Vous êtes sur la page 1sur 258

N dordre Anne 2010

THESE DE LUNIVERSITE DE LYON



Dlivre par

LUNIVERSITE CLAUDE BERNARD LYON 1

LECOLE DOCTORALE E2M2

DIPLOME DE DOCTORAT
(Arrt du 7 aot 2006)
Soutenue publiquement le 17 dcembre 2010

par

Monsieur Benjamin HUBERT



La rgulation pigntique des lments
transposables dans les populations naturelles de
Drosophila simulans


Directeur de thse : Cristina VIEIRA


JURY :

Madame Malika AINOUCHE Rapporteur
Madame Maria Pilar GARCIA-GUERREIRO Rapporteur
Monsieur Pierre CAPY Rapporteur
Monsieur Christian GAUTIER Examinateur
Monsieur Christophe TERZIAN Examinateur
Madame Cristina VIEIRA Directeur


Laboratoire de Biomtrie et Biologie Evolutive
UMR CNRS 5558, Universit Claude Bernard Lyon 1
43 bd du 11 novembre 1918, 69622 Villeurbanne




t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
2
__________________________________________________________________________
RESUME
La mthylation de lADN et les modifications post-traductionnelles des histones sont des
modifications pigntiques qui interviennent dans la rgulation des lments transposables
(ET) chez de nombreuses espces. La proportion des ET dans les gnomes varie selon les
espces considres et pose la question des mcanismes de rgulation de ces ET. Au sein de
lespce Drosophila simulans, les populations naturelles prsentent un polymorphisme unique
dans le nombre de copies des ET, ce qui en fait un excellent modle pour tudier cette
question. Ltude de la mthylation dADN et des modifications post-traductionnelles des
histones associes au rtrotransposon LTR tirant dans la ligne germinale des populations
naturelles a permis de montrer linfluence dune copie dET sur la structure de la chromatine
au site dinsertion. Dans un second volet, nous avons cherch caractriser la mthylation de
lADN chez la drosophile, chez laquelle la fonction est encore mal connue. Nous avons, par
des approches spcifiques et globales, mesur labondance de cette marque pigntique chez
la drosophile. Nous concluons que les taux de mthylation de lADN sont trs faibles mais
variables entre espces. Notre travail na pas permis de mettre en vidence un rle de la
mthylation de lADN dans le contrle des ET, toutefois, nous ne pouvons pas exclure ce
systme de rgulation.
___________________________________________________________________________
TITLE
Epigenetic rgulation of transposable elements in natural populations of Drosophila simulans
___________________________________________________________________________
ABSTRACT
Epigenetic modifications such as DNA methylation and post-translational histone
modifications are involved in transposable elements (TE) silencing in many species. Their
relative abundance in genomes ask the question of differences in regulation mecanism
between species. Within the Drosophila simulans species, natural populations exibits a unique
polymorphism in TE copy number, providing a powerfull tool for the analysis of TE
regulation in population from the same specie. We analyzed DNA methylation and post-
translational histone modifications associated with the LTR retrotransposon tirant in the
germline of natural populations and report the influence of this element on chromatine
structure. DNA methylation is a wide-conserved epigenetic modification involved in gene
regulation and TE silencing but its function in drosophila remains missunderstood. Using
different methods, we determined the abundance of methylated cytosines in drosophila, and
showed that methylation level are low and variable between species. Our results show low
evidence for a TE regulation system involving DNA methylation but this cannot be so far
excluded.
___________________________________________________________________________
DISCIPLINE
E2M2 : volution cosystmes, Microbiologie, Modlisation
_________________________________________________________________________
MOTS-CLES
lment transposable, pigntique, mthylation de lADN, modifications post-
traductionnelles des histones, rtrotransposon LTR, Drosophila simulans, populations
naturelles
___________________________________________________________________________
INTITULE ET ADRESSE DE L'U.F.R. OU DU LABORATOIRE :
Laboratoire de Biomtrie et Biologie volutive UMR CNRS 5558
Universit Claude Bernard Lyon1
43 bd du 11 novembre 1918, 69622 Villeurbanne
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
3
Table des matires
INTRUDUCTIUN...................................................................................................................................... 9
1. Les lments transposables...............................................................................................................11
1.1. Classification et tiansposition ues ET.....................................................................................................12
1.2. Relations avec le gnome..............................................................................................................................14
2. La rgulation des ET.............................................................................................................................17
2.1. Les igulations pigntiques....................................................................................................................17
2.2. vaiiabilit ues igulations pigntiques.............................................................................................22
3. Les populations naturelles de drosopbiles pour comprendre la dynamique des ET ....24
S.1. vaiiabilit en ET uans les populations natuielles ue uiosophiles..............................................24
S.2. Epigntique chez la uiosophile................................................................................................................2S
S.S. Le Nouele tiront................................................................................................................................................28
CHAPITRE 1. Etude des marques pigntiques associes a tlrunt dans des
populations naturelles de . xlmulunx........................................................................................ 31
1. Dtermination et analyse des profils de mtbylation de la rgion rgulatrice de
tlrunt......................................................................................................................................................................33
1.1. Nthoues u'analyse ue la mthylation ue l'ABN ................................................................................SS
1.2. Piofils ue mthylation ue la LTR S' ue tiront .......................................................................................4S
1.S. Biais ue la technique ue bisulfite...............................................................................................................Su
2. Analyse des modifications d'bistones associes a des insertions de tlrunt ......................53
2.1. Piincipe ue la ChIP...........................................................................................................................................SS
2.2. Nouifications u'histones associes tiront ..........................................................................................SS
2.S. Influence ue tiront sui la chiomatine chez B. simulons...................................................................S7
3. Conclusion sur la rgulation pigntique de tlrunt cbez . xlmulunx ...............................59
CHAPITRE 2. Analyse globale de la mtbylation de l'ADN dans les gnomes de
drosopbiles........................................................................................................................................... 1
1. Quantification des taux de mtbylation de l'ADN dans les gnomes de drosopbiles.....3
1.1. Intiouuction........................................................................................................................................................6S
1.2. Btection et quantification ues S-NeuC pai BPLC couple la spectiomtiie ue
masse (NS) .......................................................................................................................................................................6S
1.S. Rsultats...............................................................................................................................................................72
2. Exploration de la prsence de cytosines mtbyles au niveau des ET dans des
populations naturelles de . melunoguxter et . xlmulunx..............................................................74
2.1. 0tilisation ue couples u'isoschizomeies poui uteiminei la pisence ue cytosines
mthyles..........................................................................................................................................................................74
2.2. Rsultats...............................................................................................................................................................78
2.S. Conclusion...........................................................................................................................................................82
DISCUSSIUN - PERSPECTIVES ......................................................................................................... 83
1. Problmes d'interprtation des donnes produites par bisulfite........................................85
2. Conservation de la mtbylation de l'ADN cbez les eucaryotes et rgulation des ET......89
3. La rgulation des ET cbez la drosopbile : exemple de tlrunt dans les populations
naturelles de . xlmulunx ............................................................................................................................92
PUBLICATIUNS .................................................................................................................................... 95
MATERIELS ET METHUDES ........................................................................................................... 143
1. Urigine et levage des soucbes de drosopbiles........................................................................ 145
2. Rcolte des embryons....................................................................................................................... 145
3. Extraction d'ADN gnomique ......................................................................................................... 14
4. Traitement au Bisulfite .................................................................................................................... 147
5. PCR de l'ADN trait au bisulfite de sodium................................................................................ 147
. ClonageJSquenageJAnalyse des profils de mtbylation .................................................. 148
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
4
7. Digestions enzymatiques................................................................................................................. 149
8. Immunoprcipitation de la Cbromatine {CbIP]....................................................................... 151
9. qPCR........................................................................................................................................................ 154
10. Hydrolyse de l'ADN et prparation des cbantillons pour la HPLC................................ 155
ANNEXES.............................................................................................................................................. 157
1. Mtbylation de l'ADN ........................................................................................................................ 159
2. HPLC et spectromtrie de masse................................................................................................... 241
BIBLIUCRAPHIE................................................................................................................................ 247

t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
5
Table des illustrations
Figure 1. Classification des ET eucaryotes ....................................................................................13
Figure 2: Principales modifications post-traductionnelles des lysines de l'histone H3. ................19
Figure 3: Structure du rtrotransposon LTR tirant......................................................................29
Figure 4: Carte des zones d'chantillonnage des souches tudies ................................................30
Figure 5. Etapes de conversion de la cytosine en uracile par le bisulfite de sodium.....................35
Figure 6. Schma de la technique de "Bisulfite Genomic Sequencing" ........................................36
Figure 7. Amorces utilises pour l'amplification par PCR de la LTR 5' de tirant aprs
traitement au bisulfite de sodium...................................................................................................38
Figure 8. Profils de mthylation de la LTR 5 de tirant dans les ovaires de souches mutantes
pour dDNMT2................................................................................................................................41
Figure 9. Profils de mthylation de la LTR 5 de tirant dans des ovaires de la population de
Makindu .........................................................................................................................................42
Figure 10. Profils de mthylation de la LTR5 de tirant dans la population de Makindu (D.
simulans) ........................................................................................................................................44
Figure 11. Profils de mthylation de la LTR5 de tirant dans la population du Zimbabw (D.
simulans) ........................................................................................................................................45
Figure 12. Profils de mthylation de la LTR5 de tirant dans la population de Chicharo (D.
simulans) ........................................................................................................................................46
Figure 13. Profils de mthylation de la LTR5 de tirant dans la population du Sngal (D.
melanogaster).................................................................................................................................47
Figure 14. Profils de mthylation des sites dinsertion des copies compltes M1, M2 et M3 de
tirant de la population de Makindu................................................................................................50
Figure 15. Efficacit du traitement au bisulfite selon les conditions exprimentales ....................51
Figure 16. Profils de mthylation du brin complmentaire de la LTR 5 de tirant dans la
population de Makindu...................................................................................................................52
Figure 17. Schma de la technique de ChIP...................................................................................54
Figure 18. Modifications post-traductionnelles de lhistone H3 associes tirant .......................56
Figure 19. Influence de tirant sur la structure de la chromatine au niveau de deux sites
dinsertion.......................................................................................................................................58
Figure 20. Structures de dC et de 5-MedC.....................................................................................65
Figure 21. Dtection des dC et 5-MedC par HPLC/DAD/ESI-MS. ..............................................66
Figure 22. Gammes talon utilises pour la quantification des dC et 5-MedC..............................68
Figure 23. Chromatogrammes des extractions dions correspondant aux fragments spcifiques
de la dC (m/z 455) et de la 5-MedC (m/z 483) ...............................................................................69
Figure 24. Tests de quantification de nuclosides standards en lecture UV et en spectromtrie
de masse .........................................................................................................................................71
Figure 25. Dtermination du taux de 5-MedC dans les gnomes de drosophiles ..........................72
Figure 26. Recherche de sites mthyls dans la rgion 5 de quatre ET........................................76
Figure 27. Illustration de la technique de MSRE. ..........................................................................77
Figure 28. Dtection de cytosines mthyles par enzymes de restriction dans la population de
Sngal (D. melanogaster). ............................................................................................................78
Figure 29. Mise en vidence de sites mthyls dans les rgions 5 de quatre ET de rfrence.....79
Figure 30. Frquence de dinuclotides mthyls dans les rgions 5 de Roo, F et 412.................81
Figure 31. Mise en vidence de sites mthyls dans les rgions codantes de F.............................81
Figure 32. Schma du plan exprimental de la ChIP. ..................................................................151

t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
6


Tableau 1. Proportion en ET et taille des gnomes eucaryotes de rfrence. ................................12
Tableau 2. Insertions des copies de type C de tirant identifies dans les populations de
Makindu, Chicharo et Zimbabw (D. simulans) ............................................................................43
Tableau 3. Proportion dET dans les 12 gnomes squencs de drosophiles (Drosophila 12
genomes consortium, 2007) ...........................................................................................................64
Tableau 4. Nombre moyen de copies des lments F, Roo, 412 et tirant dtermin par
hybridation in situ dans les populations naturelles de D. melanogaster et D. simulans. ...............75
Tableau 5. Amorces PCR utilises pour lamplification de squences dADN traites au
bisulfite de sodium. ......................................................................................................................148
Tableau 6. Enzymes de restriction utilises. ................................................................................150
Tableau 7. Paramtres utiliss pour les digestions enzymatiques en fonction des enzymes
utilises.........................................................................................................................................150
Tableau 8. Amorces PCR utilises pour diagnostiquer ltat de mthylation des sites de
restriction......................................................................................................................................150
Tableau 9. Amorces utilises en qPCR pour lanalyse des rsultats de ChIP..............................154
Tableau 10. Gradient HPLC.........................................................................................................156

Figures supplmentaires
Figure supplmentaire 1. Profil de mthylation des squences non converties correspondant
la LTR 5 de tirant. ......................................................................................................................159
Figure supplmentaire 2. Frquence de mthylation des dinuclotides dans les squences non-
converties des populations de Makindu et Zimbabw. ................................................................160
Figure supplmentaire 3. Schma de la copie de tirant M2 de la population de Makindu,
insre dans lintron du gne tkv. .................................................................................................162
Figure supplmentaire 4. Elment 412.........................................................................................163
Figure supplmentaire 5. Elment F. ...........................................................................................163
Figure supplmentaire 6. Elment Roo. .......................................................................................163
Figure supplmentaire 7. Alignements des squences traites au bisulfite de sodium. ...............164
Figure supplmentaire 8. . Chromatogrammes en courant ionique total et UV obtenus par
HPLC pour les 12 gnomes squencs de drosophiles. ...............................................................242

Tableau supplmentaire 1. Rsultats obtenus partir dADN purifi extrait partir dovaires.
................................................................................................................................................ 160
Tableau supplmentaire 2. Rsultats obtenus pour les lignes mutantes. .............................. 160
Tableau supplmentaire 3. Rsultats obtenus pour les populations naturelles avec les amorces
tir01 et tir52. ........................................................................................................................... 161
Tableau supplmentaire 4. Rsultats complmentaires de vrification de la prsence de biais
exprimentaux. ....................................................................................................................... 162
Tableau supplmentaire 5. Frquence de mthylation des dinuclotides pour les lments F,
Roo et 412 dans la population de Makindu. ........................................................................... 162

t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
7

Liste des Abrviations

5-MedC : 5-methyl-2-doxycytidine
5-OHMedC : 5-hydroxymmethylcytosine
ADN : Acide Doxyribonuclique
ARN : Acide Ribonuclique
BGS : Bisulfite Genomic Sequencing
ChIP : Immunoprcipitation de la Chromatine
DMI : Densely Methylated DNA Island
DNMT : DNA Methyl Transferase
dC : 2-doxycytidine
ET : lment Transposable
HPCE : High Performance Capillary Electrophoresis
HPLC : High Performance Liquid Chromatography
LTR : Long Terminal Repeat
MeDIp : Methyl DNA ImmunoPrecipitation
MSRE : Methyl Sensitive Restriction Enzyme
ORF : Open Reading Frame
PCR : Polymerase Chain Reaction
pb : paire de bases
kb : kilo base
PCR : Polymerase Chain Reaction
RdDM : RNA directed DNA Methylation
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
8

t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
9



INTRODUCTION
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
10

t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
11

Le 25 avril 1953, Watson et Crick publient dans la revue scientifique Nature un article
intitul Molecular Structure Of Nucleic Acids qui bouleversa la gntique. Leurs travaux
dmontrent pour la premire fois que la molcule dADN est compose de deux chaines
complmentaires et antisens dacides nucliques, structure permettant une copie des
chromosomes, support de linformation gntique. Quelques dcennies plus tard, en 2009, le
gnome de Watson lui mme sera squenc.
1. Les lments transposables
Quelques annes avant la dcouverte de Watson et Crick, alors que les chromosomes
sont dfinis comme des structures stables, B. McClintock publie le 8 avril 1950 The Origin
And Behavior Of Mutable Loci In Maize , article dans lequel elle dmontre que des
squences dADN composes dlments rgulateurs sont capables de transposer , cest--
dire de se dplacer dun endroit un autre dans un gnome. Cette notion de dynamique des
gnomes associe des squences mobiles mit plusieurs annes pour tre accepte par la
communaut scientifique. Les rsultats de B. McClintock mettent en vidence que chez le
mas, les diffrences de pigmentation que lon peut observer sur certains grains sont dues la
mobilisation des lments Ds (Dissociateur), sous le contrle de llment Ac (Activateur). En
effet, le gne responsable de la pigmentation des grains possde une insertion de llment Ds
et lors de sa mobilisation, active par llment Ac, ce gne chappe la rpression induite
par Ds, permettant ainsi la synthse de pigments. Cette dcouverte, montrant dune part que
lADN nest pas stable mais dynamique, et dautre part que les ET influencent la rgulation
des gnes et donc le phnotype, fut difficile faire accepter au sein de la communaut
scientifique. De fait, B. McClintock fut contraint dabandonner ses travaux. Ce nest que
quelques annes plus tard que limportance de ses travaux fut enfin reconnue et que B.
McClintock se vit dcerner, en 1983, le prix Nobel de mdecine pour la dcouverte des ET.
Aujourd'hui largement tudis, les ET possdent des caractristiques tonnantes. Hormis chez
Plasmodium falciparum et quelques bactries endosymbiotiques, les ET sont prsents en
proportion variable dans tous les gnome (Tableau 1). Certaines de ces squences dADN
dtiennent leurs propres squences rgulatrices, leur propre potentiel codant et sont
autonomes tandis que dautres dites dfectives, dpendent au contraire dautres lments pour
se dplacer : ceci est notamment le cas pour des SINE (Small Interpserced Nuclear Element),
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
12
qui utilisent la machinerie molculaire code par les LINE (Long Interpserced Nuclear
Element) pour transposer. Bien que les ET aient un cycle de rplication indpendant du cycle
cellulaire, ils utilisent toutefois la machinerie transcriptionnelle de lhte. C'est la raison pour
laquelle ils ont longtemps t qualifis d ADN parasite .
Tableau 1. Proportion en ET et taille des gnomes eucaryotes de rfrence.
Espce Taille du gnome (Mb) % ET
Zea mays 2400 80
Arabidopsis thaliana 120 10
Homo sapiens 3000-3200 45
Mus musculus 2500 40
Drosophila simulans 180 2-3
Drosophila melanogaster 180 5-6
Caenorhabditis elegans 97 12
Saccharomyces cerevisae 12 3-5
Les tailles de gnomes ont t collectes dans la base de donne Genome Project du NCBI
(http://www.ncbi.nlm.nih.gov.gate1.inist.fr/) et les proportions en ET dans les articles de
squenage de rfrence (Z. mays (Schnable et al. 2009), A. thaliana (Arabidopsis Genome
Initiative, 2000), C. elegans (C. elegans Sequencing Consortium, 1998), H. sapiens (Lander et
al. 2001), D. melanogaster et D. simulans (Clark et al. 2007), S. cerevisae (Goffeau, et al.
1997), M. musculus (Waterston et al. 2002)).
1.1. Classification et transposition des ET
Les ET peuvent tre classs selon plusieurs critres. Une premire classification
propose par Finnegan et al (1989) distingue les ET selon leur intermdiaire de transposition
(Finnegan, 1989).
La classe 1 est compose de rtrotransposons LTR (Long Terminal Repeat) et de
rtrotransposons sans LTR, composs essentiellement de deux familles majeures : les LINE et
les SINE (Figure 1). Leur mode de transposition fait intervenir un intermdiaire de type ARN,
transcrit produit partir dune copie dET, puis rtrotranscrit en ADN pour former une
nouvelle copie. La classe 2 est quant elle compose de transposons qui ont un mode de
transposition faisant intervenir un intermdiaire ADN. Dans ce cas, la transposition consiste
en lexcision dune copie dET et son insertion un autre locus. Ce mode de transposition en
couper-coller est non rplicatif, puisqu'il consiste en un dplacement de la mme copie sur
les chromosomes.
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
13

Figure 1. Classification des ET eucaryotes
Cette classification propose par Finnegan divise les ET en deux familles, selon leur mode de
transposition. Les ET de classe 1, qui sont transcrits puis rtrotranscrits pour aboutir la
formation dune nouvelle copie, ont un mode de transposition en copier-coller . Les ET de
classe 2, appels aussi les transposons ADN, codent pour une transposase qui va leur
permettre de sexciser et de se rinsrer ailleurs dans le gnome ; il sagit de la mme copie
qui se dplace, selon un mode de transposition en couper-coller . Cette classification trs
simplifie nillustre pas la totalit des familles dET qui sont rpertories ce jour.
Cette classification est la plus utilise, elle permet de diffrencier la majeure partie des
ET. Cependant, la grande diversit qui existe au sein des ET, mise en vidence durant les
dernires annes grce aux quantits abondantes de donnes obtenues par les divers projets de
squenage, ne permet pas avec ce premier mode de classification de positionner toutes les
familles dET. Certaines dentres elles, comme par exemple les Miniature Inverted Tandem
Repeat (MITE) sont difficilement caractrisables selon leur simple mode de transposition. En
effet, les MITE transposent via un mcanisme de copier-coller sans passer par un
intermdiaire ARN. Tous les ET connus sont rfrencs dans la base de donnes RepBase
(http://www.girinst.org/repbase/index.html), dans laquelle les dveloppeurs ont tabli une
nouvelle mthode pour leur classification. En prenant en compte lenzymologie, les
similarits de structure et les relations entre les squences, les auteurs proposent une
classification accompagne dune nouvelle nomenclature des ET, mentionnant notamment le
nom de la superfamille, un identifiant de structure et un identifiant despce (Kapitonov et
Jurka, 2008). Une classification du mme type est propose en 2007 par Wicker et al., et
intgre galement la structure et la squence des ET (Wicker et al. 2007). Il sagit dune
classification unifie, hirarchique, qui permet de caractriser tous les ET connus, partir de
la classification tablie par Finnegan (1989). Dans ce modle de classification, les ET sont
dabord diviss en deux classes, selon la prsence ou non dun intermdiaire de transposition
de type ARN, puis en sous-classes, ordres et familles. Dans la suite de mon manuscrit,
Retrotransposons Transposons
Non LTR LTR
SINE LINE
Classe 1 Classe 2
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
14
jutiliserai la classification de Finnegan, reprsente sur la Figure 1 (p.13), qui ne prsente
aucune ambigut concernant la classification des ET tudis durant ma thse.
1.2. Relations avec le gnome
La transposition ou mobilisation dun ET peut avoir des consquences dltres pour
un gnome si il sinsre dans ou prs dun gne important. Le fait que les ET puissent tre
prsents en grand nombre de copies dans un gnome augmente aussi la probabilit de
recombinaison pouvant ainsi engendrer des mutations, et altrer lactivit des gnes voisins
(Kazazian, 2004). Chez lhomme, beaucoup de maladies lies aux ET ont t dcrites : elles
font principalement intervenir les ET de classe 1, qui sont les plus rpandus dans ce gnome.
Malgr tout, il nest pas toujours possible de conclure si linsertion de lET est la cause
directe de la maladie. Dans certains cas cependant, des insertions dET ont pu tre identifies
comme dclencheurs de maladies. Par exemple, les gnes BRCA1 et BRCA2 sont tous deux
impliqus dans des prdispositions au cancer du sein. En effet, une mutation de lun de ces
gnes est un facteur favorisant lapparition de cancer chez le sujet porteur. Un cas dinsertion
dun lment Alu a t identifi dans lexon 22 du gne BRCA2 dune patiente atteinte dun
cancer du sein (Miki et al. 1996). La prsence de cette insertion entraine un dcalage du cadre
de lecture du gne, provoquant dune part lpissage de lexon 22 et dautre part lapparition
dun codon stop prmatur, conduisant ainsi la production dune protine tronque.
Malgr ce caractre nuisible des ET, il nen demeure pas moins que leur implication
dans lvolution des gnomes est de plus en plus dmontre par la communaut scientifique.
La vision contemporaine que nous avons des gnomes, plus dynamique avec une
plasticit certaine, confre aux ET un rle central au cours de lvolution qui est
actuellement peu contest. Leur fort pouvoir mutagne, associ au fait que ce soient des
squences multicopies, donc favorables aux recombinaisons, fait des ET des acteurs majeurs
de la dynamique des gnomes. De lutilisation de leurs squences rgulatrices jusqu leur
domestication, de nombreux exemples montrent que certaines insertions dET ont pu tre
slectionnes par le gnome hte. Chez les vertbrs mchoire, les gnes RAG1 et RAG2
(Recombination Activating Genes) sont impliqus dans la recombinaison des segments V, D
et J, servant crer de la diversit dimmunoglobulines (Ig) et de TCR (T Cell Receptor)
ncessaire la rponse immunitaire spcifique un antigne (Volff, 2006). Les clusters de
gnes dIg et TCR sont composs des segments V, D et J flanqus de squences inverses
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
15
appeles Recombination Signal Sequence (RSS), ce qui leur confre une structure de type
Insertion Sequence (IS) procaryotique. Le complexe RAG1/RAG2 agit sur ces squences
RSS via RAG1, possdant lactivit recombinase pour induire la recombinaison V(D)J avec
un mode daction en couper-coller semblable celui dune transposase. Lanalyse du gne
RAG1 a montr quil possde une forte similarit de squence au niveau de sa rgion Core
avec les lements de type transib, prsents chez les insectes et nmatodes et dont le mode de
transposition est de type couper-coller (Fugmann, 2010). Une composante principale du
systme immunitaire des mammifres et plus largement des vertbrs mchoire proviendrait
donc de la domestication dET (Feschotte, 2008). Chez lHomme, le gne de la syncitine-1,
impliqu dans la formation du placenta, plus prcisment dans la fusion du trophoblaste,
provient de la domestication du gne env dun rtrovirus endogne de la famille HERV-W
(Human Endogenous RetroVirus-W) (pour revue, Stoye, 2009). Chez la levure
Saccharomyces cerevisiae, la famille de rtrotansposons LTR Ty a largement contribu
lvolution et ladaptation des levures (Lesage et Todeschini, 2005). Dans de nombreux
stress, le rtrotransposon Ty1 est ractiv transcriptionnellement avec arrt des mcanismes
de contrle post-transcriptionnels, permettant sa transposition. En cas dabsence de nitrogne
dans le milieu de croissance des levures (indispensable leur mtabolisme), les cellules vont
former des filaments, composs de cellules juxtaposes, et vont ainsi pouvoir migrer dans le
milieu de culture. Cette modification de la formation des colonies de levures leur permet
denvahir le milieu la recherche de nitrogne (Lesage et Todeschini, 2005). Chez
Drosophila melanogaster, les extrmits des chromosomes ne sont pas allonges aprs
chaque mitose par une tlomrase comme cest le cas pour de nombreuses autres espces,
mais par linsertion des rtrotransposons sans LTR, Het-A et TART. En effet, lintgrit des
tlomres est prserve par la transposition successive de ces deux lments, qui se fait
surtout par la collaboration de leur protine gag (Pardue et al. 2005). Chez les bactries, les
ET, ou Squences dInsertion (IS), peuvent intervenir dans lchange de gnes de rsistance
aux antibiotiques entre bactries. En effet, les IS peuvent tre prsents dans les
bactriophages, dans les chromosomes ainsi que dans les plasmides, squences dADN
circulaires extrachromosomiques faisant partie du gnome bactrien. Les plasmides
interviennent dans le phnomne de conjugaison, qui nest autre quun change de matriel
gntique entre deux bactries, appel transfert horizontal. Deux IS peuvent former un
transposon composite, lment mobile comportant un gne qui, dans le cas de Tn10, est un
gne de rsistance la ttracycline (Haniford, 2006). Le transposon Tn7, autre transposon
composite, possde deux modes de transposition particulirement astucieux. Un mode de
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
16
transposition vertical, au cours duquel des squences spcifiques du chromosome bactrien
sont la cible de la copie excise, et un mode de transposition horizontal, au cours duquel les
plasmides et les bactriophages seront leur tour cibls spcifiquement. Ces deux modes, qui
font intervenir des partenaires molculaires diffrents, ont des rles essentiels dans le
maintien du transposon Tn7 dans les lignes de bactries et dans sa propagation horizontale.
Par ailleurs, comme dans le cas de Tn10, il a t montr que Tn7 tait impliqu dans le
caractre multirsistant de certaines souches bactriennes comme Acinetobacter baumanii,
qui portent plusieurs gnes de rsistance diverses drogues (Parks et Peters, 2009). La
capacit de certains ET de la famille Tn7 transfrer horizontalement des gnes de rsistance
permet aux bactries de sadapter et de survivre dans diffrents environnements. La relation
entre les ET et le gnome peut tre qualifi de relation hte/parasite, mais peut aussi tre
considre comme une interaction entre un cosystme (le gnome) compos de niches
cologiques dans lesquelles un ensemble despces (ET, gnes etc.) interagissent (Le Rouzic
et al. 2007; Venner et al. 2009).
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
17

