattage et runis afin dextraire leurs plasmides par maxi-prparation (cf partie 10.2)

9. Mthodes molculaires appliques Escherichia coli


9.1 Bactries chimio-comptentes et transformation
La souche utilise pour la transformation est la souche dE. coli DH5 (Invitrogen) chimiquement comptente. LADN plasmidique est mlang 100 l de suspension de bactries comptentes. Aprs une incubation de 10 min 4C, les tubes sont placs 5 min 37C puis 1 ml de milieu LB liquide (Annexe) est ajout. Ce mlange est alors incub 1 heure 37C. Les transformants sont slectionns sur milieu LB contenant lantibiotique appropri (Ampicilline 100g/mL ou Kanamycine 50g/mL) et du X-Gal 40 g.ml-1 si le vecteur contient le gne de la -galactosidase.

186

9.2 Bactries lectrocomptentes et transformation


La souche utilise pour la transformation par lectroporation est la souche dE. coli ElectroMAX DH10B ou DH10B"T1R (Invitrogen). Pour transformer les bactries, 100 200 ng dADN plasmidique contenus dans un volume de 1-2 l sont ajouts 20 l de cellules lectrocomptentes. Les cuvettes dlectroporation striles (1mm) sont refroidies sur la glace. Aprs mlange, la cuvette est place dans un lectroporateur (Eppendorf). Un courant de 2000 volts est alors appliqu et les cellules sont remises rapidement dans un tube froid strile auquel est ajout 1 ml de milieu SOC liquide (Annexe). Les cellules sont alors incubes 1 h 37C. Diffrentes quantits de cellules (de 50 200 l) sont ensuite tales sur un milieu slectif appropri. tel-00482109, version 2 - 29 Feb 2012

10. Extraction et purification dADN plasmidique bactrien


10.1 Purification rapide de plasmides :"Mini-prparations"
Les colonnes NucleoSpin Plasmid de Macherey-Nagel permettent dobtenir rapidement de lordre de quelques g dADN plasmidique super-enroul sous une forme pure. Les bactries contenant le plasmide sont cultives 12 heures 37C dans 5 ml de milieu LB contenant lantibiotique appropri. Elles sont ensuite centrifuges 10 min 4C 10 000 rpm. Le culot est repris dans 250 l de tampon A1 (Tris-HCl 50 mM pH 8 ; Na2EDTA 10 mM ; RNase A 100 g.ml-1). 250 l de tampon A2 (NaOH 200 mM ; SDS 1%) sont ajouts et le mlange est laiss 5 min temprature ambiante. Aprs laddition de 350 l de tampon A3 (KOAc 3M pH 5,5), la suspension est centrifuge 10 min 15 000 rpm. Le surnageant est rapidement dpos sur colonne NucleoSpin. La colonne est lave par 500 l de tampon AW prchauff 50C, puis par 600 l de tampon A4. LADN est lu par 50 l deau ultra-pure strile puis quantifi.

187

10.2 Purification de plasmides :"Maxi prparations"


Les bactries contenant les banques dADNc dans le plasmide pFL61 ont t grattes et runies dans 250 mL de milieu LB. Aprs 1-2 h 37C, les cellules sont centrifuges 10 min 4C 6000 rpm. Le culot est resuspendue dans 20 mL de Minilysat 1X (Glc 50mM, EDTA 10mM, Tris pH8 25mM). Aprs homognisation, 40 mL dune solution de NaOH 0,2M et SDS 1% sont ajouts et le mlange est remu doucement laide dune baguette en verre. 30 mL de K Actate (3M pH 4,8) sont ajouts et le mlange est laiss 10 30 min dans la glace. Aprs incubation, la suspension est centrifuge 25 min 4C 10000 rpm et le surnageant est filtr laide dun entonnoir et dun filtre papier. LADN est ensuite prcipit avec 60 mL disopropanol pendant 10 30 min temprature ambiante, puis centrifug 30 min 10000 rpm et repris dans 3 mL de TE pH 8. tel-00482109, version 2 - 29 Feb 2012 Aprs une extraction au phnol/SEVAG, lADN est prcipit par 0,1 volume de Na Actate (3M pH 4,8) et 2,5 volumes dthanol absolu -70C pendant 30 min. Le culot dADN est rinc lthanol 70%, sch puis repris dans de leau ultra-pure strile.

10.3 Modification du plasmide pFL61


Le plasmide pFL61 (Minet et al., 1992) (plasmide se multipliant dans la levure et dans E. coli) (Fig. 53) a t modifi par incorporation de sites Sfi1 A et B dans son site de clonage au niveau du site Not1 en aval du promoteur PGK afin de permettre lexpression constitutive, dans la levure, des ADNc prsentant des sites Sfi A et B leurs extrmits gnres par le kit SMART cDNA Library Construction (Clontech). Le vecteur de clonage pFL61 est linaris par digestion enzymatique laide de lenzyme de restriction Not1. Aprs une extraction au phnol/SEVAG, lADN est prcipit par 0,1 volume de Na Actate (3M pH 4,8) et 2,5 volumes dthanol absolu -70C pendant 30 min. Le culot dADN est rinc lthanol 70%, sch puis repris dans de leau ultra-pure strile. Cent ng (0,028 pmole) du plasmide pFL61 digr par lenzyme de restriction Not ont t ligus une nuit 4C 2,8 pmoles des oligonuclotides SfipFL1 et SfipFL2 (Fig. 53) hybrids sur eux-mmes (chauffs 1 min 70C puis refroidis temprature ambiante) en prsence de 1L de ligase du phage T4 3 U.L-1 (Fermentas) dans du tampon de ligation 10X.

188

La souche comptente E. coli DH5 a t transforme par 1 L de mlange de ligation et tale sur milieu glos LB + Amp (100 g.mL-1). Une amplification par PCR de la zone de clonage a t ralise avec les amorces PFLU et PFLR (Tableau 25) pour dtecter la prsence de la squence hybride SfipFL1/SfipFL2 qui contient les sites Sfi A et Sfi B. Linsertion correcte des sites Sfi a t vrifie par squenage.

11. Analyse bioinformatique des squences dADNr et dARNr 18S


Toutes les squences ont t compares aux donnes de la banque nr de Genebank (http://www.ncbi.nlm.nih.gov/) laide du logiciel BLASTn. Seule les squences prsentant tel-00482109, version 2 - 29 Feb 2012 des homologies sur toute leur longueur avec des gnes dADNr 18S rpertoris ont t conserves. En parallle, toutes les squences ont t analyses par le logiciel Check Chimera (http: //rdp8.cme.msu.edu/cgis/chimera.cgi ?su=SSU) afin didentifier les ventuelles squences chimres artfactuelles gnres lors de la PCR. Des squences dorganismes de rfrences reprsentatifs de la diversit des grands rgnes eucaryotes (champignons, protistes) ont t ajoutes la suite des squences slectionnes et cet ensemble de squences t align laide du logiciel dalignement CLUSTALW (http://www.ebi.ac.uk/). Lalignement ainsi gnr a servi de base pour gnrer des arbres phylogntiques laide du logiciel PhyloWin en utilisant le modle Neighbour Joining et les p-distances. Les courbes de rarfaction ont t construites avec laide du logiciel Analytical rarefaction 1.3 de S. Holland (http://www.uga.edu/strata/software/). Les estimateurs SChao1 et SACE, tous deux bass sur labondance des taxons, ont t choisis pour estimer la richesse spcifique dun sol partir dun chantillon de celui-ci. Ils ont t calculs grce au logiciel dvelopp par Kemp et Aller (http://www.also.org/lomethods/free/2004/0114a.html).

12. Analyses statistiques


Actuellement SChao1 et SACE sont les deux estimateurs les plus couramment utiliss afin destimer la richesse des banques ribosomiques 16S et 18S. Ces mthodes estiment la richesse spcifique (nombre total de phylotypes) dun chantillon environnemental de petite taille sans prsupposer de modles dabondance particuliers. Elles sont bases sur des mthodes

189

statistiques de Mark-Release-Recapture (MRR) initialement utilises pour estimer la taille des populations animales. Ces approches considrent la proportion des phylotypes observs plus dune fois ( recaptured ) par rapport celle des phylotypes observes une seule fois ( singletons ). Ainsi, plus la diversit est faible, plus la probabilit de dtecter plusieurs fois le mme phylotype est leve. Lestimateur SChao1 (Chao, 1984) bas uniquement sur les phylotypes apparaissant 1 ou 2 fois se traduit par lquation suivante :

On dsignera par Sobs le nombre de phylotypes observes dans la banque tel-00482109, version 2 - 29 Feb 2012 ribosomique, et par F1 et F2 le nombre de phylotypes apparaissant une ou deux fois. Lestimateur SACE se traduit par lquation suivante :

On dsignera par F1 le nombre de phylotypes apparaissant seulement une fois dans la banque ribosomique, par Srare le nombre de phylotypes apparaissant au maximum 10 fois et par Sabund le nombre de phylotypes apparaissant plus de 10 fois dans la banque ribosomique. ACE2 est un coefficient de variation de F1. ACE est un estimateur du taux de couverture de lchantillon.

13.

Levures

13.1 Souches utilises


Les cellules de levures utilises appartiennent lespce Saccharomyces cerevisiae et sont issues de la souche BY4741 (Mat a ; his31 ; leu20 ; met150 ; ura30).

