307

ARTICLE
Boswellic acid disables signal transduction of IL-6–STAT-3 in
Ehrlich ascites tumor bearing irradiated mice
Enas Mahmoud Moustafa, Noura Magdy Thabet, and Khaled Shaaban Azab

Abstract: Boswellic acid (BA) is known for its ability to trigger apoptosis as well as to inhibit angiogenesis in tumor tissue. In this
study, we investigated the effect of BA on the IL-6–STAT-3 signalling pathway in irradiated mice bearing solid tumors of Ehrlich
ascites carcinoma (EAC). For this, we administered BA (25 mg·(kg body mass)–1·day–1, by intraperitoneal injection) to mice with
EAC, and then exposed them to 4 Gy of gamma radiation. Data analyses of the results revealed a specific impact from BA on IL-6R
mRNA and survivin mRNA in EACs and irradiated EAC-bearing mice. Also, significant improvements were observed in the
protein expression of JAK-1, P-JAK-1, STAT-3, P-STAT-3, and caspase-3, as well as VEGF and IL-6 levels. We propose that BA
interfered with IL-6–STAT-3 signal transduction, thereby preventing the activation of caspase-3 and subsequently triggering the
process of apoptosis. However, the alternative angiogenesis pathway, which includes the over-expression of VEGF and which
depends on IL-6–STAT-3 signalling, was inhibited by the action of BA. Thus, we recommend that therapeutic strategies for cancer
should include treatment with BA.

Key words: boswellic acid, gamma radiation, IL-6R, STAT-3, P-JAK-1, P-STAT-3.

Résumé : L’acide boswellique (AB) est reconnu pour sa capacité à déclencher l’apoptose ainsi qu’à inhiber l’angiogenèse dans les
tissus tumoraux. Dans la présente étude, l’effet de l’AB sur la signalisation de l’IL-6/STAT-3 a été examiné chez des souris
irradiées, porteuses de la tumeur ascitique solide de Ehrlich (EAC). Une dose de 25 mg·(kg de masse corporelle)–1·jour–1 (i.p.) d’AB
a été administrée aux souris porteuses de la EAC et exposées à 4 Gy de radiation gamma. L’analyse des données a révélé un impact
spécifique de l’AB sur l’ARNm de l’IL-6 et de la survivine chez les souris EAC et EAC irradiées. Des améliorations significatives
étaient aussi observées sur le plan de l’expression protéique de JAK-1, P-JAK-1, STAT-3, P-STAT-3 et caspase-3, de même que sur les
niveaux de VEGF et d’IL-6. Les auteurs suggèrent que l’AB a interféré avec la voie de transduction de l’IL-6–STAT-3, qui prévient
l’activation de la caspase-3 et déclenche subséquemment le processus d’apoptose. Le sentier angiogénique alternatif, qui inclut
la surexpression de VEGF qui dépend de la signalisation de l’IL-6/STAT-3, était inhibé par l’action de l’AB. Il est permis de
recommander ici que les stratégies thérapeutiques du cancer incluent l’administration d’AB. [Traduit par la Rédaction]

Mots-clés : acide boswellique, irradiation gamma, IL-6R, STAT-3, P-JAK-1, P-STAT-3.

Introduction fundamental role in fluid accumulation and tumor growth in

Signal-transducer-and-activator-of-transcription (STAT) is a fam-
ily of 6 different transcription factors that play major roles in
cytokine signalling. STAT-3 is one of the major mediators of tu-
morigenesis. The oncogenic significance of activated STAT-3 mol-
ecules is due to their effects on numerous parameters for the
development and progression of malignancy, such as apoptosis,
cell proliferation, angiogenesis, and immune system evasion
(Aggarwal et al. 2006). STAT-3 was initially regarded as an acute-
phase response factor activated by interleukin-6 (IL-6). IL-6 first
binds to the IL-6 receptor (IL-6R), and this complex then associates
with gp130, inducing dimerization and the initiation of STAT-3
phosphorylation by Janus kinase (JAK) (Mitsuyama et al. 2007). The
caspases, key players in the apoptotic pathway, are a family of
cysteine proteases. They are synthesized as proenzymes and acti-
vated by proteolytic cleavage. Caspase 3 is considered to be the
key effector caspase. Survivin is a member of the “inhibitor of
apoptosis” protein family. It inhibits apoptosis directly or indi-
rectly by suppressing the caspase 3 function (Poomsawat et al.
2014). Angiogenesis is an essential step in the development of
tumors, and vascular endothelial growth factor (VEGF) plays a
ascites tumors (Agrawal et al. 2011).
Cancer continues to be one of the major devastating diseases.
Cancer is a class of disease in which a cell or a groups of cells
displays uncontrolled growth, invasion, and metastasis (Dolai et al.
2012). Experimental tumors have great importance in modeling,
and Ehrlich ascites carcinoma (EAC) is one of the commonest
tumors. It is a spontaneous murine mammary adenocarcinoma
adapted to ascites form and carried in outbred mice by serial
intraperitoneal (i.p.) passages. EAC has high transplantable capa-
bility, no regression, rapid proliferation, short life span, 100% ma-
lignancy, and also does not have tumor-specific transplantation
antigen (TSTA). EAC is used as ascites or a solid form because of
these properties; that is, if ascites fluid containing the tumor cells
is administered by i.p. injection, the ascites form is obtained, but
if the fluid is injected subcutaneously (s.c.) or intramuscularly
(i.m.), a solid form is obtained (Ozaslan et al. 2011; El-Bahy et al.
2012). Since the description of Ehrlich ascites, researchers have
exploited it for chemotherapeutic studies (Jaganathan et al. 2010).
The biological effects of radiation affect both neoplastic and
normal tissues. The nature and extent of such effects, however,
depend on specific biological parameters, and can be modified by

