Designing primers for plant DNA barcoding,

improvement of RPA technique for low

resources research settings
Author:

Tania PESIC

Supervised by:

Nicolas ADAM

Professor:

Sebastian MAERKL

SUMMER 2023
Table of contents
I. Introduction .............................................................................................................. 1
1. Abstract ........................................................................................................................... 1
2. Global context of the project: the Genorobotics project. ................................................... 2
3. State of Art ...................................................................................................................... 2
II. Designing primers for ITS and rbcl .............................................................................. 5
1. Aim of the experiment...................................................................................................... 5
2. Primer design protocol ..................................................................................................... 6
3. Rbcl primer design............................................................................................................ 6
4. ITS primer design.............................................................................................................. 6
III. Experiences ............................................................................................................ 7
1. PCR experiment for sample taken from the Jorat forest. .................................................... 8
2. Liquid base kit RPA Twistdx© test on two genes: ITS and rbcl with microneedle extraction
of Solanum lycopersicum. ....................................................................................................... 14
3. Liquid base kit RPA Twistdx test on three genes: ITS and rbcl and trnH-psbA with
commercial DNA of Solanum lycopersicum. ............................................................................. 16
4. Primer screening for ITS.................................................................................................. 18
IV. General conclusion and future prospect ................................................................... 20
V. Protocols ................................................................................................................. 21
1. Polymerase Chain Reaction (PCR) ................................................................................... 21
2. Recombinase Polymerase Amplification (RPA) ................................................................ 24
3. Purification .................................................................................................................... 27
4. Agarose Gel .................................................................................................................... 28
5. Ladder Preparation......................................................................................................... 29
6. Electrophoresis .............................................................................................................. 29
7. Primers resuspension ..................................................................................................... 30
VI. Bibliography ........................................................................................................ 31

I. Introduction

1. Abstract

1
 The aim of this scientific report is to follow the process of amplification in DNA barcoding from
microneedle extracted DNA, from polymerase chain reaction to recombinase protein amplification.
We based this report on the amplification of four gene (ITS, rbcl, trnH-psbA and matK), first via PCR
like in the Genorobotics publication (Selz et al. 2023). Then we tested the protocol of amplification with
RPA to improve this new method of amplification. We varied multiple parameters like the concentration
of dNTPs or the design of new primers specific to RPA with ITS and rbcl. In addition, we tested different
target amplicon sizes to observe its impact on RPA performance.
This work belongs to a global effort to establish a fully optimized protocol for RPA amplification. This
would lead to more accessible amplifications in the field. Coupled with multiplexing improvement/effort,
this would lead to a more cost efficient and accessible way to implement DNA barcoding in countries
where resources are limited.

2. Global context of the project: the Genorobotics project.

With an increasing human population and the multiplication of environmental challenges, it is

urgent to find new solutions of collecting data about the evolution of those environmental challenges
for the evolution of biodiversity. Indeed, with deforestation, wildfires and human activities, the natural
ecosystem is disappearing at an alarming rate, leading to world health problems and more alarming
consequences. In this global context, Genorobotics, an Interdisciplinary project at EPFL lead by students,
engineers, and researchers has the main objective to design new methods of plant identification using
DNA barcoding methods. These techniques aim to be more effective, faster, and easier to use in the field
where resources are often limited.

This process of DNA barcoding is separated into three steps:

- Extraction
- Amplification
- Sequencing

Extraction is done with a microneedle patch which perforates the leaf of the plant that we want
to sequence. Then, DNA is collected with an elution buffer. Amplification is done with recombinase
polymerase amplification technique (RPA), a new isothermal amplification method. This method
requires a low temperature and so does not require a thermocycler like a traditional polymerase chain
recombination (PCR). Thus, this technique is more efficient in the field. At the end, the sequencing part
is done with a portable DNA sequencer, the MinIon sequencer.
In this context, my report aims to summarize all the experiences that we performed during the
course of this bachelor project, to improve this RPA method for two genes ITS and rbcl, especially by
designing new primers to eliminate the challenge of the size of the amplicon.

3. State of Art

2
A) DNA Barcoding Method

DNA Barcoding is a new method that uses an organism's DNA to identify its belonging to a
certain species. The idea is to extract the DNA sequence from a tiny tissue sample of the organism that
we want to barcode and collect the data from. It’s a tool for taxonomists and helps to flag species that
are potentially new to science, detect species that are harmful for human health or invasive for the
environment (Kress et Erickson 2012). Rbcl, Matk, trnh-psbA and ITS are four universal barcoding
genes in plants which we are focused on for our project.

B) Recombinase Polymerase Amplification (RPA)

To amplify our genes of interest, we use a new method of amplification: Recombinase

Polymerase Amplification (RPA). This new isothermal method relies on several proteins (recombinase,
single stranded binding proteins and Strand displacing polymerase) to amplify a gene of interest.
RPA is one of several isothermal amplification techniques. This technique was developed after the
polymerase chain reaction (PCR). It was chosen as suitable for low resource settings (such as field work)
due to the following characteristics:

- Only two primers are needed for the amplification.

- There is no need for an initial heating phase (no denaturation of the DNA).
- The temperature of incubation is low and constant (around 39°C for our experiences but it
can be between 37°C to 42°C), so the use of a thermocycler is not necessary.
- It’s the fastest isothermal method, with an incubation time of 20-40min.
- With the liquid-based kit used in this report, multiplexing is possible, which allows to
amplify multiple samples at the same time, reducing the cost of amplification per sample
and thus making it particularly cost efficient.