190

13.1.1 Souches sensibles au cadmium Les souches sensibles au cadmium utilises sont Yap1 (Mat a ; his31 ; leu20 ; met150 ; ura30 ; YML007wp::kanMX4) et Ycf1 (Mat a ; his31 ; leu20 ; met150 ; ura30; YDR135c::kanMX4). Le gne yap1 code pour un facteur de transcription de type bZIP (basic leucine zipper) impliqu dans la tolrance au stress oxydant. Il est activ par le peroxyde dhydrogne (H2O2) qui induit plusieurs tapes de formation de ponts disulfures. Ce facteur transite alors du cytoplasme vers le noyau et active la transcription de nombreux gnes impliqus dans la rsistance au stress oxydant tel que les thiordoxines et les peroxyrdoxines. Le gne ycf1 code pour un transporteur vacuolaire du glutathion de type ABC (ATPbinding cassette). Il joue un rle dans la dtoxification de mtaux tel que le cadmium en tel-00482109, version 2 - 29 Feb 2012 transportant le complexe glutathion-Cd du cytoplasme vers la vacuole. 13.1.2 Souche sensible au zinc La souches sensible au zinc utilise est Zrc1 (Mat a ; his31 ; leu20 ; met150 ; ura30 ; YMR243c::kanMX4). Le gne zrc1 code pour un transporteur tonoplastique du zinc. Il transporte le zinc du cytoplasme vers la vacuole o il est stock.

13.2 Milieux de cultures


Les cellules de levures sont cultives 30C. Elles sont entretenues sur un milieu complet YPG (Annexe 1). La slection des cellules de levures transformes avec le plasmide pFL61 modifi est effectue sur un milieu minimum W0 (0,67% de Yeast Nitrogen Base , 2% de glucose) complment par une solution dacides amins (Annexe 1) de ladnine 1% et de la tyrosine 5%. Ce milieu est dpourvu duracile (marqueur de slection). Les tests de complmentation fonctionnelle des mutants de levures sensibles aux mtaux sont raliss sur un milieu minimum W0 complment en acides amins et en adnine et supplment par du CdCl2 (20M pour Yap1, 40M pour Ycf1) ou de ZnSO4 (17,5 mM pour Zrc1). Il sagit du milieu slectif.

191

Pour confirmer que le phnotype de rsistance rsulte bien du gne port sur le plasmide, ce dernier est limin en inoculant les transformants sur un milieu W0 complment en acides amins, en adnine, en uracile et en acide 5-fluoro-orotique (FOA). Lacide 5-fluoro-orotique est un analogue structural dun mtabolite ncessaire la synthse de luracile. Son ajout dans le milieu de culture conduit la synthse du 5-fluoro-uracile qui est capable de sincorpor dans lARN, dinduire une transcription errone et donc de provoquer larrt du cycle cellulaire. Les cellules vont donc utiliser luracile prsent dans le milieu et rejeter leur plasmide.

13.3 Transformation de Saccharomyces cerevisiae.


13.3.1 Mthode TRAFO adapte tel-00482109, version 2 - 29 Feb 2012 Les cellules sont pr-cultives dans 5 mL de milieu complet YPG 28C pendant deux trois jours. Cinquante L de cette prculture sont utiliss pour inoculer 50 mL de milieu YPG et sont placs pendant une nuit sous agitation 150 rpm 28C jusqu lobtention denviron 107 cellules/mL (DO 600 = 1-2). Aprs une centrifugation de 5 min 3000 rpm, les cellules sont laves par 25 mL deau ultrapure strile, puis reprises dans 1mL deau et rparties dans 10 tubes eppendorf raison de 100L par tube. Les cellules sont centrifugs 30 sec 6000 rpm, les surnageants sont limins et les culots sont repris dans 360L dun mlange contenant : 240L de PEG 3350 50%, 36 L de tampon lithium actate (actate de lithium pH 7,5 0,1 M), 100g dADN de sperme de saumon et 500ng dADN plasmidique (banque ADNc). Aprs homognisation et incubation 42C pendant 40 min, les cellules sont centrifuges 30 sec 6000 rpm et reprises dans 1 mL de YPG. Le mlange est plac 30C pendant 4h, puis centrifug et repris dans 1mL deau ultrapure strile. Les cellules sont tales sur un milieu slectif appropri. 13.3.2 Slection des transformants rsistants aux mtaux Les transformants sont slectionns aprs 3-4 jours de culture 30C sur un milieu slectif appropri, puis re-isols par stries dpuisement sur le mme milieu slectif et cultivs pendant 3 jours 30C. Le plasmide est alors limin du transformant par culture sur milieu supplment en acide 5-fluoro-orotique. Aprs 3 jours de croissance 30C, les cellules sont

192

dilution 1 DO600nm = 1 tmoin BY4741 tmoin YAP ou ZRC transformant A transformant B transformant C transformant D transformant E transformant F 2 DO600nm = 0.1 3 DO600nm = 0.01 4 DO600nm = 0.001 5 DO600nm = 0.0001 6 7 DO600nm = 1

dilution 8 DO600nm = 0.1 9 DO600nm = 0.01 10 DO600nm = 0.001 11 DO600nm = 0.0001 12

A B C D E F G H

transformant G transformant H transformant I transformant J transformant K transformant L transformant M transformant N

tel-00482109, version 2 - 29 Feb 2012

Figure 54: Schma dune microplaque 96 puits dans laquelle sont ralises les dilutions en cascade de chaque culture de vrais transformants de S. cerevisiae.

composition du mlange nombre de clones extraire solution 1 5 10 20 30 40 50 0,75 mL 1,5 mL 3 mL 4,5 mL 6 mL 7,5 mL Zymolyase 9,75 L 19,5 L 39 L 58,5 L 78 L 97,5 L

Tableau 26: Volumes de solution 1 et denzyme Zymolyase ajouter lors de la purification de plasmide de levure avec le kit Zymoprep Yeast Plasmid Extract1 (Zymo Research).

193

places sur un milieu W0 complment en acides amins, en adnine, en uracile et supplment par le mtal dintrt. A ce stade, les cellules qui ne repoussent pas sont considres comme de vrai transformants. 13.3.3 Tests en gouttes Une pr-culture de chaque vrai transformant est ralise dans 5 mL de milieu minimum (supplment en uracile pour les souches sans plasmide) pendant 24h 30C. La DO 600nm est ajuste 1, puis 200L de culture sont dposs dans une microplaque 96 puits strile. Des dilutions au 1/10me en cascades sont ensuite ralises (Fig. 54). 5 L de chaque dilution sont dposs sur un milieu slectif glos (avec ou sans uracile) et sont incubs 30C pendant 3 5 jours. Deux rptitions sont effectues pour chaque tel-00482109, version 2 - 29 Feb 2012 transformant.

13.4 Purification des plasmides de levures


LADN total est extrait des cellules de levures puis utilis pour transformer des cellules lectrocomptentes de E. coli afin de rcuprer le plasmide contenu dans la levure. Les cellules sont cultives dans 5mL dun milieu slectif appropri pendant 48h 28C. Aprs une centrifugation de 5 min 3000rpm, temprature ambiante, le culot est lav par 500L deau strile ultrapure, puis dans 200L de tampon de lyse (2% Triton X100 ; 1% SDS ; 100mM NaCl ; 10 mM Tris-HCl pH 8 ; 1mM Na2EDTA). 200L dun mlange phnol/ chloroforme/ alcool isoamylique sont ajouts et les cellules sont fortement agites au vortex pendant 5 min en prsence de 0,3g de billes de verre de diamtre 0,5mm. Les cellules sont nouveau fortement agites au vortex aprs lajout dune solution de TE (10mM TrisHCl pH 8 ; 1 mM Na2EDTA pH 8). Aprs une centrifugation de 3 min 13000 rpm temprature ambiante, les acides nucliques sont prcipits par 1 mL dthanol absolu. Le culot repris dans 400L de TE pH 8 en prsence de 3 L de RnaseA (10mg/mL) est digr pendant 5 min 37C. Aprs une re-prcipitation avec 40L de Na Actate 3M pH 5,2 et 1 mL dthanol absolu, le culot est lav, sch puis repris dans 20 L de TE pH 8. LADN total peut galement tre extrait avec le kit Zymoprep Yeast Plasmid Extract1 (Zymo Research). Les cellules sont cultives dans 5mL dun milieu slectif

194

appropri pendant 48h 28C. Aprs centrifugation de 1 mL de culture 11000 rpm pendant 2 min, le culot est repris dans 150 L dun mlange de solution 1 et denzyme zymolyase (Tableau 26). Aprs incubation 37C pendant 15 60 min, 150 L de solution 2 puis 150 L de solution 3 sont ajoutes et homognises. La suspension est centrifuge 2 min 12000 rpm et le surnageant est transfr dans un nouveau tube. 400 L disopropanol sont ajouts et le mlange est centrifug 8 min 12000 rpm. Le culot est repris dans 35 L deau UP strile. 2 L de cette prparation plasmidique sont utiliss pour transformer E. coli.