Received 18 December 2015. Accepted 12 March 2016.

E.M. Moustafa, N.M. Thabet, and K.S. Azab. Radiation Biology Department National Centre for Radiation Research and Technology, Atomic Energy
Authority, Cairo, Egypt.
Corresponding author: Noura Magdy Thabet (email: noura_magdy@hotmail.com).
Copyright remains with the author(s) or their institution(s). Permission for reuse (free in most cases) can be obtained from RightsLink.

Biochem. Cell Biol. 94: 307–313 (2016) dx.doi.org/10.1139/bcb-2015-0169 Published at www.nrcresearchpress.com/bcb on 22 March 2016.
308
chemical agents such as chemotherapeutic agents. Precise control
of the mode of action of the radiation is important to achieve the
maximum effect on tumor tissue while minimizing the effects on
normal tissue. Combination therapy treatment for tumors with
radiation and different anticancer drugs has been tried clinically.
Herbal medicines have gained attention and popularity because
of their negligible toxicity, and possibly offer the hope that they
may replace some of the available antineoplastic drugs that are
highly toxic (Jagetia and Venkatesha 2005).
Boswellic acid (BA) is isolated from Boswellia serrata. BAs have
been used to treat Crohn’s disease, ulcerative colitis, bronchial
asthma, endotoxin-induced hepatitis, and arthritis. BA is a mixture
composed of 4 major pentacyclic triterpene acids: beta-boswellic
acid, 3-acteyl beta boswellic acid, 11-ketobeta-boswellic acid, and
3-acetyl-11-keto-beta-boswellic acid (AKBA), which are reported to
be effective as anti-inflammatory, immune-modulator, and anti-
asthmatic agents (Agrawal et al. 2011).
This study looks at the possible beneficial effects of BA in cancer
treatment via studying the IL-6–STAT-3 signalling pathway in
EAC-bearing irradiated mice. Among these, the mRNA expression
of IL-6 receptor/IL-6 levels, JAK-1/phospho-JAK-1 (P-JAK-1), and
STAT-3/phospho-STAT-3 (P-STAT-3), in addition to apoptotic
(survivin and caspase-3) proteins as well as angiogenic (VEGF)
protein were assayed.
Materials and methods
Materials
Boswellic acid was obtained from Nature’s Way Products (Spring-
ville, Utah, USA), whereas other chemicals and reagents were ob-
tained from the Sigma–Aldrich Chemical Co.
Radiation facility
Whole body ␥-irradiation of mice was performed with a Cana-
dian gamma cell-40, (137Cs) at the National Center for Radiation
Research and Technology, Cairo, Egypt, at a dose rate of 0.46 Gy·min–1.
Experimental animals
Adult female Swiss albino mice weighing 22–25 g, obtained
from the breeding unit of the Egyptian Organization for Biologi-
cal Products and Vaccines (Cairo), were used in this study. The
animals were acclimatized for one week and during this period
they were maintained on a commercial standard pellet diet and
water, ad libitum. In vivo studies were conducted under National
Research Centre guidelines for the use and care of laboratory
animals, and were approved by an independent ethics committee
of the National Centre for Radiation Research and Technology.
Methods
Tumor transplantation
A cell line of EAC was used in this study. The parent line was
supplied by the Egyptian National Cancer Institute (NCI), Cairo
University. EAC cells originated from human breast cancers that
were modified to grow in female Swiss albino mice, and main-
tained by the i.p. administration of 2.5 million carcinoma cells in
the mice. The EAC cells were counted before the i.p. injection,
using a bright line haemocytometer, and dilution was done using
physiological sterile saline solution. To asses Ehrlich solid tumor
(EST) in thigh muscle, 0.2 mL EAC cells (2.5 × 106 cells·mouse–1)
were inoculated i.m. in the right thigh of the lower limb of the
female mice (Gupta et al. 2004; El-Bahy et al. 2012).
Experimental design
In our study design, 50 mice were randomly distributed equally
among 5 groups (10 mice each) as follows: (i) control group (C; mice
in this group were neither treated nor irradiated, but just received
saline by gavage); (ii) the EAC-bearing group (E; EAC cells were
implanted i.m. into the right thigh of the hind limb of the mice
at time zero of experiment); (iii) BA-treated EAC-bearing group,
Biochem. Cell Biol. Vol. 94, 2016
(E+BA; mice in this group received 7 successive doses of BA
(25 mg·(kg body mass)–1·day–1; i.p.) (Agrawal et al. 2011), starting
from day 13 of tumor implantation and continuing to day 20;
(iv) radiation-treated EAC-bearing group (E+R; mice in this group
were inoculated with EAC and exposed to radiation (4 Gy) on
day 13 of the experiment; (v) EAC-bearing mice treated with BA
and R (E+BA+R; mice were inoculated with EAC, exposed to 4 Gy of
radiation, and treated with BA. At the end of BA treatments, the
animals were sacrificed. The skeletal muscle (normal control) and
tumor tissues in the EAC-bearing groups were collected for bio-
chemical and histopathological examination.
Biochemical assays
Lipid peroxidation was measured by thiobarbituric acid assay,