The mechanism of recombination polymerase amplification is slightly different from polymerase chain
amplification:

3
Figure 1: RPA mechanism adapted from Safiabadi Tali et al., Clinical Microbiology Reviews
(2021)

The reaction is initiated by the binding of a recombinase protein and a loading factor to each of
the forward and reverse primers. Those proteins form a complex which binds to homologous sequence
of primers, found in the double stranded DNA. Once the homologous sequence is bound, the
recombinase complex opens the DNA targeted, forming a structure called a “D-loop”. It creates single
stranded DNA allowing other proteins called single-strand DNA binding proteins (SSBs) to bind to it,
stabilizing the opposite strand and allowing access to the primer-binding sequence. Recombinase and
loading factor disassemble and are released while primers are binding. They extend thanks to a strand
displacement polymerase. Finally, SSBs are displaced, and the replication of both strands is complete.
(Lobato et O’Sullivan 2018)

4
C) Our genes of interest: ITS, trnH-psbA, rbcl and matK

In this report, we are focusing on four genes that allow DNA barcoding that we can separate in
three categories:
- Matk and rbcl, two plastid genes.
- trnH-psbA, a plastid intergenic spacer.
- ITS, a nuclear ribosomal interspace DNA.

Rbcl is a plasmid DNA coding for a subunit of Rubisco which is a protein playing an important role in
photosynthesis since it fixes carbon. (Klein, Salvador, et Bogorad 1994)
Matk is a plant plastid gene. This protein encodes for an organelle intron maturase, a protein that splices
group II introns. Matk and rbcl are both widely used DNA barcode for all land plants. Matk is quite
variable between species, so it must be coupled with rbcl to have a better specificity of the DNA
barcoding. (Ho et al. 2021)
TrnH-psbA is a non-coding plasmid interspace DNA. This gene has a low variability between species
so it’s a good gene for barcoding coupled with the four others. (Pang et al. 2012)
ITS is normally used to describe three different genes: ITS1, 5.8S and IT2S. The assemblage of the three
different parts can be quite difficult to amplify, so alternatively ITS2 can be used without ITS1 and 5.8S.
It reduces amplification and sequencing problems and ITS2 is more length conserved so it’s a better
choice than ITS1 (Hollingsworth, Graham, et Little 2011). In this report, we called ‘ITS’ the gather of
ITS1, 5.8S, ITS2, 28S.

II. Designing primers for ITS and rbcl

1. Aim of the experiment

The aim of this experiment was to design new pairs of primers for two genes: rbcl and ITS. The
particularity of RPA is that the size of the amplicon is critical since it favors rapid amplification in the
field. Some primers have already been tested in the past within the lab, however RPA did not provide
satisfactory with microneedle extraction.

In this context, we aimed to reduce the size of our amplicons to find out if size is a key parameter in
optimizing RPA results. If size is critical, we set to determine which range would be optimal for RPA
following microneedle extraction.

According to the twistamp assay design manual (Twistamp assay design manual, s. d.), targets of over
500 base pairs (bp) do not amplify well. They recommend an amplicon length ideally between 100 and
200bp. We decided to design primers that would amplify half of each gene separately to divide the

5
amplicon size by two while conserving the genetic information. For ITS, we designed multiple primers
to amplify one half, two thirds and the entire gene.

2. Primer design protocol

According to the Manufactured manual “twistamp assay design manual” (Twistamp assay design
manual, s. d.) some parameters are recommended to maximize the chance of a successful RPA :

- Ideal primer length should be between 30 and 35 nucleotides.

- Melting temperature should be between 50-100 C°.
- Primer GC% (proportion of G and C bases in the primer) should be between 20% and 70%.
- Maximum allowable length of a mononucleotide repeat (ex: ‘CCCCC’) set to 5.

We used Benching to design those primers. After picking ideal primer candidates, we paid close
attention to self-dimerization and cross-dimerization within each candidate primer pairs to avoid primer
noise (which is defined as visible dimerization in the gel). For this, we used the ThermoFisher Multiple
Primer Analyzer tool.

Note that cross dimers are only problematic if they form in the direction of the polymerase (5’ => 3’).

3. Rbcl primer design

For this gene, we designed two pairs of primers that would each amplify one half of the gene.
For the beginning and the end of the gene, we used a primer pair that has shown satisfactory
results in the past: reverse primer Rv3 and forward primer fw3.

Sequence Length Self- Cross

Dimer dimer
Rt1 ccgttaccaatatgtttacttccattgtaggt 32 No Ft2
Ft1 ttccgttaccaatatgtttacttccattgtag 32 No Rt2
Rt2 attggtaacggaaccttcttcaaaaaggtctaaa 31 yes Ft3, Ft1
Ft2 acttccattgtaggtaacgtatttgggttcaa 32 no /
Rt3 ttcttcaaaaaggtctaaagggtaagctacataag 35 No /
Ft3 gttccgttaccaatatgtttacttccattgtag 32 No Rt2
Fw3 gggatttatgtcaccacaaacagagactaaag 32 No /
Rv3 tcgcatgtacctgcagtagcattcaagtaatg 32 No /

4. ITS primer design.

For ITS, the work was a bit different since ITS is a ribosomal DNA and not a plastid DNA. At
first, we based our work on the ITS on chromosome 11 but precedent work on ITS primers was
done on the ITS sequence on chromosome 2. It’s the same sequence for ITS on both

6
chromosomes but with small variations. Since the sequence has small nucleotides variations,
we redesigned some primers for the beginning and the end of the gene thanks to Benchling and
its research tool.
We designed our amplicon so that a large region of the ITS gene would be amplified: the
amplicon gathers the end of the ITS1 gene, all the 5.8S rRNA, all the ITS2 gene and the
beginning of the 28S rRNA. FT and RT are both primers for the beginning and the end of the
total amplicon. The rest of the primers are designed in the middle of the amplicon.