2. La rgulation des ET
Bien que les ET aient russi envahir certains gnomes, ils sont soumis des
mcanismes de rgulation de leur activit. Parmi ces mcanismes, les rgulations
transcriptionnelles et post-transcriptionnelles conduisent la diminution de la transposition et,
la recombinaison homologue entre deux copies du mme ET conduit une diminution de son
nombre de copies. Ces dernires annes, de nombreuses tudes ont montr limplication des
rgulations pigntiques dans le contrle des ET, et ce, dans de nombreux organismes
comme lHomme, la plante, la drosophile, ou encore la levure.
2.1. Les rgulations pigntiques
Depuis les annes 2000, de nombreux gnomes ont t squencs. Malgr la quantit
abondante et prcieuse dinformations que cela a apport au monde scientifique, il a bien fallu
se rendre lvidence : le code gntique, plus petit dnominateur commun de linformation
gntique, ne permet pas lui seul de comprendre le vivant. Quel dterminisme conduit une
cellule souche embryonnaire devenir potentiellement tout type cellulaire composant un
organisme ? Comment expliquer que certains caractres phnotypiques acquis par un
individu peuvent tre hrits ? Ces questions trouvent des rponses depuis la dcouverte des
rgulations pigntiques.
Lpigntique, telle que dfinie par Riggs, Martienssen et Russo en 1996 dans la
prface du livre Epigenetic Mechanisms of Gene Regulation (Edition Cold Spring Harbor
Laboratory Press), est ltude des changements hritables post-mitotiques ou post-miotiques
qui ne peuvent pas sexpliquer par des modifications dans la squence de lADN. La
chromatine, double hlice dADN enroule autour de protines de structure, telles que les
histones, dfinit un degr de compaction des chromosomes dans le noyau des cellules.
Laccessibilit de lADN aux facteurs de transcription dpend alors du niveau plus ou moins
important de compaction de la chromatine. Les modifications post-traductionnelles des
protines dhistones, la mthylation des cytosines de lADN et les petits ARN interviennent
dans ltablissement et le maintien de ltat chromatinien. Associs, ces trois mcanismes
peuvent dfinir des zones euchromatiques, peu denses, associes lactivation de la
transcription, et des zones htrochromatiques, denses, associes la rpression de la
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
18
transcription. Cette vision est toutefois simpliste, et plusieurs travaux dmontrent que la
dynamique associe ltat chromatinien est en ralit plus complexe.
2.1.1. Les modifications post-traductionnelles des histones
Les histones sont des protines trs conserves au cours de lvolution des eucaryotes.
Elles sont organises en nuclosome, structure dfinie comme un octamre autour duquel
senroule lADN dans les noyaux des cellules eucaryotes. La succession des nuclosomes le
long de la molcule dADN lui confre une structure en collier de perle , premier niveau de
compaction de la chromatine. Un octamre dhistone est un complexe protique compos de
doublets de molcules dhistone H2A, H2B, H3 et H4, par-dessus lesquelles lhistone H1
vient se fixer aprs enroulement de lADN. Les histones peuvent subir des modifications
post-traductionnelles sur certains des acides amins de leurs queues N et C terminales (Figure
2). Ces marques dhistones , constituant un code des histones , interviennent dans le
degr de compaction de la chromatine (Strahl et Allis, 2000) et dfinissent des zones actives
ou rpressives de lactivit transcriptionnelle des gnes concerns. Ces modifications post
traductionnelles des histones de type actylation, mthylation, phosphorylation, sumoylation,
ou encore ubiquitylation (Berger, 2007) sont rversibles. Les modifications les plus dcrites
dans la littrature concernent les lysines (K) de lhistone H3, qui peuvent tre actyles ou
mthyles (mono, di ou trimthyles). Dautres modifications ont galement t identifies
sur les parties N terminales des autres histones composant le nuclosome, comme par
exemple la marque H4K20me3, dont le rle dans la structure de lhtrochromatine
constitutive est largement conserv (Schotta et al. 2004). Certaines marques sont
mutuellement exclusives, comme la trimthylation de la lysine 9 de lhistone H3, associe
une chromatine compacte et rpressive, comme lactylation de ce mme acide amin, note
H3K9Ac, associe une chromatine ouverte et active (Jenuwein et Allis, 2001). La
mthylation nest cependant pas toujours associe une chromatine rpressive puisque la
marque H3K4me3 est associe aux rgions 5 de gnes exprims (Azuara et al. 2006). Ainsi,
certaines marques dhistones sont directement associes leuchromatine.
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
19

Figure 2: Principales modifications post-traductionnelles des lysines de l'histone H3.
Les lysines situes sur la queue de lhistone H3 (partie N terminale) peuvent subir une, deux
ou trois mthylations et certaines dentres elles peuvent tres actyles. Ces deux marques
sont mutuellement exclusives et dfinissent des tats chromatiniens diffrents. La mthylation
(mono, di, ou tri) en position K4 et K36 et lactylation des positions K9 et K14 dfinissent
un tat de chromatine ouvert (vert) favorable lexpression des gnes, tandis quelle est
associe un tat rpressif (rouge) pour les positions K9 et K27. Daprs Ebert et al (2000).
2.1.2. La mthylation de lADN
La mthylation de lADN est une modification chimique des carbones 5 des cytosines
de lADN. Elle est implique dans la rgulation des gnes, dans la structure des gnomes et
dans la rgulation des squences rptes. Lorsquelle est localise au niveau de la rgion
promotrice des gnes, la mthylation des cytosines est associe la rpression de leur
expression (Suzuki et Bird, 2008).
La mthylation des cytosines est catalyse par des enzymes appeles DNA Methyl
Transferases (DNMT). Certaines de ces enzymes, comme les DNMT3a/b, dites de novo,
sont responsables de la mthylation, tandis que dautres, comme DNMT1, dites de maintien,
ont un rle de maintien des profils de mthylation. Le maintien seffectue aprs la mitose, au
moment o les molcules dADN sont des substrats hmimthyls (Reik et al. 2001). Selon
P3
k
4
k
9
k
14
k
27
k
36
Mthylation
Di-mthylation
Tri-mthylation
Actylation
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
20
les espces, les DNMT peuvent mthyler les cytosines dans diffrents contextes
nuclotidiques. Les cytosines mthyles peuvent impliquer des dinuclotides palindromiques
CpG (ou CpNpG, o N = A, C, T, G) dits symtriques, ou des dinuclotides CpH (ou CpHpH
ou H = A, C ou T) dits asymtriques. Pour les dinuclotides symtriques, une cytosine est
porte sur chacun des deux brins complmentaires de la molcule dADN, tandis que pour les
dinuclotides asymtriques un seul brin est porteur dune cytosine. Aprs chaque division
cellulaire, les DNMT de maintien reproduisent de faon symtrique, et partir du brin
matrice, le profil de mthylation sur le brin nosynthtis, permettant ainsi un maintien des
profils de mthylation au cours des divisions cellulaires. A linverse, dans le cas de
dinuclotide asymtrique mthyl, seul lun des deux brins est porteur dune cytosine
mthyle. Enfin, les cytosines mthyles sont fortement mutagnes et peuvent tre
spontanment converties en Thymine par damination (perte du groupement amine NH2)
(Holliday et Grigg, 1993). Chez la plante Arabidospis thaliana, la mthylation des cytosines
est implique dans la rgulation des gnes ainsi que dans le dveloppement et le contrle des
ET. Ce sont les cytosines mthyles en contexte asymtrique qui sont fortement prsentes au
niveau des ET (Chan et al. 2005; Zhang et al. 2006). Ces profils de mthylation sont tablis et
maintenus par des DNMT spcifiques guides par des petits ARN ciblant par homologie les
squences dont les cytosines sont mthyler (Matzke et al. 2007). Ce type de mthylation
cibl par des petits ARN, appell RNA dependant DNA methylation (RdDM), a
galement t mis en vidence chez la souris (Miyagawa et al. 2008).
Chez les mammifres, et plus particulirement chez lHomme, la mthylation des
cytosines est indispensable au dveloppement et la survie des embryons par son implication
dans des processus de rgulation majeure tels que la rgulation des gnes, linactivation du
chromosome X et les empreintes gntiques (Morgan et al. 2005). Ds la fcondation et
jusquau stade blastula, le gnome du nouvel individu subit une dmthylation globale,
lexception des rgions centromriques et pricentromriques, des rtrotransposons et des
gnes empreintes. Ces gnes qui portent des empreintes pigntiques diffrentes (au niveau
de la mthylation de lADN), tablies dans la ligne germinale des parents, auront donc une
expression diffrentielle tout au long de la vie du nouvel individu, selon quils aient t
hrits du pre ou de la mre. Plus tard dans le dveloppement, une mise jour des
empreintes, ou reprogrammation, aura lieu dans les cellules primodiales germinales du nouvel
individu, de sorte que les gnes soumis aux empreintes des cellules de la ligne germinale
portent des empreintes correspondant au sexe de lindividu qui les produit (Morgan et al.
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
21
2005). Des dfauts dans la mise en place des empreintes peuvent avoir des consquences
graves sur le dveloppement dun individu. Chez lHomme, un exemple trs bien dtaill
concerne la rgion dADN localise en position 15q11-q13 (bandes 11 13 du bras long du
chromosome 15), qui, si elle est soumise un dfaut dempreinte, sera responsable des
syndromes de Prader Willy ou dAngelmann. Le syndrome de Prader Willy est une
pathologie associe un dfaut dempreinte du chromosome 15 hrit du pre, tandis que le
syndrome dAngelmann est la pathologie associe un dfaut dempreinte du chromosome
15 hrit de la mre (Cassidy et al. 2000). Des organismes comme C. elegans ou S. cerevisae
nont pas de mthylation de lADN, et aucune DNMT na pu tre identifie dans leurs
gnomes (Ponger et Li, 2005). Labsence de rle fonctionnel de la mthylation de lADN
dans ces organismes modles laisse penser que cette modification pigntique est
principalement spcifique aux mammifres et aux plantes. Toutefois, la dcouverte dun
systme complet de mthylation chez labeille Apis millifera a permis de reconsiderer ce point
de vue. En effet, labeille possde un systme de mthylation fonctionnel dirig sur les CpG,
semblable celui des mammifres (Wang et al. 2006). Lanalyse des ratios CpG
observs/attendus au niveau des gnes de labeille, suit une distribution bimodale,
caractristique de la prsence de mthylation au niveau des dinuclotides CpG dans un
gnome. Les cytosines mthyles sont fortement mutagnes et leur damination conduit une
dpltion en CpG pour les gnes concerns. La mthylation de lADN chez labeille est
implique dans la rgulation des gnes pendant le dveloppement. Les auteurs proposent
comme hypothse que la mthylation de lADN est la base de la diffrenciation entre les
classes sociales chez labeille (Elango et al. 2009). Les gnes DNMT1, DNMT2 et DNMT3
ont galement t identifis chez linsecte parasitode Nasonia vitripennis (Werren et al.
2010) et la mthylation des cytosines a t dtecte chez de nombreux insectes.
2.1.3. Les petits ARN
Depuis leur dcouverte dans les annes 1990, les mcanismes de rgulation faisant
intervenir des petits ARN ont rvl leur importance chez de nombreuses espces. Ces petits
ARN, de 20 29 nuclotides agissent en squestrant ou en dgradant les ARN messagers,
permettant une rgulation de lexpression des gnes au niveau post-transcriptionnel (Siomi et
Siomi, 2009). Impliqus dans des processus aussi varis que la mise en place de la ligne
germinale et le contrle des squences rptes de type ET chez les mammifres, les
drosophiles et les plantes, les petits ARN interviennent aussi pour cibler des modifications
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
22
pigntiques sur certaines squences rptes. Les premiers petits ARN dcouverts furent les
small interfering RNA (siRNA) et de nouvelles familles sont rgulirement dcouvertes.
Ainsi en plus des siRNA, les micro RNA (miRNA), les PIWI-interacting RNA
(piRNA) ou encore les endogenous-siRNA (endo-siRNA) sont impliqus dans diffrentes
voies de rgulation. Ces petits ARN diffrent par leur taille, par lenzyme qui les clive et par
la protine qui les prend en charge. Les piRNA de 24 29 nuclotides, aussi appels
repeat associated small interfering RNA (rasiRNA), sont produits par des squences
rptes de type ET et ont t mis en vidence rcemment dans la ligne germinale de la
drosophile. Limplication de ces rasiRNA dans la rgulation des ET sera dtaille ci-aprs.
2.2. Variabilit des rgulations pigntiques
Les mcanismes pigntiques de rgulation des gnes chez lHomme et les plantes, et
dempreintes gnomiques chez les mammifres sont bien dcrits et nous avons vu
prcdemment les consquences graves que peuvent avoir des dfauts dans la mise en place
ou le maintien des profils de mthylation. Cependant, quelques exemples montrent que les
rgulations pigntiques et plus prcisment la mthylation de lADN sont sensibles
lenvironnement. Un exemple frappant concerne les jumeaux monozygotiques, par dfinition
gntiquement identiques car issus de la division dun zygote en deux cellules filles, qui
peuvent dans certains cas avoir des phnotypes discordants et dvelopper des maladies
gntiques diffrentes. Chez lHomme, ltude des modifications pigntiques a permis de
montrer que des jumeaux monozygotiques adultes prsentent des diffrences significatives au
niveau des profils de mthylation des cytosines et dactylation des histones (Fraga et al.
2005). Au contraire, les jumeaux plus jeunes prsentent relativement peu de diffrence de ces
profils. Cela peut sexpliquer par le fait que les sujets jeunes vivent souvent dans le mme
environnement, tandis que les sujets adultes vivent plus loigns lun de lautre. Ltude des
cotypes Columbia (Col) et Landsberg (Ler) a permis de mettre en vidence chez la plante
Arabidopsis thaliana des diffrences importantes dans les profils de mthylation de la
molcule dADN sur laquelle les 5 mthylcytosines sont essentiellement localises
lintrieur des gnes sans entrainer de diminution de leur expression (Vaughn et al. 2007). En
revanche, trs peu de polymorphismes dans les profils de mthylation associs aux ET furent
rvls entre ces deux cotypes, soulevant donc le rle central que la mthylation de lADN
possde dans le contrle des ET chez cette plante. Des travaux mens chez labeille ont
montr que lalimentation est implique dans la diffrenciation entre la reine qui est fertile, et
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
23
les travailleuses qui sont striles. En effet, la gele royale est une substance spcialement
synthtise par les nourrices pour nourrir les larves destines devenir reine. La majorit des
larves mutes pour DNMT3 par injection de siRNA donnent des reines, ce qui implique que
la gele royale contient des substances agissant sur ltablissement des profils de mthylation
chez labeille (Kucharski et al. 2008). La relation entre la rgulation des ET, la mthylation de
lADN et les conditions de lenvironnement suggre alors une implication en synergie de ces
trois composantes dans lvolution des espces et la spciation. Un relchement de la
rpression des ET lors de changements des conditions de lenvironnement peut fournir au
gnome hte un avantage adaptatif certain (Rebollo et al. 2010).
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
24

3. Les populations naturelles de drosophiles pour
comprendre la dynamique des ET
3.1. Variabilit en ET dans les populations naturelles de drosophiles
Les espces D. melanogaster et D. simulans sont deux espces trs proches
phylogntiquement, dont la divergence est estime 2,5 millions dannes (par comparaison,
la divergence entre lHomme et le chimpanz est estime 6 millions dannes (Goodman et
al. 1998)). Malgr cette proximit volutive, ces deux espces ont, dans leurs gnomes, des
proportions trs diffrentes de squences rptes, de l'ordre de 5 % pour D. simulans et de 14
% pour D. melanogaster (Dowsett et Young, 1982). Le rcent squenage de ces deux
gnomes fait tat de 2,73 % chez D. simulans et de 5,35 % chez D. melanogaster (Clark et al.
2007). Ces deux analyses reposent sur des techniques diffrentes. La premire quantification
fut ralise en mesurant les cintiques de dissociation-rassociation des squences dADN
chez ces deux espces. La deuxime quantification fut quant elle calcule partir des parties
squences des gnomes de ces deux espces, principalement de leuchromatine,
lhtrochromatine tant difficilement squenable et annotable. La proportion relle en ET
de ces deux gnomes se situe probablement entre ces deux estimations puisque dune part, la
premire mthode quantifie les squences rptes au sens large, et donc pas exclusivement
les ET et dautre part, la deuxime mthode ne prend pas en compte lhtrochromatine,
particulirement dense en ET. Bien que la valeur absolue de la quantit en ET des deux
espces puisse tre discute, la diffrence entre les deux espces se confirme selon les
estimations prcites. Ces deux espces invasives originaires des rgions est-africaines ont
une histoire cologique diffrente et la colonisation du monde par D. melanogaster est plus
ancienne que celle de D. simulans (Lachaise et Silvain, 2004). La colonisation dun nouvel
environnement est souvent associe une augmentation de la transposition, comme le
rapportent les tudes du nombre de copies qui est plus faible dans les populations africaines
que celui observ dans les populations du reste du monde (Vieira et al. 1999). Le nombre de
copie dET dans les populations de drosophiles serait maintenu au niveau de la ligne
germinale par un quilibre entre la transposition et la slection naturelle, comme le proposent
diffrents modles, et une rgulation plus fine au niveau de chaque individu est apporte par
les mcanismes pigntiques (Lee et Langley, 2010). Par ailleurs, il ne semble pas y avoir de
lien entre le nombre de copies des ET et leur taux de transposition chez ces deux espces
(Pasyukova et al. 1998; Vieira et al. 1997). LET de classe 2 mariner prsente une diffrence
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
25
dexpression somatique entre les populations de D. simulans : lexpression est plus grande
dans les jeunes populations invasives que dans les populations installes depuis plus
longtemps (principalement africaines) (Picot et al. 2008). Ltude des populations naturelles
dmontre quil existe une grande variabilit du nombre de copies dET entre les populations
de ces deux espces (Vieira et Bimont, 2004). Ces nombres de copies ont t dtermins
pour plusieurs familles dET par hybridation in situ sur les chromosomes polytnes des
glandes salivaires de larves de drosophiles. Cette technique, qui utilise une sonde spcifique
chaque ET, permet de compter les copies euchromatiques situes sur les bras des
chromosomes. Les insertions dET prsentes au niveau du chromocentre, ensemble fortement
htrochromatique compos des centromres des chromosomes polytnes, ne peuvent pas tre
dnombres par cette technique. Ainsi, bien que plusieurs populations naturelles de D.
simulans naient pas de copies euchromatiques de certains ET, toutes possdent nanmoins
des copies au niveau des chromocentres. Parmi les ET prsentant un polymorphisme
dinsertion important, le rtrotransposon tirant prsente une variabilit du nombre de copies
euchromatiques particulire chez D. simulans, puisquhormis deux populations est-africaines,
aucune autre population nen possde au niveau euchromatique.
3.2. Epigntique chez la drosophile
3.2.1. Methylation de lADN
Le taux de mthylation des cytosines chez D. melanogaster est compris entre 0,4 % et
1 % (Kunert et al. 2003; Lyko et al. 2000). Parmi les gnes connus codant des enzymes ayant
une activit DNA methyltransferase , tous ont t perdus au cours de lvolution des
drosophiles lexception de DNMT2 (Ponger et Li, 2005). Aucune activit de type DNMT
na pu tre attribue in vitro dDNMT2 et sa fonction n'est connue que depuis quelques
annes. De nombreuses et rcentes tudes montrent en effet que DNMT2 est une RNA
methyltransferase capable de transfrer un groupement mthyl sur les cytosines des ARN de
transfert (ARNt). Cette activit de mthylation des cytosines des ARN de transfert joue
certainement un rle biologique important car elle est conserve de lHomme la drosophile
en passant par la levure S. pombe (Schaefer et Lyko, 2010; Goll et al. 2006). Lexpression du
gne dDNMT2, bien que faible, est maximale durant les stades larvaires du dveloppement de
la drosophile mais nulle au stade adulte (Lyko et al. 2000). Les mutations de DNMT2 sont
viables et ne provoquent aucun phnotype, tandis que la surexpression de ce gne conduit
une augmentation de la longvit des mouches (Lin et al. 2005). Ceci conduit penser que,
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
26
chez la drosophile, la mthylation de lADN nintervient pas dans la rgulation des gnes et
des ET comme cela a t mis en vidence dans dautres espces. Cependant, lutilisation
denzymes de restriction et de traitement au bisulfite ont permis de mettre en avant la
prsence de sites mthyls chez D. willistoni (Garcia et al. 2007) et des squences fortement
mthyles au niveau de la rgion rgulatrice du rtrotransposon LTR invader 4 durant les
stades embryonnaires du dveloppement de D. melanogaster (Phalke et al. 2009). Dans ce
dernier exemple, la mthylation dinvader 4 durant les stades prcoces permettrait de recruter
lhistone mthyl-transferase SUV4-20, pour ensuite trimthyler H4K20. Un dfaut des
structures tlomriques, associ la transposition de llment invader 4, a t de plus
constat dans des mutants dDNMT2.
Enfin, il a rcemment t montr par enzyme de restriction lexistence de profils de
mthylation sexe-spcifique chez certaines espces de drosophiles du sous-genre Sophophora
(D'vila et al. 2010), suggrant ainsi une analogie avec les empreintes gntiques impliques
dans la rgulation des gnes chez les mammifres. Lensemble de ces rsultats est
contradictoire mais nous ne pouvons cependant pas exclure que la mthylation de lADN chez
la drosophile soit implique dans la rgulation des ET.
3.2.2. Modification des histones
Chez la drosophile, la mthylation de H3K9 est implique dans la rgulation des gnes
durant le dveloppement, dans la structure des chromosomes et dans le contrle des ET (Peng
et Karpen, 2007). Le phnomne de Position Effect Variegation (PEV), mis en vidence
chez la drosophile, est caractris par un vnement de recombinaison ayant pour rsultat de
juxtaposer des rgions euchromatiques des rgions dhtrochromatine constitutive (Girton
et Johansen 2008). Les gnes prsents dans ces rgions euchromatiques vont alors tre
htrochromatiniss et devenir transcriptionnellement inactifs. Ces rgions sont dfinies
comme de lhtrochromatine facultative. Lanalyse des composants molculaires intervenant
dans le PEV a permis didentifier de nombreuses protines impliques dans la formation de
lhtrochromatine, baptises Suppresseurs de Variegation (SU(VAR). Les SU(VAR)
sont pour la plupart des enzymes assurant les modifications post-traductionnelle des histones.
Lhistone mthyltransfrase SU(VAR)3-9, qui mthyle lhistone H3 sur sa lysine 9 (H3K9), a
un rle central dans ltablissement de lhtrochromatine des chromocentres et du
chromosome 4 de la drosophile (Schotta et al. 2002). De plus, il semblerait que la fonction de
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
27
cette enzyme soit extrmement bien conserve puisquil est possible de restaurer un
phnotype sauvage chez un mutant auquel lenzyme SU(VAR)3-9 humaine est transfecte.
3.2.3. Petits ARN
Quelques annes auparavant, la dcouverte, chez la drosophile, des piRNA,
initialement connus sous le nom de repeat associated small interfering RNA (rasiRNA)
(Vagin et al. 2006), bouleversa nos connaissances en terme de rgulation des ET. Les piRNA
sont des lments cls dun systme de rgulation des ET deux composantes : une
composante gntique code par des locus htrochromatiques contenant des copies
dfectives dET d'une part, et une composante adaptative correspondant aux piRNA produits
par les copies fonctionnelles des ET localises dans leuchromatine d'autre part. Les piRNA
sont des petits ARN non codants, antisens, de 25 29 nuclotides, produits par des clusters
localiss dans les rgions pricentromriques et tlomriques des chromosomes, composs de
squences dET dgnres (Saito et al. 2006). La sous-classe PIWI fait partie de la famille
des protines Argonaute, et comprend les protines PIWI ( P-element Induced Wimpy
testis ), Argonaute 3 (AGO3) et AUBergine (AUB). Les piRNA sont pris en charge par les
protines PIWI ou AUB, afin de cibler et dgrader les transcrits sens des ET pour lesquels ils
sont complmentaires. Le clivage des transcrits sens des ET par les piRNA produit des petits
ARN sens qui seront alors pris en charge par la protine AGO3. Ce nouveau complexe
ARN/AGO3 ciblera son tour les transcrits antisens. Un modle damplification de
limmunit induite par ces piRNA, appel ping-pong , est propos par Brennecke et al
(2007). De rcentes tudes montrent que les protines PIWI et AUB interviennent
respectivement dans les rgulations somatique et germinale des ET (Malone et al. 2009).
Chez la drosophile, la dysgnsie des hybrides est un phnotype caus par la transposition
massive de llment I ou de llment P. Le croisement de mles inducteurs I (prsence de
copies actives de I) et de femelles ractives R (absence de copies actives de I) conduit une
strilit de la descendance. Le croisement inverse impliquant des mles R et des femelles I
conduit une descendance fertile. Chez les individus I, llment I est rgul et son
expression est faible. Il a t montr que les facteurs cytosplasmiques transmis
maternellement et permettant de rguler la transposition de llment I, correspondent des
piRNA spcifiques de la ligne germinale (Chambeyron et al. 2008; Brennecke et al. 2008).
En effet, lanalyse de mutants spcifiques de la voie de rgulation impliquant des piRNA
AGO3-dpendant a montr une ractivation transcriptionnelle de llment I dans les souches
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
28
I. Les piRNA dirigs contre llment I et dposs maternellement assurent la rgulation de
cet ET et empchent lapparition du phnotype dysgnsique dans la descendance lors dun
croisement mle R et femelle I. Un autre lment de la drosophile, gypsy, un rtrovirus
endogne, permet dillustrer la voie de rgulation somatique impliquant des piRNA. Le locus
flamenco (ou locus COM) (Desset et al. 2008), prsent chez D. melanogaster et conserv
chez D. erecta et D. yakuba, est un locus htrochromatique compos dET dgnrs
producteurs de piRNA antisens (Malone et al. 2009). Ces derniers, pris en charge par PIWI,
sont impliqus dans la rgulation somatique de gypsy dans les cellules folliculaires. La leve
de la rpression de gypsy a t montre par lutilisation de mutants de la voie PIWI
somatique-dpendant ainsi que par des mutants du locus flamenco. Les auteurs proposent que
ces deux systmes distincts permettent de rguler les ET actifs au niveau somatique et
germinal chez la drosophile.
3.3. Le Modle tirant
Dune manire gnrale, pour un lment, le nombre de copies est plus lev dans les
populations naturelles de D. melanogaster prsentant une variabilit inter-populationnelle de
ce nombre faible, que chez les populations naturelles de lespce D. simulans, pour laquelle la
variabilit inter-populationnelle est plus leve (Vieira et al. 1999). LET tirant est un
rtrotransposon LTR de type gypsy et spcifique au sous-groupe melanogaster (Marsano et
al. 2000). Sa structure canonique tablie partir de squences de D. melanogaster est
prsente sur la Figure 3 (Caizares et al. 2000). Avec une structure caractristique des
rtrovirus endognes, tirant est flanqu par deux LTR et possde les cadres ouverts de lecture
gag, pol et env codant les enzymes indispensables sa rtrotransposition. Dans les
populations naturelles de D. melanogaster et D. simulans, cet lment possde une
distribution du nombre de copies tonnante. Dune part, il a t mis en vidence par Southern
blot que toutes les populations de D. melanogaster et D. simulans possdent des copies de
tirant, et que toutes les populations testes lexception de la population du Zimbabw (D.
simulans) contiennent au moins une copie complte, donc potentiellement active (Fablet et al.
2006). Dautre part, lhybridation in situ sur chromosomes polytnes a montr que toutes les
populations de D. melanogaster possdent environ une dizaine de copies de tirant, tandis que
chez D. simulans, la plupart des populations ne possdent pas de copies de tirant sur les bras
des chromosomes, lexception de deux populations de lest africain, Zimbabw et Makindu
(Kenya) (Vieira et al. 1999).
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
29