which is based on the reaction of malondialdehyde (MDA) with
thiobarbituric acid to form thiobarbituric acid reactive sub-
stances (TBARS), which are a pink-coloured complex exhibiting a
maximum absorption at 532 nm (Yoshioka et al. 1979). ELISA kits
(R&D Systems) were used, according to the manufacturer’s in-
structions, for the enzyme-linked immunosorbent assays to deter-
mine the levels of VEGF and IL-6 in the supernatants of sample
tissue homogenates. In brief, microplates were coated with
100 ␮L·well–1 of capture antibody, and then they were incubated
overnight at 4 °C. After washing, the plates were blocked with
assay diluent at room temperature for 1 h. One hundred microli-
ters of a serum sample was added to each well of the plate, fol-
lowed by incubation for 2 h at room temperature. Working
detector was added into each well, and the plate was incubated for
an additional 1 h at room temperature before adding the substrate
solution. The reaction was stopped by adding stop solution. The
absorbance was read using an ELISA reader. The concentrations
were calculated from standard curves, according to the instruc-
tions in the protocol.
Detection of IL-6R and survivin gene expression by quantitative
real time PCR
RNA isolation and reverse transcription
RNA was extracted from the tumor tissue homogenate using
the RNeasy plus mini kit (QIAGEN, Venlo, the Netherlands), ac-
cording to the manufacturer’s instructions. Genomic DNA was
eliminated by a DNase-on-column treatment supplied with the
kit. The RNA concentration was determined spectrophotometri-
cally at 260 nm using the NanoDrop ND-1000 spectrophotometer
(Thermo Fisher Scientific, Waltham, Massachusetts, USA), and
RNA purity was checked by means of the absorbance ratio at
260–280 nm. RNA integrity was assessed by electrophoresis on
2% agarose gels. RNA (1 ␮g) was used in the subsequent cDNA
synthesis reaction, which was performed using the reverse tran-
scription system (Promega, Leiden, the Netherlands). Total RNA
was incubated at 70 °C for 10 min to prevent secondary structures.
The RNA was supplemented with MgCl2 (25 mmol·L–1), RTase buf-
fer (10×), dNTP mixture (10 mmol·L–1), oligod(dT) primers, RNase
inhibitor (20 U), and AMV reverse transcriptase (20 U·␮L–1). This
mixture was incubated at 42 °C for 1 h.
Quantitative real time PCR
qRT-PCR was performed in an optical 96-well plate with an ABI
PRISM 7500 fast sequence detection system (Applied Biosystems,
Carlsbad, California, USA) and universal cycling conditions of
40 cycles of 15 s at 95 °C and 60 s at 60 °C after an initial denaturation
step at 95 °C for 10 min. Each 10 ␮L reaction contained 5 ␮L SYBR
Green Master Mix (Applied Biosystems), 0.3 ␮L gene-specific for-
ward and reverse primers (10 ␮mol·L–1), 2.5 ␮L cDNA, and 1.9 ␮L
nuclease-free water. The sequences of PCR primer pairs used for
each gene are shown in Table 1. Data were analysed with the ABI
Prism sequence detection system software and quantified using
the version 1.7 sequence detection software from PE Biosystems
Published by NRC Research Press
Moustafa et al.
Table 1. Primer sequences used for RT-PCR.
Primer Sequence (5=–3=)
IL-6R Forward: GATGAGTACAAAAGTCCTGATCCA
Reverse: CTGCAGCCACTGGTTCTGT
Survivin Forward: GCCACTTGTCCCAGCTTTCC
Reverse: GTCACAATAGAGCAAAGCCACA
GAPDH Forward: CTCCCATTCTTCCACCTTTG
Reverse: CTTGCTCTCAGTATCCTTGC
(Foster City, Calif.). Relative expression of the studied genes was
calculated using the comparative threshold cycle method. All val-
ues were normalized to the endogenous control GAPDH (Livak
and Schmittgen 2001).
Western blot analysis of JAK-1, P-JAK-1, STAT-3, P-STAT-3, and
caspase-3
A section of tissue was homogenized with RIPA buffer contain-
ing 5 mol·L–1 NaCl, 1 mmol·L–1 phenylmethylsulfonyl fluoride
(PMSF), 10% deoxycholic acid (DOC), 10% sodium dodecyl sulphate
(SDS), and 1 mol·L–1 Tris (pH 8.6). The tissue lysate was centrifuged
at 23 182g for 20 min at 4 °C. The lysate was then collected and
protein concentration was determined with a BCA protein assay
kit (Thermo Fisher Scientific). An aliquot of 7.5 ␮g protein of each
sample was denatured, then each sample was loaded on 8% SDS –
polyacrylamide gels for separation by electrophoresis and then
transferred to a nitrocellulose membrane (Amersham Bioscience,
Piscataway, New Jersey, USA) using a semidry transfer apparatus
(Bio-Rad, Hercules, Calif.). The membranes were incubated at 4 °C
overnight with 5% milk blocking buffer containing 10 mmol·L–1
Tris–HCl (pH 7.4), 150 mmol·L–1 NaCl, and Tris-buffered saline with
0.05% Tween-20 (TBST). The membranes were then washed with
TBST and incubated on a roller shaker at 4 °C overnight with a
1:1000 dilution of anti-caspase-3 or anti JAK-1 antibodies (total and
phosphorylated) or anti-STAT-3 (total and phosphorylated; Thermo
Fisher Scientific). The filters were washed and subsequently
probed with horseradish-peroxidase-conjugated goat anti-mouse