Sequence Length Self-dimer Cross dimer

Fw1 accaagcatcgcatttcgctaccttcttcatc 32 No /
Fw2 cgctaccttcttcatcgatgcgagagccgagat 33 No /
Fw3 cgatggttcacgagattctgcaattcacaccaa 33 No Rv3
Rv1 agtctttgaatgcaagttgtgcctgaagccat 32 No /
Rv2 gcaagttgtgcctgaagccatttggccgaggg 32 No /
Rv3 Tgaattgcagaatctcgtgaaccatcgagtct 32 No Fw3
RT tgaaccttattatttagaggaaggagaagtag 32 No Fw1
Rv4 tgcgaactcgttttaaacacctgggggaggcg 32 No /
FT ttcctccgcttattgatatgcttacactcagc 32 No Fw2

III. Experiences

Diagram of our experimental path

7
 1. PCR experiment for sample taken from the Jorat forest.
Aim of the experiment: Determine the presence of DNA in the microneedle extractions from the Jorat
Forest. Follow the protocol of the publication of Genorobotics (Selz et al. 2023) and validate it to start
recombinase protein amplification.
For this experiment we used one sample (one species) and four PCR tubes. In each PCR tube we loaded
one pair of primers specific to one of the four genes studied.
Primers used were those from the Genorobotics’s publication (Selz et al. 2023):

Gene Forward Reverse

trnH-psbA trnH psbA

ITS ITS-p4 ITS-p5

matK matK3F matK1R

rbcL rbcLa-F rbcL724R

Results:

8
9
Figure 2 : Gel of PCR for Jorat forest sample from 1 to 13. A) Large gel with
primers from the Genorobotics publication for ITS, matk and rbcl. B) and C) small gels with
primers from the same publicationfor trnh-psbA. The number of the sample is marked in green
and the number of the pcr tube used for the experiment is marked in white (note that we have 4
samples of pcr for one sample of one plant). In dotted line are marks of the gene expected.

10
Figure 3: Gel representing amplified sample from 40 to 50 of the Jorat forest.
Primers used were primers from the Genobotics publication. The number of the sample is marked in
green, and the number of the PCR tube used for the experiment is marked in black (note that we have 4
sample of pcr for one sample of one plant) In dotted line are marks of the gene expected.

Analysis:

For figure 2, which represents the first PCR, we can see that almost all samples have succeeded in
amplifying the ITS gene. MatK did not work for all the samples tested, nor the rbcl gene. For tnrH-psbA,
only one gene seems to have worked, even if there’s a similar band not far from the size expected. Due
to the aspect of the ladder, which is unsteady and unclear, we cannot conclude if the band is due to the
presence of the trnH-psbA gene or just an error of manipulation (lack of gel dye, a problem with TAE
buffer or an error of manipulation during the realization of the gel.)

In figure 3, two amplifications of the tnrH-psbA seem to have worked (wells 41 and 43) like one
amplification of ITS in the well 48. Matk like in the precedent gel doesn’t seems to have work at all,
like rbcl for this gel.

11
Conclusion of the experiment:

Many species from the forest show at least the presence of one gene, so we can conclude that the
microneedle extraction worked. A few species show the presence of two genes, which would allow the
identification of the plant. Numerous species did not show any presence of any genes. For Matk in
particular, none of the species extracted shown the presence of this gene. This result is in adequation to
the Genorobotics publication where really few species succeeded in amplifying Matk. The three other
genes (ITS, tnrH-psbA and rbcl) were at least amplified once. The lack of amplification can be due to:

- Inadequate primers.
- Problems in the purification step.
- Low DNA output of microneedle extraction.
- Pipetting errors.

Results could be improved by designing more adequate primers or optimizing the purification protocol.
Microneedle extraction output could be improved by reducing the elution buffer volume (30µ l) to have
a more concentrated DNA.
Note that we did two others PCR (for species from 14 to 39) but a problem with the TAE buffer led to
unsuccessful gels. We should re-do those gels in the future.

Figure 4: Resume of the gene amplified for each species collected in the Jorat forest.

Number Name in latin ITS Matk Rbcl Trnh- Identification

of the psba
sample
1 Fagus sylvatica no no no no
2 Sorbus yes no no no
aucuparia
3 rubus idaeus yes no no yes
4 athyrium filix- no no no No
femina
5 lysimachia yes no no no
nemorum
6 oxalis acetosella yes no no yes
7 Hedera Helix yes no no no
8 maianthemum yes no no no
bifolium
9 rubus fruticosus yes no no no
10 Abies alba yes no no no
11 carex sylvatica yes no no no
12 circaea yes no no no
lutetiana

12
13 veronica yes no no no
officinalis
14 fragaria vesca No No data No data No data
data
15 altissima No No data No data No data
data
16 veronica No No data No data No data
montana data
17 Dryopteris filix- No No data No data No data
mas data
18 lotus No No data No data No data
pedunculatus data
19 sambucus No No data No data No data
racemosa data
20 dryopteris No No data No data No data
dilatata data
21 fraxinus No No data No data No data
excelsior data
22 quercus robur No No data No data No data
data
23 castanea sativa No No data No data No data
data
24 juncus No No data No data No data
conglomeratus data
25 carex remota No No data No data No data
data
26 carex pilulifera No No data No data No data
data
27 carex leporina No No data No data No data
data
28 carex pallescens No No data No data No data
data
29 luzula pilosa No No data No data No data
data
30 agrostis No No data No data No data
capillaris data
31 milium effusum No No data No data No data
data
32 anemone No No data No data No data
nemorosa data
33 acer No No data No data No data
pseudoplatanus data
34 urtica dioica No No data No data No data
data
35 valeriana No No data No data No data
montana data
36 ilex aquifolium No No data No data No data
data
37 galium No No data No data No data
odoratum data