tel-00482109, version 2 - 29 Feb 2012

195

tel-00482109, version 2 - 29 Feb 2012

Bibliographie

196

Adl SM, Simpson AG, Farmer MA, et al., 2005. The new higher level classification of eukaryotes with emphasis on the taxonomy of protists. J Eukaryot Microbiol. 52, 399451. Adriano D, 1986. Trace elements in the terrestrial environment. New York, USA: Springer Verlag. Aguilera A, Manrubia SC, Gomez F, et al., 2006. Eukaryotic community distribution and its relationship to water physicochemical parameters in an extreme acidic environment, Rio Tinto (southwestern Spain). Appl Environ Microbiol. 72, 5325-30. Ahonen-Jonnarth U, Finlay R, Van-Hees P, et al., 2000. Organic acids produced by mycorrhizal Pinus sylvestris exposed to elevated aluminium and heavy metal concentration. New Phytologist. 146, 557-567. Al-Hiyali S, McNeilly T et Bradshaw A, 1990. The effect of zinc contamination from electricity pylons. Contrasting patterns of evolution in five grass species. New Phytologist. 114, 183-190. Al-Hiyali S, McNeilly T, Bradshaw A, et al., 1993. The effect of zinc contamination from electricity pylons. Genetic constraints on selection for zinc tolerance. Heredity. 70, 2232. Altschul SF, Madden TL, Schaffer AA, et al., 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25, 3389-402. Amann RI, Ludwig W et Schleifer KH, 1995. Phylogenetic identification and in situ detection of individual microbial cells without cultivation. Microbiol Rev. 59, 143-69. Amaral Zettler LA, Gomez F, Zettler E, et al., 2002. Microbiology: eukaryotic diversity in Spain's River of Fire. Nature. 417, 137. Andersson JO, 2005. Lateral gene transfer in eukaryotes. Cell Mol Life Sci. 62, 1182-97. Antonovics J, Bradshaw A et Turner R, 1971. Heavy metal tolerance in plants. Advances in Ecological Research. 7, 1-85. Archibald JM, 2005. Jumping genes and shrinking genomes-probing the evolution of eukaryotic photosynthesis with genomics. IUBMB Life. 57, 539-47. Arisue N, Hasegawa M et Hashimoto T, 2005. Root of the Eukaryota tree as inferred from combined maximum likelihood analyses of multiple molecular sequence data. Mol Biol Evol. 22, 409-20. Ashelford KE, Chuzhanova NA, Fry JC, et al., 2006. New screening software shows that most recent large 16S rRNA gene clone libraries contain chimeras. Appl Environ Microbiol. 72, 5734-41. Atkins P et Jones L, 1997. Chemestry - molecules, matter and change. New York, USA: W.H. Freeman. Audia JP, Patton MC et Winkler HH, 2008. DNA microarray analysis of the heat shock transcriptome of the obligate intracytoplasmic pathogen Rickettsia prowazekii. Appl Environ Microbiol. 74, 7809-12. Bailly J, Fraissinet-Tachet L, Verner MC, et al., 2007. Soil eukaryotic functional diversity, a metatranscriptomic approach. Isme J. 1, 632-42. Baker BJ, Hugenholtz P, Dawson SC, et al., 2003. Extremely acidophilic protists from acid mine drainage host Rickettsiales-lineage endosymbionts that have intervening sequences in their 16S rRNA genes. Appl Environ Microbiol. 69, 5512-8. Baldauf SL, Roger AJ, Wenk-Siefert I, et al., 2000. A kingdom-level phylogeny of eukaryotes based on combined protein data. Science. 290, 972-7. Bapteste E, Brinkmann H, Lee JA, et al., 2002. The analysis of 100 genes supports the grouping of three highly divergent amoebae: Dictyostelium, Entamoeba, and Mastigamoeba. Proc Natl Acad Sci U S A. 99, 1414-9.

tel-00482109, version 2 - 29 Feb 2012

197

Barajas-Aceves M, Hassan M, Tinoco R, et al., 2002. Effect of pollutants on the ergosterol content as indicator of fungal biomass. J Microbiol Methods. 50, 227-36. Bass D et Cavalier-Smith T, 2004. Phylum-specific environmental DNA analysis reveals remarkably high global biodiversity of Cercozoa (Protozoa). Int J Syst Evol Microbiol. 54, 2393-404. Beeby A, 2001. What do sentinels stand for? Environ Pollut. 112, 285-98. Bj O, Spudich EN, Spudich JL, et al., 2001. Proteorhodopsin phototrophy in the ocean. Nature. 411, 786-9. Bellion M, Courbot M, Jacob C, et al., 2006. Extracellular and cellular mechanisms sustaining metal tolerance in ectomycorrhizal fungi. FEMS Microbiol Lett. 254, 17381. Blaudez D, Botton B et Chalot M, 2000a. Cadmium uptake and subcellular compartmentation in the ectomycorrhizal fungus Paxillus involutus. Microbiology. 146 ( Pt 5), 1109-17. Blaudez D, Jacob C, Turnau K, et al., 2000b. Differential responses of ectomycorrhizal fungal isolates to heavy metals in vitro. Mycol. Res. 104, 1366-1371. Boldrin F, Santovito G, Irato P, et al., 2002. Metal interaction and regulation of Tetrahymena pigmentosa metallothionein genes. Protist. 153, 283-91. Bonkowski M, 2002. Protozoa and plant growth: trophic links and mutualism. Eur J Protistol 37, 363-365. Borrelly GP, Harrison MD, Robinson AK, et al., 2002. Surplus zinc is handled by Zym1 metallothionein and Zhf endoplasmic reticulum transporter in Schizosaccharomyces pombe. J Biol Chem. 277, 30394-400. Bowers N, Pratt J, Beeson D, et al., 1997. Comparative evaluation of soil toxicity using lettuce seeds and soil ciliates. Environ Toxicol Chem. 16, 207-213. Bradshaw A et McNeilly T, 1981. Evolution and pollution. Studies in biology. 146, 1-76. Brinkmann H, van der Giezen M, Zhou Y, et al., 2005. An empirical assessment of longbranch attraction artefacts in deep eukaryotic phylogenomics. Syst Biol. 54, 743-57. Bui ET, Bradley PJ et Johnson PJ, 1996. A common evolutionary origin for mitochondria and hydrogenosomes. Proc Natl Acad Sci U S A. 93, 9651-6. Bult CJ, White O, Olsen GJ, et al., 1996. Complete genome sequence of the methanogenic archaeon, Methanococcus jannaschii. Science. 273, 1058-73. Burki F, Shalchian-Tabrizi K, Minge M, et al., 2007. Phylogenomics reshuffles the eukaryotic supergroups. PLoS One. 2, e790. Campbell C, Warren A, Cameron C, et al., 1997. Direct toxicity assessment of two soils amended with sewage sludge contaminated with heavy metals using a protozoan (Colpoda steinii) bioassay. Chemosphere. 34, 501-514. Cavalier-Smith T, 1993. Kingdom protozoa and its 18 phyla. Microbiol Rev. 57, 953-94. Cavalier-Smith T, 2002. The phagotrophic origin of eukaryotes and phylogenetic classification of Protozoa. Int J Syst Evol Microbiol. 52, 297-354. Cavalier-Smith T et Chao EE, 1996. Molecular phylogeny of the free-living archezoan Trepomonas agilis and the nature of the first eukaryote. J Mol Evol. 43, 551-62. Cavalier-Smith T et Chao EE, 2003. Phylogeny and classification of phylum Cercozoa (Protozoa). Protist. 154, 341-58. Cavalier-Smith T et von der Heyden S, 2007. Molecular phylogeny, scale evolution and taxonomy of centrohelid heliozoa. Mol Phylogenet Evol. 44, 1186-203. Chapman G et Dunlop S, 1981. Detoxication of zinc and cadmium by the freshwater protozoan Tetrahymena pyriformis. I. The effect of water hardness. Environ Res. 26, 81-6.

tel-00482109, version 2 - 29 Feb 2012

198

Choe CP, Hwang UW et Kim W, 1999. Putative secondary structures of unusually long strepsipteran SSU rRNAs and its phylogenetic implications. Mol Cells. 9, 191-9. Chuang HW, Wang IW, Lin SY, et al., 2009. Transcriptome analysis of cadmium response in Ganoderma lucidum. FEMS Microbiol Lett. 293, 205-13. Cobbett C et Goldsbrough P, 2002. Phytochelatins and metallothioneins: roles in heavy metal detoxification and homeostasis. Annu Rev Plant Biol. 53, 159-82. Collins L et Penny D, 2005. Complex spliceosomal organization ancestral to extant eukaryotes. Mol Biol Evol. 22, 1053-66. Colpaert J et Van-Assche J, 1992. The effects of cadmium and the cadmium-zinc interaction on the axenic growth of ectomycorrhizal fungi. Plant Soil. 145, 237-243. Colpaert J, Vandenkoornhuyse P, Adriaensen K, et al., 2000. Genetic variation and heavy metal tolerance in the ectomycorrhizal basidiomycete Suillus luteus. New Phytologist. 147, 367-379. Conklin DS, Culbertson MR et Kung C, 1994. Interactions between gene products involved in divalent cation transport in Saccharomyces cerevisiae. Mol Gen Genet. 244, 303-11. Conklin DS, McMaster JA, Culbertson MR, et al., 1992. COT1, a gene involved in cobalt accumulation in Saccharomyces cerevisiae. Mol Cell Biol. 12, 3678-88. Courbot M, Diez L, Ruotolo R, et al., 2004. Cadmium-responsive thiols in the ectomycorrhizal fungus Paxillus involutus. Appl Environ Microbiol. 70, 7413-7. Courtois S, Cappellano CM, Ball M, et al., 2003. Recombinant environmental libraries provide access to microbial diversity for drug discovery from natural products. Appl Environ Microbiol. 69, 49-55. Courtois S, Frostegard A, Goransson P, et al., 2001. Quantification of bacterial subgroups in soil: comparison of DNA extracted directly from soil or from cells previously released by density gradient centrifugation. Environ Microbiol. 3, 431-9. Coyle P, Philcox JC, Carey LC, et al., 2002. Metallothionein: the multipurpose protein. Cell Mol Life Sci. 59, 627-47. Cruz-Vasquez BH, Diaz-Cruz JM, Arino C, et al., 2002. Study of Cd2+ complexation by the glutathione fragments Cys-Gly (CG) and gamma-Glu-Cys (gamma-EC) by differential pulse polarography. Analyst. 127, 401-6. Culotta VC, Howard WR et Liu XF, 1994. CRS5 encodes a metallothionein-like protein in Saccharomyces cerevisiae. J Biol Chem. 269, 25295-302. Cumming J, Swiger T, Kurnik B, et al., 2001. Organic acid exudation by Laccaria bicolor and Pisolithus tinctorius exposed to aluminium in vitro. Can J For Res. 31, 703-710. Dacks JB, Marinets A, Ford Doolittle W, et al., 2002. Analyses of RNA Polymerase II genes from free-living protists: phylogeny, long branch attraction, and the eukaryotic big bang. Mol Biol Evol. 19, 830-40. Daniel R, 2004. The soil metagenome-a rich resource for the discovery of novel natural products. Curr Opin Biotechnol. 15, 199-204. Daniel R, 2005. The metagenomics of soil. Nat Rev Microbiol. 3, 470-8. Dawson SC et Pace NR, 2002. Novel kingdom-level eukaryotic diversity in anoxic environments. Proc Natl Acad Sci U S A. 99, 8324-9. Deckert J, 2005. Cadmium toxicity in plants: is there any analogy to its carcinogenic effect in mammalian cells? Biometals. 18, 475-81. Demaneche S, David MM, Navarro E, et al., 2009. Evaluation of functional gene enrichment in a soil metagenomic clone library. J Microbiol Methods. 76, 105-7. Diaz S, Amaro F, Rico D, et al., 2007. Tetrahymena metallothioneins fall into two discrete subfamilies. PLoS One. 2, e291. Diaz S, Martin-Gonzalez A et Carlos Gutierrez J, 2006. Evaluation of heavy metal acute toxicity and bioaccumulation in soil ciliated protozoa. Environ Int. 32, 711-7.