immunoglobulin (Amersham. Life Science). Chemiluminescence
detection was performed with the Amersham detection kit, ac-
cording to the manufacturer’s protocols, and exposed to X-ray
film. The amount of studied protein was quantified by densito-
metric analysis of the autoradiograms using a scanning laser den-
sitometer (Biomed Instruments). Results were normalized against
␤-actin protein expression (as the housekeeping protein) (Mingone
et al. 2003).
Histopathological study
Autopsy samples were taken from the thigh muscle of mice
from the different groups and fixed in 10% formol saline for 24 h.
The samples were washed in tap water, then dehydrated in serial
dilutions of alcohol (methyl, ethyl, and absolute ethyl). Specimens
were cleared in xylene and embedded in paraffin at 56 °C in a
hot-air oven for 24 h. Paraffin – bees wax tissue blocks were pre-
pared for sectioning at 4 ␮m thickness with a slide microtome.
The tissue sections were collected on glass slides, deparaffinized,
and stained with hematoxylin and eosin for routine examination
by light microscopy (Banchroft et al. 1996).
Statistics
Statistical analysis was performed by one-way analysis of vari-
ance (ANOVA) followed by Duncan’s Multiple Range test, using
SPSS version 15.0 for Windows. Values for P ≤ 0.05 were consid-
ered statistically significant.
309
Results
Biochemical assay
Impact of BA on the IL-6 –STAT-3 pathway in the presence or
absence of gamma radiation
This study was designed to investigate the effects of BA on the
IL6–STAT-3 pathway by measuring the levels of IL-6R, IL-6, JAK-1,
P-JAK-1, STAT-3, and P-STAT-3.
The control levels of IL-6R and IL-6 were 1.04 ± 0.01 and 32.93 ±
0.68 pg·(mg tissue)–1, respectively. The normal levels of JAK-1 and
P-JAK-1 were 1.02 ± 0.02 and 0.73 ± 0.016, respectively; STAT-3 and
P-STAT-3 were 1.08 ± 0.015-fold and 0.68 ± 0.019-fold, respectively.
The gene expression of IL-6R mRNA and IL-6 levels in the tumor
tissue were significantly higher (P < 0.05) in the E-bearing group
compared with the control. After administration of BA and expo-
sure to ␥-radiation, the data revealed significant modulation in
gene expression of IL-6R mRNA (Fig. 1A) and IL-6 levels (Fig. 1B) in
the E+BA, E+R, and E+BA+R groups compared with the E group.
Also, the protein expression of JAK-1 and P-JAK-1 were signifi-
cantly increased in tumor tissues of the E group compared with
the control. But after administration of BA and (or) exposure to
␥-radiation (E+BA, E+R, and E+BA+R groups) a significant decrease
(P < 0.05) was observed in the protein expression of JAK-1 (Figs. 1C
and 1G) and P-JAK-1 (Figs. 1D and 1G) compared with the E group.
Significant increases were also found for the protein expression
of STAT-3 (Figs. 1E and 1G) and P-STAT-3 (Figs. 1F and 1G) in the
E group compared with the control group, and this result was
significantly improved (P < 0.05) by treatment with BA and (or)
exposure to ␥-radiation.
Impact of BA on survivin and caspase-3 levels in the presence or
absence of gamma radiation
The control levels of survivin and caspase-3 were about 1.02 ±
0.01 and 1.03 ± 0.023, respectively. By comparison with the control
group, in the E group the gene expression of survivin mRNA was
significantly increased (P < 0.05) (Fig. 2A), but there was a signifi-
cant (P < 0.05) decrease in protein expression of caspase-3 (Figs. 2B
and 2C). However, in the E+BA, E+R, and E+BA+R groups, the gene
expression of survivin mRNA and protein expression of caspase-3
were significantly different from the E group (P < 0.05) (Fig. 2).
Impact of BA on VEGF levels in the presence or absent of gamma
radiation
The control level of VEGF was 29.03 ± 0.61 pg·(mg tissue)–1. The
data obtained revealed a significant increase (P < 0.05) in VEGF
levels in the E group compared with the control (Fig. 3A). How-
ever, there were significant (P < 0.05) decreases in VEGF levels in
the E+BA, E+R, and E+BA+R groups compared with the E group
(Fig. 3A).
Impact of BA on lipid peroxidation in the presence or absent of
gamma radiation
The control level of MDA (index of lipid peroxidation) was
109.28 ± 2.12 nmol·(g wet tissue)–1. There was a significant increase
(P < 0.05) in MDA levels in the E group compared with the control
group. However, there was a significant decrease in MDA levels in
the E+BA, E+R, and E+BA+R groups (P < 0.05) compared with the
E group (Fig. 3B).
Histopathological study
The histopathological examination of skeletal muscle (thigh
muscle) showed no histopathological alteration in the muscle
bundle in the control group (Fig. 4A). In the E group, tumor cells
had penetrated the muscle bundles and showed cellular pleomor-
phism and nuclear hyperchromasia (Fig. 4B). In the E+R group,
massive numbers of EAC tumor cells infiltrated the muscle bun-
dles (Fig. 4C). In the E+BA group, a wide area of necrosis was
detected in the muscle bundles associated with apoptosis in the
Published by NRC Research Press
310 Biochem. Cell Biol. Vol. 94, 2016