Figure 3: Structure du rtrotransposon LTR tirant
Dans la suite de mon manuscrit, un intrt particulier sera port quatre populations
dont les caractristiques sont les suivantes : la population de D. melanogaster, provenant du
Sngal, qui possde neuf copies euchromatiques de tirant ; les populations de D. simulans de
Chicharo (Portugal), Zimbabw et Makindu (Kenya), qui possdent respectivement zro,
deux et cinq copies euchromatiques de tirant (Figure 4). Lanalyse de lexpression de tirant a
t dtermine par RT-PCR partir dARN totaux, extraits partir de femelles entires,
dovaires et de testicules de ces quatre populations. Au niveau somatique, tirant est exprim
dans toutes les populations, tandis que dans la ligne germinale, tirant nest exprim que dans
les ovaires et les testicules de la population de Makindu (D. simulans) (Fablet et al. 2006).
Deux variants de tirant ont t identifis selon des diffrences dans la squence nuclotidique
de leurs rgions rgulatrices, compose de la LTR 5 et de lUTR 5. Un premier variant
prsent chez les deux espces a t baptis type C ; un second, prsent uniquement dans les
populations naturelles de D. simulans, a t quant lui baptis type S. Des mesures dactivit
promotrice des variants de type C et S avec un gne rapporteur en cultures cellulaires ont
montr que tous deux sont capables in vitro dinitier la transcription (Fablet et al. 2009). En
revanche, le squenage des produits de RT-PCR a montr que seul le variant de type C est
transcrit in vivo (Fablet et al. 2006).

t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
30

Figure 4: Carte des zones d'chantillonnage des souches tudies
La population chantillonne au Sngal appartient lespce D. melanogaster, les
populations de Chicharo, Zimbabw et Makindu appartiennent lespce D. simulans. Le
nombre de copies euchromatiques de chaque population est indiqu.
Les sites dinsertion des copies de tirant dans les populations de Chicharo, Makindu et
Zimbabw (D. simulans) ont t dtermins par genome walking , technique permettant
didentifier la squence du gnome flanquant linsertion dun ET. Ces populations naturelles
de D. simulans offrent ainsi un systme idal pour tudier la dynamique de tirant chez la
drosophile, et plus particulirement les marques pigntiques comme la mthylation de
lADN et les modifications post-traductionnelles des histones.
Sngal
Chicharo
Makindu
Zimbabw
9 copies
5 copies
2 copies
0 copie
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
31



CHAPITRE 1
tude des marques pigntiques
associes tirant dans des populations
naturelles de D. simulans
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
32

t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
33

1. Dtermination et analyse des profils de mthylation de
la rgion rgulatrice de tirant
1.1. Mthodes danalyse de la mthylation de lADN
Diffrentes approches, ne fournissant pas les mmes informations, permettent
danalyser la mthylation de lADN des gnomes. La dtermination du taux de 5
mthylcytosine (5-MedC) par rapport au taux de cytosines (dC) totales de diffrents gnomes
(espces, individus ou tissus diffrents) peut tre ralise par chromatographie dont le
principe est dtaill dans le chapitre 2. Ce type danalyse globale ne permet cependant pas
didentifier les squences dADN mthyles. Dautres techniques sont utilises pour identifier
les squences mthyles dun gnome et tablir les profils de mthylation des cytosines
correspondant ces squences. Elles reposent sur limmunoprcipitation, les enzymes de
restrictions ou encore, le traitement au bisulfite de sodium. Lamlioration des technologies
de squenage et lapparition du squenage haut dbit permettent maintenant de squencer
le mthylome dun gnome partir de lune de ces trois techniques (Pomraning et al. 2009).
1.1.1. Limmunoprcipitation de lADN mthyl (MeDiP)
Lutilisation dun anticorps spcifique dirig contre les 5-MedC sert
immunoprcipiter les fragments dADN mthyls. Il est ensuite possible de mesurer par q-
PCR, pour un locus prcis, un enrichissement relatif en squences mthyles en comparant la
fraction enrichie (immunoprcipite par lanticorps spcifique des 5-MedC), et la fraction
tmoin (immunoprcipite par un anticorps aspcifique, gnralement anti-IgG). Les
squences de la fraction enrichie en ADN mthyl peuvent aussi tre identifies par clonage
et squencage (Jacinto et al. 2008), ou par hybridation sur des puces ADN (Zilberman et
Henikoff, 2007).
1.1.2. Les enzymes de restriction
Certaines enzymes de restriction sont sensibles la prsence de 5-MedC sur leur site
de restriction. Des techniques bases sur ces proprits, appeles MSRE (Methyl Sensitive
Restriction Enzymes) permettent de mettre en vidence la prsence ou non de 5-MedC dans
un gnome. En effet, il est possible, aprs digestion dun chantillon dADN par un couple
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
34
denzyme, sensible et non sensible la mthylation de lADN, de visualiser sur gel
dlectrophorse les polymorphismes de digestion entre ces deux enzymes, signifiant alors la
prsence de sites de restriction mthyls sur leurs cytosines. De plus, la comparaison de deux
profils de digestion de lenzyme sensible partir dchantillons diffrents peut tre utilise
pour dtecter des profils de mthylation tissu ou sexe-spcifique. La rsolution limite de la
mthode ne fait pas toujours ressortir des diffrences entre les enzymes sensibles et non
sensibles. Il est nanmoins possible danalyser les fragments dADN digrs par PCR, q-PCR
(PCR quantitative), Southern-blot ou encore par hybridation sur des puces ADN.
Au cours de ma thse, jai utilis la PCR avec des amorces flanquant le site de
restriction pour mettre en vidence des sites de mthylation au niveau des ET; cette technique
sera dtaille dans le chapitre 2.
1.1.3. Les traitements au bisulfite de sodium
Le Bisulfite Genomic Sequencing (BGS), permettant dtablir des profils de
mthylation de squences spcifiques, est trs largement utilis car il est trs informatif. Par le
biais de cette technique, il est possible de dterminer le profil de mthylation des cytosines
sur des squences dADN jusqu 1000 pb. Le BGS repose sur les proprits chimiques du
bisulfite de sodium qui convertit les cytosines non mthyles en uracile. La cintique de
raction sur les cytosines non mthyles est trs leve, tandis qu linverse, elle est trs
faible sur les cytosines mthyles (Hayatsu 2008) (Figure 5).
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
35


Figure 5. Etapes de conversion de la cytosine en uracile par le bisulfite de sodium
La conversion des cytosines non mthyles en uracile par le bisulfite de sodium se droule en
trois tapes. Tout dabord, il y a addition dions hydrognosulfates la cytosine (Step 1), pour
former des cytosines sulfures (C-SO
3
-
) qui vont ensuite tre damines par hydrolyse (Step
2) pour former des uraciles sulfures (U- SO
3
-
). Enfin, un simple traitement alcalin (Step 3)
permet de librer les ions hydrognosulfates (dsulfonation) pour former luracile.
Lefficacit de cette raction est optimale sur des molcules dADN purifies et
dnatures. La conversion des cytosines non mthyles conduit la formation de deux brins
dADN qui ne sont plus complmentaires. Le profil de mthylation dun locus dintrt peut
tre tabli, aprs PCR, clonage et squenage dun ADN trait au bisulfite de sodium, par
comparaison de la squence traite avec une squence de rfrence non traite (Figure 6).
Aprs le traitement au bisulfite de sodium, les molcules dADN sont composes duraciles,
obtenues aprs conversion des cytosines non mthyles, qui seront, lors de la PCR,
remplaces par des thymines. Les cytosines mthyles, non converties lors du traitement,
pourront tre alignes avec les cytosines de la squence de rfrence, tandis quun
msappariement T/C entre la squence traite et la squence de rfrence sera caractristique
de la damination, lors du traitement, dune cytosine non methyle. A partir de ce profil de
mthylation, il est possible dune part de calculer un taux de mthylation, et dautre part
dtudier la distribution des cytosines mthyles en fonction du contexte dinuclotidique. Une
mthode base sur lutilisation denzymes de restriction, sur un produit de PCR amplifi
partir dun ADN gnomique trait prcdemment au bisulfite de sodium, a t dveloppe et
baptise COBRA (Combine Bisulfite Restriction Analysis, (Eads et Laird, 2002)). Son
principe est dutiliser les proprits du bisulfite pour modifier les sites de restriction
dendonuclases. Le site de restriction est prserv aprs le traitement au bisulfite de sodium
si ses cytosines sont mthyles. Dans ce cas, lenzyme pourra reconnatre son site de
restriction et le cliver. A linverse, si les cytosines du site de restriction ne sont pas mthyles,
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
36
le traitement au bisulfite de sodium modifiera la squence du site de restriction et lenzyme ne
pourra pas le cliver.

Figure 6. Schma de la technique de "Bisulfite Genomic Sequencing"
1, une molcule dADN double brin porte une cytosine mthyle sur le brin 5-3, localise
sur le dinuclotide CpA. La deuxime cytosine du mme brin est, quant elle, non mthyle.
Le brin 3-5 ne porte pas de cytosine mthyle. 2, une fois que lADN a t dnatur, les
cytosines non mthyles vont tre converties en uracile. 3, le fragment dintrt est amplifi
par PCR avec des amorces brin spcifique du brin 5-3. Lors de la PCR, des thymines sont
incorpores la place des uraciles. 4, Aprs clonage et squenage, les squences obtenues
sont alignes avec la squence de rfrence non traite. Lalignement des cytosines permet
didentifier les cytosines mthyles tandis que lalignement dune cytosine avec une thymine
permet didentifier une cytosine non mthyle.
5
5
3
3
3
5
3
2
3 3
4
Rfrence
Traite
Cytosine
mthyle
Cytosine
non mthyle
C A A T G C T
C A A T G T T
C A A T G T T
G T T A C A A
C A A T G U T
G T T A U G A
Me
C
C
C
T
5
3
3 5
1
C A A T G C T
G T T A U G A
Me
C
Me
Cytosine
mthyle
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
37
Lun des objectifs de ma thse a t de dterminer si la rgion rgulatrice de tirant est
associe des cytosines mthyles selon un profil spcifique et ce, afin dexpliquer son
activit dans les populations naturelles. Dans ce but, jai dtermin les profils de mthylation
de la rgion rgulatrice de tirant par BGS. Cette technique comporte des artefacts lis au
traitement au bisulfite, conduisant parfois une interprtation errone des rsultats. Ces
artfacts sont associs certaines tapes critiques, telles que la dnaturation de lADN, la
dsulfonation (tape 3 du traitement au bisulfite, Figure 5) et lamplification PCR des
fragments traits. La conception des amorces ncessaires lamplification dun fragment
partir dADN trait au bisulfite est aussi une tape critique. Il faut tenir compte du fait que
lamplification est brin spcifique, mais aussi que toutes les cytosines localises au niveau de
la zone dhybridation entre lamorce et lADN gnomique sont susceptibles davoir t
converties ou non en uracile. Chez lhomme, les cytosines mthyles sont exclusivement
localises au niveau des dinuclotides symtriques CpG, particularit importante pour la
conception damorces et lvaluation de lefficacit du traitement puisque les cytosines en
contexte asymtrique ne sont jamais mthyles. Lors de la conception des amorces, ces
cytosines sont virtuellement converties en uracile et les amorces sont positionnes sur des
squences complmentaires dpourvues en CpG. Cette approche possde deux avantages : en
premier lieu, lutilisation damorces dgnres (ensemble damorces contenant plusieurs
combinaisons de squences) nest pas ncessaire, ce qui facilite la mise au point et la
spcificit de la PCR ; en second lieu, seules les squences totalement converties par le
traitement sont amplifies. De plus, toutes les cytosines hors CpG non converties par le
traitement deviennent des contrles internes qui permettent dapprhender lefficacit de la
raction de conversion. Ainsi, dans toutes les tudes de profils de mthylation symtriques,
lamplification par PCR brin spcifique, inhrente la technique de BGS, offre un contrle
interne de lefficacit du traitement. Chez la drosophile, la situation est plus complexe : les
cytosines mthyles tant potentiellement localises dans tous les contextes dinuclotidiques,
la dmarche dcrite ci-dessus ne peut pas tre envisage. Lutilisation damorces dgnres
devient ds lors indispensable. Egalement, les conditions damplification par PCR
(temprature dhybridation, quantit dADN trait amplifier, quantit de MgCl2, cycle de
PCR) ncessitent une longue priode de mise au point. En effet, la conversion en uracile des
cytosines des diffrentes copies dun locus, comme dans le cas des copies dun ET, sont
susceptibles de gnrer plusieurs combinaisons de squences cibles pour les amorces. Dans
ces conditions, des gradients de temprature dhybridation sont raliss afin de dterminer
celle qui permettra lamplification dune bande spcifique. Pour amplifier la rgion
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
38
rgulatrice de tirant, jai conu plusieurs couples damorces diffrents dont trois, nomms
tir01, tir52 et tirC1, qui ont permis lamplification de produit de PCR (Figure 7). Les deux
couples damorces tir01 et tir52 amplifient des rgions chevauchantes du brin 5-3 des LTR-
UTR5 de toutes les copies de type C de tirant. Elles ne permettent pas lamplification de solo
LTR mais privilgient les copies plus longues, voire compltes. Le couple damorces tirC1
amplifie le brin 3-5 correspondant et sera utilis comme contrle pour vrifier les rsultats
obtenus par les autres amorces.

Figure 7. Amorces utilises pour l'amplification par PCR de la LTR 5' de tirant aprs
traitement au bisulfite de sodium
Les brins dADN initialement complmentaires sont dnaturs puis traits au bisulfite de
sodium. Les PCR ncessaires lamplification de fragments dADN traits au bisulfite sont
brin-spcifiques. Lors de la conception des amorces pour amplifier une squence dont le
profil de mthylation est inconnu, il faut considrer, a priori, que chaque position de cytosine
est potentiellement convertie en uracile. A, exemple simplifi de la conception des amorces
tir01 forward et reverse qui possdent une cytosine dans leur squence. Cette cytosine
est convertie ou non en uracile en fonction de son tat de mthylation. Ainsi, la position de
lamorce reverse complmentaire dune cytosine est note R (A ou G). Pour lamorce
forward , dont la squence est identique celle du brin 5-3, la cytosine est note Y (C ou
T). Ce code universel permet llaboration damorces dgnres pour ces positions. B, les
couples damorces tir01 (flches violettes) et tir52 (flches bleues) amplifient des fragments
chevauchants du brin 5-3 dune partie de la rgion rgulatrice de tirant. Le couple damorce
tirC1 (flches vertes) permet lamplification du brin 3-5 correspondant.
Lutilisation de diffrentes amorces pour amplifier de lADN trait au bisulfite est
fortement conseille car les biais damplification sont frquents (Wojdacz et al. 2008). Les
amorces tir01 et tir52 ont une composition en base et des longueurs diffrentes. Ainsi, les
amorces tir01 et tir52 permettent respectivement lamplification dun produit de PCR
(G/A)TACAA
LTR 5
UTR 5
tirC1for tirC1rev
tir01for tir01rev
tir52for tir52rev
5 3
tir01for
tir01rev
(C/U)ATGTT TT(U/C)AGT
3 5
TT(A/G)AGT
C T T ( A / C ) A G T
(C/T)ATGTT
B
A
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
39
spcifique correspondant aux copies de type C de tirant des tempratures dhybridation de
43C et 52,4C. Des amorces amplifiant les copies de type S ont galement t mises au point
dans le but de vrifier si ces copies, exclusivement htrochromatiques et non transcrites,
possdent des profils de mthylation spcifiques. La difficult de cette exprience rside dans
labsence de contrle interne permettant de valider lefficacit du traitement. Lefficacit du
traitement au bisulfite de sodium peut tre rduite dans diffrentes conditions. La prsence de
protines ou dune dnaturation partielle de lADN peut empcher la raction de conversion
des cytosines non mthyles ; ceci conduisant une mauvaise interprtation des rsultats et
une surestimation du taux de mthylation des locus analyss. Afin de palier au manque de
contrles internes de cette technique, jai intgr dans le plan exprimental des rplicats
techniques et biologiques. Jai aussi vrifi lefficacit de la conversion des cytosines sur des
ADN extraits partir des 3 lignes diffrentes toutes mutantes pour le gne dDNMT2
(GS12412, DNMT2-/- et R2), pour lesquelles le taux de mthylation dtermin doit
correspondre au seuil defficacit de la technique. Les rsultats, obtenus avec les amorces
tir01 partir dADN purifi extrait des lignes mutantes, sont prsents dans la Figure 8 sous
la forme dun alignement reprsentant les profils de mthylation des cytosines de la LTR 5
de tirant. Ces derniers ont t tablis par comparaison avec la squence de rfrence de tirant,
obtenue pour chaque population ; les figures ont t produites par le logiciel Kismeth
(Gruntman et al. 2008), disponible en ligne (http://katahdin.mssm.edu/kismeth/revpage.pl).
Ce logiciel ralise ces profils partir de deux fichiers soumis par lutilisateur : un premier
compos de toutes les squences traites, non alignes, et un second, contenant la squence de
rfrence. Les alignements correspondant aux figures prsentes dans ma thse sont
disponibles en annexe. Dans la reprsentation des profils de mthylation donne par le
logiciel Kismeth, toutes les cytosines de la squence sont mises bout bout et un code couleur
dfinit le contexte trinuclotidique de chacune dentres elles (CHH, CHG ou CG). Les
cytosines non mthyles sont reprsentes par un rond vide et les cytosines mthyles par un
rond rempli de la couleur correspondante au contexte trinuclotidique. Les diffrents
contextes trinuclotidiques sont CHH, HG ou CG, dans lesquels H peut tre A, C, ou T. Cet
outil danalyse des squences dADN obtenues aprs traitement au bisulfite, initialement
dvelopp pour lanalyse de profils de mthylation chez les plantes, est particulirement
intressant pour ltude de la mthylation de lADN chez la drosophile, puisquil considre
que toutes les cytosines peuvent tre potentiellement mthyles indpendamment du contexte
nuclotidique. La grande majorit des autres outils danalyse des squences traites au
bisulfite de sodium ne prennent en compte que les dinuclotides CpG, masquant ainsi toutes
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
40
les autres cytosines. Les premiers rsultats obtenus sur des mutants de dDNMT2 montrent
que la majorit des cytosines de lensemble des clones a t convertie par le traitement, avec
une efficacit identique celle thorique de 99 %, mentionne dans le kit utilis. Deux
squences obtenues partir du mutant GS12412 nont pas t converties, probablement
cause dune mauvaise dnaturation de lADN. Dans les squences obtenues partir des
mutants DNMT2-/- et R2, nous distinguons deux types de squences, en fonction de la
rptition ou non dun motif de 19 pb au dbut de la rgion analyse. Le type C de tirant
prsente en effet au niveau de sa rgion rgulatrice une squence de 19 pb qui peut tre
rpte ou non (Fablet et al. 2006). Les squences de rfrence utilises pour les alignements
possdent toutes une rptition de ce motif. Lorsque ce motif de 19 pb nest pas rpt dans
les clones obtenus, cela se traduit, sur les profils de mthylation, par une dltion en dbut de
squence. Ces deux sous variants de tirant ont t identifis dans les lignes DNMT2-/- et R2,
contrairement la ligne GS12412, dans laquelle seul celui compos de deux motifs de 19 pb
a t retrouv dans mes rsultats.
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
41


Figure 8. Profils de mthylation de la LTR 5 de tirant dans les ovaires de souches mutantes
pour dDNMT2
Les ADN extraits partir des trois lignes dDNMT2-/-, GS12412 et R2 ont t traites au
bisulfite, les LTR 5 de tirant ont t amplifies avec lamorce tir01. Les produits de PCR ont
t clons et squencs et les profils de mthylation ont t tablis en utilisant le logiciel
Kismeth.
Ce premier rsultat, qui permet notamment de valider la technique de BGS, montre
que parfois, certaines squences dADN prsentent une rsistance au bisulfite de sodium,
indpendante de la mthylation des cytosines.
Durant la phase de mise au point de la technique, des profils de mthylation de la
rgion rgulatrice de tirant ont t obtenus partir dADN purifi extrait dovaires de la
population naturelle de Makindu (D. simulans), puis trait au bisulfite de sodium en utilisant
indpendamment les amorces tir01 et tir52 (Figure 9).
DNMT2-/-
(tir01)
GS12412
(tir01)
R2
(tir01)
CG CHH CHG
5meCG 5meCHH 5meCHG
CG CHH CHG
5meCG 5meCHH 5meCHG CHH
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
42

Figure 9. Profils de mthylation de la LTR 5 de tirant dans des ovaires de la population de
Makindu
Des ADN purifis extraits partir dovaire de la population du Makindu ont t traits au
bisulfite. Les deux couples damorces utiliss, tir01 for et tir01 rev (flches violettes) et tir52
for et tir52 rev (flches bleues) amplifient des fragments chevauchants de la rgion rgulatrice
de tirant.
Les rsultats montrent que le taux de mthylation de la rgion rgulatrice de tirant
dans la population de Makindu est trs faible et les cytosines sont mthyles sans position
spcifique, comme observs chez les mutants. Une position mthyle commune entre quatre
clones diffrents a t mise en vidence avec les amorces tir01. Lalignement de ces
squences disponibles en annexe ne permet cependant pas de dtecter de polymorphisme
entre ces quatre clones ; nous ne pouvons donc pas carter lhypothse quil sagisse du mme
produit de PCR clon puis squenc plusieurs fois. Par ailleurs, une substitution de thymine
en cytosine en position 250 se retrouve uniquement dans ces quatre squences, suggrant
quil sagit bien du mme amplicon.
Les nouveaux traitements au bisulfite ne ncessitent pas de grandes quantits dADN,
contrairement ceux disponibles lorsque jai commenc mon projet de thse. Jai utilis un
kit similaire celui test prcdemment, propos par le mme fabriquant afin de traiter de trs
faibles quantits de tissus. Aprs broyage et traitement la protinase K, de faibles quantits
de tissu peuvent tre traites sans tape dextraction dADN. Ce choix a t motiv par le fait
que lextraction de quantits dADN de testicules suffisantes pour le traitement ncessitait de
nombreuses heures de dissection. Ainsi, partir de 35 paires de testicules ou de 20 paires
dovaires broyes et traites la protinase K, un traitement au bisulfite suivi dune
amplification PCR est possible.
LTR 5
UTR 5
CG CHH CHG
5meCG 5meCHH 5meCHG
CG CHH CHG
5meCG 5meCHH 5meCHG CHH
tir01for tir01rev
tir52for tir52rev
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
43
1.2. Profils de mthylation de la LTR 5 de tirant
Les populations naturelles du Sngal (D. melanogaster), de Chicharo, du Zimbabw
et de Makindu (D. simulans) possdent respectivement neuf, zro, deux et cinq copies
euchromatiques de tirant. En outre, pour les populations de D. simulans, la connaissance des
sites dinsertion des copies de tirant (Tableau 2) obtenues dans lquipe par Genome
Walking (Fablet et al. 2009) a permis une analyse site spcifique des modifications
pigntiques associes tirant. Afin de savoir si la mthylation de lADN au niveau de la
rgion rgulatrice de tirant est associe au polymorphisme dinsertion dans les populations
naturelles, jai ralis une tude sur la ligne germinale des drosophiles, partir dovaires et
de testicules. La population de Chicharo est particulirement intressante car elle ne possde
que des copies htrochromatiques de tirant, permettant de dtecter si celles-ci ont des profils
de mthylation spcifiques de lhtrochromatine. Les rsultats obtenus avec les amorces
tir01 et tir52 sont prsents dans les Figure 10 (Makindu), Figure 11 (Zimbabw), Figure 12
(Chicharo) et Figure 13 (Sngal).
Tableau 2. Insertions des copies de type C de tirant identifies dans les populations de
Makindu, Chicharo et Zimbabw (D. simulans)
Population Localisation Commentaire Taille
Makindu
M1 ADN centromrique Ilots de Maupiti Copie complte
M2 2L Intron du gne tkv Copie complte
M3 X ADN non annot Copie complte
Zimbabw
Z1 ADN centromrique Ilots de Maupiti Fragment court
Z2 3R ADN non annot Fragment court
Z3 3 Htrochromatine Fragment long
Chicharo
C1 ADN centromrique Ilots de Maupiti Copie complte
C2 Htrochromatine Fragment long
C3 diver2 LTR retrotransposon Fragment court
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
44

Figure 10. Profils de mthylation de la LTR5 de tirant dans la population de Makindu (D.
simulans)
A: testicules; B: ovaires.