tel-00482109, version 2 - 29 Feb 2012

199

Diez B, Pedros-Alio C et Massana R, 2001. Study of genetic diversity of eukaryotic picoplankton in different oceanic regions by small-subunit rRNA gene cloning and sequencing. Appl Environ Microbiol. 67, 2932-41. Dinsdale EA, Edwards RA, Hall D, et al., 2008. Functional metagenomic profiling of nine biomes. Nature. 452, 629-32. Dmuchowski W et Bytnerowicz A, 1995. Monitoring environmental pollution in Poland by chemical analysis of Scots pine (Pinus sylvestris L.) needles. Environ Pollut. 87, 87104. Dondero F, Cavaletto M, Ghezzi AR, et al., 2004. Biochemical characterization and quantitative gene expression analysis of the multi-stress inducible metallothionein from Tetrahymena thermophila. Protist. 155, 157-68. Doolittle WF, 1999. Phylogenetic classification and the universal tree. Science. 284, 2124-9. Duffus J, 2002. "Heavy metals" - A meaningless term? Pure and Applied Chemestry. 74, 793-807. Dumont MG, Radajewski SM, Miguez CB, et al., 2006. Identification of a complete methane monooxygenase operon from soil by combining stable isotope probing and metagenomic analysis. Environ Microbiol. 8, 1240-50. Eckburg PB, Bik EM, Bernstein CN, et al., 2005. Diversity of the human intestinal microbial flora. Science. 308, 1635-8. Edgcomb VP, Roger AJ, Simpson AG, et al., 2001. Evolutionary relationships among "jakobid" flagellates as indicated by alpha- and beta-tubulin phylogenies. Mol Biol Evol. 18, 514-22. Eide DJ, Bridgham JT, Zhao Z, et al., 1993. The vacuolar H(+)-ATPase of Saccharomyces cerevisiae is required for efficient copper detoxification, mitochondrial function, and iron metabolism. Mol Gen Genet. 241, 447-56. Ekelund F, Frederiksen HB et Ronn R, 2002. Population dynamics of active and total ciliate populations in arable soil amended with wheat. Appl Environ Microbiol. 68, 1096-101. Embley TM et Martin W, 2006. Eukaryotic evolution, changes and challenges. Nature. 440, 623-30. Eschenfeldt WH, Stols L, Rosenbaum H, et al., 2001. DNA from uncultured organisms as a source of 2,5-diketo-D-gluconic acid reductases. Appl Environ Microbiol. 67, 420614. Fast NM, Kissinger JC, Roos DS, et al., 2001. Nuclear-encoded, plastid-targeted genes suggest a single common origin for apicomplexan and dinoflagellate plastids. Mol Biol Evol. 18, 418-26. Fauchon M, Lagniel G, Aude JC, et al., 2002. Sulfur sparing in the yeast proteome in response to sulfur demand. Mol Cell. 9, 713-23. Favier A, 2003. La chimie dans les sciences mdicales. L'actualit chimique. 269-270, 103108. Felsenstein J, 1985. Confidence limits on phylogenies: an approach using the bootstrap. Evolution. 39, 783-791. Fergusson J, 1990. The heavy elements. Chemestry, environmental impact and health effects. Oxford, UK: Pergamon Press. Fierer N, Breitbart M, Nulton J, et al., 2007. Metagenomic and small-subunit rRNA analyses reveal the genetic diversity of bacteria, archaea, fungi, and viruses in soil. Appl Environ Microbiol. 73, 7059-66. Floyd R, Abebe E, Papert A, et al., 2002. Molecular barcodes for soil nematode identification. Mol Ecol. 11, 839-50.

tel-00482109, version 2 - 29 Feb 2012

200

Fomina M, Hillier S, Charnock JM, et al., 2005. Role of oxalic acid overexcretion in transformations of toxic metal minerals by Beauveria caledonica. Appl Environ Microbiol. 71, 371-81. Forbes V, 1998. Genetics of ecotoxicology. Ann Arbor: Taylor and Francis. Foster R, 1988. Microenvironments of soil microorganisms. Biol. Fertil. Soils. 6, 189-203. Frank DN et Pace NR, 2008. Gastrointestinal microbiology enters the metagenomics era. Curr Opin Gastroenterol. 24, 4-10. Frias-Lopez J, Shi Y, Tyson GW, et al., 2008. Microbial community gene expression in ocean surface waters. Proc Natl Acad Sci U S A. 105, 3805-10. Gabor E, deVries E et Janssen D, 2003. Efficient recovery of environmental DNA for expression cloning by indirect methods. FEMS Microbiol. Ecol. 44, 153-163. Gabor EM, de Vries EJ et Janssen DB, 2004. Construction, characterization, and use of small-insert gene banks of DNA isolated from soil and enrichment cultures for the recovery of novel amidases. Environ Microbiol. 6, 948-58. Gallego A, Martin-Gonzalez A, Ortega R, et al., 2007. Flow cytometry assessment of cytotoxicity and reactive oxygen species generation by single and binary mixtures of cadmium, zinc and copper on populations of the ciliated protozoan Tetrahymena thermophila. Chemosphere. 68, 647-61. Galtier N, Gouy M et Gautier C, 1996. SEAVIEW and PHYLO_WIN: two graphic tools for sequence alignment and molecular phylogeny. Comput Appl Biosci. 12, 543-8. Garcia JJ, Martinez-Ballarin E, Millan-Plano S, et al., 2005. Effects of trace elements on membrane fluidity. J Trace Elem Med Biol. 19, 19-22. Gast C, Jansen E, Bierling J, et al., 1988. Heavy metals in mushrooms and their relationships with soil characteristics. Chemosphere. 17, 789-799. Gilbert JA, Field D, Huang Y, et al., 2008. Detection of large numbers of novel sequences in the metatranscriptomes of complex marine microbial communities. PLoS One. 3, e3042. Gillespie DE, Brady SF, Bettermann AD, et al., 2002. Isolation of antibiotics turbomycin A and B from a metagenomic library of soil microbial DNA. Appl Environ Microbiol. 68, 4301-6. Gonzalez-Chavez MC, Carrillo-Gonzalez R, Wright SF, et al., 2004. The role of glomalin, a protein produced by arbuscular mycorrhizal fungi, in sequestering potentially toxic elements. Environ Pollut. 130, 317-23. Grant S, Grant WD, Cowan DA, et al., 2006. Identification of eukaryotic open reading frames in metagenomic cDNA libraries made from environmental samples. Appl Environ Microbiol. 72, 135-43. Guillou L, Viprey M, Chambouvet A, et al., 2008. Widespread occurrence and genetic diversity of marine parasitoids belonging to Syndiniales (Alveolata). Environ Microbiol. 10, 3349-65. Gupta R, Beg QK et Lorenz P, 2002. Bacterial alkaline proteases: molecular approaches and industrial applications. Appl Microbiol Biotechnol. 59, 15-32. Habura A, Pawlowski J, Hanes SD, et al., 2004a. Unexpected foraminiferal diversity revealed by small-subunit rDNA analysis of Antarctic sediment. J Eukaryot Microbiol. 51, 173-9. Habura A, Pawlowski J, Hanes SD, et al., 2004b. Unexpected foraminiferal diversity revealed by small-subunit rDNA analysis of Antarctic sediment. J Eukaryot Microbiol. 51, 173-9. Hackett JD, Scheetz TE, Yoon HS, et al., 2005. Insights into a dinoflagellate genome through expressed sequence tag analysis. BMC Genomics. 6, 80.