13
 38 quercus rubra No No data No data No data
data
39 veronica No No data No data No data
officinalis data
40 fagus sylvatica no no no no
41 sorbus no no no yes
aucuparia
42 galeopsis no no no no
tetrahit
43 mycelis muralis no no no yes
44 lonicera nigra no no no no
45 prenanthes no no no no
purpurea
46 prunus avium no no no no
47 festuca gigantea no no no no
48 viola yes no no no
reichenbachiana
49 stachys sylvatica no no no no
50 geum urbanum no no no no
51 aegopodium no data no data no data no data
podagraria
52 impatiens no data no data no data no data
parviflora

2. Liquid base kit RPA Twistdx™ test on two genes: ITS and rbcl with
microneedle extraction of Solanum lycopersicum.
Aim of the experiment: Learn how to use the TwistAmp Liquid Base Kit with two genes: ITS and rbcl.
Test the amplification of the microneedle extraction of Solanum Lycopersicum with the RPA the
TwistAmp Liquid Base Kit.

Results:

14
Figure n°5 : First test of the RPA TwistAmp® Basic kit with microneedle extractions of
solanum lycopersicum. The three first wells of each gel were loaded with MN extractions of the
plant. A) The RPA was done with rbcl primers previously verified in the lab. The positive control was
done with commercial DNA from Solanum Lycopersicum and the same primers. B) The primers used
for ITS results were from previous work in the lab. Positive control was also done with commercial DNA
of the species and the same primers.

Analysis: We don’t have any visible band for the first gel (Fig5. A), except for the positive control.
The band of the positive control is around 677bp, the size of the amplicon targeted. Bands are visible
around 100bp, which corresponds to the primers used. For the second well we have a double band which
can correspond to a self-dimerization of primers.

For the second gel, like the first one, there’s only visible bands at 100bp which correspond to the primers
used. In the positive control a band is visible around 350bp but it’s too small to be ITS so it’s probably
cross-dimerization of primers. A small band appears for the positive control of ITS (around 710bp) and
we don’t have any band for the negative control so there’s no contamination. We can see a band at the
size expected for the positive control, but the intensity is lower than other bands at 300bp and 100bp.
This can be due to dimerization of primers or a pipetting/manipulation error.

Conclusion: The amplification of the two genes of interest (rbcl and ITS) wasn’t successful. We can
suspect that this experience is unsuccessful because:

• The Liquid base kit RPA from Twistdx protocol was not executed properly, maybe the
concentration of dNTP was not correct thus reagents were limiting, and amplification
could not occur.
• The Microneedle extraction didn’t work and thus, there’s not enough DNA to amplify.
• Primers are not adequate to the amplification of those genes: maybe we could try to re-
design primers that are more specific to RPA (we can see that on the gels some primers
cross dimerized and/or self-dimerized).
• The size of the amplicon is too large: RPA is more effective with smaller amplicon (see
primers design section), so maybe it could work with the amplification of smaller
amplicon.

With those conclusions, we decided to test first the Liquid base RPA kit with only commercial DNA to
know if the concentration of dNTPs could play a role in the success of the amplification. Indeed, the
advantage of the Liquid Base Kit in contrary to TwistAmp Basic kit is that we have the possibility to
change a lot of parameters/quantities of different reactants of the RPA, so we decided to vary the
concentration of dNTPs. Those experiences could also clarify the doubt on the primers that we used for
the first test of the RPA liquid base kit and give an idea of the implication of the amplicon size.

15
 3. Liquid base kit RPA Twistdx test on three genes: ITS and rbcl and
trnH-psbA with commercial DNA of Solanum lycopersicum.

Aim of the experience: determine why the first RPA test didn’t succeed with the microneedle
extraction by testing different concentration of dNTP on commercial DNA.

Results:

Figure 6: Gel representing results from RPA liquid Base Kit with ITS primers. The
primers used were those from a past student. 2*, 4* and 1* correspond to the original concentration of
dNTP two times more concentration (20mM), four times more concentrated (40mM) and not more
concentrated (10mM)

16
Figure 7: Gel representing results from RPA liquid Base Kit with trnH-psbA
primers. The primers used were those from a precedent work. 2*, 4* and 1* correspond to the
original concentration of dNTP two times more concentrated (20mM), four times more concentrated
(40mM) and with the same concentration than the initial protocol (10mM)

Figure 8: Gel representing results from RPA liquid Base Kit with rbcl primers. Primers
used were those already used in the lab. 2*, 4* and 1* correspond to the original concentration of
dNTP two times more concentration (20mM), 4 times more concentrated (40mM) and with the same
concentration indicated on the protocol (10mM).

Analysis: On the first RPA for amplifying ITS (Fig 6), we can see bands for the well 4,5,6,7, 8 and 9
at approximately the same size of the ITS amplicon (700bp).
On the second RPA for amplifying trnH-psbA (Fig 7), we can see in all wells expected the well 9 bands
at the size of the trnH-psbA amplicon, except for the well 6, due to an error of manipulation. We also
have a band around 542bp for the no DNA control and nothing for the no primers as expected.
At last, for the last RPA amplifying the rbcl gene (fig 8), we can see bands around 745bp for wells from
1 to 6, and a bright band for the no DNA condition. As expected, we don’t have anything for the well
with no primers. We have smears for wells from 7 to 9, so we cannot say for sure that the amplification
worked, the experience was unsuccessful.