LTR 5
UTR 5
A
B
tir01
tir52
tir01
tir52
CG CHH CHG
5meCG 5meCHH 5meCHG
CG CHH CHG
5meCG 5meCHH 5meCHG CHH
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
45

Figure 11. Profils de mthylation de la LTR5 de tirant dans la population du Zimbabw (D.
simulans)
A: testicules; B: ovaires.

LTR 5
UTR 5
tir01
tir52
tir01
tir52
A
B
CG CHH CHG
5meCG 5meCHH 5meCHG
CG CHH CHG
5meCG 5meCHH 5meCHG CHH
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
46

Figure 12. Profils de mthylation de la LTR5 de tirant dans la population de Chicharo (D.
simulans)
A: testicules; B: ovaires.

LTR 5
UTR 5
tir01
tir52
tir01
tir52
A
B
CG CHH CHG
5meCG 5meCHH 5meCHG
CG CHH CHG
5meCG 5meCHH 5meCHG CHH t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
47

Figure 13. Profils de mthylation de la LTR5 de tirant dans la population du Sngal (D.
melanogaster)
A: testicules; B: ovaires.

LTR 5
UTR 5
tir01
tir52
tir01
tir52
A
B
CG CHH CHG
5meCG 5meCHH 5meCHG
CG CHH CHG
5meCG 5meCHH 5meCHG CHH
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
48
Les squences obtenues pour les populations du Sngal (D. melanogaster) et de
Chicharo D. simulans) tant au niveau des ovaires quau niveau des testicules ont des niveaux
trs faibles de mthylation et aucun profil spcifique na t identifi. Lorsquon utilise les
amorces tir01, les populations de Makindu et Zimbabw montrent la prsence de squences
dans lesquelles les cytosines sont non converties. Le taux de non conversion est lv dans les
rplicats de la population de Makindu mais plus faible dans la population du Zimbabw. De
plus, les squences fortement mthyles ne concernent que les squences de type C possdant
deux motifs de 19 paires de bases rptes en dbut de LTR. En revanche, les squences
obtenues avec les amorces tir52 ne comportent que trs peu de cytosines mthyles, dont la
rpartition tout au long de la squence est sporadique. Nous avons vu, avec les rsultats des
mutants de DNMT2, que dans certains cas la LTR 5 de tirant peut tre non convertie. Les
rsultats obtenus avec amorces tir01 montrent un biais damplification dans lequel les
squences non converties sont prfrentiellement amplifies et les amorces tir52 sont quant
elle idales puisquelles namplifient que les squences converties. Des squences dfinies
comme des Densely Methylated DNA Island (DMI) dont le taux de mthylation
dtermin par BGS est compris entre 50 et 100 %, ont t mises en vidence il y a une
quinzaine dannes chez plusieurs espces dont lHomme (Selker et al. 1993; Tasheva et
Roufa, 1995; Tasheva et Roufa, 1994). Le profil de mthylation de ces squences ne semble
pas avoir de prfrence dinuclotidique. Ces rsultats ont t discrdits par dautres tudes
des mmes rgions, dans les mmes gnomes, dans des conditions optimales de traitement au
bisulfite (Rein et al. 1997). La non-dnaturation, la dnaturation partielle ou encore labsence
de traitement la protinase K favorisent lobtention de squences non converties (Warnecke
et al. 2002). Nous reviendrons sur les artefacts lis la technique du BGS dans le paragraphe
suivant mais il est important de noter que les profils de mthylation des squences identifies
comme mthyles par Selker et al. et par Tasheva et al. sont du mme type que ceux que nous
avons obtenus avec les amorces tir01 dans les populations de Makindu et Zimbabw. Pour la
suite de mon manuscrit, les squences ayant un taux de mthylation lev, sans prfrence
dinuclotidique et sans position conserve entre les clones, seront donc considres comme
des squences non converties. Il reste noter cependant que les squences non converties ont
t retrouves systmatiquement et uniquement dans les rplicats techniques et biologiques
des populations de Makindu et Zimbabw. Les raisons de la reproductibilit de cette non
conversion, spcifique ces populations, restent dterminer, et ce dautant plus que nous
observons des profils de cytosines non converties forts ressemblants entre diverses
populations, avec certaines positions trs conserves (Figure supplmentaire 1, p. 161).
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
49
Sans tenir compte de ces squences, le taux de mthylation moyen observ dans les
autres clones des diffrentes populations est comparable celui observ dans les lignes
mutantes pour dDNMT2. Labsence de positions mthyles conserves entre les diffrents
clones est un argument majeur permettant daffirmer que les cytosines identifies comme
mthyles dans mes rsultats, ne sont pas impliques dans la rgulation de lexpression de
tirant. Toutefois, lanalyse que jai ralise concerne la mthylation de lensemble des LTR5
des copies de tirant des gnomes de chaque espce. Or les biais damplification PCR peuvent
conduire une reprsentation biaise des diffrents profils de mthylation existants au sein de
chaque gnome. Afin de vrifier si certains profils sont caractristiques de certaines rgions,
jai ralis une analyse site-spcifique de la LTR de trois copies compltes M1, M2 et M3
(Tableau 2, p.43), prsentes dans le gnome de la population de Makindu, des
compartiments chromatiniens diffrents. Les rsultats des profils de mthylation de ces
insertions sont reprsents sur la Figure 14.
Les rsultats obtenus avec le couple damorces tir151 pour la copie M3 insre sur le
chromosome X montrent une forte proportion de squences non converties. En revanche,
lutilisation dun deuxime couple damorces, tir152, pour cette mme insertion permet
damplifier des squences converties. Pour chacun des trois sites tudis, aucun ne prsente
des taux de mthylation suprieurs ceux prsents chez les mutants et aucune position
mthyle nest retrouve parmi les clones. Ainsi, aucun profil de mthylation spcifique des
copies compltes de tirant insres dans lhtrochromatine ou dans leuchromatine ne peut
tre mis en vidence.
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
50

Figure 14. Profils de mthylation des sites dinsertion des copies compltes M1, M2 et M3 de
tirant de la population de Makindu
1.3. Biais de la technique de bisulfite
Pour vrifier si les squences non converties sont dues la prsence de cytosines
mthyles, jai ralis des expriences complmentaires visant dterminer les profils de
mthylation du brin 5-3 dans diffrentes conditions, ainsi que du brin complmentaire de la
rgion rgulatrice de tirant dans la population de Makindu, population dans laquelle la
proportion de squences non converties est la plus forte. Les facteurs ayant la capacit de se
fixer lADN empchent la conversion des cytosines lors du traitement au bisulfite et sont
soit de type protiques soit de type nucliques. De nombreuses populations de petits ARN ont
t mises en vidence ces dernires annes, principalement des piRNA, produits partir des
ET. La mthode que jai utilise pour le traitement au bisulfite partir des tissus ne comporte
pas dtape de dgradation des ARN. Nous pouvons aussi envisager que, lors du traitement,
dans lequel la renaturation des brins dADN est une tape critique, des petits ARN
complmentaires de tirant prsents augmentent la cintique de rassociation des molcules.
Diffrents traitements au bisulfite ont t raliss, dont un premier dans les conditions
standards, un deuxime prcd dun traitement plus long la protinase K, et enfin un
troisime prcd dun traitement la RNase H (ralis aprs le traitement la protinase K)
M1
LTR 5
M2
M3
151f
LTR 5
LTR 5
f
152f 152r
151r
271f 271r
191f 191r 1 f
CG CHH CHG
5meCG 5meCHH 5meCHG
CG CHH CHG
5meCG 5meCHH 5meCHG CHH
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
51
dgradant ainsi les ARN apparis lADN. Les rsultats prsents sur la Figure 15
confirment, une fois de plus, que les conditions standards conduisent lobtention de
squences non converties. Le traitement ralis avec un supplment de protinase K permet
quant lui dobtenir une squence non convertie. Enfin, les squences obtenues partir dun
traitement avec supplment en protinase K, suivi dune incubation dune heure 37C avec
la RNaseH ont toutes t converties. Ainsi, le traitement des chantillons la RNaseH et la
protinase K optimise la conversion des cytosines par traitement au bisulfite. Ceci nexplique
cependant pas pourquoi des squences non converties sont retrouves avec les amorces tir01,
uniquement dans les populations de Makindu et Zimbabw, et que ces squences ne
concernent que les copies de tirant de type C comportant une rptition du motif de 19 paires
de bases.

Figure 15. Efficacit du traitement au bisulfite selon les conditions exprimentales
Des traitements au bisulfite de sodium ont t raliss partir dovaires broyes de la
population de Makindu. Le couple damorces tir01 a t utilis pour amplifier la LTR 5 de
tirant partir de lADN trait. A: ADN trait dans les conditions standards. B: Ajout de
protinase K au tissu broy. C: Ajout de protinase K suivi dun traitement la Rnase H.
Les cytosines non converties du brin 5-3 prsentes dans les squences obtenues
partir dchantillons de la population de Makindu font intervenir tous les types de
dinuclotides, tant symtriques quasymtriques. Les cytosines mthyles des dinuclotides
CpG devraient galement tre dtectes mthyles sur le brin complmentaire dans le cas de
vrai mthylation symtrique. Ainsi, la dtermination du profil de mthylation du brin
+ prot K
standard
+ prot K
+ Rnase H
CG CHH CHG
5meCG 5meCHH 5meCHG
CG CHH CHG
5meCG 5meCHH 5meCHG CHH
A
B
C
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
52
complmentaire valide les rsultats observs au niveau du brin sens (Warnecke et al. 2002).
Les amorces tirC1 sont des amorces dgnres qui permettent damplifier aprs traitement
au bisulfite de sodium une partie complmentaire des squences dtermines avec les
amorces tir01. Les profils de mthylation du brin complmentaire de la LTR 5 de tirant
reprsents sur la Figure 16 ont t tablis partir dovaires et de testicules de la population
de Makindu. Seules quelques cytosines mthyles ont t mises en vidence sur le brin
complmentaire, dont deux CpG mthyls dans les ovaires. Ce faible taux de mthylation
symtrique sur le brin complmentaire est un argument supplmentaire dmontrant que les
squences fortement mthyles nont pas de ralit biologique.

Figure 16. Profils de mthylation du brin complmentaire de la LTR 5 de tirant dans la
population de Makindu
ADN extrait dovaires (A) et de testicules (B). Les amorces tirC1f et tirC1r utilises
permettent damplifier la mme rgion que celle amplifie par le couple damorces tir01.
A
B
CG CHH CHG
5meCG 5meCHH 5meCHG
CG CHH CHG
5meCG 5meCHH 5meCHG CHH
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
53

2. Analyse des modifications dhistones associes des
insertions de tirant
Comme nous lavons vu dans lintroduction, certaines marques dhistones sont
associes de lhtrochromatine constitutive, dautres de leuchromatine. Afin de
caractriser le contexte chromatinien des insertions de tirant, jai choisi des marques
caractristiques de leuchromatine, comme H3K4me2 et de lhtrochromatine, comme
H3K9me2 et H3K27me3. En effet, la chromatine associe des squences rptes prsente
de trs faible taux de H3K4me2 et est enrichie en H3K9m2 (Peng et Karpen, 2007). Afin
dtablir le contexte chromatinien des copies de tirant chez D. simulans, jai ensuite recherch
par Imunoprcipitation de la Chromatine (ChIP), parmi ces marques dhistones, lesquelles
taient le plus fortement reprsentes.
2.1. Principe de la ChIP
La ChIP est une immunoprcipitation de la chromatine via un anticorps spcifique
dune marque dhistone. Cette mthode vise obtenir une fraction dADN enrichie en cette
marque (Figure 17). Diffrentes analyses peuvent alors tres ralises, selon la faon dont
cette fraction dADN enrichie sera analyse. La premire tape de la ChIP consiste
solidariser lADN de la chromatine en fixant les protines lies lADN. Cette tape, appele
cross linking , prserve les liaisons entre lADN et les protines impliques dans la
structure de la chromatine. Lutilisation danticorps dirigs contre les marques dhistones
dintrt permettra dobtenir une fraction appele Immunoprcipitat (IP) dADN enrichi en
cette marque par rapport la fraction dADN non enrichie appele INPUT (Figure 32,
matriels et mthodes, p.153). La chromatine est extraite des noyaux par lyse mcanique et
chimique des cellules, puis est sonique (cassure par ultrasons) pour casser les chromosomes
en petits fragments de 500 paires de bases et permettre une bonne rsolution de la ChIP. Ces
fragments sont ensuite immunoprcipits par les anticorps spcifiques des marques dhistones
recherches. Un tmoin dimmunoprcipitation, ralis avec un anticorps anti IgG, sera utilis
comme contrle ngatif, mesurant laspcificit de limmunoprcipitation. La rcupration
des complexes ADN/protines immunoprcipits sobtient par des lavages. La chromatine est
ensuite traite la RNase et la protinase K (ou reverse cross-link ), puis lADN est
extrait au phnol-chloroforme. Lenrichissement relatif des diffrentes copies de tirant pour
chaque marque dhistone est dtermin par qPCR par rapport la fraction INPUT, non
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
54
enrichie. Les modifications dhistones tudies sont toutes lies lhistone H3. Les rsultats
denrichissement des diffrentes marques ont t normaliss par lenrichissement en H3 total
(H3T) de chaque site analys, ce qui permet de saffranchir du biais d labondance en
nuclosomes pour chaque site analys. Ceci est ncessaire car les rgions dinsertion des
copies ne sont pas associes de faon identique H3. Le gne euchromatique RP49 a t
utilis comme contrle de ChIP.

Figure 17. Schma de la technique de ChIP
Les protines de la chromatine, dont les octamres dhistone composant les nuclosomes, sont
fixes lADN durant ltape de Cross-linking, puis les chromosomes sont coups en
fragments de 500 pb par sonication. Lutilisation danticorps dirigs contre une marque
dhistone permet dimmunoprcipiter les fragments lis un nuclosome comportant cette
marque. LADN est ensuite extrait et lenrichissement relatif de cette marque dhistone par
rapport la fraction INPUT est mesur en q-PCR pour des sites spcifiques.
Lanalyse par qPCR de lADN immunoprcipit doit concerner des copies uniques
afin dtre la plus rsolutive possible. Puisque les sites dinsertion de tirant dans les
populations de Makindu, Zimbabw et Chicaro sont connus, une analyse site spcifique des
modifications dhistones associes tirant vrifiera que ltat chromatinien observ
corresponde celui attendu, relatif la position de la copie sur le chromosome. Les sites
dinsertion de tirant dans les populations tudies sont rappels dans le Tableau 2 (p.43).
Cross-linking
Sonication
Immunoprcipitation
Extraction ADN
PCR quantitative
INPUT
ADN enrichis en squences fixes ADN non enrichis
IP
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
55
2.2. Modifications dhistones associes tirant
Les rsultats des marques dhistones associes aux diffrentes copies de tirant sont
reprsents dans laFigure 18. Ces rsultats montrent que rp49 est majoritairement associ la
marque H3K4me2, et que lenrichissement en H3K9me2 et H3K27me3 est trs faible. Ceci
signifie que le gne rp49 est associ une rgion euchromatique, favorable sa transcription,
ce qui confirme que celui-ci est un gne de mnage. Les copies de tirant M1, Z1 et C1 sont
toutes insres au mme site centromrique dans les ilots de Maupiti. Ces copies sont
enrichies en H3K27me3 dans les trois populations et prsentent un enrichissement variable en
H3K9me2 et H3K4me2. En effet, la marque H3K4me2 se retrouve enrichie uniquement au
niveau des copies Z1 et M1, contrairement la copie C1. Les autres copies de la population
de Chicharo ont des enrichissements en H3K27me3 uniquement.
La marque euchromatique H3K4me2 se retrouve fortement associe aux copies M2,
M3 et Z2 tandis que la marque H3K27me3 est associe la copie M2. Les copies M3, copie
complte, et Z2, fragment court de tirant, ont des profils dhistones similaires, ce qui montre
quil ny a pas dinfluence de la taille de la copie sur les modifications dhistones qui lui
seront associes. Cela sobserve aussi pour les copies de Chicharo, dont la copie C1 est une
copie complte, tandis que les autres sont dltes. Enfin, la copie Z3 prsente un profil
original denrichissement, principalement en H3K9me2, avec de faibles valeurs
denrichissement pour les marques H3K4me2 et H3K27me3. La prsence de marques
euchromatiques et htrochromatiques associes la mme squence, ou bivalence,
concernant les copies M1 et M2, a dj t mise en vidence pour tirant dans les tissus
somatiques de D. simulans (Fablet et al. 2009) ainsi que chez lHomme, dans les cellules
souches embryonnaires avec les marques H3K4me2 et H3K27me3 (Bernstein et al. 2006).
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
56

Figure 18. Modifications post-traductionnelles de lhistone H3 associes tirant
Les enrichissements relatifs pour chaque marque dhistone analyse ont t normaliss par
lhistone H3 totale. Le gne rp49 a t utilis comme contrle euchromatique. Les marques
H3K9me2, H3K4me2 et H3K27me3 ont t analyses. LIgG a t utilis comme contrle de
laspcifit des IP.
Les profils dhistones associs aux copies Z3 et Z2 de tirant montrent que la copie Z3
est dans un contexte htrochromatique alors que la copie Z2 est dans un contexte
euchromatique. Ce rsultat est tout fait compatible avec le fait que la copie Z2 est insre
sur le bras du chromosome, tandis que la copie Z3 est insre dans une rgion
htrochromatique. Pour la population de Chicharo, les copies C2 et C3 ne peuvent pas ce
jour tre positionnes dans le gnome squenc de D. simulans cause de la mauvaise qualit
de son squenage ainsi que les problmes dannotations qui lui sont lis. Les enrichissements
des copies C2 et C3 sont exclusivement htrochromatiques, ce qui est en accord avec le fait
que la population de Chicharo ne possde pas de copies de tirant sur les bras des
chromosomes. Lensemble des rsultats prsents ci-dessus montre que les profils de
0
0,2
0,4
0,6
0,8
1
1,2
H3K9me2 H3K4me2 H3K27me3 IgG
Makindu
0
0,5
1
1,5
H3K9me2 H3K4me2 H3K27me3 IgG
0
0,1
0,2
0,3
0,4
0,5
0,6
H3K9me2 H3K4me2 H3K27me3 IgG
Zimbabw Chicharo
rp49 rp49 rp49
0
0,1
0,2
0,3
0,4
H3K9me2 H3K4me2 H3K27me3 IgG
M1
0
0,05
0,1
0,15
0,2
0,25
0,3
H3K9me2 H3K4me2 H3K27me3 IgG
Z1
0
0,05
0,1
0,15
0,2
H3K9me2 H3K4me2 H3K27me3 IgG
C1
0
0,1
0,2
0,3
0,4
H3K9me2 H3K4me2 H3K27me3 IgG
M2
0
0,1
0,2
0,3
0,4
0,5
0,6
H3K9me2 H3K4me2 H3K27me3 IgG
M3
0
0,02
0,04
0,06
0,08
0,1
H3K9me2 H3K4me2 H3K27me3 IgG
Z3
0
0,05
0,1
0,15
0,2
H3K9me2 H3K4me2 H3K27me3 IgG
Z2
0
0,05
0,1
0,15
0,2
0,25
H3K9me2 H3K4me2 H3K27me3 IgG
C2
0
0,1
0,2
0,3
0,4
0,5
H3K9me2 H3K4me2 H3K27me3 IgG
C3
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
57
modifications dhistones identifis pour les copies de tirant sont cohrents avec leurs
localisations dans les gnomes des populations tudies. Lexpression de tirant dans la
population de Makindu peut tre explique par le fait que la copie M3 est associe
majoritairement une modification dhistone caractristique de leuchromatine favorable la
transcription. A linverse, les copies M1 et M2 de tirant, localises dans des rgions
euchromatiques, portent des marques dhtrochromatine facultative. La copie M2 est insre
dans le gne tkv, qui code pour un rcepteur de decapentaplegic (dpp), impliqu dans le
dveloppement embryonnaire de la drosophile (Terracol et Lengyel, 1994; Brummel et al.
1994). Lorsquune nouvelle copie dun ET sinsre un locus du gnome, elle peut adopter la
structure chromatinienne de son site dinsertion, ou tre la cible de nouvelles modifications
pigntiques. En consquence, linsertion de tirant dans ce gne provoquera, le cas chant,
un bouleversement de la structure chromatinienne de de ce gne et modifiera ainsi son
expression. Nous avons ensuite utilis le polymorphisme dinsertion de tirant au sein des
populations naturelles de D. simulans pour voir leffet de cet lment sur la structure de la
chromatine au niveau de son site dinsertion.
2.3. Influence de tirant sur la chromatine chez D. simulans
Les sites M2 et M3 sont des sites dinsertion de tirant spcifiques de la population de
Makindu. Ces sites nont pas dinsertion de tirant dans les populations de Chicharo et
Zimbabw. Nous avons donc analys les enrichissements relatifs en H3K9me2, H3K27me3 et
H3K4me2, aux deux sites dinsertion des copies M2 et M3 dans les populations de Chicharo
et Zimbabw (Figure 19), afin de savoir si tirant est capable de modifier la structure de la
chromatine son site dinsertion. Nos rsultats montrent que les sites dinsertion des copies
M1 et M3 ne sont associs qu la marque euchromatique H3K4me2. Or, chez Makindu, en
plus de la prsence de la marque euchromatique H3K4me2, les marques htrochromatiques
H3K9me2 et H3K27me3 sont associes cette copie de tirant. Ainsi, les sites dinsertion des
copies M1 et M3 ne sont pas htrochromatiques lorsque tirant est absent, et les marques
htrochromatiques associes tirant dans la population de Makindu pour ces deux copies
ont probablement comme influence la rpression de ces copies. Une insertion de tirant dans
un gnome peut provoquer une modification de la conformation de la chromatine au niveau
des sites dinsertion. Nous nous sommes ainsi poss la question de savoir si un spreading
(tendue) de ces marques pouvait tre mis en vidence et associ des modifications de
lexpression des gnes proches. Pour rpondre cette question, nous avons regard si les
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
58
marques htrochromatiques associes la copie M2 stendent jusquau promoteur le plus
proche. Le gne tkv produit quatre variants nomms RA, RB, RC et RD, initis par quatre
promoteurs diffrents (Figure supplmentaire 3, p.164). Le promoteur du variant RD est situ
en amont de linsertion de tirant, et nous avons dtermin les marques dhistones associes
ce promoteur dans les populations de Makindu, Chicharo et Zimbabw (Figure 19).