Fig. 1. IL-6–STAT-3 pathway. (A) Gene expression of IL-6R mRNA (real-time PCR). (B) IL-6 level. (C) Protein expression of JAK-1. (D) P-JAK-1.
(E) STAT-3. (F) P-STAT-3 (Western blot analysis). (G) SDS–PAGE of JAK-1/P-JAK-1 (130 kDa) and STAT-3/P-STAT-3 (92 kDa) proteins, and ␤-actin
(42 kDa) as the housekeeping protein. Values are the mean ± SE (n = 10 female Swiss albino mice); a, P ≤ 0.05 compared with the control
group; b, P ≤ 0.05 compared with the E group. E group, mice with Ehrlich ascites carcinoma (EAC); E+R, mice with EAC treated with gamma
radiation; E+BA, mice with EAC treated with boswellic acid (BA); E+BA+R, mice with EAC treated with BA and radiation.

EAC tumor cells (Fig. 4D). However, in the E+BA+R group, there
was a wide area of necrosis and apoptosis in most of the EAC
tumor cells in the muscle bundles (Fig. 4E).
Discussion
Several studies have targeted the IL-6–STAT-3 signalling path-
way because of its pivotal role in tumor proliferation. IL-6 has
been linked with the proliferation of many cancer types (multiple
myloma, renal cell, carcinoma, prostate cancer, etc.), and has
been shown to induce its effects through the activation of STAT-3
protein via phosphorylation of its tyrosine units. IL-6 engages
with the cell surface cytokine receptor (IL-6R) activating Janus
kinase (JAK), which phosphorylates the latent STAT-3 proteins in
the cytoplasm (Aggarwal et al. 2006). The data obtained from our
study agree with Aggarwal et al. (2006), in that the gene expres-
sion of IL-6R mRNA and the level of IL-6 as well as the protein
expression of JAK-1/P-JAK-1 and STAT-3/P-STAT-3 are over-
expressed in the E group compared with the control mice (Fig. 1).
The observed increases in IL-6R could sustain the presence of
activated STAT-3 due to increased possibilities for IL-6 cytokine –
receptor interaction. Further, over-expression of survivin to-
gether with decreased protein expression of caspase-3 were ob-

Published by NRC Research Press

Moustafa et al. 311

Fig. 2. Survivin and caspase-3. (A) Gene expression of survivin mRNA (real-time PCR). (B) Protein expression of caspase-3 (Western blot
analysis). (C) SDS–PAGE of caspase-3 protein (35 kDa) with ␤-actin (42 kDa) as the housekeeping protein. Values are the mean ± SE (n = 10 female
Swiss albino mice); a, P ≤ 0.05 compared with the control; b, P ≤ 0.05 compared with the E group. E group, mice with Ehrlich ascites
carcinoma (EAC); E+R, mice with EAC treated with gamma radiation; E+BA, mice with EAC treated with boswellic acid (BA); E+BA+R, mice
with EAC treated with BA and radiation.