Conclusion: The RPA was successful for all our gene tested. With our results, we cannot conclude
that one concentration of dNTP is optimal for all genes since results seem to be different according to
the size of the amplicon. For ITS, 20mM seems to be the ideal concentration of a successful
amplification, whereas for trnH-psbA it seems to be 10mM and for rbcl bands on the gel are more intense
and visible for the concentration corresponding to 40mM of dNTPs. With those results, we suppose that
the minimal concentration of dNTPs for RPA can be different according to the size of the amplicon.
Finally, we see that for multiple wells, we do have perfectly clear bands and no band for the primers
(Fig 7): it can be a trail for a new axe of research: we could maybe vary the concentration of primers to
have better result for the amplification.

17
NB: in this experience, we have the presence of DNA in all our positive controls (no DNA). This can
be due to two things:

• We put DNA in the no DNA tube during the preparation of RPA tubes.
• RPA product is extremely volatile: it’s important to have only one tube at a time open
to not contaminate others. Contamination with volatile product could have been done
on the purification step or the loading step of the electrophoresis.

Now that we have seen and tested the impact of dNTP concentration and that we have a better idea of
the impact of the size of the amplicon on commercial DNA, we can investigate the impact of the
amplicon size by using newly designed primers for ITS.

With commercial DNA, we saw that the amplicon size didn’t have a huge impact on amplification results,
but it had certainly an impact on the concentration of dNTPs. Indeed, if the amplicon is longer, it
certainly needs more dNTPs. We can already suppose that a problem with microneedle extraction is
possible.

The idea with the ITS primers screening would be to determine if the size plays a role or not in the RPA
with MN DNA.

4. Primer screening for ITS

Aim of the experiment: determine if the size of the amplicon has an impact on recombinase
protein amplification efficiency by testing primer pairs, amplifying sections of different sizes
of the ITS gene (one half, three quarters and the entire gene).

Results:

18
Figure 9: Screening of ITS primers on microneedle extracted DNA and on
commercial DNA. Dotted line corresponds to the size of the amplicon that we are supposed to see
on the gel according to primers used. We used primers that we designed on benchling, corresponding
to one half of the ITS amplicon (Ft/Rv1), two third of the gene (Ft/Rv4) and all the amplicon
(fw4/Rv1). Positive and negative control's primers are those design from precedent work in the lab.

Analysis:

For the test of the pair Ft/Rv1 which correspond to the first half of the amplicon, we can see a small
band for the first well and some smears for the two wells with commercial DNA.
For the test of the pair Ft/Rv4 which correspond to two third of the amplicon, some smears are visible
for the first well, the third and the fourth but we don’t have any visible band at the size expected (around
589bp). Some bands are brighter between 300bp and 400bp, this could be dimerization of primers (cross
dimerization or self-dimerization).
For the test of the pair Ft/Rv which correspond to the full amplicon, we don’t have any bands at the size
expected. Like the precedent pair of primers some bands are visible between 100 and 400bp, and this is
probably dimerization of primers.
At last, the positive control done with the student’s precedent primers (fw4 and Rv1) have a small band
at the size of ITS amplicon, but it also has other bands spaced of 100bp each that shouldn’t be visible.
This error in the positive control could be due to:

• A contamination in the positive control tube with the ladder

• A contamination in the positive control tube with other primers
• Dimerization of those primers.

Conclusion :
In this experiment, during the loading step of the electrophoresis, our sample went out of the well as
soon as we tried to load them. We then tried first to space them and after the fourth well, we tried to

19
load only 10 l of the 20 l of electrophoresis solution (RPA + loading dye). The first four sample
almost went out of the well entirely. This problem with the gel could have been caused by:

• A problem in the TAE buffer (too concentrated)

• A problem in the washing of the comb with ethanol where a small amount of ethanol
could stay in the comb during the making of the gel.
• Errors of manipulation during the making of the gel.

Since the positive control didn’t work, we can say that this experience was unsuccessful. Next time, it
would be necessary to resolve problems with the gel and make sure that there’s no contamination.

IV. General conclusion and future prospect

In this report, we established the amplification stage for DNA barcoding, by realizing first a PCR to
know if the microneedle extraction worked and then realizing amplifications of our genes of interest
with RPA. We tried to vary different parameters in the purpose to improve our RPA protocol for future
uses on the field.

We first tried to vary the concentration of dNTPs to know if it has an impact on the amplification. Results
showed that the concentration of dNTPs has an impact, but there’s not a perfect concentration for all the
genes: it could depend on the size of the amplicon or the rate of GC, since for our three different genes
tested the rate was quite different (58% for ITS, 42% for rbcl and 28% for trnH-psbA). GC content can
indeed affect the efficiency of the amplification due to the tendency of these templates to fold into
complex secondary structures. This is due to increased hydrogen bonding between guanine and cytosine
bases, which can cause the DNA to be resistant to melting.

With this approach, we design multiple primers for two of our genes: rbcl and ITS to know if the size
of the amplicon had an impact on the amplification. We tried some of the primers designed for ITS to
amplify half of the amplicon, two thirds and the whole amplicon. Overall, the experience wasn’t
successful since there were problems with the gel.

For future prospects, it would be ideal to vary another parameter of the liquid base kit like the
concentration of primers or the concentration of Magnesium to know if those have a major impact on
the amplification.

For the primers already designed, there’s a lot to test in the future. It would be interesting to re-try the
ITS screening test with primers already tested and tested more combinations: we design 8 pair of primers

20
for ITS plus 1 reverse primer, so 12 combinations to test to have conclusive results. It could be also
promising to test rbcl primers already designed to know if they give a better result concerning the
amplicon size.

A test with primers used with the RPA/commercial DNA test would be interesting to do with this time
microneedle extracted DNA.