tel-00482109, version 2 - 29 Feb 2012

201

Hackett JD, Yoon HS, Li S, et al., 2007. Phylogenomic analysis supports the monophyly of cryptophytes and haptophytes and the association of rhizaria with chromalveolates. Mol Biol Evol. 24, 1702-13. Hall JL, 2002. Cellular mechanisms for heavy metal detoxification and tolerance. J Exp Bot. 53, 1-11. Hampl V, Hug L, Leigh JW, et al., 2009. Phylogenomic analyses support the monophyly of Excavata and resolve relationships among eukaryotic "supergroups". Proc Natl Acad Sci U S A. 106, 3859-64. Handelsman J, Rondon MR, Brady SF, et al., 1998. Molecular biological access to the chemistry of unknown soil microbes: a new frontier for natural products. Chem Biol. 5, R245-9. Hashimoto T, Nakamura Y, Kamaishi T, et al., 1995. Phylogenetic place of mitochondrion-lacking protozoan, Giardia lamblia, inferred from amino acid sequences of elongation factor 2. Mol Biol Evol. 12, 782-93. Henne A, Daniel R, Schmitz RA, et al., 1999. Construction of environmental DNA libraries in Escherichia coli and screening for the presence of genes conferring utilization of 4hydroxybutyrate. Appl Environ Microbiol. 65, 3901-7. Henne A, Schmitz RA, Bomeke M, et al., 2000. Screening of environmental DNA libraries for the presence of genes conferring lipolytic activity on Escherichia coli. Appl Environ Microbiol. 66, 3113-6. Hirt RP, Logsdon JM, Jr., Healy B, et al., 1999. Microsporidia are related to Fungi: evidence from the largest subunit of RNA polymerase II and other proteins. Proc Natl Acad Sci U S A. 96, 580-5. Hgberg M et Hgberg P, 2002. Extramatrical ectomycorrhizal mycelium contributes one third of microbial biomass and produces, together with associated roots, half of the dissolved organic carbon in a forest soil. New Physiologist. 154, 791-795. Holben WE, Jansson JK, Chelm BK, et al., 1988. DNA Probe Method for the Detection of Specific Microorganisms in the Soil Bacterial Community. Appl Environ Microbiol. 54, 703-711. Hugenholtz P et Tyson GW, 2008. Microbiology: metagenomics. Nature. 455, 481-3. Hurt RA, Qiu X, Wu L, et al., 2001. Simultaneous recovery of RNA and DNA from soils and sediments. Appl Environ Microbiol. 67, 4495-503. Jacob C, Courbot M, Brun A, et al., 2001. Molecular cloning, characterization and regulation by cadmium of a superoxide dismutase from the ectomycorrhizal fungus Paxillus involutus. Eur J Biochem. 268, 3223-32. Jacob C, Courbot M, Martin F, et al., 2004. Transcriptomic responses to cadmium in the ectomycorrhizal fungus Paxillus involutus. FEBS Lett. 576, 423-7. James TY, Kauff F, Schoch CL, et al., 2006. Reconstructing the early evolution of Fungi using a six-gene phylogeny. Nature. 443, 818-22. Jkely G, 2005. Glimpsing over the event horizon: evolution of nuclear pores and envelope. Cell Cycle. 4, 297-299. Jeon S, Bunge J, Leslin C, et al., 2008. Environmental rRNA inventories miss over half of protistan diversity. BMC Microbiol. 8, 222. Johnson MD, Tengs T, Oldach DW, et al., 2004. Highly divergent SSU rRNA genes found in the marine ciliates Myrionecta rubra and Mesodinium pulex. Protist. 155, 347-59. Juste C, 1988. Apprciation de la mobilit et de la biodisponibilit des lments en traces du sol. Sci Sol. 26, 103-112. Kamizono A, Nishizawa M, Teranishi Y, et al., 1989. Identification of a gene conferring resistance to zinc and cadmium ions in the yeast Saccharomyces cerevisiae. Mol Gen Genet. 219, 161-7.

tel-00482109, version 2 - 29 Feb 2012

202

Kempf P et Aller J, 2004. Estimating prokaryotic diversity: when are 16S rDNA libraries large enough? Limnology and Oceanography: Methods. 2, 114-125. Kim E, Simpson AG et Graham LE, 2006. Evolutionary relationships of apusomonads inferred from taxon-rich analyses of 6 nuclear encoded genes. Mol Biol Evol. 23, 2455-66. Kim SJ, Lee CM, Han BR, et al., 2008. Characterization of a gene encoding cellulase from uncultured soil bacteria. FEMS Microbiol Lett. 282, 44-51. King N, Westbrook MJ, Young SL, et al., 2008. The genome of the choanoflagellate Monosiga brevicollis and the origin of metazoans. Nature. 451, 783-8. Knietsch A, Bowien S, Whited G, et al., 2003a. Identification and characterization of coenzyme B12-dependent glycerol dehydratase- and diol dehydratase-encoding genes from metagenomic DNA libraries derived from enrichment cultures. Appl Environ Microbiol. 69, 3048-60. Knietsch A, Waschkowitz T, Bowien S, et al., 2003b. Metagenomes of complex microbial consortia derived from different soils as sources for novel genes conferring formation of carbonyls from short-chain polyols on Escherichia coli. J Mol Microbiol Biotechnol. 5, 46-56. Kozdroj J, Piotrowska-Seget Z et Krupa P, 2007. Mycorrhizal fungi and ectomycorrhiza associated bacteria isolated from an industrial desert soil protect pine seedlings against Cd(II) impact. Ecotoxicology. 16, 449-56. Kuhn DA, Gregory DA, Buchanan GE, Jr., et al., 1978. Isolation, characterization, and numerical taxonomy of Simonsiella strains from the oral cavities of cats, dogs, sheep, and humans. Arch Microbiol. 118, 235-41. Kunkel TA et Loeb LA, 1979. On the fidelity of DNA replication. Effect of divalent metal ion activators and deoxyrionucleoside triphosphate pools on in vitro mutagenesis. J Biol Chem. 254, 5718-25. Kuroda K et Ueda M, 2006. Effective display of metallothionein tandem repeats on the bioadsorption of cadmium ion. Appl Microbiol Biotechnol. 70, 458-63. Kurokawa K, Itoh T, Kuwahara T, et al., 2007. Comparative metagenomics revealed commonly enriched gene sets in human gut microbiomes. DNA Res. 14, 169-81. Lanfranco L, 2007. The fine-tuning of heavy metals in mycorrhizal fungi. New Phytol. 174, 3-6. Lanfranco L, Bolchi A, Ros EC, et al., 2002. Differential expression of a metallothionein gene during the presymbiotic versus the symbiotic phase of an arbuscular mycorrhizal fungus. Plant Physiol. 130, 58-67. Lara E, Chatzinotas A et Simpson AG, 2006. Andalucia (n. gen.)-the deepest branch within jakobids (Jakobida; Excavata), based on morphological and molecular study of a new flagellate from soil. J Eukaryot Microbiol. 53, 112-20. Lara E, Moreira D et Lopez-Garcia P, 2009. The Environmental Clade LKM11 and Rozella Form the Deepest Branching Clade of Fungi. Protist. Lawley B, Ripley S, Bridge P, et al., 2004. Molecular analysis of geographic patterns of eukaryotic diversity in Antarctic soils. Appl Environ Microbiol. 70, 5963-72. Lecointre G et Le-Guyader H, 2001. Classification phylogntique du vivant. Belin, Paris. Lee J, Godon C, Lagniel G, et al., 1999. Yap1 and Skn7 control two specialized oxidative stress response regulons in yeast. J Biol Chem. 274, 16040-6. Lee SW, Won K, Lim HK, et al., 2004. Screening for novel lipolytic enzymes from uncultured soil microorganisms. Appl Microbiol Biotechnol. 65, 720-6. Lefevre E, Roussel B, Amblard C, et al., 2008. The molecular diversity of freshwater picoeukaryotes reveals high occurrence of putative parasitoids in the plankton. PLoS One. 3, e2324.

tel-00482109, version 2 - 29 Feb 2012

203

Leininger S, Urich T, Schloter M, et al., 2006. Archaea predominate among ammoniaoxidizing prokaryotes in soils. Nature. 442, 806-9. Lesaulnier C, Papamichail D, McCorkle S, et al., 2008. Elevated atmospheric CO2 affects soil microbial diversity associated with trembling aspen. Environ Microbiol. 10, 92641. Li ZS, Lu YP, Zhen RG, et al., 1997. A new pathway for vacuolar cadmium sequestration in Saccharomyces cerevisiae: YCF1-catalyzed transport of bis(glutathionato)cadmium. Proc Natl Acad Sci U S A. 94, 42-7. Liles MR, Manske BF, Bintrim SB, et al., 2003. A census of rRNA genes and linked genomic sequences within a soil metagenomic library. Appl Environ Microbiol. 69, 2684-91. Liu J, Qu W et Kadiiska MB, 2009. Role of oxidative stress in cadmium toxicity and carcinogenesis. Toxicol Appl Pharmacol. 238, 209-14. Liu Y, Zhou J, Omelchenko MV, et al., 2003. Transcriptome dynamics of Deinococcus radiodurans recovering from ionizing radiation. Proc Natl Acad Sci U S A. 100, 41916. Lopz-Garcia P et Moreira D, 2008. Tracking microbial biodiversity through molecular and genomic ecology. Research in Microbiology. 159, 67-73. Lopez-Garcia P, Rodriguez-Valera F, Pedros-Alio C, et al., 2001. Unexpected diversity of small eukaryotes in deep-sea Antarctic plankton. Nature. 409, 603-7. Ma J, Ryan P et Delhaize E, 2001. Aluminium tolerance in plants and the complexing role of organic acids. Trends in Plant Science. 6, 273-278. Maclean RC, Richardson DJ, LePardo R, et al., 2004. The identification of Naegleria fowleri from water and soil samples by nested PCR. Parasitol Res. 93, 211-7. Majernik A, Gottschalk G et Daniel R, 2001. Screening of environmental DNA libraries for the presence of genes conferring Na(+)(Li(+))/H(+) antiporter activity on Escherichia coli: characterization of the recovered genes and the corresponding gene products. J Bacteriol. 183, 6645-53. Mangot JF, Lepere C, Bouvier C, et al., 2009. Community structure and dynamics of small eukaryotes (<5 {micro}m) targeted by new oligonucleotide probes: a new insight into the lacustrine microbial food web. Appl Environ Microbiol. Margulis L, 1975. Symbiotic theory of the origin of eukaryotic organelles; criteria for proof. Symp Soc Exp Biol. 21-38. Massana R, Terrado R, Forn I, et al., 2006. Distribution and abundance of uncultured heterotrophic flagellates in the world oceans. Environ Microbiol. 8, 1515-22. Mayumi D, Akutsu-Shigeno Y, Uchiyama H, et al., 2008. Identification and characterization of novel poly(DL-lactic acid) depolymerases from metagenome. Appl Microbiol Biotechnol. 79, 743-50. McGrath KC, Thomas-Hall SR, Cheng CT, et al., 2008. Isolation and analysis of mRNA from environmental microbial communities. J Microbiol Methods. 75, 172-6. Medini D, Serruto D, Parkhill J, et al., 2008. Microbiology in the post-genomic era. Nat Rev Microbiol. 6, 419-30. Meharg A et Cairney J, 2000. Co-evolution of mycorrhizal symbionts and their hosts to metal-contamined environments. Advances in Ecological Research. 30, 69-112. Meharg AA, 2003. The mechanistic basis of interactions between mycorrhizal associations and toxic metal cations. Mycol Res. 107, 1253-65. Mehra RK et Winge DR, 1991. Metal ion resistance in fungi: molecular mechanisms and their regulated expression. J Cell Biochem. 45, 30-40. Mendez-Alvarez S, Rfenacht K et Eggen R, 2000. The Oxidative Stress-Sensitive yap1 Null Strain of Saccharomyces cerevisiae Becomes Resistant Due to Increased