Fig. 3. Effect of BA on VEGF and MDA. Values are the mean ± SE (n = 10 female Swiss albino mice); a, P ≤ 0.05 compared with the control group; b,
P ≤ 0.05 compared with the E group. E group, mice with Ehrlich ascites carcinoma (EAC); E+R, mice with EAC treated with gamma radiation; E+BA,
mice with EAC treated with boswellic acid (BA); E+BA+R, mice with EAC treated with BA and radiation; MDA, malondialdehyde.

served (Fig. 2). Also, levels of the angiogenic mediator VEGF
increased significantly (Fig. 3). Constitutively, active STAT-3 has
been implicated in the induction of resistance to apoptosis. Its
role in tumorigenesis is mediated through the expression of var-
ious genes that suppress apoptosis and mediate cell proliferation,
invasion, and angiogenesis. These genes include survivin (which
suppresses apoptosis directly, or indirectly by suppressing
caspase-3) and VEGF (Aggarwal et al. 2006; Poomsawat et al. 2014).
It is worth noting that the increases observed in the end-product
of lipid peroxidation (MDA) in the E group compared with the
control mice were associated with the increases in IL-6–STAT-3
signalling (Fig. 1). This could be interpreted to mean that the de-
veloping tumor damages the surrounding tissues, causing them
to release oxygen-derived free radicals. These free radicals attack
macromolecules such as lipids, thereby initiating the lipid peroxi-
dation process, ending with the formation of MDA. Agrawal et al.
(2011) reported that the MDA concentration in cancer tissues is
significantly higher than in nondiseased tissue. Further, Vijaya
and Balu (2015) showed a strong positive correlation between the
levels of IL-6 and MDA. Moreover, the accumulation of lipid per-
oxide moieties during lipid peroxidation steps is involved in the
activation of STAT-3 (Mazière et al. 1999). Histopathological exam-
ination of the tumors from the E and the E+R groups determined
a noticeable change in muscle bundles and the cell architecture in
addition to the occurrence of tumor cell infiltration and penetra-
tion when compared with the micrograph of thigh muscle bun-
dles from the control group (Fig. 4). These results could be
attributed to the changes observed in biochemistry of tumors,

Published by NRC Research Press

312 Biochem. Cell Biol. Vol. 94, 2016

Fig. 4. Histopathological examination of tumor tissues (Ehrlich ascites carcinoma (EAC) in mouse thigh muscle). (A) Skeletal muscle (thigh) of
the control group showing the normal histological structure of the muscle bundles. (B) Thigh muscle from the E group showing hyperchromatic
nuclei and pleomorphic EAC cells penetrating the muscle bundles. (C) Thigh muscle from the E+R group showing massive numbers of EAC
cells infiltrating the bundles. (D) Thigh muscle from the E+BA group showing wide areas of necrosis in the muscle bundles as well as
apoptosis in most of the EAC cells. (E) Thigh muscle from the E+BA+R group showing wide areas of necrosis in the muscle bundles and
apoptosis in most of the EAC cells. (A–E) Stained with hematoxylin and eosin, magnification 400×. E group, female Swiss albino mice with
Ehrlich ascites carcinoma (EAC); E+R, mice with EAC treated with gamma radiation; E+BA, mice with EAC that were treated with boswellic
acid (BA); E+BA+R, mice with EAC treated with BA and radiation. [Colour online.]

where the changes in IL-6–STAT-3 signalling and the accumula-
tion of MDA in the cells of muscle bundles destroyed the integrity
of the cells and led to tumor proliferation. The MDA accumulation
at the end of the lipid peroxidation process deteriorated the intact
cell membranes (Moustafa et al. 2015).
The results show a noticeable increase in IL-6–STAT-3 signalling
in the E+R group compared with the control group; however,
significant decreases were observed when compared with the
E group (Fig. 1). One could expect that the increase in IL-6–STAT-3
signalling would be magnified in the E+R group compared with
the E group; however, the opposite occurred. This might be re-
lated to a suppressive mechanism associated with the radiation
(senescence effect), which is associated with slowed production of
certain cytokines and growth factors (IL-6 and VEGF) (Figs. 1 and 3).
Yu et al. (2013) found that senescence was induced by 3–6 Gy of
radiation. Cellular senescence is a permanent cell-cycle arrest that
was initially described as the terminal phase of primary cell pop-
ulations that cannot be stimulated to return to the cell cycle by
growth factors. Therefore, senescence is viewed as a tumor-
suppressive mechanism that prevents cancer cell proliferation.
Diverse factors, such as oxidative damage, telomere dysfunction,
DNA damage response caused by ionising radiation, and several
chemotherapeutic drugs can trigger irreversible cellular senes-
cence. Senescent cells remain metabolically active and have un-
dergone widespread changes in protein expression and secretion,
ultimately developing senescence-associated secretory pheno-
types (SASPs). SASPs include cytokines and chemokines (such as
IL-6), growth factors (such as VEGF), several matrix metalloprotei-
nases, and nitric oxide (Yu et al. 2013). Freund et al. (2010) reported
that after radiation, the DNA damage response is activated imme-
diately, whereas the SASPs develop slowly over several days.
These results helped to better define the role of IL-6–STAT-3
signalling in tumorigenesis. Managing this pathway could help to
prevent the development of the tumorigenic process. The experi-
mental results obtained upon administration of BA showed signif-
icant amelioration of the expression of IL-6R mRNA and IL-6 levels
and the protein expression of JAK-1/P-JAK-1 and STAT-3/P-STAT-3 as
well as the apoptotic markers (caspase-3 and survivin) in addition
to angiogenic activator molecules (VEGF) in the E and the E+R
groups compared with the control group (Fig. 1). Also, the degree
of lipid peroxidation, as an index of oxidative stress, which was
caused by the tumor or radiation exposure or the synergism be-
tween the 2 stressors, was significantly decreased after BA treat-
ment. Further, the results of histopathological examination for
the tumor micrographs of the E+BA and E+R+BA groups, by com-
parison with the E group, show noticeable amelioration of the cell
architecture of the muscle bundle in addition to certain improve-
ments in the levels of tumor-cell infiltration and penetration, as
well as the area of necrosis (Fig. 4). The results suggest that BA
plays a role in the inhibition of STAT-3 activation events. The
down-regulation of IL-6R expression and inflammatory cytokine
(IL-6) by BA, as indicated in our results, could be attributed to the
suppression of nuclear factor kappa B (NF-␬B; a regulator of gene
transcription and gene products), which was reported in a study
by Takada et al. (2006). Kunnumakkara et al. (2009) found that
AKBA (one of the 4 major BA families) inhibits the STAT-3 activa-
tion process through the suppression of JAK proteins (even the
constitutively active form or that induced by the IL-6). Subse-
quently, the role of active STAT-3 in the inhibition of apoptosis
and the activation of angiogenesis was inhibited and appeared
inactive. Moreover, AKBA could halt the progression of angio-
genic processes directly via inhibiting the expression of the type-2
receptor for VEGF, and subsequently destabilizing the linkage of
VEGF to the receptors leading to the suppression of gene products
involved in proliferation, survival, and angiogenesis (Agrawal
et al. 2011). Further, it could be that BA directly promotes the
apoptotic process by cleaving pro-caspase-3, or indirectly pro-
motes it through activation of caspase-8-mediated pathways (Xia
et al. 2005). Takada et al. (2006) showed that BA inhibits NF-␬B-
regulated gene transcription and regulates gene products that are