At last, if all our research is not conclusive concerning the RPA test, some research could be done on
other isothermal amplification techniques.
Other methods that could be useful on the field are HDA, with only two primers needed, a
constant temperature of 65°C, an amplification time from 30min to 120min and multiplexing
possible.

V. Protocols
NB : Make sure to keep all the genetic material on ice and have everything you need before starting the
experience.

1. Polymerase Chain Reaction (PCR)

We perform PCR on 4 genomic regions (ITS, trnH-psbA, rbcL & matK) of DNA of different plants
extracted by microneedles in the Vertigo excursion into the Jorat forest. We had around 52 samples of
different species, so we divided them into four groups of 13 samples each. This protocol is based on 13
samples so four 0.2ml tubes for each, sixty-four 0.2ml tube.

Before starting:
Label all your tube from 1 to 64. It’s important to order your labelling before starting the experience, so
we detail down below our labelling.

Material needed:
• 0.2ml tube
• 1.5ml tube
• Taq 2X Master Mix
• Forward Primer
• Reverse Primer
• Water

21
 • DNA template

The labelling of our 0.2ml for 13 samples with 13 species :

1. 1 trnH-psbA 33. 9 trnH-psbA
2. 1 ITS 34. 9 ITS
3. 1 matK 35. 9 matK
4. 1 rbcL 36. 9 rbcL
5. 2 trnH-psbA 37. 10 trnH-psbA
6. 2 ITS 38. 10 ITS
7. 2 matK 39. 10 matK
8. 2 rbcL 40. 10 rbcL
9. 3 trnH-psbA 41. 11 trnH-psbA
10. 3 ITS 42. 11 ITS
11. 3 matK 43. 11 matK
12. 3 rbcL 44. 11 rbcL
13. 4 trnH-psbA 45. 12 trnH-psbA
14. 4 ITS 46. 12 ITS
15. 4 matK 47. 12 matK
16. 4 rbcL 48. 12 rbcL
17. 5 trnH-psbA 49. 13 trnH-psbA
18. 5 ITS 50. 13 ITS
19. 5 matK 51. 13 matK
20. 5 rbcL 52. 13 rbcL
21. 6 trnH-psbA 53. trnH-psbA + control
22. 6 ITS 54. ITS + control
23. 6 matK 55. matK + control
24. 6 rbcL 56. rbcL + control
25. 7 trnH-psbA 57. No DNA (trnH-psbA primers)
26. 7 ITS 58. No DNA (ITS primers)
27. 7 matK 59. No DNA (matK primers)
28. 7 rbcL 60. No DNA (rbcL primers)
29. 8 trnH-psbA 61. No Primer
30. 8 ITS 62. No Primer
31. 8 matK 63. No Primer
32. 8 rbcL 64. No Primer

22
Note: For control we only use 1 uL of template and therefore we use 23uL of water

We design one master mix for each primer pair containing primers, Taq and water. We make it x16 as
we have 13 samples +1 positive control on commercial solanum lycopersicum (10ng/uL) + 2 reserve.
Master mix composition :

- Taq 2X Master Mix

- Forward Primer
- Reverse Primer
- Water

We mix 43 L of MM with 7uL of template.

For the control add 1 L of template and 6 of H20

1- Prepare the four Master Mixes by mixing the Taq 2X Master Mix, forward, reverse primer,
Water.
2- load 43 l of Master Mix with 7L of template. For the control add 1ul of template and 6 of
H20.
3- Put in the thermocycler all the sample with this program:

Thermocycler settings :

Cycles Step Temperature Time

1x Initial Denaturation 95°C 2m

45x Denaturation 95°C 30 s

Annealing 54°C 40 s

Extension 68°C 40 s

1x Final Extension 68°C 10 m

1x Hold 4°C ∞

23
 2. Recombinase Polymerase Amplification (RPA)

This protocol is based on the test of the impact of the concentration of dNTPs in the RPA.
We tested three different concentrations: 10mM, 20mM and 40mM. This protocol is based on
the TwistAmp™ Liquid Basic Quick Guide.

Before starting:

Pre-heat the thermocycler to 39°C with the program ‘RPA’. Label all the 0.2ml. Label the 1.5ml tube
for the different master mixes. Make sure that the core mix is at room temperature.

Material needed:

• 0.2 ml tube
• 1.5 ml tube
• UltraPure water
• TwistAmp™ Liquid Basic :
o 2X Reaction Buffer
o dNTPs (10mM)
o 10x Basic E-Mix
o 20x Core Reaction Mix

For one sample :

• 2X Reaction Buffer 25uL

• dNTPs 2.3uL (10mM)
• UltraPure water 6.9uL
• 10x Basic E-Mix 5uL
• Forward primer 2.4uL
• Reverse primer 2.4uL
•
Test of twistAmp liquid for 11 samples :

1. PC trnh *4 dNTPs
2. PC trnh *4 dNTPs
3. PC trnh *4 dNTPs

24
 4. PC trnh *2 dNTPs
5. PC trnh *2 dNTPs
6. PC trnh *2 dNTPs
7. PC trnh *1 dNTPs
8. PC trnh *1 dNTPs
9. PC trnh *1 dNTPs
10. No DNA
11. No Primers

Note : 4*, 2* and 1* concentrated means that the final solution should have 40mM, 20mM and 10mM
of dNTP.