Figure 19. Influence de tirant sur la structure de la chromatine au niveau de deux sites
dinsertion
Sites dinsertions des copies M2 (dans le gne tkv) et M3 (dans le chromosome X) dans la
population de Makindu (A) et sites vides correspondants dans les populations de Chicharo et
Zimbabw (B). Les marques dhisones associes ces sites ont t analyses par ChIP (C).
Les amorces utilises en qPCR sont positionnes (flches).
0
0,1
0,2
0,3
0,4
0,5
0,6
0,7
0,8
H3K9me2 H3K4me2 H3K27me3 IgG
0
0,5
1
1,5
2
2,5
H3K9me2 H3K4me2 H3K27me3 IgG
0
0,1
0,2
0,3
0,4
0,5
0,6
H3K9me2 H3K4me2 H3K27me3 IgG
0
0,05
0,1
0,15
0,2
0,25
0,3
0,35
H3K9me2 H3K4me2 H3K27me3 IgG
0
0,05
0,1
0,15
0,2
0,25
0,3
0,35
0,4
H3K9me2 H3K4me2 H3K27me3 IgG
0
0,05
0,1
0,15
0,2
0,25
0,3
0,35
H3K9me2 H3K4me2 H3K27me3 IgG
Zimbabw
tkv, Chr. 2L M2 tirant M3 tirant Chr. X
tkv, Chr. 2L
Chr. X
0
0,05
0,1
0,15
0,2
0,25
0,3
0,35
H3K9me2 H3K4me2 H3K27me3 IgG
Makindu
M3, Makindu RD, Makindu
0
0,1
0,2
0,3
0,4
0,5
H3K9me2 H3K4me2 H3K27me3 IgG
0
0,1
0,2
0,3
0,4
0,5
0,6
H3K9me2 H3K4me2 H3K27me3 IgG



Chicharo
0
0,1
0,2
0,3
0,4
0,5
0,6
H3K9me2 H3K4me2 H3K27me3 IgG
0
0,05
0,1
0,15
0,2
0,25
0,3
0,35
0,4
H3K9me2 H3K4me2 H3K27me3 IgG
Zimbabw
0
0,05
0,1
0,15
0,2
0,25
0,3
0,35
H3K9me2 H3K4me2 H3K27me3 IgG
Makindu Makindu
Chicharo
Site M2 promoteur tkv-RD
0
0,05
0,1
0,15
0,2
0,25
0,3
0,35
H3K9me2 H3K4me2 H3K27me3 IgG
0
0,05
0,1
0,15
0,2
0,25
0,3
0,35
H3K9me2 H3K4me2 H3K27me3 IgG
0
0,1
0,2
0,3
0,4
0,5
H3K9me2 H3K4me2 H3K27me3 IgG
0
0,1
0,2
0,3
0,4
0,5
0,6
0,7
0,8
H3K9me2 H3K4me2 H3K27me3 IgG
0
0,5
1
1,5
2
2,5
H3K9me2 H3K4me2 H3K27me3 IgG
0
0,1
0,2
0,3
0,4
0,5
0,6
H3K9me2 H3K4me2 H3K27me3 IgG
Zimbabw Zimbabw
Makindu Makindu
Chicharo Chicharo
Site M3
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
59
Mes rsultats montrent que le promoteur du variant RD du gne tkv est associ la
marque htrochromatique H3K27me3 dans la population de Makindu, tandis que dans les
populations de Chicharo et Zimbabw, il est associ uniquement H3K4me2. Un
spreading des marques htrochromatiques associes tirant existe donc dans la
population de Makindu au niveau de la copie M2, entranant une modification de la structure
chromatinienne du promoteur du variant RD du gne tkv. Cependant, la distance entre
linsertion de tirant et le promoteur RD, qui est de 2571 pb chez D. melanogaster, nest pas
connue chez D. simulans. En effet, certaines rgions du gnome squenc de D. simulans,
dont une partie du gne tkv, prsentent des gaps pour lesquels la squence nuclotidique
na pas pu tre dtermine. Lvaluation par PCR de la distance entre le site dinsertion de la
copie de tirant et le promoteur RD est en cours, et nous pourrons valuer plus prcisment
cette distance chez D. simulans. Ainsi, au del de leffet dltre quune nouvelle insertion
dET peut engendrer, tirant est capable de bouleverser la structure chromatinienne de son site
dinsertion. Lexpression du gne tkv dans ces trois populations a t mesure par qPCR et
montre que linsertion de la copie M2 dans le gne tkv est associe une diminution de son
expression. Ces rsultats sont prsents dans un article en prparation disponible dans la
partie Publications, p.95.
3. Conclusion sur la rgulation pigntique de tirant
chez D. simulans
Lanalyse des marques pigntiques associes tirant dans les populations naturelles
de D. simulans montre que les modifications des histones semblent prdominer sur la
mthylation de lADN. En effet, il parait peu probable que les trs faibles taux de mthylation
associs tirant sans position spcifiquement mthyle soient impliqus dans un mcanisme
de contrle de tirant. Ces rsultats, obtenus de faon globale au niveau des LTR5 de tirant,
ont t renforcs par labsence de profils sites spcifiques lors de lanalyse des copies M1,
M2 et M3 de la population de Makindu. Ces copies prsentent des profils de modifications
dhistones diffrents bien que chaque insertion de tirant soit caractrise par la prsence des
marques htrochromatiques H3K9me2 et H3K27me3, ce qui suggre un contrle de
lactivit de cet lment induit par des modifications de la structure de la chromatine. En
outre, la copie complte M3, qui chappe cette rgle, pourrait correspondre la copie
exprime dans la population de Makindu.
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
60
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
61




CHAPITRE 2
Analyse globale de la mthylation de
lADN dans les gnomes de drosophiles
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
62

t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
63

1. Quantification des taux de mthylation de lADN dans
les gnomes de drosophiles
1.1. Introduction
Un nuclotide est form dune base azote, purique (A,G) ou pyrimidique (C,T),
associe un 2dsoxyribose et un groupe 5 phosphate. Le groupe 5 phosphate est
impliqu dans la liaison phosphodiester permettant de relier entre eux les nuclotides dans le
sens 5-3 et de former ainsi la molcule dADN. Un nuclotide qui a perdu son groupe 5
phosphate est appel un nucloside et ne peut plus former de liaison phosphodiester. Les
cytosines de lADN peuvent tre mthyles sur leur carbone numro 5 et les nuclosides non
mthyls et mthyls correspondant sont appels respectivement 2-doxycytidine (dC) et 5-
methyl-2-doxycytidine (5-MedC) (Figure 20). Les taux de mthylation dans un gnome
peuvent tre importants. Cest le cas chez les mammifres, de nombreux insectes et la plante
A. thaliana. Chez les drosophiles, des estimations faites pour les espces D. simulans, D.
melanogaster et D. pseudoobscura dcrivent des niveaux trs faibles de 5-MedC (< 1%)
(Marhold et al. 2004). Alors que certains insectes comme labeille ou le bombyx ont des taux
de mthylation de leur gnome levs (Xiang et al. 2010; Elango et al. 2009), aucune tude
plus large de quantification des 5-MedC au sein des diffrentes espces de drosophiles na,
ce jour, t ralise. Afin de mieux comprendre limportance et la fonction de la mthylation
de lADN chez les drosophiles, nous avons quantifi les taux de 5-MedC des gnomes
squencs de 12 espces de drosophiles (Drosophila 12 genomes consortium 2007) pour
lesquels la charge en ET est note dans le Tableau 3 (p.64). Ce travail a t ralis en
collaboration avec Floriant Bellvert du Centre dEtude des Substances Naturelles (CESN) de
Lyon, dirig par Gilles Comte.
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
64

Tableau 3. Proportion dET dans les 12 gnomes squencs de drosophiles (Drosophila 12
genomes consortium, 2007)

Espce
% ET
D. melanogaster
5,35
D. simulans
2,73
D. sechellia
3,67
D. yakuba
12,04
D. erecta 6,97
D. ananassae 24,93
D. pseudoobscura 2,76
D. persimilis 8,47
D. willistoni 15,57
D. virilis 13,96
D. mojavensis 8,92
D. grimshawi 2,84

Les techniques de quantification des cytosines mthyles sont de diffrents types. Des
techniques bases sur la combinaison de traitement au bisulfite avec du squenage haut
dbit permettent de cartographier des profils de mthylation tout le long des chromosomes et
de calculer le nombre total de cytosines mthyles (Bibikova et Fan, 2010). Ces techniques,
bien quautomatises et trs informatives, sont toutefois trs coteuses et ncessitent un lourd
travail bioinformatique dannotation des squences obtenues et sont surtout dpendantes des
biais de conversion possibles. Dautres techniques didentification bases sur la sparation
des nuclosides selon leurs proprits physico-chimiques comme les lectrophorses en
capillaire haute performance (HPCE) et les chromatographies liquides haute performance
(HPLC) peuvent galement tre utilises, (Berdasco et al. 2009). Les appareils HPCE et
HPLC sont alors quips dun dtecteur barrette de diode (DAD) ou dun spectromtre de
masse (MS) afin didentifier les composs analyss par chromatographie. Cest cette dernire
mthode (HPLC couple un DAD et la MS, lappareillage tant alors not
HPLC/DAD/ESI-MS) que nous avons utilise pour estimer les taux de 5-MedC dans les 12
gnomes de drosophiles. Ainsi, lHPLC spare les molcules entre une phase stationnaire (la
colonne) et une phase mobile (les solvants). La colonne utilise ici est de type phase inverse
C18 (chaine de 18 atomes de carbone fixs sur des billes de silice). Les composs sont ainsi
spars dans une large gamme de polarit. La chromatographie utilisant cette colonne est une
chromatographie dite daffinit . Le dtecteur DAD permet dobtenir les
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
65
chromatogrammes diffrentes longueurs dondes. Nos composs ayant une absorbance
maximale 280 nm, nous avons analys les chromatogrammes la longueur donde de 280
nm (Figure 21 A). Le DAD est trs robuste au niveau quantitatif mais son seuil de dtection
nest pas suffisant pour dtecter les 5-MedC dans certains de nos chantillons. Cest pour cela
que nous avons eu besoin de coupler lHPLC la spectromtrie de masse (MS).

Figure 20. Structures de dC et de 5-MedC
1.2. Dtection et quantification des 5-MedC par HPLC couple la spectromtrie de
masse (MS)
La MS enregistre lionisation des molcules pour des masses allant de m/z 100 jusqu
m/z 900 (ou m/z = masse/charge) et fournit un chromatogramme de courant ionique total
(TIC) (Figure 21 B et Figure 21 C).
dC 5mdC dC 5mdC
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
66

Figure 21. Dtection des dC et 5-MedC par HPLC/DAD/ESI-MS.
Le chromatogramme 280 nm (A) et ceux correspondant aux courants ioniques totaux
positifs (B et C) sont reprsents. Les hauteurs de pics sont exprimes en unit arbitraire en
fonction du temps. Spectres de masse correspondants lionisation de la dC et de la 5-MedC
(D).

Lors de lionisation, il y a ajout dun proton sur la molcule M qui devient alors un ion
positif not [M+H]
+
. Un dimre de la molcule se forme alors, suivi de lajout dun proton
not [2M+H]
+
. Ces ions passent ensuite au niveau du fragmenteur qui engendre des cassures
formant les ions fragments nots [M-X+H]
+
o, dans le cas de nos molcules, X correspond
lunit de sucre. La proportion relative des trois formes [M+H]
+
, [2M+H]
+
et

[M-X+H]
+

dpend de lintensit de lionisation et du fragmenteur. Ainsi, chaque molcule de dC et de 5-
m/z 250 500 750
0
20
40
60
80
100
228.1 [M+H]+
455.0 [2M+H]+
112.2 [M-X+H]+
m/z 250 500 750
0
20
40
60
80
100
126.2 [M-X+H]+
483.1 [2M+H]+
242.1 [M+H]+
min 0 5 10 15 20 25 30 35 40
AU
0
2
4
6
8
10
12
dC 5mdC


dC 5mdC
I
n
t
e
n
s
i
t


min 0 5 10 15 20 25 30 35 40
0
5
10
15
20
25
30
dC 5mdC
min 0 5 10 15 20 25 30 35 40
5
10
15
20
dC 5mdC


AU
AU
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
67
MedC sera caractrise par des fragments de masse spcifique (Figure 21 D). A partir du
chromatogramme de courant ionique total, il est possible dobtenir un chromatogramme
correspondant uniquement au courant ionique dune masse spcifique. Ces chromatogrammes
sont appels chromatogrammes dextraction dions . La quantification des molcules est
dtermine partir des chromatogrammes TIC et des chromatogrammes dextraction dions
des masses des fragments spcifiques de la dC et de la 5mdC. La spcificit et la sensibilit
de la quantification sont majores en utilisant les chromatogrammes dextraction dions. Les
temps de rtention de la dC et de la 5-MedC sont dtermins grce linjection de standards.
Ils sont respectivement de 6 et 10 minutes dans nos conditions analytiques. Chacun de ces
fragments, reprsentatif dun compos, est utilis pour quantifier ce compos partir de laire
sous la courbe dfinie par le pic sur le chromatogramme correspondant au temps de rtention
du compos. Pour chaque dtecteur et chaque molcule, nous avons tabli des gammes talon
permettant de convertir laire sous la courbe en concentration, exprime en nano molaire (nM)
et ainsi faire le rapport des concentrations de ces deux composs prsents dans le mme
chantillon. Le taux de 5-MedC dans les gnomes analyss est dfini comme suit : % 5-MedC
= [5-MedC (nM) / dC (nM) + 5-MedC (nM)] * 100. Les gammes ralises en HPLC/DAD
donnent des courbes de rgression dont le coefficient de linarit est trs satisfaisant (0,999).
En revanche, le seuil de dtection des molcules ne permet pas de dceler de faibles
concentrations en 5-MedC (<0,21 M). Si les courbes des gammes obtenues partir des
chromatogrammes dextraction dions ont des coefficients de linarit moins bons, cette
mthode a toutefois un seuil de dtection plus bas. Parmi les ions-fragments reprsentatifs de
la dC et de la 5-MedC, ceux qui permettent ltablissement de gammes talon les plus
linaires (dont le coefficient de linarit est suprieur 0,99) sont respectivement les ions-
fragments m/z 455 et m/z 483, correspondant tous deux aux formes [2M+H]
+
des composs.
Les gammes tablies pour la dC et la 5-MedC partir de ces extractions dions, ainsi qu
partir des chromatogrammes DAD, sont prsentes sur la Figure 22. Nous avons test la
validit de notre mthode de quantification en mesurant les taux de mthylation de deux
oligonuclotides de mme squence (). Le premier, loligonuclotide mthyl (OM),
comporte cinq cytosines mthyles sur neuf. Le second est loligonuclotide non mthyl
(ONM). Cette mthode de quantification a t valide par lobtention des taux de 5-MedC
attendus pour loligonuclotide mthyl (% 5-MedC = 44%) ainsi que pour loligonuclotide
non mthyl (pour lequel nous navons pas dtect de 5-MedC).
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
68

Figure 22. Gammes talon utilises pour la quantification des dC et 5-MedC
Ces gammes ont t tablies en mesurant laire sous la courbe (axe des ordonnes) du pic
correspondant aux fragments m/z 455 et m/z 483 (avec les fragmenteurs 60 et 120), 280nm
pour des concentrations croissantes en nM de dC et 5-MedC. Les coefficients directeurs de
chacune des courbes ainsi que le coefficient de linarit R
2
sont renseigns.

y = 643817x
R = 0,97964
0,E+00
5,E+06
1,E+07
2,E+07
0,00 5,00 10,00 15,00 20,00
m/z 455 frag 120
y = 60,072x
R = 0,99829
0
500
1000
1500
0,00 5,00 10,00 15,00 20,00
Chromato UV
y = 461015x
R = 0,99045
0,00E+00
2,00E+06
4,00E+06
6,00E+06
8,00E+06
1,00E+07
0,00 5,00 10,00 15,00 20,00
m/z 455 frag 60
y = 585415x
R = 0,99314
0,00E+00
5,00E+06
1,00E+07
1,50E+07
0,00 5,00 10,00 15,00 20,00
m/z 483 frag 60
y = 916438x
R = 0,9912
0,00E+00
5,00E+06
1,00E+07
1,50E+07
2,00E+07
0,00 5,00 10,00 15,00 20,00
m/z 483 frag 120
y = 50,779x
R = 0,99933
0,00E+00
2,00E+02
4,00E+02
6,00E+02
8,00E+02
1,00E+03
0,00 5,00 10,00 15,00 20,00
Chromato UV
M M
M M
M M


t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
69

Figure 23. Chromatogrammes des extractions dions correspondant aux fragments spcifiques
de la dC (m/z 455) et de la 5-MedC (m/z 483)
A, Echantillon oligonuclotide mthyl (les cytosines marques en rouge sont mthyles).
B, Echantillon oligonuclotide non mthyl . Aucun pic correspondant la 5-MedC (m/z
483) nest dtect dans lchantillon non mthyl au temps de rtention de ce compos
(encadr en pointills rouges).
Afin dvaluer la reproductibilit de notre mthode de quantification, nous avons
ensuite ralis six injections diffrentes, des jours diffrents, dun mlange quimolaire de dC
et 5-MedC, des concentrations de 1000ng/mL (4,4M) dont le taux de 5-MedC est de 50 %.
GCCGAATGCTGACATTCCGGCCGAATGCT
GCCGAATGCTGACATTCCGGCCGAATGCT
A. Oligonuclotide mthyl
B. Oligonuclotide non mthyl
min 0 5 10 15 20 25 30 35 40
0
2
4
min 0 5 10 15 20 25 30 35 40
0
2
4
6
8
min 0 5 10 15 20 25 30 35 40
0
2
4
6
min 0 5 10 15 20 25 30 35 40
0
2
5
7,5
10
min 0 5 10 15 20 25 30 35 40
0
2
4
6
8
min 0 5 10 15 20 25 30 35 40
0
5
10
min 0 5 10 15 20 25 30 35 40
0
1
2
3
min 0 5 10 15 20 25 30 35 40
0
1
2
3
10
10
10
10
10
m/z 455 frag 60
m/z 455 frag 120
m/z 483 frag 60
m/z 483 frag 120
m/z 455 frag 60
m/z 455 frag 120
m/z 483 frag 60
m/z 483 frag 120
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
70
Les quantifications absolues des dC et 5-MedC sont mesures pour chaque chantillon en
DAD 280 nm (Figure 24A) et en MS avec les ions-fragments 455, et 483 avec les
fragmenteurs 60 et 120 (Figure 24B). La quantification absolue en DAD 280 nm de ces
chantillons est reproductible alors quelle prsente une variabilit importante en MS.
Nanmoins, ces deux outils de mesure sont robustes et hautement reproductibles pour ltude
de la quantification relative du taux de 5-MedC par rapport aux dC totales, (vrifi par
ANOVA1, Fobs=2,38 ; Fseuil=3,68 ; p=0,127) (Figure 24C). Nous avons galement
quantifi les taux 5-MedC dans le thymus de veau et les cellules humaines Hela, frquemment
utiliss comme contrle de quantification et pour lesquels les valeurs publies sont
respectivement 2,3 % et 6,4 % (Brown et al. 2007; Stach et al. 2003). Une autre tude a
montr que le taux de mthylation de lADN de thymus de veau peut tre compris entre 4,75
% et 8 ,1 % (Kok et al. 2007). Un groupe de scientifique anglo-saxon a publi dans Journal
of Chromatography B la mthode de quantification des taux de 5-MedC par HPLC et
spectromtrie de masse que nous tions en train de mettre au point (Sandhu et al. 2009). Les
taux de 5-MedC mesurs pour les cellules Hela et le thymus de veau sont respectivement de
3,02 % et 6,26 %. Une nouvelle mesure des 5-MedC sera ralise prochainement afin de
vrifier ces rsultats.
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
71

Figure 24. Tests de quantification de nuclosides standards en lecture UV et en spectromtrie
de masse
Afin de vrifier la robustesse de la quantification et la reproductibilit des rsultats, nous
avons ralis une srie de 6 injections sur diffrents jours de la mme solution quimolaire de
dC et 5-MedC. Les quantifications absolues de la dC et de la 5-MedC ont t dtermines en
lecture UV (A) et en spectromtrie de masse (B) en utilisant les ions fragments m/z 455 pour
la dC et m/z 483 pour la 5-MedC (fragmenteurs 60 et 120). La quantification relative du taux
de 5-MedC de la solution a t effectue (C) avec les mesures dtermines en lecture UV et
en spectromtrie de masse avec les coefficients directeurs correspondants.

0,00
10,00
20,00
30,00
40,00
30,00
60,00
1 2 3 4 3 6
uv frag 60 frag 120
0,00E+00
1,00E+02
2,00E+02
3,00E+02
1 2 3 4 5 6
UV C
0,00E+00
5,00E+01
1,00E+02
1,50E+02
2,00E+02
2,50E+02
3,00E+02
1 2 3 4 5 6
UV 5mdC
A
8
C


3
-
M
e
d
C

0,00L+00
2,00L+06
4,00L+06
6,00L+06
8,00L+06
1,00L+07
1,20L+07
1,40L+07
m/z 433 frag 60 m/z 433 frag 120
dC (m/z 455)
0,00L+00
3,00L+06
1,00L+07
1,30L+07
2,00L+07
m/z 483 frag 60 m/z 483 frag 120
5mdC (m/z 483)
M M
M M
1 2 3 4 5 6 1 2 3 4 5 6 1 2 3 4 5 6 1 2 3 4 5 6
Frag 60 Frag 60 Frag 120 Frag 120
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
72
1.3. Rsultats
Les ADN des gnomes des 12 espces de drosophiles, fournis par le Drosophila
STOCK CENTER de San Diego (Californie), sont extraits partir dembryons de moins de
16 heures. Nous avons ajout cette tude des ADN extraits partir dembryons de moins de
deux heures des populations naturelles de Makindu (D. simulans) et du Sngal (D.
melanogaster). Les rsultats des taux de mthylation, reprsents sur laFigure 25, sont
prliminaires et la ralisation dun rplicat biologique permettra la validation statistique des
rsultats.

Figure 25. Dtermination du taux de 5-MedC dans les gnomes de drosophiles
La dviation standard, reprsente pour chaque chantillon (barre verticale), a t tablie
partir des valeurs obtenues par les fragmenteurs 60 et 120.

0
0,1
0,2
0,3
0,4
0,3
0,6
0,7
0,8
0,9
1
u
.

m
e
l
o
o
o
q
o
s
t
e
t

u
.

s
l
m
o
l
o
o
s

u
.

s
e
c
b
e
l
l
l
o

u
.

y
o
k
o
b
o

u
.

e
t
e
c
t
o

u
.

o
o
o
o
o
s
s
o
e

u
.

p
s
e
o
J
o
o
b
s
c
o
t
o

u
.

p
e
t
s
l
m
l
l
l
s

u
.

w
l
l
l
l
s
t
o
o
l

u
.

m
o
j
o
v
e
o
s
l
s

u
.

v
l
t
l
l
l
s

u
.

q
t
l
m
s
b
o
w
l

%

d
e

5
-
M
e
d
C

t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
73
Nos rsultats montrent que les taux de mthylation dans les gnomes de drosophiles
sont globalement faibles et infrieurs 1 %. Les espces D. sechellia, D. yakuba, D.
mojavensis et D. grimshawi possdent des taux de mthylation de lADN infrieurs 0,50 %
tandis quil est de 0,71 % pour D. simulans. Nos rsultats ne sont pas en accord avec les taux
de mthylation dADN dembryons de moins de deux heures prcdemment publis (Marhold
et al. 2004) pour les espces D. melanogaster (0,37 %) et D. pseudoobscura (0,21 %) pour
lesquelles nous observons respectivement 0,58 % et 0,50 % de 5-MedC. Aucun niveau de 5-
MedC na pu tre dtect pour lespce D. willistoni, pour laquelle la quantit en dC est
quivalente celle mesure chez D. ananasae dont le taux de 5-MedC est pourtant de 0,67 %.
La prsence de mthylation sexe-spcifique au niveau des squences rptes dADN
ribosomaux chez des adultes de D. willistoni a cependant t montre par enzymes de
restriction et Southern-blot (Garcia et al. 2007). Ainsi, les taux de mthylation de lADN des
embryons de cette espce sont probablement faibles et infrieurs au seuil de dtection de
notre technique.
Les taux de mthylation des embryons de moins de deux heures, obtenus pour les
populations naturelles du Sngal (D. melanogaster) et de Makindu (D. simulans), sont eux
aussi trs faibles. En effet, le taux de 5-MedC est de 0,04% pour la population naturelle de
Makindu et non dtectable pour celle du Sngal. Les taux de 5-MedC mesurs sont
largement infrieurs ceux obtenus avec les gnomes des souches squences des espces
correspondantes, dont les ADN ont t extraits partir dembryons gs de moins de seize
heures. Bien que ces derniers chantillons sont composs dembryons dges diffrents, les
taux quasi nuls de 5-MedC obtenus sur les populations naturelles ne sont pas en accord avec
les donnes bibliographiques, selon lesquelles les taux de mthylation sont plus levs dans
les embryons de moins de deux heures que dans ceux de moins de seize heures (Lyko et al.
2000). De fait, nous pouvons alors envisager que les populations naturelles prsentent des
caractristiques pigntiques diffrentes de celles des souches de laboratoires quant la
mthylation de lADN. Une deuxime rptition de ces mesures, en cours, et permettra de
vrifier ces rsultats.
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
74

2. Exploration de la prsence de cytosines mthyles au
niveau des ET dans des populations naturelles de D.
melanogaster et D. simulans
2.1. Utilisation de couples disoschizomres pour dterminer la prsence de cytosines
mthyles
Dans certains gnomes comme celui dA. thaliana, les ET sont une cible privilgie
des DNMT, et plus globalement des systmes de rgulation pigntique impliqus dans leur
rgulation et le maintien de leur stabilit. Il a t observ chez la drosophile que des
squences dET sont retrouves dans des fractions enrichies en 5-MedC par
immunoprcipitation de lADN mthyl (Salzberg et al. 2004). Le taux de mthylation chez
D. simulans par HPLC et spectromtrie de masse tant de 0,70 %, nous avons voulu savoir si
les ET y taient mthyls dans la ligne germinale des populations naturelles de cette espce.
Pour cela, jai utilis une approche par enzymes de restriction, dans le but de mettre en
vidence la prsence de sites de restriction mthyls dans des squences dET par la
technique de MSRE combine de la PCR. Les endonuclases sont des enzymes possdant
un site de restriction propre, lactivit de clivage du site de restriction par lenzyme pouvant,
dans certains cas, tre inhibe. Ceci est notamment le cas lorsquune ou plusieurs cytosines de
ce site sont mthyles. Lutilisation denzymes clivant le mme site de restriction (ou
isoschyzomres) est particulirement intressante puisque certaines dentre elles sont
sensibles, ou non, la prsence de 5-MedC au site de restriction. Ainsi, il est possible
didentifier un site de restriction localis dans la rgion rgulatrice dun ET, associ deux
isoschyzomres dont lun sera sensible la prsence de 5-MedC et lautre pas. Des amorces
de PCR positionnes de part et dautre du site de restriction permettent de vrifier
lamplification dans les cas de digestion avec une enzyme sensible et une enzyme non
sensible. Jai tudi les rtrotransposons LTR de rfrences Roo, tirant, et 412 ainsi que
llment LINE F. Les populations tudies proviennent du Sngal et de Chicharo (Portugal)
pour lespce D. melanogaster et de Chicharo, Makindu (Kenya), Zimbabw, Grand Ferrade,
Papetee, Canberra, Runion, Can River, Amieu et Anjiro pour lespce D. simulans. Pour
toutes ces populations, les nombres de copies euchromatiques des quatre ET analyss ont t
estims par hybridation in situ, et sont reprsents dans le Tableau 4 (p.75).
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
75
Tableau 4. Nombre moyen de copies des lments F, Roo, 412 et tirant dtermin par
hybridation in situ dans les populations naturelles de D. melanogaster et D. simulans.

D.
melanogaster
D. simulans
Sn Chi Chi Mak Zim Gra Pap Can Ru CaR Ami Anj
F 16 32,5 1 0 0 37 13/0 10,5 0 3 1 ND
Roo 44,5 65 40 40,5 45 41,5 33,5 47,5 43,5 40 28 ND
412 24,5 33,5 16,5 2,5 9 11 20 58 5,5 5 7 ND
Tirant 9 15 0 4 2,5 0 2 0,5 2 0 0 ND
Sn: Sngal, Chi: Chicharo, Mak: Makindu, Zim: Zimbabw, Gra: Grand Ferade, Pap:
Papetee, Can: Canberra, CaR: Can River, Ami: Amieu, Anj: Anjiro.
A partir des squences de rfrence des quatre ET tablies chez D. melanogaster et D.
simulans, jai dtermin dans leur rgion 5, des sites de restrictions pouvant tre clivs par
des enzymes sensibles ou non la mthylation via le logiciel NEB CUTTER
(http://tools.neb.com/NEBcutter2/; (Vincze et al. 2003). La structure canonique de chacun de
ces ET est reprsente sur la Figure 26 sur laquelle sont galement positionns les sites de
restriction des enzymes ainsi que les amorces utilises pour la PCR. Puisque la mthylation de
lADN au niveau des rgions codantes des gnes a t mise en vidence chez D. melanogaster
(Salzberg et al. 2004), jai intgr mon tude des sites de restriction localiss dans les
parties codantes de llment F. Pour les lments tirant et 412, ainsi que pour les sites F
ORF1 et F ORF2 localiss dans les parties codantes de F, les couples MspI/HpaII, dont HpaII
est lenzyme sensible, ont t utiliss. Pour les lments Roo et la rgion 5 de F, les couples
AvaII/BsoBI et BsmAI/BsmBI ont t respectivement utiliss, AvaI et BsmBI tant les
enzymes sensibles. Les sites de restriction de ces enzymes contiennent tous un CpG sur lequel
la prsence dune mthylation empchera lenzyme sensible de cliver le site. Un schma
illustrant cette technique avec les enzymes MspI et HpaII est reprsent sur la Figure 27 et les
sites de restriction de chaque enzyme sont dtaills dans la partie Matriels et Mthodes.


t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
76

Figure 26. Recherche de sites mthyls dans la rgion 5 de quatre ET.
Les structures canoniques de tirant, 412, Roo et F sont reprsentes (gag : gne de la
nuclocapside ; pol : gnes de la transcriptase inverse et intgrase ; env : gne de lenveloppe ;
LTR : Long Terminal Repeat). Les sites de restriction des enzymes utilises pour les
digestions sont positionns ainsi que les couples damorces utiliss pour la PCR (flches
noires).