Published by NRC Research Press

Moustafa et al.
involved in anti-apoptotic processes (e.g., survivin) and that are
involved in angiogenic processes (e.g., VGEF). In addition, Agrawal
et al. (2011) reported that BA reduces elevated levels of lipid per-
oxidation.
It is clear that treatment with BA disrupts the IL-6–STAT-3 sig-
nalling pathway at the point of interaction between IL-6 and its
receptor. The expected influence of BA on JAK-1 and STAT-3 acti-
vation is not absolute, and could be attributed to changes in the
expression of STAT-3 and JAK-1, rather than the activation of JAK
and STAT-3 signalling due to the lack of difference between the
ratio of P-JAK-1/JAK-1 and P-STAT3/STAT-3 in the control cells and
tumor cells. The combination of BA and exposure to radiation
sustain the anti-tumorigenic pathways. Therefore, BA has the po-
tential to be a good addition to therapeutic treatment for cancer.
Acknowledgement
Authors acknowledge the work of Adel Bakeer Kholoussy (Pro-
fessor of Pathology, Cairo University) in the examination of the
skeletal muscle sections in this study.
References
Aggarwal, B.B., Sethi, G., Ahn, K.S., Sandur, S.K., Pandey, M.K., Kunnumakkara, A.B.,
Sung, B., and Ichikawa, H. 2006. Targeting signal-transducer-and-activator-of-
transcription-3 for prevention and therapy of cancer: modern target but
ancient solution. Ann. N.Y. Acad. Sci. 1091: 151–169. doi:10.1196/annals.1378.
063.
Agrawal, S.S., Saraswati, S., Mathur, R., and Pandey, M. 2011. Antitumor proper-
ties of boswellic acid against Ehrlich ascites cells bearing mouse. Food Chem.
Toxicol. 49: 1924–1934. doi:10.1016/j.fct.2011.04.007.
Banchroft, J.D., Stevens, A., and Turner, D.R. 1996. Theory and Practice of histo-
logical techniques. 4th Ed. Churchill Livingstone.
Dolai, N., Karmakar, I., Kumar, R.B.S., Bala, A., Mazumder, U.K., and Haldar, P.K.
2012. Antitumor potential of Castanopsis indica (Roxb. ex Lindl.) A. DC. leaf
extract against Ehrlich’s ascites carcinoma cell. Indian J. Exp. Biol. 50(4):
359–365. PMID:22803326.
El-Bahy, A.A., Abou-Aisha, Kh., Noaman, E., and Mahran, L.G. 2012. Regression of
murine Ehrlich ascites carcinoma using tumor-targeting salmonella
vnp20009: comparison with the effect of the anticancer drug doxorubicin.
Adv. Cancer: Res. Treatment, 2012. doi:10.5171/2012.125978.
Freund, A., Orjalo, A.V., Desprez, P.Y., and Campisi, J. 2010. Inflammatory net-
works during cellular senescence: causes and consequences. Trends Mol.
Med. 16: 238–246. doi:10.1016/j.molmed.2010.03.003.
Gupta, M., Mazumder, U.K., Kumar, R.S., and Kumar, T.S. 2004. Antitumor activ-
ity and antioxidant role of Bauhinia racemosa against Ehrlich ascites carci-
noma in Swiss albino mice. Acta Pharmacol. Sin, 25(8): 1070–1076. PMID:
15301742.
Jaganathan, S.K., Mondhe, D., Wani, Z.A., Pal, H.C., and Mandal, M. 2010. Re-
search Article: Effect of honey and eugenol on Ehrlich ascites and solid
313
carcinoma. J. Biomed. Biotechnol. 2010. Article ID 989163 (5 pages). doi:10.
1155/2010/989163. PMID:20369055.
Jagetia, G.C., and Venkatesha, V.A.K. 2005. Enhancement of radiation effect by
aphanamixispolystachya in mice transplanted with Ehrlich ascites carci-
noma. Biol. Pharm. Bull. 28(1): 69–77. PMID:15635166.
Kunnumakkara, A.B., Nair, A.S., Sung, B., Pandey, M.K., and Aggarwal, B.B. 2009.