1- Prepare 3 masters mix one for the *4 dNTPs, one for the *2 dNTPs, one for the 1* dNTPS. No DNA
control will be done with *2 dNTPs

Primer mix for *4 dNTPs (3 samples) • 2X Reaction Buffer 75uL

• dNTPs 27,6 uL (10mM)
• UltraPure water 20,7 uL
• 10x Basic E-Mix 15 uL
• Forward primer 7,2 uL
• Reverse primer 7,2 uL
• 20x Core Reaction Mix 7,5 uL

Primer mixes for *2 dNTPs (3 samples + 1 control) • 2X Reaction Buffer 100 uL

• dNTPs 18,4 uL (10mM)
• UltraPure water 27,6 uL
• 10x Basic E-Mix 20 uL
• Forward primer 9,6 uL
• Reverse primer 9,6 uL
• 20x Core Reaction Mix 10 uL

Primer mix for *1 dNTPs (3 samples) • 2X Reaction Buffer 75uL

• dNTPs 6,9 uL (10mM)
• UltraPure water 20,7 uL
• 10x Basic E-Mix 15 uL
• Forward primer 7,2 uL
• Reverse primer 7,2 uL

25
 • 20x Core Reaction Mix 7,5 uL

Mix for the control sample with no primers (do directly • 2X Reaction Buffer 25uL
in the 0.2 ml tube to avoid pipette errors). • dNTPs 2.3uL (10mM)
• UltraPure water 11,7 uL
• 10x Basic E-Mix 5uL
• 20x Core Reaction Mix 2,5 uL

Note: The 20x Core Reaction Mix should be warmed to room temperature and pipette mixed slowly to
ensure all proteins are in solution and homogenous.

2- Add 2.5 μl 20x Core Reaction Mix (per reaction) to tube lid. Mix by 10x full inversions of tube and
spin briefly. (If your template is RNA, add 1 μl 50x RT (per reaction) to tube lid.) Master mix is now
complete. Pipette mix before use.

3 - Add 46.5 μl master mix to 0.2ml PCR tubes (add a single micro ball to each tube if using a magnetic
mixing incubation device).

4- Add 2.5 μl 280 mM MgOAc (supplied) and 1 μl template (or DNase free water for negative control)
to the tube lids. DNA/RNA and MgOAc should be kept separate in the tube lid prior to spin-down, to
reduce the formation of tertiary structures. Spin in MgOAc/template and mix well (6x inversions) to
start reaction, spin-down briefly.

Note: The TwistAmp® reactions are activated using MgOAc. The RPA reaction starts as soon as the
MgOAc is added, even at room temperature. It is advisable to proceed swiftly to incubation of the sample
at the chosen incubation temperature once MgOAc has been added.

6- Incubate at 37-42°C for 20-40 minutes. For low template copy number, remove strip after 4 minutes
(5 minutes for RNA), mix by 6x full inversions and spin briefly, and replace in heating device.
Alternatively, magnetic mixing using a micro ball may be applied during incubation. Variation in sample
agitation timing can sometimes improve product formation.

7- After incubation period (step 5), clean amplicons before running on an agarose gel. See ‘Monitoring
TwistAmp® Liquid Basic/Basic RT amplification reactions.’

26
 3. Purification

The purification follows steps of the QIAquick PCR Purification Kit from Qiagen©

Before starting:

Prepare 3 tubes per sample you want to purify and label them: two 1.5 ml tube and one QIAquick column
per sample.

Material needed:

• QIAquick PCR purification kit, QIAGEN

o PE buffer
o PB Buffer
o QIAquick Spin Column
o EB buffer
• 1.5 ml tubes

1. Add 5 volumes Buffer PB to 1 volume of the RPA reaction in a 1.5 ml tube, vortex and
centrifuge. For this experiment we used 50 l of RPA and 250 l of Buffer PB per sample.
2. To bind DNA, apply the sample to the QIAquick column and centrifuge for 30–60s until all the
samples have passed through the column. Discard flow-through and place the QIAquick column
back in the same tube.
3. To wash, add 750 µl Buffer PE to the QIAquick column centrifuge for 30–60 s. Discard flow-
through and place the QIAquick column back into the same tube.
4. Centrifuge the QIAquick column once more in the provided 2 ml collection tube for 1 min to
remove residual wash buffer.
5. Place each QIAquick column in a clean 1.5 ml microcentrifuge tube.
6. To elute DNA, add 50 µl Buffer EB (10 mM Tris·Cl, pH 8.5) or water (pH 7.0–8.5) to the center
of the QIAquick membrane and centrifuge the column for 1 min. For increased DNA
concentration, add 30 µl elution buffer to the center of the QIAquick membrane, let the column
stand for 1 min and then centrifuge. For this experiment, we add 30 l of elution buffer in order
to have a more concentrated result.

27
 4. Agarose Gel

Small electrophoresis agarose gel: 100ml

Large electrophoresis agarose gel: 200ml
Extra small agarose gel: 60ml

For the experiment with the RPA, since we do not have many samples, we used two small gels (120 ml
of solution in total). For the PCR, since we had a lot of samples, we used one large gel and two small
gels (320 mL of solution)

Before starting:

Wash all molds, electrophoresis gel boxes, combs for gel and other material used for the preparation
with ethanol.

Material needed:

• Weighing ship
• Thing for stirring.
• Thing for weighting
• Molds
• Analytic weight
• 250mL or 500mL Erlenmeyer flask (selon la quantité souhaitée)
• Standard agarose powder, type-LE
• 1X TAE Electrophoresis buffer (prepared by mixing 1L distilled water and 20ml of 50X
TAE)
• SYBR stain

PCR (320ml of solution) • 4,8g of agarose powder

• 230mL of 1X TBE or TAE
• Gel Stain 23 l

RPA (120ml of solution) • 1,8g of agarose powder

• 120ml 1X TBE or TAE
• Gel Stain 12 l

28
 1. Weigh 1.5% agarose, put in a Erlenmeyer (500ml of 250ml) or microwavable flask
2. Add 120ml (230ml) 1X TBE or TAE.
3. Microwave the flask and stir every 30s until agarose is fully dissolved into the solution: liquid
should be transparent but not boiling. (It should take between 3 to 5 min)
4. Add 10 l /100 ml of solution EtBr of SYBR stain into the Erlenmeyer (check the concentration)
and stir until it’s fully dissolved.
5. Pour the solution into the mold.
6. Mix well with the comb (avoid air bubbles) then place it.
7. Let dry for max 45 min.