9000
gag
ORF2 ORF1
1000
pb
tirant
412
Roo
F
Site de restriction
MspI/HpaII
MspI/HpaII
AvaII/BsoBI
BsmAI/BsmBI
MspI/HpaII MspI/HpaII
F 5 F ORF1 F ORF2
5LTR
5LTR
3LTR
3LTR
pol
Gag/pol/env
3LTR 5LTR gag pol env
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
77

Figure 27. Illustration de la technique de MSRE.
A: un fragment dADN non mthyl. B: un fragment dADN mthyl, au niveau du
dinuclotide CpG du site de restriction du couple MspI/ HpaII dont la squence nuclotidique
est CCGG. Lenzyme sensible (S) est HpaII et lenzyme non sensible (NS) est MspI. Aprs
digestion, une amplification PCR avec les amorces situes de part et dautre du site de
restriction permet de visualiser sur gel dagarose si le fragment est cliv (pas damplification
= rectangle vide) ou non (amplification = rectangle plein). Le contrle non digr (ND)
permet de visualiser la bande attendue si le fragment nest pas cliv, et le contrle ngatif
(contrle -) permet de vrifier que la digestion est totale.
















S














NS
ND
Contrle -

Marqueur de
taille
A: site non mthyl
S NS
ND
Contrle -
Marqueur de
taille
B: site mthyl
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
78
2.2. Rsultats
Lamplification par PCR des fragments correspondant aux ET analyss diagnostique
la prsence ou non de cytosines mthyles au niveau du site de restriction des enzymes
utilises. Les produits de PCR sont dposs sur gel dagarose, comme reprsent sur la Figure
28 pour la population du Sngal (D. melanogaster). Les rsultats montrent que lenzyme
sensible na pas cliv les sites de restriction correspondant aux rgions 5 des lments F et
tirant, dans les ovaires et les testicules, ce qui signifie que ces sites de restriction sont
mthyls dans ces tissus. Llment Roo nest pas mthyl dans les ovaires et testicules de
cette population.

Figure 28. Dtection de cytosines mthyles par enzymes de restriction dans la population de
Sngal (D. melanogaster).
LADN extrait partir dovaires et de testicules a t digr avec les enzymes de restriction
MspI, BsoBI et BsmAI, non sensibles (NS) et HpaII, AvaI et BsmBI sensibles (S). Les
produits de digestion ont ensuite servi dADN matrice pour une amplification PCR avec des
amorces situes de part et dautre des sites de restriction spcifiques des lments F, Roo, 412
et tirant. Un tmoin de PCR partir dADN non digr (C+) a t ralis. La prsence dun
produit damplification partir dADN trait avec lenzyme sensible signifie une absence de
coupure par cette enzyme due la prsence dune cytosine mthyles au niveau du site de
restriction.
Le polymorphisme nuclotidique qui peut exister au sein de la squence des ET
conduit des digestions partielles si les sites polymorphes sont localiss au niveau des sites
de restriction des enzymes utilis. Afin de contrler la digestion de ces sites dans toutes les
populations, jai vrifi la digestion par les enzymes non sensibles la mthylation de lADN
des produits de PCR de chaque couple damorces utilises. Dans tous les cas, les produits de
PCR sont digrs, signifiant quaucun polymorphisme nexiste dans les chantillons au
niveau des sites tudis.
C+
F
Roo
412
tirant
S
ovaires testicules
NS C+ S NS
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
79
Dans la suite de mon manuscrit, lensemble des rsultats sera simplifi et chaque site
sera reprsent par un cercle rempli en noir sil est mthyl, et vide sil ne lest pas. Ces
rsultats sont reprsents sur la Figure 29. De nombreux sites mthyls ont pu tre mis en
vidence par cette mthode dans les populations de D. melanogaster et D. simulans pour
lensemble des ET tudis lexception de Roo. En effet, pour cet ET, seul un site mthyl a
pu tre mis en vidence dans lADN des ovaires de la population de Chicharo (D. simulans).
Pour F et 412, les sites de restriction analyss sont mthyls dans les ovaires dans un
grand nombre de populations. En revanche, dans les testicules, ces mmes sites ne sont pas
mthyls dans la plupart des populations (sauf Sngal (D. melanogaster) et Amieu (D.
simulans)).

Figure 29. Mise en vidence de sites mthyls dans les rgions 5 de quatre ET de rfrence
Makindu
Sngal
Chicharo
Chicharo
F
Makindu
Zimbabw
Grand Ferrade
Papeete
Canberra
Runion
Can river
Amieu
Anjiro
Roo tirant 412
Sngal
Chicharo
Chicharo
Zimbabw
Grand Ferrade
Papeete
Canberra
Runion
Can river
Amieu
Anjiro
Ovaires
Testicules
dDNMT2-/-
D. melanogaster
D. simulans
D. melanogaster
F Roo tirant 412
dDNMT2-/-
D. simulans
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
80
Pour tirant, le site de restriction est mthyl au niveau des ovaires dans toutes les
populations sauf Grand Ferrade (D. simulans) et au niveau des testicules dans les populations
de Sngal et Chicharo de D. melanogaster, et Chicharo, Makindu, Can River et Amieu de D.
simulans.
Les sites de restriction localiss dans les LTR 5 des lments Roo, 412 et tirant, ainsi
que dans la rgion non codante 5 de F sont donc mthyls dans la plupart des populations au
niveau de la ligne germinale femelle. Ces mmes sites ont aussi t identifis comme
mthyls dans la ligne mutante dDNMT2-/-, utilise comme contrle.
Les donnes de BGS obtenues lors de lanalyse de tirant sont en contradiction avec
nos donnes obtenues par enzyme de restriction. En effet, le site de restriction qui apparat
mthyl nest pas retrouv dans les rsultats prsents dans le premier chapitre de ma thse,
concernant les profils de mthylation de la LTR5 de tirant dans les ovaires et les testicules de
la population de Makindu.
La mthode de dtection par simple PCR des fragments non digrs par lenzyme
sensible peut amplifier des squences minoritaires non retrouves dans les clones squencs
du premier chapitre. Afin de vrifier cela pour les autres ET, jai dtermin par BGS les
profils de mthylation des rgions 5 de F, Roo et 412 comprenant les sites de restriction
tudis, partir dADN dovaires de la population de Makindu (Figure supplmentaire 4,
Figure supplmentaire 5, Figure supplmentaire 6). Les sites de restriction analyss tant
sensibles la mthylation des cytosines des dinuclotides CpG, jai calcul la frquence de
mthylation des cytosines en fonction de leur contexte dinuclotidique partir des profils de
mthylation de F, Roo et 412 (Figure 30). Le dinuclotide CpG du site de restriction des
enzymes MspI et HpaII (CCGG) a t retrouv mthyl dans un clone sur 29 pour llment
412. Aucune mthylation des sites de restriction analyss pour F et de Roo na pu tre
identifie par BGS. Les cytosines mthyles de la rgion 5 de F et 412 concernent tous les
dinuclotides avec une prfrence au niveau des dinuclotides CpA et CpG pour F et CpA,
CpG et CpT pour 412. Les cytosines mthyles de la rgion 5 de Roo sont exclusivement
localises au niveau de dinuclotides CpA et CpT, pour lesquels aucune mthylation
symtrique na t identifie par bisulfite. Ce rsultat est cohrent avec les rsultats obtenus
avec lenzyme AvaI, sensible la prsence de CpG mthyls.
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
81

Figure 30. Frquence de dinuclotides mthyls dans les rgions 5 de Roo, F et 412
ADN extrait partir dovaires de la population de Makindu (D. simulans), puis trait au
bisulfite de sodium.


Figure 31. Mise en vidence de sites mthyls dans les rgions codantes de F

Enfin, les sites F ORF1 et F ORF2 localiss dans les parties codantes de llment F
sont mthyls dans lensemble des populations analyses (Figure 31) sauf dans la ligne
mutante dDNMT2-/-.
u,uu
u,1u
u,2u
u,Su
u,4u
u,Su
u,6u
u,7u
u,8u
u,9u
CpA CpC Cpu CpT
Roo
I
412
Sngal
Chicharo
Chicharo
ORF 1
Makindu
Zimbabw
Grand Ferrade
Papeete
Canberra
Runion
Can river
Amieu
Anjiro
ORF 2
dDNMT2-/-
Ovaires
D. melanogaster
D. simulans
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
82
2.3. Conclusion
La mthylation de lADN chez les 12 gnomes de drosophiles est faible avec un
niveau de 5-MedC infrieur 1%. Nous ne pouvons pas tablir de corrlation entre la
proportion en 5-MedC dun gnome et sa quantit en ET, ce qui suggre que la mthylation
des cytosines chez la drosophile nest pas principalement dirige contre les ET. Chez D.
simulans, nous avons cependant mis en vidence des cytosines mthyles au niveau de
dinuclotides CpG pour les rgions 5 de F, 412 et tirant. Ce travail exploratoire doit tre
approfondi et il est ncessaire de pouvoir vrifier ces rsultats par des techniques diffrentes.
Pour cela, plusieurs mthodes sont envisageables. Il serait trs enrichissant de raliser des
Methyl DNA ImmuniPrcipitation (MeDIP) dans les populations naturelles de D.
simulans et de cloner et squencer lADN enrichi en 5-MedC. Aussi, il serait opportun de
dterminer le profil de mthylation sur tout le long de la squence dun ET, afin de voir si des
profils spcifiques de mthylation peuvent tre mis en vidence au niveau des cytosines dans
les parties codantes de ces ET. Les rsultats obtenus au niveau des parties codantes de
llment F favorisent lhypothse dune mthylation de lADN lintrieur des gnes, et cela
devra tre tudi pour les autres ET. Enfin, lexistence dune diffrence de mthylation entre
les lignes germinales mle et femelle est confirme.
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
83




DISCUSSION - PERSPECTIVES
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
84

t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
85

1. Problmes dinterprtation des donnes produites par
bisulfite
Dans divers organismes, de nombreuses tudes utilisant le traitement au bisulfite ont
mis en vidence la prsence de Densely Methylated DNA Island (DMI), qui prsentent
des taux de mthylation suprieur 50% (Wang et al. 2001; Tasheva et Roufa, 1995; Tasheva
et Roufa, 1994). Dans le cadre de ltude de la rgulation somatique du rtrotransposon
Invader 4 chez D. melanogaster, des squences fortement mthyles, correspondant la
LTR5 de cet lment, ont t rapportes (Phalke et al. 2009). Ces rsultats, obtenus par
bisulfite sur de lADN extrait partir dembryons de moins de deux heures, montrent des
profils de mthylation des cytosines sans prfrence dinuclotidique, avec des taux de 5-
MedC trs levs (>50%). Les amorces utilises pour lamplification aprs traitement ne sont
pas dgnres et sont donc favorables lamplification prfrentielle des squences non
converties. Les conditions de traitement, caractrises par une courte phase de damination
dune heure avec une solution de bisulfite de sodium de faible molarit (3,1 M), ont t
remises en question quelques mois plus tard (Schaefer et Frank Lyko, 2010). De plus, il a t
montr que la conversion des cytosines non mthyles par des solutions de bisulfite de
sodium de faible molarit (< 5,5 M) ncessite une phase de damination plus longue pour
obtenir une efficacit de conversion de lordre de 95 % (Genereux et al. 2008). Ainsi, jai
considr que de telles squences, obtenues durant ma thse, devaient tre considres
comme des artefacts, les expriences complmentaires ralises par la suite ne montrant pas
un tel type de profil de mthylation. Chez A. thaliana, il est admis que les taux de mthylation
sont levs et aussi bien symtriques quasymtriques. Rcemment, Slotkin et al (2009)
proposent ce titre un modle de la rgulation des ET dans le pollen reposant principalement
sur la prsence de ces squences fortement mthyles. Lexpression des ET dans le pollen est
suprieure celle trouve dans les autres tissus de la plante et est associe une
dmthylation de leurs rgions rgulatrices. Le grain de pollen contient un noyau vgtatif et
un noyau germinal (sperme), et les rsultats de ces auteurs montrent que les squences dET
correspondant au noyau vgtatif prsentent une dmthylation des trinuclotides CHH,
tandis que les squences dET du sperme sont hypermthyles au niveau de ces mmes
positions. Les auteurs proposent via leur modle que les transcrits dET produits dans le
noyau vgtatif sont clivs en petits ARN allant cibler la mthylation des sites correspondant
dans le gnome du sperme et ainsi rguler lexpression des ET. Ce modle repose en partie
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
86
sur des rsultats de bisulfite montrant de longues chaines de cytosines mthyles sans
prfrence dinuclotidique sur les brins sens et antisens de fragments dADN du noyau
germinal. Ces profils de mthylation ressemblent fortement ceux mis en vidence dans mes
rsultats prliminaires sur les populations de Makindu et Zimbabw de D. simulans et doivent
tre interprts avec prcaution. En effet, dans les travaux de cartographie de la mthylation
de lADN chez A. thaliana, il a t considr que les squences contenant plus de trois
cytosines mthyles conscutives dans un contexte CHH sont non converties (Cokus et al.
2008). Dans cette tude, lefficacit du traitement au bisulfite est estime 99,97 %, en
prenant comme rfrence le taux de conversion du gnome non mthyl du chloroplaste.
Malgr toutes ces prcautions, des squences fortement mthyles ont t obtenues, dont le
profil de mthylation prsente une priodicit de 150 pb conserve entre les clones. Cette
priodicit est dfinie comme lalternance de rgions fortement mthyles et de rgions plus
faiblement mthyles. Selon ces auteurs, cette distance de 150 pb correspond la distance
entre deux nuclosomes qui seraient positionns au niveau des rgions faiblement mthyles,
et lADN enroul autour du nuclosome serait moins accessible aux DNMT (Cokus et al.
2008). Pour les populations de Makindu et Zimbabw, les squences non converties ont des
profils fortement corrls les uns avec les autres (Figure supplmentaire 1, p.159), ce qui
suggre que ces profils ne sont pas dus des artefacts alatoires le long de la squence
dADN, mais plutt des composants molculaires ou protiques qui empcheraient la
conversion des cytosines non mthyles certaines positions. Ces profils prsentent
galement une priodicit de lordre de 150 pb comparable celle observe dans les
squences fortement mthyles du gnome dA. thaliana (Cokus et al. 2008). De plus, cest
dans la population de Makindu, dans laquelle tirant est transcrit, que la proportion de
squences non converties est la plus forte. La relation entre lARN et la mthylation de
lADN fait intervenir le mcanisme de RNA directed DNA Methylation (RdDM) chez la
plante, et permet la mise en place de profils de mhylation spcifiques au niveau des
squences dET htrochromatiques (Mathieu et Bender 2004). Cependant, rien nexplique de
manire vidente comment le mcanisme de RdDM permet la mthylation de toutes les
cytosines dune squence. Toujours chez la plante, et aprs avoir test plusieurs mthodes
diffrentes de traitement au bisulfite, dautres auteurs ont ralis deux traitements conscutifs
permettant dobtenir une efficacit de conversion de 99,14 % (taux de conversion du gnome
du chloroplaste) (Lister et al. 2008). Dans cette tude, pour laquelle les petits ARN ont t
totalement squencs, les auteurs ont mis en vidence la correspondance entre les squences
de ces derniers et les squences fortement mthyles avant den conclure que les petits ARN
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
87
sont impliqus dans la mise en place de ces profils de mthylation. Durant ma thse, jai mis
en avant que labsence de squences non converties tait corrle avec labsence
dhtroduplexes ARN/ADN. Le traitement au bisulfite de sodium convertit les cytosines des
molcules dADN dnatures. Par consquent, les homoduplexes ADN/ADN ainsi que les
htroduplexes ARN/ADN peuvent empcher la conversion des cytosines de ces squences.
Le traitement au bisulfite se fait dans un thermocycleur une temprature de 64C et favorise
ainsi des hybridations ADN/ARN sur certaines rgions. Un article sur la prsence
dhtroduplexes ARN/ADN et leur implication dans les artefacts lis au traitement au
bisulfite est actuellement en prparation.
Henderson et al (2010) a publi un article sur les conditions exprimentales
appliquer pour obtenir des rsultats fiables issus de traitements au bisulfite de sodium chez les
plantes, dans lequel il rappelle que de longues chaines de cytosines conscutives mthyles
correspondent lamplification par PCR dADN non converti. Ainsi, tout rsultat obtenu
aprs traitement au bisulfite qui montre de fortes quantits en 5-MedC dans une squence doit
tre prouv par une autre approche permettant de vrifier ces profils, notamment lutilisation
denzymes de restriction. Pour ce faire, jai donc vrifi cela par lutilisation denzymes de
restriction sensibles et non sensibles la mthylation de lADN. Cette approche, qui ma
permis de montrer que tirant nest pas hypermthyl dans les populations naturelles de D.
simulans, a rvl que le gnome de ces populations nest pas dpourvu de 5-MedC. En effet,
de nombreux sites de restriction localiss dans des squences dET sont mthyls dans un
grand nombre de populations. De plus, lidentification de certains sites de restriction mthyls
dans la ligne mutante dDNMT2 suggre que dautres enzymes capables de mthyler les
cytosines de lADN peuvent tre prsentes chez cette espce.
Rcemment, la spectromtrie de masse a permis la dcouverte dune nouvelle
modification pigntique associe aux cytosines. Les 5-hydroxymethylcytosines (5-
OHMedC) rsultent de lajout dun groupe hydroxyle sur les 5-MedC par les enzymes de la
famille Tet, trs conserves chez les mammifres. Les 5-OHMedC sont particulirement
enrichies dans les cellules de Purkinje du cerveau (Kriaucionis et Heintz, 2009), et absentes
des cellules cancreuses. Des mutations dans des protines de la famille Tet ont de plus t
associes des leucmies mylodes (Tahiliani et al. 2009), suggrant aini que les 5-
OHMedC influeraient la rgulation de certains gnes. Ces 5-OHMedC, contrairement aux 5-
MedC, ne permettent pas la fixation de la Methyl Binding Protein MeCP2 (Valinluck et
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
88
al. 2004). Enfin, les 5-OHMedC sont converties de la mme manire que les 5-MedC par le
bisulfite de sodium. Cette technique ne distingue donc pas les 5-MedC des 5-OHMedC dans
une squence (Huang et al. 2010). Bien quun orthologue de la famille TET ait t identifi
chez D. melanogaster (Tahiliani et al. 2009), nous navons pas dtect de 5-OHMedC par
spectromtrie de masse dans toutes les espces pour lesquelles nous avons estim le taux de
mthylation. Nous suggrons donc que cette modification des 5-MedC nexiste pas chez la
drosophile, ou des niveaux trs faibles situs en dessous de la limite de dtection de notre
appareillage.
Les analyses de mthylation de lADN par BGS gnrent des quantits abondantes
dinformations mais cette technique comporte de nombreux biais dont la reproductibilit a t
montre lors de ma thse. Les biais de conversion et les biais damplification peuvent tre
mis en vidence par lutilisation denzymes de restriction et en utilisant diffrents jeux
damorces pour amplifier une mme rgion.
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
89

2. Conservation de la mthylation de lADN chez les
eucaryotes et rgulation des ET
Bien que fortement conserve, la mthylation de lADN na ce jour pas pu tre
dtecte dans les gnomes de Saccharomyces cerevisae et Caenorhabditis elegans. Ces deux
espces deucaryotes possdent dautres systmes de rgulation post-transcriptionnelle des ET
impliquant notamment chez le nmatode la voie des RNAi (Lesage et Todeschini 2005;
Bessereau 2006). Le champignon Neurospora crassa possde une unique DNMT appele
DIM-2, responsable de la mthylation des cytosines en contextes symtriques et asymtriques
(Kouzminova et Selker, 2001). Chez cette espce, un systme de mutagnse dirig contre les
ET appel Repeat Induced Point-mutation (RIP), dtecte les squences rptes de plus de
400 pb et induit des transition C:G en T:A. Ce mcanisme est si efficace que peu dET sont
actifs chez N. crassa. Les squences mthyles chez cette espce, identifies par MedIP,
correspondent des ET riches en AT qui sont sous le contrle de la RIP (Selker et al. 2003).
Chez les insectes, la fonction de la mthylation des cytosines est implique, selon les espces,
dans des fonctions aussi diverses que la rgulation des gnes, les empreintes gnomique, la
rgulation des ET et la stabilit du gnome (Field et al. 2004). De nombreux insectes
possdent des systmes de mthylation comparables ceux des vertbrs avec dans leur
gnome un ou plusieurs orthologues des diffrentes DNMT. Labeille Apis millifera, le ver
soie Bombyx mori, et la gupe Nasoni vitripentis en font partie. Le gnome de labeille, dans
lequel les gnes DNMT1, DNMT2 et DNMT3 sont prsents, possde un systme de
mthylation de lADN dirig contre les dinuclotides CpG intervenant dans la rgulation des
gnes (Wang et al. 2006). De plus, les cytosines mthyles sont principalement localises
dans les rgions codantes des gnes et absentes au niveau des ET (Field et al. 2004). Le
phasme Medauroidea extradentada possde quant lui une forte proportion de CpG
mthyls, ainsi que des CpA et CpT localiss au niveau des squences rptes et lintrieur
des gnes (Krauss et al. 2009). Le gnome du ver soie, B. mori, contient 0,67% de 5-MedC,
principalement localises au niveau des dinuclotides CpG, lintrieur des gnes et absente
au niveau des ET (Xiang et al. 2010). tonnamment, aucun lien na pu tre tabli chez cette
espce entre la mthylation des promoteurs et la rpression de la transcription. Au contraire,
une corrlation a t mise en vidence entre le taux de mthylation des rgions codantes dun
gne et son expression. Cette mme corrlation a t mise en vidence chez A. thaliana, chez
laquelle la mthylation des cytosines dans le corps des gnes est un vnement galement
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
90
frquent. Selon le dogme de la mthylation des cytosines, la prsence de 5-MedC au niveau
de la rgion promotrice dun gne empche son expression, et de nombreuses donnes
rcentes montrent que les parties codantes des gnes exprims sont fortement mthyles. Il a
t propos que la mthylation de lADN dans les parties codantes des gnes qui sexpriment
(donc non mthyls au niveau de leur rgion promotrice) empcherait une initiation de la
transcription ailleurs que sur le promoteur (Suzuki et Bird, 2008).
La vaste conservation au cours de lvolution de la mthylation de lADN suggre un
rle important et nous avons vu que son implication dans la rgulation des gnes nest pas la
mme selon lespce considre. La mthylation des cytosines dans le corps des gnes est un
vnement rpandu au cours de lvolution des gnomes eucaryotes (Zemach et al. 2010). A
linverse, les systmes de rgulation des ET par la mthylation de lADN sont peu conservs.
Une tude chez lHomme a montr que la majorit des sites CpG sont mthyles (Edwards et
al. 2010), et que le taux de mthylation des squences est corrl avec leur densit en
dinuclotides CpG. Les squences trs denses en CpG, comme les rgions promotrices des
gnes, sont linverse non mthyles. Selon les auteurs, ltat des cytosines est, par dfaut,
mthyl et que les promoteurs seraient prservs de cette mthylation par leur forte densit en
dinuclotides CpG. Limplication de la mthylation de lADN dans la structure et le maintien
de la stabilit du gnome est appuye par plusieurs exemples, dans lesquels labsence de
mthylation est associe des anomalies chromosomiques ainsi qu une leve de la
rpression des ET.
The genome is an ecological niche, and it was inevitable that the resources available
there should come to be exploited by specialized replicating entities .
Dans leur article, dont la citation ci-dessus a t extraite, Bestor et al (1997) indiquent
que la mthylation des cytosines est un mcanisme de prservation de lintgrit du gnome
des mammifres et des plantes en rprimant les ET. Ils considrent que le gnome de la
drosophile, qui possde beaucoup dlments actifs et peu de mthylation de lADN, ne
possde pas ce systme de rpression. Chez la drosophile, la seule enzyme capable de
mthyler lADN est DNMT2, qui est aussi la DNA methyl transferase la plus conserve
des gnomes eucaryotes (Ponger et Li, 2005). Bien quelle possde tous les domaines
catalytiques spcifiques des DNMT, lactivit DNMT de cette enzyme est trs faible
(Hermann et al. 2003) et comme nous lavons vu dans le chapitre 2, les taux de 5-MedC dans
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
91
les gnomes de drosopiles sont faibles. Des rsultats rcents ont montr que son activit
principale est de mthyler les ARNtAsp, (Acide Aspartique) chez lHomme, les plantes, la
souris et la drosophile (Goll et al. 2006). Lenzyme DNMT2 est une RNA Methyl
Transferase parmi dautres, dont la conservation extrmement importante des procaryotes
jusquaux eucaryotes pourrait toutefois suggrer que les DNMT des mammifres et des
plantes en drivent (Pavlopoulou et Kossida, 2009). La localisation de DNMT2 nuclaire et
cytoplasmique, ainsi que la faible activit DNMT, peuvent expliquer les faibles taux de 5-
MedC observs chez la drosophile. Bien que le gne dDNMT2 semble tre impliqu chez la
drosophile dans la mise en place de marques dhistones htrochromatiques au niveau des ET
(Gou et al. 2010; Phalke et al. 2009), le lien entre la mthylation de lADN des squences
dET et son rle dans leur rgulation transcriptionnelle nest, ce jour, pas tabli. Ceci
suggre que le gne dDNMT2 pourrai tre impliqu dans un mcanisme de rgulation des
gnes et des ET qui ne ferai pas intervenir la mthylation des cytosines de lADN.
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
92