tel-00482109, version 2 - 29 Feb 2012

204

Carotenoid Levels upon the Introduction of the Chlamydomonas reinhardtii cDNA, Coding for the 60S Ribosomal Protein L10a. Biochemical and Biophysical Research Communications. 267, 953-959. Mergeay M, Monchy S, Vallaeys T, et al., 2003. Ralstonia metallidurans, a bacterium specifically adapted to toxic metals: towards a catalogue of metal-responsive genes. FEMS Microbiol Rev. 27, 385-410. Miller DN, Bryant JE, Madsen EL, et al., 1999. Evaluation and optimization of DNA extraction and purification procedures for soil and sediment samples. Appl Environ Microbiol. 65, 4715-24. Mills HJ, Martinez RJ, Story S, et al., 2005. Characterization of microbial community structure in Gulf of Mexico gas hydrates: comparative analysis of DNA- and RNAderived clone libraries. Appl Environ Microbiol. 71, 3235-47. Minet M, Dufour ME et Lacroute F, 1992. Complementation of Saccharomyces cerevisiae auxotrophic mutants by Arabidopsis thaliana cDNAs. Plant J. 2, 417-22. Mirete S, de Figueras CG et Gonzalez-Pastor JE, 2007. Novel nickel resistance genes from the rhizosphere metagenome of plants adapted to acid mine drainage. Appl Environ Microbiol. 73, 6001-11. Mironov AA, Banin VV, Sesorova IS, et al., 2007. Evolution of the endoplasmic reticulum and the Golgi complex. Adv Exp Med Biol. 607, 61-72. Moon-van der Staay SY, De Wachter R et Vaulot D, 2001. Oceanic 18S rDNA sequences from picoplankton reveal unsuspected eukaryotic diversity. Nature. 409, 607-10. Moon-van der Staay SY, Tzeneva VA, van der Staay GW, et al., 2006. Eukaryotic diversity in historical soil samples. FEMS Microbiol Ecol. 57, 420-8. Moreira D et Lopz-Garcia P, 2002. The molecular ecology of microbial eukaryotes unveils a hidden diversity. Trends in Microbiology. 10, 31-39. Murasugi A, Wada C et Hayashi Y, 1981. Cadmium-binding peptide induced in fission yeast, Schizosaccharomyces pombe. J Biochem. 90, 1561-4. Muttray A et Mohn W, 1999. Quantitation of the population size and metabolic activity of a resin acid degrading bacterium in activated sludge using slot-blot hybridization to measure the rRNA:rDNA ratio. Microbial Ecology. 38, 348-357. Nara K, 2006a. Pioneer dwarf willow may facilitate tree succession by providing late colonizers with compatible ectomycorrhizal fungi in a primary successional volcanic desert. New Phytologist. 171, 187-198. Nara K, 2006b. Ectomycorrhizal networks and seedling establishment during early primary succession. New Phytologist. 169, 169-178. Nickrent DL et Sargent ML, 1991. An overview of the secondary structure of the V4 region of eukaryotic small-subunit ribosomal RNA. Nucleic Acids Res. 19, 227-35. Nieboer E et Richardson D, 1980. The replacement of the nondescript term 'heavy metals' by a biologically and chemically significant classification of metal ions. Environmental Pollution Series B, Chemical and Physical. 1, 3-26. Nikolaev SI, Berney C, Petrov NB, et al., 2006. Phylogenetic position of Multicilia marina and the evolution of Amoebozoa. Int J Syst Evol Microbiol. 56, 1449-58. Nishimura K, Igarashi K et Kakinuma Y, 1998. Proton gradient-driven nickel uptake by vacuolar membrane vesicles of Saccharomyces cerevisiae. J Bacteriol. 180, 1962-4. Not F, Valentin K, Romari K, et al., 2007. Picobiliphytes: a marine picoplanktonic algal group with unknown affinities to other eukaryotes. Science. 315, 253-5. Nowack EC, Melkonian M et Glockner G, 2008. Chromatophore genome sequence of Paulinella sheds light on acquisition of photosynthesis by eukaryotes. Curr Biol. 18, 410-8.

tel-00482109, version 2 - 29 Feb 2012

205

O'Brien HE, Parrent JL, Jackson JA, et al., 2005. Fungal community analysis by largescale sequencing of environmental samples. Appl Environ Microbiol. 71, 5544-50. Ochiai E, 1987. General principles of biochemistry of the elements. New York: Plenum Press. Ogram A, Sayler G et Barkay T, 1987. The extraction and purification of microbial DNA from sediments. J. Microbiol. Methods. 7, 57-66. Pace NR, 1997. A molecular view of microbial diversity and the biosphere. Science. 276, 734-40. Pace NR, 2009. Problems with "procaryote". J Bacteriol. 191, 2008-11. Pagani A, Villarreal L, Capdevila M, et al., 2007. The Saccharomyces cerevisiae Crs5 Metallothionein metal-binding abilities and its role in the response to zinc overload. Mol Microbiol. 63, 256-69. Parfrey LW, Barbero E, Lasser E, et al., 2006. Evaluating support for the current classification of eukaryotic diversity. PLoS Genet. 2, e220. Park J, Lee J et Jung J, 2003. Cadmium uptake capacity of two strains of Saccharomyces cerevisiae cells. Enz Microb Technol. 33, 371-378. Pathak GP, Ehrenreich A, Losi A, et al., 2009. Novel blue light-sensitive proteins from a metagenomic approach. Environ Microbiol. 11, 2388-99. Patron NJ, Inagaki Y et Keeling PJ, 2007. Multiple gene phylogenies support the monophyly of cryptomonad and haptophyte host lineages. Curr Biol. 17, 887-91. Paul E et Clark F, 1989. Soil microbiology and biochemistry. Academic Press, San Diego, CA. Pawlowski J, 2000. Introduction to the molecular systematics of foraminifera. Micropaleontology 46, 112. Pawlowski J et Burki F, 2009. Untangling the phylogeny of amoeboid protists. J Eukaryot Microbiol. 56, 16-25. Pazour GJ, Agrin N, Leszyk J, et al., 2005. Proteomic analysis of a eukaryotic cilium. J Cell Biol. 170, 103-13. Philippe H et Germot A, 2000. Phylogeny of eukaryotes based on ribosomal RNA: longbranch attraction and models of sequence evolution. Mol Biol Evol. 17, 830-4. Poretsky RS, Bano N, Buchan A, et al., 2005. Analysis of microbial gene transcripts in environmental samples. Appl Environ Microbiol. 71, 4121-6. Poretsky RS, Hewson I, Sun S, et al., 2009. Comparative day/night metatranscriptomic analysis of microbial communities in the North Pacific subtropical gyre. Environ Microbiol. 11, 1358-75. Porter TM, Schadt CW, Rizvi L, et al., 2008. Widespread occurrence and phylogenetic placement of a soil clone group adds a prominent new branch to the fungal tree of life. Mol Phylogenet Evol. 46, 635-44. Precigou S, Goulas P et Duran R, 2001. Rapid and specific identification of nitrile hydratase (NHase)-encoding genes in soil samples by polymerase chain reaction. FEMS Microbiol Lett. 204, 155-61. Prescott DM, 2000. Genome gymnastics: unique modes of DNA evolution and processing in ciliates. Nat Rev Genet. 1, 191-8. Pruesse E, Quast C, Knittel K, et al., 2007. SILVA: a comprehensive online resource for quality checked and aligned ribosomal RNA sequence data compatible with ARB. Nucleic Acids Res. 35, 7188-96. Qiu J, Guo Z, Liu H, et al., 2008. DNA microarray-based global transcriptional profiling of Yersinia pestis in multicellularity. J Microbiol. 46, 557-63. Radajewski S, McDonald IR et Murrell JC, 2003. Stable-isotope probing of nucleic acids: a window to the function of uncultured microorganisms. Curr Opin Biotechnol. 14, 296-302.