5. Ladder Preparation

This protocol is following the protocol of BioLabs ladder, and so only follows the BioLabs
Ladder:

Material needed:

• Distilled water (dH20) or TE buffer

• Gel loading Dye, Purple (6X), no SDS
• DNA Ladder/Marker
• 1.5 ml tube

Distilled water (dH20) or TE buffer 4 l

Gel loading Dye, Purple (6X), no SDS 1 l
DNA Ladder/Marker 1 l
Total Volume 6 l

1. Prepare the loading mixture.

2. Mix gently by pipetting.
3. Load onto the agarose gel

6. Electrophoresis

29
Before starting

Make sure to label all the 0.2ml tube where we’re going to put all samples for the electrophoresis to
know where to load all your sample in your agarose gels.

Material needed:

• 6X loading dye
• DNA ladder
• 0.2 ml tubes
• 1X TAE buffer

1. Take 20l from the RPA samples in an 0.2 ml tube: add 4uL of 6X loading dye to the 20l
solutions (up and down well). To make shore to not have too much loading dye in each sample,
centrifuge the loading dye tube to avoid drops on the tip of the micropipette.
2. Put the agarose gel in the electrophoresis gel box corresponding to the size of the gel.
3. Fill the bow with 1X TAE buffer until the gel is covered by 5mm.
4. Load 10 l for the ladder (if already colored). If it’s Biolabs ‘s Ladder, load 6 l of the ladder
preparation described before.
5. Load the gel with 20l of each sample (quick spin the tubes if needed)
6. Apply wires to the gel stand and the other ends to the power supply. (Make shore that wells are
next to the negative electrodes since DNA is negatively charged and so migrates toward the plus
end).
7. Run for 45min at 80V for extra small or small gel, 70min at 120V for the large gel. (Adjust time
in function of the position of the visible bands: if two combs are used for the extra small gel
time should be adjust to 30-35min)
8. Visualize the results under UV light. Save picture

7. Primer resuspension

This protocol is based on the Microsynth guideline: https://www.microsynth.com/hints-and-tips.html

Before starting :

Make sure you use nuclease-free solutions only (see our suggestion below for potential solvents) Handle
the DNA oligonucleotides carefully to avoid bacterial contamination.

30
Oligos are more stable at higher concentrations.
Pre-heat the heater at 65°C

Material needed:

- Nuclease free Water

- Dehydrated oligo DNA

1- Do a short spin at max. speed in a centrifuge to collect the pellet at the bottom of the
tube
2- Add an appropriate amount of sterile water or buffer (check the technical sheet given
by microsynth)
3- Heat the tube for 5 minutes at 65°C
4- Vortex or mix by pipetting vigorously up and down

VI. Bibliography
Ho, Viet The, Thi Kim Phuong Tran, Thi Thanh Tram Vu, et Sasanti Widiarsih. 2021. « Comparison of
matK and rbcL DNA Barcodes for Genetic Classification of Jewel Orchid Accessions in
Vietnam ». Journal, Genetic Engineering & Biotechnology 19 (1): 93.
https://doi.org/10.1186/s43141-021-00188-1.

Hollingsworth, Peter M., Sean W. Graham, et Damon P. Little. 2011. « Choosing and Using a Plant
DNA Barcode ». PloS One 6 (5): e19254. https://doi.org/10.1371/journal.pone.0019254.

Klein, U., M. L. Salvador, et L. Bogorad. 1994. « Activity of the Chlamydomonas Chloroplast rbcL
Gene Promoter Is Enhanced by a Remote Sequence Element ». Proceedings of the National
Academy of Sciences of the United States of America 91 (23): 10819‑23.
https://doi.org/10.1073/pnas.91.23.10819.

Kress, W. John, et David L. Erickson. 2012. « DNA Barcodes: Methods and Protocols ». Methods in
Molecular Biology (Clifton, N.J.) 858: 3‑8. https://doi.org/10.1007/978-1-61779-591-6_1.
Lobato, Ivan Magriñá, et Ciara K. O’Sullivan. 2018. « Recombinase Polymerase Amplification: Basics,
Applications and Recent Advances ». Trends in Analytical Chemistry: TRAC 98 (janvier): 19‑35.
https://doi.org/10.1016/j.trac.2017.10.015.

Pang, Xiaohui, Chang Liu, Linchun Shi, Rui Liu, Dong Liang, Huan Li, Stacey S. Cherny, et Shilin
Chen. 2012. « Utility of the trnH-psbA Intergenic Spacer Region and Its Combinations as Plant
DNA Barcodes: A Meta-Analysis ». PloS One 7 (11): e48833.
https://doi.org/10.1371/journal.pone.0048833.

Selz, Jonathan, Nicolas R. Adam, Céline E. M. Magrini, Fulvia Malvido Montandon, Sven Buerki, et
Sebastian J. Maerkl. 2023. « A Field-Capable Rapid Plant DNA Extraction Protocol Using
Microneedle Patches for Botanical Surveying and Monitoring ». Applications in Plant Sciences
11 (3): e11529. https://doi.org/10.1002/aps3.11529.

Twistamp assay design manual. 2018.

31
32