3. La rgulation des ET chez la drosophile : exemple de
tirant dans les populations naturelles de D. simulans
Le phnotype associ des mutants pour l histone methyl transferase SU(VAR)3-
9, qui mthyle lhistone H3 sur la lysine 9, est caractris par des translocations
chromosomiques, dfauts de structure de la chromatine et perte dhtrozygotie, aussi bien
dans la ligne germinale que dans la ligne somatique (Peng et Karpen, 2009). Une
drpression des ET peut conduire au mme phnotype (Bourc'his et Bestor 2004; Miura et al.
2001), et, comme nous avons vu au cours du chapitre 1, la structure de la chromatine est
implique dans la rgulation de lET tirant. Les ET peuvent tre considrs comme des
lments essentiels de la stabilit des gnomes. Les squences dET seraient donc impliques
dans ltablissement des rgions htrochromatiques et euchromatiques, indispensables pour
la stabilit du gnome. Mes rsultats ont montr que tirant etait capable de modifier la
structure de la chromatine au niveau de son site dinsertion, mais aussi en amont. En effet,
linsertion dune copie complte de tirant dans lintron du gne tkv dans la population de
Makindu est responsable de la prsence de la marque htrochromatique H3K27-me3 au
niveau de son promoteur. Etablie partir du gnome squenc de D. melanogaster, la
distance entre le dbut de la LTR5 de cette copie de tirant et le promoteur du gne tkv est
estim 2 571 pb. Linfluence quun ET peut avoir sur la structure de la chromatine au
niveau de son environnement gnomique a t dcrit avec llment P, dont linsertion peut
conduire au phnomne de Position Effect Variegation (PEV) caractris par une
htrochromatinisation de gnes euchromatiques (Girton et Johansen, 2008; Weiler et
Wakimoto, 1995). Le spreading, sur plusieurs kb, de la marque H3K27me3 a t rapport
chez la Drosophile (Suganuma et Workman, 2010) et chez la A. thaliana, chez laquelle le
silencing pigntique provoqu par linsertion dun ET dans ou proximit dun gne a
de plus t mis en vidence (Schubert et al. 2006; Lippman et al. 2004). Des rsultats
prliminaires obtenus dans lquipe montrent que le gne tkv est plus faiblement exprim
dans la population de Makindu que dans les autres populations analyses, ce qui confirme
linfluence de la prsence de la marque H3K27me3 au niveau de son promoteur. Le
phnotype associ des mutations du gne tkv chez la drosophile est caractris par des ailes
dont les nervures sont fines, na cependant pas t mis en vidence dans la population de
Makindu. Ce cas particulier devra tre tudi afin de comprendre linfluence des ET sur les
gnes et les interactions qui peuvent exister entres ces squences.
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
93
Avec lexemple de tirant, nous avons montr que des rgions euchromatiques sont
associes des marques htrochromatiques lorsquune copie de cet lment y est insre.
Comment expliquer que tirant soit exprim uniquement dans la population de Makindu ? Les
copies M3 et Z2 sont associes des marques euchromatiques, mais seule la copie M3 est
complte, ce qui peut expliquer que des transcrits de tirant naient pu tre mis en vidence
que dans la population de Makindu. Afin didentifier la copie de tirant qui est exprim, il
faudra tudier par CHIP lassociation de la copie M3 avec dautres marqueurs caractristiques
de lhtrochromatine et de leuchromatine, ainsi quavec des marqueurs dexpression comme
par exemple, la polymrase II, qui peu tre utilise en ChIP pour identifier les squences
transcrites (Sun et al. 2010). Le squenage des transcrits de la population de Makindu pourra
galement nous permettre didentifier la copie transcrite partir des polymorphismes de
squences observs.
Des rsultats rcents dhybridation in situ de tirant sur ovaires des populations de
Sngal, Makindu, Chicharo et Zimbabw, ralises par Abdou Akkouche (Thse de
doctorat), ont permis de localiser les transcrits de type C de tirant de la population de
Makindu au niveau des cellules nourricires appartenant la ligne germinale. De nombreux
transferts dARN ont lieu des cellules nourricires vers lovocyte lors de la maturation de
lovocyte, cependant, aucun transcrit de tirant na t localis dans lovocyte. Cela suggre
dune part quun mcanisme de rgulation de tirant empche son expression dans lovocyte,
et dautre part, que les ARN de tirant localiss dans les cellules nourricires sont squestrs
dans des structures particulires empchant leurs transferts vers lovocyte. Dans la voie de
rgulation de la ligne germinale des ET par les piRNA, il a t montr rcemment chez la
drosophile que les transcrits dET rguls sont squestrs dans les Yb-Bodies, structures
localises dans le nuage nuclaire (Olivieri et al. 2010). Lensemble de ces donnes suggre
que les copies exprimes de tirant sont rgules par la voie piRNA dans la ligne germinale
de la population de Makindu. Cette voie de rgulation, galement implique dans le
phnotype de dysgnsie des hybrides (Brennecke et al. 2008), fait intervenir des populations
de petits ARN dont la composition peut tre diffrente entre plusieurs souches, comme cela a
t montr au sein de lespce D. virilis (Rozhkov et al. 2010). Ce travail ouvre diffrentes
perspectives dont une approche spcifique danalyse de la rgulation de tirant par la
chromatine et par les piRNA, et une approche globale didentification des piRNA dans les
populations naturelles tudies ici.
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
94
Nous avons vu que le modle de tirant est idal pour tudier linfluence dun ET sur la
structure de la chromatine et les consquences au niveau de lexpression des gnes situs
proximit. Le rle fonctionnel des protines impliques dans la voie de rgulation piRNA
devra tre confirm par la mise en vidence de la colocalisation et de linteraction des
protines PIWI avec les ARN de tirant. Dans notre hypothse, les transcrits de tirant
squestrs dans les Yb-bodies proviendraient de la copie M3.
Enfin, nous avons vu dans le chapitre 2 que les taux de mthylation chez les
drosophiles, dtermins par HPLC, sont faibles, mais que lanalyse par enzymes de restriction
montre que les ET prsentent des sites mthyls. Chez de nombreuses espces dinsectes, de
mammifres ou de plantes, les ET sont la cible privilgie de la mthylation des cytosines.
Les rsultats prliminaires obtenus partir dADN extrait dembryons de moins de 2 heures
des populations de Makindu (D. simulans) et Sngal (D. melanogaster) montrent des taux de
5-MedC trs faibles. Ces rsultats devront tre confirms et lanalyse devra tre tendue
dautres populations naturelles de D. simulans, diffrents stades de dveloppement.
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
95



PUBLICATIONS
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
96

t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
97

Article publi en 2010:
Rebollo R, Horard B, Hubert B, Vieira C, Jumping genes and epigenetics: Towards
new species, Gene, 454. 1-7
Article en rvision :
Ken Kraaijeveld
1,2
*, Brechtje Zwanenburg
1
, Padu Franco
1
, Benjamin Hubert
3
,
Cristina Vieira
3
, Sylvia de Pater
1
, Richard Stouthamer
4
, Peter de Knijff
2
& Jacques J. M. van
Alphen
5
, Rampant proliferation of a transposable element in an asexual wasp. En rvision
dans la revue Science. Jai ralis dans le cadre de ce travail les analyses de mthylation
dun ET par BGS.

Articles en prparation:
Hubert B, Akkouche A, Fablet M, Vieira C, Tirant transposable element induced
change in chromatin structure in natural populations of D. simulans (journal pour
soumission: FASEB)
Hubert B, Bellvert F, Comte G, Vieira C, Variation of 5methylcytosine proportion
among drosophilids phylogeny and natural populations

t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
98

t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
99
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
100
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
101

t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
102

t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
103

t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
104

t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
105

t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
106


t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
107
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
108
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
109
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
110
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
111
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
112
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
113
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
114
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
115
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
116
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
117
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
118
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
119
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
120
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
121
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
122
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
123
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
124
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
125
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
126
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
127
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
128
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
129
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
130
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
131
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
132

t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
133

Rampant proliferation of a transposable element in an asexual wasp


Ken Kraaijeveld
1,2
*, Brechtje Zwanenburg
1
, Padu Franco
1
, Benjamin Hubert
3
, Cristina Vieira
3
, Sylvia
de Pater
1
, Richard Stouthamer
4
, Peter de Knijff
2
& Jacques J. M. van Alphen
5


1
Institute of Biology, Leiden University, PO Box 9505, 2300 RA Leiden, The Netherlands
2
Department of Human Genetics, Leiden University Medical Center S4-P, P.O. Box 9600, 2300 RC
Leiden, The Netherlands
3
Universit de Lyon, F-69000, Lyon; Universit Lyon 1; CNRS, UMR5558, Laboratoire de Biomtrie et
Biologie Evolutive, F-69622,Villeurbanne, France
4
Entomology, University of California, Riverside, CA 92521, USA
5
UMR 6553 ECOBIO, Universit de Rennes I, Campus de Beaulieu, Avenue du Gnral Leclerc, 35
042 Rennes cedex, France

*To whom correspondence should be addressed. E-mail: (Rozhkov et al. 2010)

One-sentence summary: Asexual lineages of a parasitoid wasp have accumulated large numbers of
copies of a retrotransposon as predicted by theory.



ABSTRACT
Asexual taxa are predicted to face early extinction because they lack an effective means of containing
the proliferation of transposable elements (TEs). We report that asexual strains of a parasitoid wasp
harbour over four times as many copies of a gypsy-like retrotransposon as sexual strains from the
same species. The asexual strains represent at least eight distinct clonal lineages that have been
accumulating TEs independently. The difference in copy number was not the result of the infection
with parthenogenesis-inducing Wolbachia. The accumulation of TE copies may eventually create a
significant genetic load and drive the extinction of asexual populations.




The widespread occurrence of sex is one of the most elusive problems in evolutionary biology.
The inefficiency of purifying selection in asexual lineages can potentially lead to unchecked
proliferation of vertically transmitted transposable elements (TEs), causing their demise (1,2). To test
this prediction, we established 25 asexual and 10 sexual isofemale lines of the parasitoid wasp
Leptopilina clavipes. Asexual populations are infected with a parthenogenesis-inducing Wolbachia,
while sexual populations are not infected. Sexual and asexual field populations were variable at both
microsatellite (16 loci) and mtDNA loci (1516 bp; Fig. 1A & B). In the asexuals, the number of mtDNA
nucleotide differences between strains correlated to the pair-wise genetic relatedness estimated from
the microsatellite data (Mantel test r = -0.57, P = 0.002). This shows that multiple female lineages
have become infected with Wolbachia. Since the sequences for 6 Wolbachia genes were identical for
all strains, the most likely explanation for is horizontal transmission of Wolbachia during its spread.
We identified a partial sequence (1110 bp) of a reverse transcriptase in the genome of L.
clavipes, showing significant similarity to the gag-pol polyprotein domain of retrotransposons from the
gypsy-Ty3 superfamily. The sequences for two sexual and two asexual strains were identical.
Quantitative real-time PCR (qPCR) revealed that the asexual strains had greater than four-fold higher
copy numbers than the sexual strains (Fig. 1C). Southern blot analysis produced a single band at
approximately 700 bp, which was substantially more intense in the asexual strains compared to the
sexual stains (F
1,18
= 103.82, P < 0.00000001; fig. S1). Genetically related strains resembled each
other in copy number of the gypsy-like element (qPCR results vs. microsatellite data; Mantel test:
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
134
r
asexual
= -0.38, P
asexual
= 0.05, r
sexual
= -0.39, P
sexual
= 0.02), indicating that asexual lineages have
accumulated copies of this element independently.
To investigate whether the accumulation of TE copies was due to a direct effect of Wolbachia
infection, we repeated the qPCR analysis using asexual females from which Wolbachia had been
removed using antibiotics. The difference in copy number between sexual and asexuals was very
similar to that in untreated females (Fig. 1C) and the Cp ratios were highly correlated to those of the
untreated samples of the same strain (r = 0.84, P < 0.0001). Wolbachia may affect the methylation
state of the host genome (3), thereby re-activating methylated TEs. We tested for such an effect by
applying bisulfite sequencing to eight samples. There was no evidence that the gypsy-like element in
L. clavipes is methylated in either sexual or asexual strains (fig. S2).
The time taken to accumulate TE copies can be estimated using the formula y = (1+t)
g
, where
y is the proportional increase in copy number, t is the transposition rate and g is the number of
generations (4). Assuming a TE transposition rate of 10
-4
per element per generation, the observed
four-fold increase would have taken 14,000 generations in the absence of purifying selection. The
asexual strains differed from the sexual strains by an average of 3.35 nucleotides on a total of 275
synonymous mtDNA sites, resulting in an estimated divergence time of 60,000 generations (mutation
rate assumed to be 2.1x10
-7
per base per generation; 5). Latent assortative mate preferences show
that the ancestor of the asexual populations remained sexual for a considerable part of this divergence
time (6). The time left would have been enough to accumulate a four-fold difference in TE copy
number, but only if purifying selection on the asexuals was inefficient. No signs of fitness reduction in
asexual strains of L. clavipes have so far been detected, but if the asexual strains continue to gain TE
copies at this rate, negative fitness effects would be expected in the future.


References and Notes
1. E. S. Dolgin, B. Charlesworth, Genetics 174, 817-827 (2006).
2. I. Arkhipova, M. Meselson, Bioessays 27, 76-85 (2005).
3. I. Negri, et al., Proc. R. Soc. B 276, 2485-2491 (2009).
4. A. Burt, R. Trivers, Genes in conflict: the biology of selfish genetic elements. (Belknap Press,
Cambridge, 2006).
5. R. Raychoudhury et al., Heredity 104, 318-326 (2010).
6. K. Kraaijeveld, P. Franco, B. M. Reumer, J. J. M. van Alphen, Evolution 63, 3085-3069 (2009).
7. We thank F. Kraaijeveld-Smit, A. Goudswaard, R. Vossen, N. Pul, B. Zwaan, R. Glas, T. de Jong,
M. van der Zee and J. Bast for help and discussions. This study was supported by a NWO-Veni-grant
to KK.
Supporting Online Material
Materials and Methods
Figs. S1 to S4
Tables S1 to S2
References
Author contributions

t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
135


Fig. 1. (A) mtDNA haplotype network of L. clavipes strains. Branch lengths are proportional to genetic
distance and dot size to the number of strains. (B) Microsatellite genotype network, with colors
representing mtDNA haplotypes (as in A). (C) Relative difference in copy number of the gypsy-like
retrotransposon as measured by qPCR for 10 asexual and 9 sexual strains. Error bars are SEM.
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
136
Supporting online material

Materials and Methods
Wasp strains and Wolbachia removal. Sexual and asexual strains of L. clavipes were collected and
cultured as described in (6). The removal of Wolbachia using antibiotics is described in (6).
Genetic diversity structure of sexual and asexual populations of L. clavipes. We assessed genetic
diversity at three levels: nuclear, mitochondrial and Wolbachia. We commissioned a genomic library
enriched for three types of tandem repeats (CA, GA and ATG; Genetic Identification Services). One
hundred colonies were sequenced, from which we selected 16 loci. Loci were amplified using loci-
specific primers (table S2; all T
a
= 55C) and run on a MegaBase 1000 (Amersham). Genotype
profiles were scored manually. Asexual genotypes were homozygous due to gamete duplication by
Wolbachia. All but two sexual genotypes were homozygous due to prolonged inbreeding in the lab.
The diploid genotypes were therefore treated as haploid in Fig. 1. We sequenced 1057 bp of the
mitochondrial gene cytochrome oxidase subunit 1 (CO1) using the primers described in (S1), except
the reverse primer for the second part, which was re-designed for this study:
TCATCTAAAAATTTTAATCCCAGT. We also sequenced 459 bp ND1 using the primers described in
(S2). The sequences for the two mitochondrial genes were concatenated using BioEdit and analysed
using DNAsp. Haplotype networks were drawn using Network. Last, we sequenced six Wolbachia
genes (coxA, hcpA, ftsZ, fbpA, gatb, wsp

(S3)).
Identification of the gypsy-like element. A short fragment of sequence was obtained using the nested
set of degenerate PCR primers described in (S4). DNA of the sexual strain DC was used as template
for this reaction. The sequence showed significant similarity to gypsy-like elements in Nasonia
vitripennis (accession XM_001601092.1) and Bombyx mori (accession AB032718.1). Based on the
similarity between these two sequences, new degenerate primers were designed:
AARYTNTAYGCNGCNAAY and RTARAARTTNACCATNCC. These were used in PCR reactions (25
l total volume) with the following conditions: 94C for 4 min, then 45 cycles of 94C for 40 s, 50C for
40 s and 72C for 30 s and then 72C for 3 min. The PCR product was cleaned (Promega wizard kit)
and cloned with the TOPO-TA cloning kit (Invitrogen). Positive colonies were picked and amplified
using standard M13 primers. Clones containing inserts of the expected size (~1000 bp) were
sequenced. These contained the target sequence within a total of 1110 bp. To compare the sequence
between strains, we designed specific primers (TTTACGCTGCAAATGGTTCA and
TTGAATCGCTTCGACCTTTT) and used these to sequence the fragment in two sexual and two
asexual strains.
Identification of the forkhead gene. The transcription factor forkhead was chosen as a control gene to
standardize the qPCR signal, as this gene is highly conserved and single-copy in Nasiona vitripennis.
Sequences for Nasiona vitripennis (accession XM_001601750.1), Trichogramma kaykai (accession
EU650782.1) and Cirrospilus coachellae (accession EF137269.1) were aligned using ClustalW. The
following degenerate primers were picked using the software Genefisher: RTSACCCTCAACGGCA
and AGCCGTTKTCRAACA, cloning and sequencing were performed as described above. Species-
specific primers were developed (GGATGCAGAGTCCAGAAGGA and
TTGGCAAAATTCCATTAGGC) for use in qPCR.
Quantitative PCR. For qPCR, we designed a set of primers spanning a 109 bp region in the reverse
transcriptase (CGTTCGGTCTGTTCGAATTT and GCGAAACAGAAGTCCAATCC). Genomic DNA
was extracted from one recently emerged female per strain (Qiagen blood and tissue kit). Relative
copy numbers of the gypsy-like TE and forkhead sequences were quantified using the Lightcycler LC-
480 qPCR system (Roche). The qPCR reactions contained 5 ul qPCR MasterMix for SYBR Green
(BioRad), the equivalent of 60 ng DNA and 300nM of each primer, and were run in duplicates, using
the following two-step cycling program: 95C for 15 s, 60C for 1 min for 40 cycles. Efficiency of the
PCR reactions was estimated from the samples separately for the two genes using the software
LinRegPCR. Data from qPCR were analysed using the second derivative maximum method. Here, the
Cp-value represents the cycle at which the increase of fluorescence is highest and where the
logarithmic phase of a PCR begins. The mean Cp of the duplicates for the TE was calibrated on one
of the sexual samples (PCR efficiency^dCp) and then normalized on the control gene.
Southern blot analysis. Genomic DNA was extracted from ten recently emerged females per strain
using phenol/chloroform. Ten g DNA per strain was digested with EcoRI and electrophorized on a
0.7% agarose gel. The DNA was transferred to hybond+ membrane (Amersham Biosciences), which
was then probed with the DIG-labelled 1110 bp gypsy-like sequence described above. Hybridization
and detection were performed using the DIG labelling protocol (Roche Applied Sciences). The
intensity of each band was quantified using ImageJ and normalized on the intensity of the marker
band. The relative intensities were ln-transformed and compared using ANOVA.
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
137
Bisulfite sequencing. Bisulfite treated samples were PCR amplified with primers
GGTAAATGAAGAAATGYYAAGTAT and CAATCACCRAAAATATTRTTTTTCC to yield a PCR
product of 373 bp. The PCR product was cleaned and sequenced following standard procedures.
Bisulfite sequencing data were analysed using Kismeth

(S5).




Supplementary Figures

Figure S1: (A) Southern blot of genomic DNA digested with EcoRI and probed with the gypsy-like
sequence. The first lane contains the size marker (HindIII-digested lambda). Each sample lane
contains DNA extracted from ten female wasps from a single strain. (B) Ethidium bromide-stained
agarose gel used for the southern blot, showing the relative amounts of DNA loaded in each lane.
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
138
Figure S2: Cytosine methylation patterns of the gypsy-like transposable element of L. clavipes as
determined by bisulfite sequencing. Each line represents a single clone and each circle a cytosine
(red: CG, blue: CHG, green: CHH). The circle is filled when the cytosine is methylated. Two to fifteen
clones were sequenced per wasp strain. Two asexual strains (AR3 and BB1) and two sexual strains
(CBY and DC) were used. Females that had been cured of their Wolbachia infection using antibiotics
are denoted Rif.
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
139

Supplementary Tables

Table S1: Genbank accession numbers.

Locus Accession numbers
Gypsy-like retrotransposon HM999657
Microsatellite loci HM999630 - HM999648
COI (mtDNA) HM999658 - HM999666
ND1 (mtDNA) HM999649 - HM999650
Wolbachia coxA HM999651
Wolbachia hcp HM999652
Wolbachia ftsZ HM999653
Wolbachia fbp HM999654
Wolbachia gatB HM999655
Wolbachia wsp HM999656




















t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
140

Table S2: Primers used for microsatellite genotyping.
Locus name Forward Reverse
E101 GAGAGTCGTCCTTTGAGTCAC CGTCGTCGTAGTGGAGATACT
E108 CGTTAAACCAATCTGTGACG AATGTGGATGCAAATCAGAG
E3a CTCTCACTCCAAACTTGTCTG GAACGAATTAACCCATTGTG
F101 AAACGAAGCTCAGAATACAAGC GTTGCGTAAAATTGTCAACTTG
F102 TTACCCCTTATTTTCCTCTGTC TGGGCTCTCTATTCTATTCTCC
F103 ATTCCGTGAACCCAACAC CGTAATGAAGGAGAGTCTGC
F107 GCGAGAAACGTCTACTAGCTC TCACCACCTCATTCATTCAC
F112 GGATTGATTTACGACAGACG CCCAACTCCTGACATTGAG
F118 GGAACAGCCTTTACTGCAC AATCGTAAGAAAACGCCTAAC
F119 GCATTCTCATTCAGCATAAAC CGGTGTATTTCCCAAAGAC
F124 CGGTTTATCGCAGTGATACA GGACGTTACATTTGTCTCTTCA
F129 CGCCAACAAAGAGATGTC CGTGTGCGAATAAAATACG
F130 CTGGTTCCAATCTCGTGTG GCCATCATCATCATCAAGG
F2 GGAATGGGATGGGATGAG GCTCGGAGAGAGATTACGC
F5 GCACGCGATAACACCAATAG GCCGATGTTCTTGATGTTTG
G10 ACAGGTCCGACGAACATAAC AGGGGATTTCTGAACTGGAT








t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
141
Supplemental References

S1. S. J. Scheffer, E. E. Grissell, Mol. Ecol. 12, 415-421 (2003).
S2. P. T. Smith, S. Kambhampati, W. Vlkl, M. Mackauer, Mol. Phylogenet. Evol. 11, 236-245 (1999).
S3. L. Baldo et al., Appl. Environ. Microb. 72, 7098-7110 (2006).
S4. I. Arkhipova, M. Meselson, Proc. Natl. Acad. Sci. USA 97, 14473-14477 (2000).
S5. E. Gruntman et al., BMC Bioinformatics 9, 371 (2008).


Author Contributions
K.K. conceived the project, participated in all aspects and wrote the manuscript. B.Z. identified the
gypsy transposable element. P.F. sequenced the mtDNA. B.H. and C.V. performed the bisulfite
sequencing. S.P. performed the Southern blot analysis. R.S. conceived the phylogenetic part. P.K.
analyzed the population genetic data. J.A. pervised the project. All authors discussed and commented
on the manuscript.

t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
142

t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
143



MATRIELS ET MTHODES
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
144

t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
145

1. Origine et levage des souches de drosophiles
Les populations naturelles de D.melanogaster et D.simulans tudies durant ma thse
ont t captures dans la nature et sont leves au laboratoire. Ces souches sont des lignes
isofemelle tablies partir de femelles uniques fcondes dans leur milieu naturel o elles ont
t rcoltes diffrentes dates et par diffrents exprimentateurs. Les lignes isofemelles
sont fortement consanguines. Les lignes mutantes pour le gne dDNMT2 sont drives de D.
melanogaster et ont t amicalement fournies par Gunter Reuter (dDNMT2-/-), Kent Golic
(R2), et C.K. James Shen (GS12412).