tel-00482109, version 2 - 29 Feb 2012

206

Reyes-Prieto A, Weber AP et Bhattacharya D, 2007. The origin and establishment of the plastid in algae and plants. Annu Rev Genet. 41, 147-68. Richards TA, Vepritskiy AA, Gouliamova DE, et al., 2005. The molecular diversity of freshwater picoeukaryotes from an oligotrophic lake reveals diverse, distinctive and globally dispersed lineages. Environ Microbiol. 7, 1413-25. Riesenfeld CS, Goodman RM et Handelsman J, 2004a. Uncultured soil bacteria are a reservoir of new antibiotic resistance genes. Environ Microbiol. 6, 981-9. Riesenfeld CS, Goodman RM et Handelsman J, 2004b. Uncultured soil bacteria are a reservoir of new antibiotic resistance genes. Environ Microbiol. 6, 981-9. Rodriguez-Ezpeleta N, Brinkmann H, Burey SC, et al., 2005. Monophyly of primary photosynthetic eukaryotes: green plants, red algae, and glaucophytes. Curr Biol. 15, 1325-30. Rodriguez-Ezpeleta N, Brinkmann H, Roure B, et al., 2007. Detecting and overcoming systematic errors in genome-scale phylogenies. Syst Biol. 56, 389-99. Rondon MR, August PR, Bettermann AD, et al., 2000. Cloning the soil metagenome: a strategy for accessing the genetic and functional diversity of uncultured microorganisms. Appl Environ Microbiol. 66, 2541-7. Rowlands T, Baumann P et Jackson SP, 1994. The TATA-binding protein: a general transcription factor in eukaryotes and archaebacteria. Science. 264, 1326-9. Rhling A et Sderstrm B, 1990. Changes in fruitbody production of mycorrhizal and litter decomposing macromycetes in heavy metal polluted coniferous forests in North Sweden. Water Air Soil Pollut 49, 375-387. Ruotolo R, Marchini G et Ottonello S, 2008. Membrane transporters and protein traffic networks differentially affecting metal tolerance: a genomic phenotyping study in yeast. Genome Biol. 9, R67. Saitou N et Nei M, 1987. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol Biol Evol. 4, 406-25. Sambrook J, Fritsch F et Maniatis T, 1989. Molecular cloning: a laboratory manual. Cold Spring Harbor, New York. Sanit-di-Toppi L et Gabbrielli R, 1999. Response to cadmium in higher plant. Env. Exp. Bot. 41, 105-130. Sapp J, 1994. Evolution by association: a history of symbiosis. (Oxford Univ. Press, New York). Schat H, Llugany M et Bernhard R, 2000. Metal-specific patterns of tolerance, uptake and transport of heavy metals in hyperaccumulating and nonhyperaccumulating metallophytes. Phytoremediation of contaminated soil and water. Lewis Publishers, Boca Raton, FL, USA. 171-188. Schutzendubel A et Polle A, 2002. Plant responses to abiotic stresses: heavy metal-induced oxidative stress and protection by mycorrhization. J Exp Bot. 53, 1351-65. Sebat JL, Colwell FS et Crawford RL, 2003. Metagenomic profiling: microarray analysis of an environmental genomic library. Appl Environ Microbiol. 69, 4927-34. Sessitsch A, Gyamfi S, Stralis-Pavese N, et al., 2002. RNA isolation from soil for bacterial community and functional analysis: evaluation of different extraction and soil conservation protocols. J Microbiol Methods. 51, 171-9. Shalchian-Tabrizi K, Kauserud H, Massana R, et al., 2007. Analysis of environmental 18S ribosomal RNA sequences reveals unknown diversity of the cosmopolitan phylum Telonemia. Protist. 158, 173-80. Shamrock VJ et Lindsey GG, 2008. A compensatory increase in trehalose synthesis in response to desiccation stress in Saccharomyces cerevisiae cells lacking the heat shock protein Hsp12p. Can J Microbiol. 54, 559-68.

tel-00482109, version 2 - 29 Feb 2012

207

Shang Y, Song X, Bowen J, et al., 2002. A robust inducible-repressible promoter greatly facilitates gene knockouts, conditional expression, and overexpression of homologous and heterologous genes in Tetrahymena thermophila. Proc Natl Acad Sci U S A. 99, 3734-9. Shiraishi E, Inouhe M, Joho M, et al., 2000. The cadmium-resistant gene, CAD2, which is a mutated putative copper-transporter gene (PCA1), controls the intracellular cadmiumlevel in the yeast S. cerevisiae. Curr Genet. 37, 79-86. Simon N, LeBot N, Marie D, et al., 1995. Fluorescent in situ hybridization with rRNAtargeted oligonucleotide probes to identify small phytoplankton by flow cytometry. Appl Environ Microbiol. 61, 2506-13. Simpson AG, 2003. Cytoskeletal organization, phylogenetic affinities and systematics in the contentious taxon Excavata (Eukaryota). Int J Syst Evol Microbiol. 53, 1759-77. Simpson AG, Inagaki Y et Roger AJ, 2006. Comprehensive multigene phylogenies of excavate protists reveal the evolutionary positions of "primitive" eukaryotes. Mol Biol Evol. 23, 615-25. Slapeta J, Moreira D et Lopez-Garcia P, 2005. The extent of protist diversity: insights from molecular ecology of freshwater eukaryotes. Proc Biol Sci. 272, 2073-81. Smit E, Leeflang P, Gommans S, et al., 2001. Diversity and seasonal fluctuations of the dominant members of the bacterial soil community in a wheat field as determined by cultivation and molecular methods. Appl Environ Microbiol. 67, 2284-91. Steenkamp ET, Wright J et Baldauf SL, 2006. The protistan origins of animals and fungi. Mol Biol Evol. 23, 93-106. Steffan RJ, Goksoyr J, Bej AK, et al., 1988. Recovery of DNA from soils and sediments. Appl Environ Microbiol. 54, 2908-15. Stiller JW et Hall BD, 1999. Long-branch attraction and the rDNA model of early eukaryotic evolution. Mol Biol Evol. 16, 1270-9. Stoeck T, Hayward B, Taylor GT, et al., 2006. A multiple PCR-primer approach to access the microeukaryotic diversity in environmental samples. Protist. 157, 31-43. Stoeck T, Taylor GT et Epstein SS, 2003. Novel eukaryotes from the permanently anoxic Cariaco Basin (Caribbean Sea). Appl Environ Microbiol. 69, 5656-63. Stohs SJ et Bagchi D, 1995. Oxidative mechanisms in the toxicity of metal ions. Free Radic Biol Med. 18, 321-36. Stommel M, Mann P et Franken P, 2001. EST-library construction using spore RNA of the arbuscular mycorrhizal fungus Gigaspora rosea. Mycorrhiza. 10, 281-285. Tokuda G et Watanabe H, 2007. Hidden cellulases in termites: revision of an old hypothesis. Biol Lett. 3, 336-9. Torsvik V, Daae FL, Sandaa RA, et al., 1998. Novel techniques for analysing microbial diversity in natural and perturbed environments. J Biotechnol. 64, 53-62. Torsvik V et Ovreas L, 2002. Microbial diversity and function in soil: from genes to ecosystems. Curr Opin Microbiol. 5, 240-5. Trassy C et Mermet J, 1984. Les Applications Analytiques des Plasmas HF. Technique et Documentation (Lavoisier), Paris. Tringe SG, von Mering C, Kobayashi A, et al., 2005. Comparative metagenomics of microbial communities. Science. 308, 554-7. Turnau K, Kottle I, Dexheimer J, et al., 1994. Element distribution in Pisolithus tinctorius mycelium treated with cadmium dust. Bot Acta. 74, 137-142. Turnbaugh PJ, Ley RE, Hamady M, et al., 2007. The human microbiome project. Nature. 449, 804-10.

tel-00482109, version 2 - 29 Feb 2012

208

Tyson GW, Chapman J, Hugenholtz P, et al., 2004. Community structure and metabolism through reconstruction of microbial genomes from the environment. Nature. 428, 3743. Uchiyama T, Abe T, Ikemura T, et al., 2005. Substrate-induced gene-expression screening of environmental metagenome libraries for isolation of catabolic genes. Nat Biotechnol. 23, 88-93. Urich T, Lanzen A, Qi J, et al., 2008. Simultaneous assessment of soil microbial community structure and function through analysis of the meta-transcriptome. PLoS One. 3, e2527. Valster RM, Wullings BA, Bakker G, et al., 2009. Free-living protozoa in two unchlorinated drinking water supplies, identified by phylogenic analysis of 18S rRNA gene sequences. Appl Environ Microbiol. 75, 4736-46. Van-Assche F et Clijsters H, 1990. Effects of metals on enzyme activity in plants. Plant, Cell and Environment. 13, 195-206. Van de Peer Y, Baldauf SL, Doolittle WF, et al., 2000. An updated and comprehensive rRNA phylogeny of (crown) eukaryotes based on rate-calibrated evolutionary distances. J Mol Evol. 51, 565-76. van der Lelie D, Schwitzguebel JP, Glass DJ, et al., 2001. Assessing phytoremediation's progress in the United States and Europe. Environ Sci Technol. 35, 446A-452A. Vandenkoornhuyse P, Baldauf SL, Leyval C, et al., 2002. Extensive fungal diversity in plant roots. Science. 295, 2051. Vangronsveld J, Colpaert JV et Van Tichelen KK, 1996. Reclamation of a bare industrial area contaminated by non-ferrous metals: physico-chemical and biological evaluation of the durability of soil treatment and revegetation. Environ Pollut. 94, 131-40. Vangronsveld J, Van Assche F et Clijsters H, 1995. Reclamation of a bare industrial area contaminated by non-ferrous metals: in situ metal immobilization and revegetation. Environ Pollut. 87, 51-9. Vellai T et Vida G, 1999. The origin of eukaryotes: the difference between prokaryotic and eukaryotic cells. Proc. Biol. Sci. 266, 1571-1577. Venter JC, Remington K, Heidelberg JF, et al., 2004. Environmental genome shotgun sequencing of the Sargasso Sea. Science. 304, 66-74. Vido K, Spector D, Lagniel G, et al., 2001. A proteome analysis of the cadmium response in Saccharomyces cerevisiae. J Biol Chem. 276, 8469-74. Viprey M, Guillou L, Ferreol M, et al., 2008. Wide genetic diversity of picoplanktonic green algae (Chloroplastida) in the Mediterranean Sea uncovered by a phylum-biased PCR approach. Environ Microbiol. 10, 1804-22. Vivas A, Barea JM, Biro B, et al., 2006. Effectiveness of autochthonous bacterium and mycorrhizal fungus on Trifolium growth, symbiotic development and soil enzymatic activities in Zn contaminated soil. J Appl Microbiol. 100, 587-98. Vogel T, Simonet P, Jansson J, et al., 2009. TerraGenome: a consortium for the sequencing of a soil metagenome. Nature Reviews Microbiology. 7, 252. Voget S, Leggewie C, Uesbeck A, et al., 2003. Prospecting for novel biocatalysts in a soil metagenome. Appl Environ Microbiol. 69, 6235-42. Voiblet C, Duplessis S, Encelot N, et al., 2001. Identification of symbiosis-regulated genes in Eucalyptus globulus-Pisolithus tinctorius ectomycorrhiza by differential hybridization of arrayed cDNAs. Plant J. 25, 181-91. Waisberg M, Joseph P, Hale B, et al., 2003. Molecular and cellular mechanisms of cadmium carcinogenesis. Toxicology. 192, 95-117. Wang B et Qiu YL, 2006. Phylogenetic distribution and evolution of mycorrhizas in land plants. Mycorrhiza. 16, 299-363.