Boswellic acid blocks STAT-3 signaling, proliferation, and survival of multi-
ple myeloma via the protein tyrosine phosphatase SHP-1. Mol. Cancer Res.
7(1): 118–128. doi:10.1158/1541-7786.MCR-08-0154.
Livak, K.J., and Schmittgen, T.D. 2001. Analysis of relative gene expression data
using real-time quantitative PCR and the 22DDCT. Methods, 25: 402–408.
doi:10.1006/meth.2001.1262.
Mazière, C., Alimardani, G., Dantin, F., Dubois, F., Conte, M., and Mazieére, J.C.
1999. Oxidized LDL activates STAT1 and STAT3 transcription factors: possible
involvement of reactive oxygen species. FEBS Lett. 448: 49–52. doi:10.1016/
S0014-5793(99)00324-5.
Mingone, C.J., Gupte, S.A., Quan, S., Abraham, N.G., and Wolin, M.S. 2003. Influ-
ence of heme and heme oxygense-1 transfection of pulmonary microvascu-
larendothelialium on oxidant generation and cGMP. Exp. Biol. Med.
(Maywood), 228: 535–539. PMID:12709582.
Mitsuyama, K., Matsumoto, S., Masuda, J., Yamasakii, H., Kuwaki, K.,
Takedatsu, H., and Sata, M. 2007. Review: Therapeutic strategies for targeting
the IL-6/STAT-3 cytokine signaling pathway in inflammatory bowel disease.
Anticancer Res. 27: 3749–3756. PMID:17970038.
Moustafa, E.M., Abdel-Rafei, M.Kh., Thabet, N.M., and Hasan, H.F. 2015. Moringa
oleifera leaf ethanolic extract subsidized by low doses of gamma irradiation
modulates the thioacetamide induced fibrotic signs in liver of albino rats.
Pakistan J. Zool. 47(3): 793–802.
Ozaslan, M., Karagoz, I.D., Kilic, I.H., and Guldur, M.E. 2011. Review: Ehrlich
ascites carcinoma. African J. Biotech. 10(13): 2375–2378.
Poomsawat, S., Punyasingh, J., and Vejchapipat, P. 2014. Overexpression of sur-
vivin and caspase 3 in oral carcinogenesis. Appl. Immunohistochem. Mol.
Morphol. 22: 65–71. doi:10.1097/PAI.0b013e31828a0d0c.
Takada, Y., Ichikawa, H., Badmaev, V., and Aggarwal, B.B. 2006. Acetyl-11-keto␤-
boswellic acid potentiates apoptosis, inhibits invasion, and abolishes oste-
oclastogenesis by suppressing NF-␬B and NF␬B-regulated gene expression.
J. Immunol. 176: 3127–3140. doi:10.4049/jimmunol.176.5.3127.
Vijaya, B.M., and Balu, M.K. 2015. Association of interleukin-6 with lipid peroxi-
dation and serum lipids in primary hypertension. IOSR J. Dental Med. Sci.
14(6-VI): 46–48.
Xia, L., Chen, D., Han, R., Fang, Q., Waxman, S., and Jing, Y. 2005. Boswellic acid
acetate induces apoptosis through caspase-mediated pathways in myeloid
leukemia cells. Mol. Cancer Ther. 4: 381–388. PMID:15767547.
Yoshioka, T., Kawada, K., Shimada, T., and Mori, M. 1979. Lipid peroxidation in
maternal and cord blood and protective mechanism against activated-
oxygen toxicity in the blood. Am. J. Obstet. Gynecol. 135: 372–376. PMID:
484629.
Yu, Y.C., Yang, P.M., Chuah, Q.Y., Huang, Y.H., Peng, C.W., Lee, Y.J., and Chiu, S.J.
2013. Radiation-induced senescence in securin-deficient cancer cells pro-
motes cell invasion involving the IL-6/STAT-3 and PDGF-BB/PDGFR pathways.
Sci. Rep. 3: 1675–1686. PMID:23591770.
Published by NRC Research Press
Copyright of Biochemistry & Cell Biology is the property of Canadian Science Publishing
and its content may not be copied or emailed to multiple sites or posted to a listserv without
the copyright holder's express written permission. However, users may print, download, or
email articles for individual use.