tel-00482109, version 2 - 29 Feb 2012

209

Wang GY, Graziani E, Waters B, et al., 2000. Novel natural products from soil DNA libraries in a streptomycete host. Org Lett. 2, 2401-4. Warnecke F, Luginbuhl P, Ivanova N, et al., 2007. Metagenomic and functional analysis of hindgut microbiota of a wood-feeding higher termite. Nature. 450, 560-5. Watanabe M et Suzuki T, 2002. Involvement of reactive oxygen stress in cadmium-induced cellular damage in Euglena gracilis. Comp Biochem Physiol C Toxicol Pharmacol. 131, 491-500. Weber M, Trampczynska A et Clemens S, 2006. Comparative transcriptome analysis of toxic metal responses in Arabidopsis thaliana and the Cd(2+)-hypertolerant facultative metallophyte Arabidopsis halleri. Plant Cell Environ. 29, 950-63. Weissman Z, Berdicevsky I, Cavari BZ, et al., 2000. The high copper tolerance of Candida albicans is mediated by a P-type ATPase. Proc Natl Acad Sci U S A. 97, 3520-5. Wellington EM, Berry A et Krsek M, 2003. Resolving functional diversity in relation to microbial community structure in soil: exploiting genomics and stable isotope probing. Curr Opin Microbiol. 6, 295-301. Wemmie JA, Szczypka MS, Thiele DJ, et al., 1994. Cadmium tolerance mediated by the yeast AP-1 protein requires the presence of an ATP-binding cassette transporterencoding gene, YCF1. J Biol Chem. 269, 32592-7. Whittaker RH, 1969. New concepts of kingdoms or organisms. Evolutionary relations are better represented by new classifications than by the traditional two kingdoms. Science. 163, 150-60. Wilkinson D et Dickinson N, 1995. Metal resistance in trees - the role of mycorrhizae. Oikos. 72, 298-300. Woese CR, 1987. Bacterial evolution. Microbiol Rev. 51, 221-71. Woese CR et Fox GE, 1977. Phylogenetic structure of the prokaryotic domain: the primary kingdoms. Proc Natl Acad Sci U S A. 74, 5088-90. Wu AL et Moye-Rowley WS, 1994. GSH1, which encodes gamma-glutamylcysteine synthetase, is a target gene for YAP-1 transcriptional regulation. Mol Cell Biol. 14, 5832-9. Wu L, Thompson DK, Li G, et al., 2001. Development and evaluation of functional gene arrays for detection of selected genes in the environment. Appl Environ Microbiol. 67, 5780-90. Xu Z, Bowers N et Pratt J, 1997. Variation in morphology, ecology and toxicological responses of Colpoda inflata (Stokes) collected from five biogeographic realms. Eur J Protistol 33, 136-144. Yergeau E, Bokhorst S, Huiskes AH, et al., 2007. Size and structure of bacterial, fungal and nematode communities along an Antarctic environmental gradient. FEMS Microbiol Ecol. 59, 436-51. Yilmaz S et Zengin M, 2004. Monitoring environmental pollution in Erzurum by chemical analysis of Scots pine (Pinus sylvestris L.) needles. Environ Int. 29, 1041-7. Yun J, Kang S, Park S, et al., 2004. Characterization of a novel amylolytic enzyme encoded by a gene from a soil-derived metagenomic library. Appl Environ Microbiol. 70, 722935. Zhou J, Bruns MA et Tiedje JM, 1996. DNA recovery from soils of diverse composition. Appl Environ Microbiol. 62, 316-22. Zhou J et Thompson DK, 2002a. Challenges in applying microarrays to environmental studies. Curr Opin Biotechnol. 13, 204-7. Zhou J, Xia B, Treves DS, et al., 2002b. Spatial and resource factors influencing high microbial diversity in soil. Appl Environ Microbiol. 68, 326-34.

tel-00482109, version 2 - 29 Feb 2012

210

Annexe 1
Milieu LB (Luria-Bertani) (daprs Sambrook et al., 1989)
Nacl Extrait de levure Tryptone Agar 10 g.L-1 5 g.L-1 10 g.L-1 15 g.L-1

Ajuster le pH 7 avec du NaOH 1M. Autoclaver 20 minutes 120C.

Milieu SOC
tel-00482109, version 2 - 29 Feb 2012 Bactotryptone Extrait de levure Glucose 20 g.L-1 5 g.L-1 20 mM

Ajuster le pH 7,2-7,4 et autoclaver 20 minutes 120C. Les solutions suivantes sont strilises par filtration et ajoutes aprs autoclavage. NaCl KCl MgCl2 MgSO4 10 mM 2,5 mM 10 mM 10 mM

Milieu YPG
Extrait de levure Bactopeptone Glucose Agar 10 g.L-1 10 g.L-1 20 g.L-1 20 g.L-1

Autoclaver 30 minutes 110C.

Milieu YNB
Yeast Nitrogen Base 6,7g.L-1 Glucose 20 g.L-1 Adnine 1 mL.L-1 Uracile 4 mL.L-1 (sauf pour le milieu slectif correspondant) Tyrosine 5 mL.L-1 Ajuster le pH 5,9 avant de mettre lagar (20g.L-1). Autoclaver 30 minutes 110C.

211

Aprs autoclave, laisser refroidir jusqu 50-60 C et ajouter les solutions suivantes (striliser par filtration) : Acides amins complet 10 mL.L-1 Arginine Histidine Isoleucine Leucine Lysine Mthionine Phnylalanine Thronine Tryptophane Valine 2g.L-1 2g.L-1 6g.L-1 6g.L-1 4g.L-1 2g.L-1 6g.L-1 5g.L-1 4g.L-1 15g.L-1

tel-00482109, version 2 - 29 Feb 2012

212

Annexe 2

Test KHI-2 ADNr+ARNr 3 Balen vs Paal ADNr+ARNr 5 Balen vs Paal ADNr+ARNr 5 Balen vs Lommel ADNr+ARNr 5 Paal vs Lommel Balen 5 ADNr/ARNr Balen 3 ADNr/ARNr Paal 5 ADNr/ARNr Paal 3 ADNr/ARNr Lommel 5 ADNr/ARNr

Fungi

Metazoa

Amoebozoa

Alveolata

Rhizaria

Heterokonta

Excavata

Plantae

Autres

0,160

3,87.10-4

7,61.10-7

0,023

0,007

0,614

0,081

3,84.10-3

2,54.10-4

0,610

2,36.10-3

0,069

0,123

0,406

0,960

0,1286

1,76.10-9

0,378

tel-00482109, version 2 - 29 Feb 2012

1,4.10-10

1,63.10-3

0,583

2,13.10-9

5,5.10-3

0,938

0,032

0,072

0,938

6,4.10-12

0,283

0,513

4,93.10-6

4,1.10-4

0,962

2,7.10-4

0,026

0,629

1,2.10-9

1,21.10-7

0,864

0,258

1,71.10-6

0,575

0,971

0,913

0,085

0,049

0,571

0,774

0,416

0,194

0,990

0,181

0,031

3,38.10-3

4,9.10-3

2,29.10-5

4,06.10-9

0,550

1,12.10-9

0,937

0,122

0,049

0,249

1,9.10-6

0,330

3,19.10-13

9,1.10-4

0,221

0,943

0,302

1,60.10-5

0,343

0,679

0,306

0,071

0,004

0,001

0,380

0,284

0,0187

0,380

Valeurs des tests de KHI-2 obtenues par comparaison des jeux de squences ribosomiques disponibles pour chaque site. Les ADNr et les ARNr cumuls reprsentant un mme phylum eucaryote ont t compars entre site pour chaque portion du gne 18S analyse. Les ADNr et les ARNr reprsentant un mme phylum eucaryote ont t compars entre eux pour chaque site et pour chaque portion du gne 18S analyse.

213

Test KHI-2 ADNc Balen / ADNc Paal

Protines annotes 6,17.10-9

Protines hypothtiques conserves 2,59.10-8

Nouvelles protines hypothtiques 1,32.10-20

Valeurs des tests de KHI-2 obtenues par comparaison des jeux de squences dADNc de Balen et de Paal pour chaque catgorie dADNc. Les protines annotes, correspondent aux protines avec une fonction biologique connue ; les protines hypothtiques conserves, correspondent aux protines de fonction inconnue dposes dans les bases de donnes ; et les nouvelles protines hypothtiques, correspondent aux ADNc qui ne donnent aucune rponse lors dun Blastx contre les bases de donnes publiques (e-value < 1e-5). tel-00482109, version 2 - 29 Feb 2012

Test KHI-2 ADNc Balen / ADNc Paal

A
0,655

B
0,416

C
8,24.10-5

D
0,034

E
0,330

F
5,37.10-3

G
0,842

H
0,138

Test KHI-2 ADNc Balen / ADNc Paal

I
0,992

J
0,894

K
3,7.10-6

L
0,159

M
0,147

N
0,973

O
0,329

Valeurs des tests de KHI-2 obtenues par comparaison des jeux de squences dADNc annots de Balen et de Paal pour chaque groupe fonctionnel dADNc. A, mtabolisme des acides nucliques ; B, mtabolisme des protines ; C, mtabolisme des acides amins et drivs ; D, mtabolisme des acides gras et des lipides ; E, mtabolisme des glucides ; F, mtabolisme secondaire ; G, autres mtabolismes (K, N, S) ; H, cofacteurs, vitamines, groupes prosthtiques, pigments ; I, trafic cellulaire ; J, contrle du cycle cellulaire ; K, respiration ; L, rponses au stress ; M, virulence ; N, paroi cellulaire ; O, autres fonctions

214

tel-00482109, version 2 - 29 Feb 2012

215