Les souches sont maintenues au laboratoire dans des tuves 25C. Le milieu de
culture se prpare de la faon suivante :
Quantit pour 1,2 kg, soit une soixantaine de tubes :
15 g agar-agar + 400 mL deau du robinet ont t ports bullition en remuant constamment.
110 g de farine de mas, 115 g de levure de bire sche, et 500 mL deau du robinet ont t
mixs jusqu obtention dun mlange homogne, puis verss dans lagar cuit.
A ce mlange ont t ajouts 6 g de nipagine dissous dans 47,5 mL dthanol 95 %,
lensemble a t ajust 1,2 kg avec de leau chaude, et bien mlang. Striliss lautoclave
pendant 30 minutes 130C, le milieu est ensuite homognis et coul dans les tubes
dlevage.
2. Rcolte des embryons
Des mouches adultes ont t mises pondre dans des boites contenant de la glose,
compose de jus de raisin + 3 % dagar, et partiellement recouverte de levure de boulanger.
Deux heures aprs, les embryons sont rcolts, grce un tamis, par rinage de la glose au
PBS 1X. Les embryons ainsi rcolts sont collects dans des tubes Eppendorf de 1,5mL
contenant du PBS 1X, dchorions par des lavages leau de javel 1%, puis lADN est extrait
en suivant le protocole dextraction dADN par phnol chloroforme dcrit ci-dessous.
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
146

3. Extraction dADN gnomique
1. Broyer le tissu dans 170 L de tampon de broyage (Tris-HCl pH8 50mM + EDTA
50mM + SDS 1%)
2. Ajouter 10 L Pk 10 g /L puis agiter
3. Incuber pendant 3h 55C (puis ajouter 5 L RNAse A 10 g/%L, incuber 5 minutes
37C)
4. Incuber 4C, 15 minutes
5. Ajouter 36 L de KO actate 5M, vortexer
6. Incuber a 4C pendant 15 minutes
7. Centrifuger (12 000 rpm, 15 minutes, 4C)
8. Rcuprer le surnageant (SN)
9. Ajouter 36 L de KO actate 5M, agiter (STEP1)
10. Incuber 4C, 15 minutes
11. Centrifuger (12 000 rpm, 15 minutes, 4C)
12. Ajouter 1 volume de Phnol/Chloroforme/IAA, vortexer 15
13. Centrifuger (12 000 rpm, 5 minutes, 4C)
14. Rcuprer le SN et mettre dans un nouveau tube et recommencer une deuxime fois
15. Prcipitation de lADN :
- 1L of glycogne
- 1/10 vol dactate de sodium 3M (pH=5.2)
- 2.5Vol dEtOH 95% froid
16. Homogniser
17. Incuber toute la nuit -20C
18. Centrifuger (14 000 rpm, 30 minutes, 4C)
19. Jeter le surnageant et laver le culot avec 1 mL dEtOH 70 % froid
20. Centrifuger (14 000 rpm, 15 minutes, 4C)
21. Jeter le surnageant et laisser scher le culot dADN temprature ambiante pendant 2
heures
22. Reprendre le culot dans 45 L H2O
23. Incuber 1h, 37C
24. Dposer sur gel dagarose 1 % pour vrifier la qualit de lADN
25. Quantifier lADN.
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
147

4. Traitement au Bisulfite
Le traitement de lADN au bisulfite de sodium est utilis pour dterminer le profil de
mthylation de squences dADN. Les cytosines non mthyles vont tre converties en
uracile tandis que les cytosines mthyles ne sont pas converties. Une fois lADN trait, les
squences dintrt sont amplifies par PCR en utilisant des amorces dgnres pour toutes
les positions de cytosines. Durant cette tape, les uraciles seront remplaces par des thymines.
Les produits de PCR sont clons et squencs. Pour toutes les expriences de traitement au
bisulfite de sodium, des rplicats techniques ont t raliss, et des rplicats biologiques et
techniques ont t raliss pour les rsultats obtenus avec les amorces tir01.
Prparation des chantillons :
- Dissquer partir dindividus adultes de 4 jours, dans du PBS 1X :
o 20 paires dovaires pour les femelles
o 35 paires de testicules pour les males
- Broyer et aliquoter les ovaires et testicules des volumes respectifs de 3 L et 9 L
- Traiter la protinase K, en suivant pour les ovaires et pour les testicules,
respectivement, la procdure A et la procdure B (de EZ DNA Methylation-Direct
TM

KIT)
- Traiter au bisulfite de sodium et extraire lADN en suivant les conditions standard
recommandes par le fabriquant (EZ DNA Methylation-Direct
TM
KIT, ZYMO
RESEARCH).
5. PCR de lADN trait au bisulfite de sodium
Les amplifications PCR de la rgion rgulatrice de tirant partir de lADN trait ont t
ralises avec les amorces rpertories dans le Tableau 5. Pour chaque PCR, 4 L dADN
trait ont t amplifis dans un volume final de raction de 50 L. Le cycle de PCR utilis est
le suivant :
1. Dnaturation (94 C, 10 minutes)
2. Dnaturation (94 C, 30 secondes)
3. Hybridation (Tm selon amorce, 30 secondes)
4. Elongation (72 C, 30 secondes), puis retour tape 2, 30 cycles
5. Finition (72 C, 10 minutes)
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
148
Tableau 5. Amorces PCR utilises pour lamplification de squences dADN traites au
bisulfite de sodium.
Bisulfite Genomic Sequencing
ET/gne amorce Squence (5-3) Tm (en C)
Taille du produit de PCR
(pb)
Tir01 f gga-aga-ygg-yaa-ytg-g
Tir01 r car-tct-aca-tct-trc
43 451
Tir52 f gaa-aay-gga-gga-yty-gag-tag
Tir52 r cat-ttr-rta-ctt-cac-aac-ttc-aat-t
51,5 293
TirC1 f agg-tag-gta-att-att-aat-agg-tag-g
tirant (type C)
TirC1 r cac-ccc-cta-aac-ccc-cac-rcc-tct-a
52,4 400
191 f ayg-gag-tga-aay-tgy-tga-att-g
Copie M1
191 r cca-ata-aar-aat-acr-act-rac-ttt-c
52,4 328
271 f gaa-aaa-aaa-aag-gga-gag-aga-aaa-a
Copie M2
271 r tcc-tcc-rtt-ttc-atc-tta-tac-ata-a
52,4 408
151f gga-gya-tgg-agy-aya-agg
151r caa-trt-trc-art-rcr-ac
59 585
152f tta-agt-agg-aaa-gtt-ttt-gta-aag-g
Copie M3
152r cca-ata-aar-aat-acr-act-rac-ttt-c
52,4 342
TypeSb f tga-agt-ggy-atg-gaa-att-atg-ttt-a
tirant (Type S) TypeSb r aca-ctt-rca-ttr-tcr-aat-aaa-aat-t
48,5 463
Roobisu f gag-agy-gat-aaa-tta-tat-tta-gga-t
Roo Roobisu r tat-tta-tac-tct-rtt-cct-tac-ctt-t
45,3 563
Fbisu f ggt-tgt-ttt-gag-tga-agt-gaa
F Fbisu r acc-car-ctt-ttt-trt-tta-crt-ttt-c
43,5 527
412bisu f aag-gya-aaa-agt-ata-agt-gya-tgg-t
412 412bisu r cca-tac-tca-ata-raa-ctc-tac-tca-c
48,5 487
Act5Cf ggy-ygg-att-tgy-ygg-aga-yg
Actine 5C Act5Cr cca-rat-ctt-ctc-cat-atc-rtc
58 161
6. Clonage/Squenage/Analyse des profils de
mthylation
Aprs traitement au bisulfite de sodium, les produits de PCR ont t clons avec le Kit
TOPO-TA cloning pour squenage (Invitrogen) suivant les recommandations du fabriquant.
Les bactries transformes sont tales en boite de Ptri contenant du milieu de culture L.B.
plus ampicilline, incubes 37 C pendant 16 heures. La confirmation des colonies positives
est ralise par PCR en utilisant les amorces universelles M13 forward et reverse, qui
permettent damplifier les fragments dADN insrs dans le vecteur. Les produits de PCR
correspondant la taille attendue ont t squencs par Genoscreen. Les squences ont t
alignes avec CLUSTALW2 (Larkin et al. 2007). Les profils de mthylation ont t analyss
avec le logiciel KISMETH (http://katahdin.mssm.edu/kismeth/revpage.pl) (Gruntman et al.
2008). Les frquences de mthylation des dinuclotides ont t calcules grce des outils
dvelopps (codes pythons) par Hussein Mortada. Le premier script python, appell Cpos.py
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
149
prend comme entre le fichier texte dalignement des squences traites. Dans ces squences,
le nombre de C va tre compt pour chaque position permettant ainsi de calculer le
pourcentage de cytosines non converties qui est donc gal, pour chaque position, au rapport
du nombre de cytosines divis par le nombre total de squences alignes. Le deuxime,
appell Racio.py, prend comme entre le fichier texte de la squence de rfrence (fichier1) et
le fichier texte dalignement des squences traites (fichier2). A partir de ces deux fichiers, le
pourcentage de C pour chaque squence du fichier2 est calcul (rapport du nombre de C dans
chaque squence du fichier1 par le nombre de C de la squence de rfrence) ainsi que celui
des dinuclotides CpA, CpT, CpG et CpC.
Solution : Milieu de culure L.B. (Luria-Bertani) plus ampicilline :
peptone 1 g
Extraits de levure 0,5 g
NaCl 1 g
Agar 1,5 g
Ampicilline 0,1 mg/mL
H2O qsp 100 mL
7. Digestions enzymatiques
Les ADN gnomiques ont t digrs pendant 16 heures 37C ou 55C selon
lenzyme considre, en accord avec les instructions du fabriquant (BioLabs). Les paramtres
de digestion utiliss pour chaque enzyme sont indiqus dans le tableau 3. Les couples
denzymes sensibles/non sensibles correspondant chaque ET tudi sont indiqus dans le
Tableau 6 et les paramtres de digestion dans le Tableau 7. Les amorces PCR utilises pour
diagnostiquer ltat de mthylation de chacun des sites sont rfrences dans le Tableau 8.



t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
150
Tableau 6. Enzymes de restriction utilises.
Elment transposable Enzyme sensible Enzyme non sensible
F site 5 BsmBI BsmAI
F ORF1 HpaII MspI
F ORF2 HpaII MspI
Roo AvaI BsoBI
412 HpaII MspI
tirant HpaII MspI

Tableau 7. Paramtres utiliss pour les digestions enzymatiques en fonction des enzymes
utilises.
Enzyme Site de restriction TC Nombre d units
BsmAI 5-CGTCTCN-3 55 50
BsmBI 5-CGTCTCN-3 55 10
MspI 5-CCGG-3 37 500
HpaII 5-CCGG-3 37 150
AvaI 5-CYCGRG-3 37 200
BsoBI 5-CYCGRG-3 37 40
Les cytosines qui bloquent lactivit de clivage de lenzyme si elles sont mthyles
(colores rouge) sont toutes localises au niveau de dinuclotides CpG. La temprature (TC)
ainsi que le nombre dunits enzymatiques utilises pour la digestion sont renseignes.
Tableau 8. Amorces PCR utilises pour diagnostiquer ltat de mthylation des sites de
restriction.
Enzymes de restriction
ET Amorce Squence (5-3) Tm (en C) Taille du produit de PCR (pb)
FR1 atg-tct-gcg-ttt-ggg-att-gt
F site 5
FF1 tga-gtg-aag-tga-acg-cca-aa
58 239
FR1site1 tct-cgc-atg-cat-ttt-ctt-tg
F ORF1
FF1site1 caa-act-ccagct-cct-ttt-gc
57 194
FR1site2 cgt-aac-tgc-gaa-gtc-gat-ca
F ORF2
FF1site2 gca-gta-ggg-cca-cac-ttc-at
62 207
Roo r1 ata-gtc-ccc-gcc-tta-tcg-ag
Roo
Roo f1 ttg-ggctcc-gtt-cat-atc-tt
58 250
412 r1 tag-gct-aat-ccg-cgt-agc-tg
412
412 f1 aac-atg-atc-acc-cac-tcg-aag
58 219
Tir r1 ttg-ctt-cgt-ttc-tta-caa-tgg
Tir f1 ggg-gaa-acc-taa-aac-cct-tc
62,5
Tir r1bis gct-gaa-act-taa-aaa-cct-tca-tac-a
tirant (type C)
Tir f1bis agt-ttg-ttt-cgt-ttc-tta-cat-gtt-t
60
153
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
151
8. Immunoprcipitation de la Chromatine (ChIP)
La ChIP est une technique qui permet dextraire la chromatine des cellules puis de
limmunoprcipiter avec des anticorps spcifiques dirigs contre des protines constitutives
de la chromatine, comme par exemple les histones. Il est ainsi possible de rcuprer des
fractions dADN enrichies en H3 totale (H3T), H3K9me2, H3K27me3 et H3K4me2. Les
anticorps anti-dimethyl histone H3 (Lys4), anti-dimethyl histone 3 (Lys9) et anti-trimethyl
histone 3 (Lys27) ont t fournis par Millipore et lanti-histone H3 (ChIP Grade) a t fournie
par AbCam. Une rgion faiblement enrichie en H3T aura des valeurs denrichissement faible
pour les marques tudies, il sera donc important de normaliser les rsultats obtenus en
fonction de lenrichissement en nuclosome, rapport par lenrichissement en H3T.
Lenrichissement en IgG permet de mesurer laspcificit de limmunoprcipitation. Le plan
exprimental utilis pour cette technique est reprsent sur la Figure 32.

Figure 32. Schma du plan exprimental de la ChIP.
Pour chaque population, chacun des rplicats biologiques a t ralis partir de 150 paires
dovaires de chaque population. Aprs extraction de la chromatine, les immunoprcipitations
(IP) ont t ralises pour les marques H3T, IgG, H3K9me2, H3K27me3 et H3K4me2 avec
leurs anticorps respectifs. Une fraction de la chromatine, non immunoprcipite appele
INPUT, partir de laquelle lADN sera extrait, sera utilise pour calculer lenrichissement de
chaque marque tudie.
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
152

Protocole de ChIP :
1- 150 paires dovaires collectes partir de femelles ges de 3 jours pour chaque
population ont t dissques, et laves au PBT.
2- Ajouter 10 mL de Crosslink solution . Agiter pendant 10 minutes temprature
ambiante.
3- Enlever la phase aqueuse, ajouter 10 mL de STOP solution puis agiter 5 minutes
temprature ambiante.
4- Enlever le surnageant et resuspendre les ovaires dans 7,5 mL de PBT froid + 300 L
dinhibiteurs de protases).
5- Isolation des cellules : Homogniser les tissus avec un pilon Potter homognisateur,
puis centrifuger (1 minute, 400 g, 4C).
6- Rcuprer le surnageant puis centrifuger (10 minutes, 1100 g, 4C).
7- Resuspendre le culot avec 7,5 mL de Cell Lysis Buffer froid + 300 L
dinhibiteurs de protases.
8- Isolement des noyaux : Homogniser les tissus avec un pilon Potter homognisateur,
puis centrifuger (4 minutes, 2000 g, 4C).
9- Resuspendre le culot avec 1 mL de Nuclear Lysis Buffer froid + 60L
dinhibiteurs de protases. Incuber temprature ambiante pendant 20 minutes.
10- Ajouter 1mL de Nuclear Lysis Buffer froid + 60L dinhibiteurs de protases.
11- Sonication de la chromatine (7 cycles, 30 secondes ON, 30 secondes OFF) puis
vrifier sur gel dagarose la taille des fragments (500 pb).
12- Centrifuger (10 minutes, 20 000 g, 4C).
13- Rcuprer le surnageant, puis ajouter le tampon 1 (qsp 6 mL).
14- Ajouter 150 L de solution de billes de sphadex puis incuber 4C pendant 1 heure.
15- Centrifuger (1 minute, 1000 g, 4C).
16- Aliquoter la chromatine (1 mL pour lIP, 500 L pour lINPUT).
17- Ajouter 5 L danticorps (1 mg/mL) puis incuber pendant la nuit 4C sur un plateau
rotatif.
18- Ajouter 80 L de solution de billes puis incuber 3 heures 4C sur un plateau rotatif.
19- Centrifuger (2 minutes, 400 g, 4C).
20- Faire les lavages suivants : 2 x 4 minutes avec la solution dIP lavage 1, puis 2 fois x
4 minutes avec la solution IP lavage 2, puis 2 x 2 minutes avec du TE.
21- Ajouter 100 L de TE + 1 L de RNAse A (10 mg/mL) pendant 1 heure 37C.
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
153
22- Ajouter de la protinase K (0,5 mg/mL) + 10 L de SDS 10% et incuber 3 heures
55C.
23- Ajouter 1 volume de Phnol/Chloroforme/IAA, vortexer 15 secondes
24- Centrifuger (12 000 rpm, 5 minutes, 4C)
25- Rcuprer le SN et mettre dans un nouveau tube
26- Ajouter 25L de NaAc 3M ph5,3 + 1L de glycogne + 550L dthanol 100.
27- Incuber 1 heure -20C.
28- Centrifuger (18 000 g, 15 minutes, 4C), laver le culot lthanol 70, puis centrifuger
encore une fois.
29- Reprendre le culot dans 40 L de TRIS 10mM pH8 pour les IP, et dans 100 L pour
lINPUT.
30- Quantifier les chantillons au nanodrop et ramener leur concentration 6 ng/L.

Solutions prparer avant de commencer:
PBT: PBS 1X, 0,1% Triton X100
Stop solution: 125 mM Glycine, PBT
Crosslink Solution: 50 mM Hepes pH8, 1 mM EDTA.Na2, 0,5 mM EGTA, 100
mM NaCl.
Prparation des billes:
Peser 160 mg de protine A Spharose et ajouter 8 mL de PBS 1X puis incuber 1
heure 4C sur un plateau rotatif. Centrifuger (3 minutes, 400g, 4C) puis enlever
le surnageant. Ajouter 2mL de PBS 1X, BSA 0,1% puis incuber toute la nuit
4C sur un plateau rotatif. Centrifuger (3 minutes, 400g, 4C) puis enlever le
surnageant. Ajouter 720 L de PBS 1X, BSA 0,1%.
Solution IP lavage 1: Triton X100 1%, SDS 0,1%, 500 mM NaCl, TE1X
Solution IP lavage 2: Triton X100 1%, Deoxycholate 0,1%, SDS 0,1%, 140 mM
NaCl, 1 mM PMSF, TE1X.
Cell Lysis Buffer : (PIPES 5mM pH8, KCL 85mM, NP40/IGEPAL 0,5%)
Nuclear Lysis Buffer : 10 mM EDTA, 0,5% N-lauroylsarcosine, 50 mM
HEPES, pH8
Tampon 1: 0,1% Triton X100, 0.1% sodium deoxycholate, 0,1% SDS, 140 mM
NaCl, TE1X.
Inhibiteurs de protases : Complete Protease Inhibitor Cocktail tablets in glass
vials (Roche).
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
154

9. qPCR
Les ADN ont t dilus et ramens la concentration de 6 ng/L, puis quantifis par qPCR
dans un lightcycler (Roche diagnostics) en utilisant les amorces du Tableau 9. Le taux
denrichissement a t calcul par diffrence de Ct par rapport lINPUT de chacune des
populations et les rsultats ont t normaliss par H3T. Les mesures ont t ralises partir
de deux expriences indpendantes.

Tableau 9. Amorces utilises en qPCR pour lanalyse des rsultats de ChIP.
qPCR TM=62C
site amorce Squence (5-3)
Rdprochip f ttt-aaa-cgc-cag-caa-gtg-tg
promoteur tkv RD
Rdprochip r acg-act-cgc-gaa-gaa-cgt-at
ilot f1 cac-cga-gtg-aaa-ctg-ctg-aa
M1, C1, Z1
ilot r1 atg-ttg-cag-tgc-gac-ttt-tg
CflanqR ctg-agc-act-tga-ttt-ggg-ctt-aga-cag-gc
M2
C2tir r gtg-ttc-cag-ttg-ccg-tct-tc
15qf2 tgt-gcg-gat-ttc-tac-tgt-ttt-c
M3
15qr2 agc-ata-atg-aac-atg-ccg-act
3122 f cgc-cag-aaa-aca-cca-aca-ga
C2
3122 r ggt-tta-gag-ggt-ggg-gtg-gt
451 f tgt-gga-cat-tag-gga-ctg-ga
C3
452 r tag-agg-cgt-ggg-ggt-tta-g
idl2_2 f cca-gag-caa-gca-aac-att-ga
Z2
idl2_2 r tag-agg-cgt-ggg-ggt-tta-g
idl3_1 f cgt-atc-gtt-cgt-gcc-att-ta
Z3
idl3_1 r ggt-tga-gtg-tcc-gac-gat-tt
15notir f gca-tcc-aat-gcg-aac-aag-aa
15notir
15notir r agg-tcc-gca-gtt-cca-cag-tt
27notir f gcc-ttt-ttg-tgt-gcc-caa-ct
27notir
27notir r gcg-ttg-ctc-taa-ggg-ga
rp49 f ct-ggt-ttc-cgg-caa-ggt-atg-t
RP49
rp49 r ca-gtt-caa-ctc-aaa-acc-gcc-aaa
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
155

10. Hydrolyse de lADN et prparation des chantillons
pour la HPLC
Les chantillons dADN gnomique des 12 espces de drosophiles dont les gnomes
ont t squencs ont t extrait partir dembryons gs de moins de 16 heures et fournis par
le Drosophila Species Stock Center (University of California, San Diego,
http://stockcenter.ucsd.edu). LADN de thymus de veau a t command chez Invitrogen, les
oligonuclotides mthyls (5-GCC-GAA-TGC-TGA-CAT-TCC-GGC-CGA-ATG-CT-3) et
non mthyls (5- GC-5MedC-GAA-TG-5MedC-TGA-CAT-TCC-GGC-5MedC-GA-ATG-
5MedC-T-3) ont t produits par EUROGENTEC. Les nuclotides standards 2-
deoxyuridine 5monophosphate (dU), 2-deoxyguanosine 5monophosphate (dG), 2-
deoxycytidine 5monophosphate (dC), 2-deoxyadnosine 5monophosphate (dA), 5-methyl
2-cytidine 5monophosphate (5-MedC), et 2-deoxythimidine 5monophosphate (dT) ont t
fournis par SIGMA-ALDRICH.
Tous les chantillons ont t traits la RNase A (concentration finale de 20 g/L)
pendant 1 heure 37C. LADN a ensuite t prcipit avec 1 volume disopropanol froid,
puis centrifug 11 000 g pendant 10 minutes. Le culot dADN a ensuite t lav lthanol
70%, centrifug 5 minutes 11 000 g, repris dans de leau et stock + 4C.
Pour chaque hydrolyse, jai utilis 6,5 g dADN dans un volume de 10 L. Les
chantillons ont t dnaturs 2 minutes 100C puis mis rapidement dans la glace pendant 5
minutes. La raction dhydrolyse a t initie par lajout de 10 L de nuclase P1 et 2 L de
sulfate de zinc, et les chantillons ont t incubs 16 heures 37C. Une foi la raction
dhydrolyse termine, les chantillons ont t incubs 2 heures 37C avec 0,75 L de
phosphatase alkaline + 1,25 L de Tris-HCL (pH8,3) afin denlever les groupements
phosphates des nuclotides. Les chantillons ont t centrifugs et le surnageant a t
rcupr et conserv + 4C.
Les taux de mthylation chez la drosophile sont faibles, et afin davoir des quantits en
5-MedC dtectables pour chacun des chantillons, les produits de quatre hydrolyses ont t
rassembls, dont 70 % ont t injects pour la HPLC.
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
156
Pour cette tude, les analyses sont ralises sur une HPLC HP 1100 series (Agilent
technologies) couple un dtecteur barrette de diode (DAD) (G1315 ; Agilent
technologies) et un spectromtre de masse simple quadriple avec une source dionisation par
electrospray HP MSD 1100 series (G1946 ; Agilent technologies). Lensemble de
lappareillage est pilot par le logiciel chemstation (Agilent technologies). Ce systme est
quip dune colonne en phase inverse Eclipse XDB

C18 (250 4.6 mm, 5 m ; Agilent


technologies). Une solution dH
2
O avec 0.1 % dacide formique (solvant A) et une solution
dH2O/mthanol (50/50) avec 0.1 % dacide formique (solvant B) sont utilises pour
llution. Le gradient est indiqu dans le tableau 1 et le dbit utilis est de 0.8 mL/min. La
temprature de la colonne est de 25C. Le DAD enregistre les donnes entre 200 et 600 nm et
la longueur donde utilise pour la quantification est 280 nm. Pour le spectromtre de
masse, lenregistrement se fait uniquement en mode positif avec deux niveaux de fragmenteur
60 et 120; Le gaz de nbulisation est une temprature de 350C avec un dbit de 10L/min et
une pression de 30 p.s.i ; le voltage du capillaire est de 3500 V et la temprature du
quadripole 300C. Lenregistrement des spectres se fait entre les masses m/z 100 et m/z 900.
Le volume dinjection de lchantillon est de 35 L ou 70 L selon les matrices. Leau
a t distille et filtre extemporanment, et le mthanol a t distill et filtr.

Tableau 10. Gradient HPLC.
Temps en minute % solvant A H
2
O + 1%
acide formique
% solvant B H
2
O/Methanol
+ 1% acide formique
0 95 5
3 95 5
30 84 16
32 75 25
35 0 100
37 0 100
38 95 5
45 95 5
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
157



ANNEXES
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
158

t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
159

1. Mthylation de lADN


Figure supplmentaire 1. Profil de mthylation des squences non converties correspondant
la LTR 5 de tirant.
Les positions de cytosine dans la squence sont reprsentes en abscisse et le taux de
mthylation en %, en ordonne, a t calcul pour chaque position de cytosine partir des
squences non converties. Ces profils de mthylation ont t tablis partir de rsultats
obtenus pour des ovaires et des testicules des populations de Makindu et Zimbabw. Ces trois
histogrammes prsentent des rgions fortement mthyls et des rgions faiblement mthyles.
De plus, les profiles de mthylation obtenus pour ces squences non converties sont
identiques (les coefficients de corrlation de Spearman entre ces profiles de mthylation sont
significativement diffrents de zro).
u
Su
1uu
1

1
1

2
1

S
1

4
1

S
1

6
1

7
1

8
1

9
1

1
u
1

1
1
1

1
2
1

1
S
1

1
4
1

1
S
1

1
6
1

1
7
1

1
8
1

1
9
1

2
u
1

2
1
1

2
2
1

2
S
1

2
4
1

2
S
1

2
6
1

2
7
1

2
8
1

2
9
1

S
u
1

S
1
1

S
2
1

S
S
1

S
4
1

S
S
1

S
6
1

S
7
1

S
8
1

S
9
1

4
u
1

4
1
1

4
2
1

4
S
1

Nakinuu ovaiies
u
Su
1uu
1

1
1

2
1

S
1

4
1

S
1

6
1

7
1

8
1

9
1

1
u
1

1
1
1

1
2
1

1
S
1

1
4
1

1
S
1

1
6
1

1
7
1

1
8
1

1
9
1

2
u
1

2
1
1

2
2
1

2
S
1

2
4
1

2
S
1

2
6
1

2
7
1

2
8
1

2
9
1

S
u
1

S
1
1

S
2
1

S
S
1

S
4
1

S
S
1

S
6
1

S
7
1

S
8
1

S
9
1

4
u
1

4
1
1

4
2
1

4
S
1

Nakinuu testicules
u
Su
1uu
1

1
1

2
1

S
1

4
1

S
1

6
1

7
1

8
1

9
1

1
u
1

1
1
1

1
2
1

1
S
1

1
4
1

1
S
1

1
6
1

1
7
1

1
8
1

1
9
1

2
u
1

2
1
1

2
2
1

2
S
1

2
4
1

2
S
1

2
6
1

2
7
1

2
8
1

2
9
1

S
u
1

S
1
1

S
2
1

S
S
1

S
4
1

S
S
1

S
6
1

S
7
1

S
8
1

S
9
1

4
u
1

4
1
1

4
2
1

4
S
1

Zimbabwe ovaiies
u
Su
1uu
1

1
1

2
1

S
1

4
1

S
1

6
1

7
1

8
1

9
1

1
u
1

1
1
1

1
2
1

1
S
1

1
4
1

1
S
1

1
6
1

1
7
1

1
8
1

1
9
1

2
u
1

2
1
1

2
2
1

2
S
1

2
4
1

2
S
1

2
6
1

2
7
1

2
8
1

2
9
1

S
u
1

S
1
1

S
2
1

S
S
1

S
4
1

S
S
1

S
6
1

S
7
1

S
8
1

S
9
1

4
u
1

4
1
1

4
2
1

4
S
1

Zimbabwe testicules
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
160



Figure supplmentaire 2. Frquence de mthylation des dinuclotides dans les squences non-
converties des populations de Makindu et Zimbabw.

Tableaux supplmentaires 1 3 : Frquence de mthylation des dinuclotides calcules
partir des rsultats de BGS.


Tableau supplmentaire 1. Rsultats obtenus partir dADN purifi extrait partir dovaires.
Tissu Population amorces nombre de squences 5-MedC (%) CpA CpC CpG CpT
converties n=14 0,67 0,71 0,13 0,16 0,00
tir01
non converties n=0
converties n=11 0,56 0,28 0,00 0,00 0,72
ovaires Makindu
tir52
non converties n=0


Tableau supplmentaire 2. Rsultats obtenus pour les lignes mutantes.
Tissu Population amorces nombre de squences 5-MedC (%) CpA CpC CpG CpT
converties n=22 0,52 0,25 0,33 0,13 0,29
dDNMT2
non converties n=0
converties n=27 0,48 0,21 0,19 0,24 0,36
GS12412
non converties n=2 81,78 0,27 0,25 0,25 0,23
converties n=18 0,31 0,22 0,40 0,25 0,13
R2
tir01
non converties n=0
converties n=19 0,00 0,00 1,00 0,00
ovaires
Makindu Act5 non converties n=0
u,2u
u,21
u,22
u,2S
u,24
u,2S
u,26
u,27
u,28
CpA CpC Cpu CpT
Nakinuu ovaiies Nakinuu testicules
Zimbabwe ovaiies Zimbabwe testicules
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
161

Tableau supplmentaire 3. Rsultats obtenus pour les populations naturelles avec les amorces
tir01 et tir52.
Tissus Population Amorces Nb de squences
5-MedC
(%)
CpA CpC CpG CpT
converties n=46 0,49 0,15 0,60 0,18 0,07
tir01
non converties n=0
converties n=8 0,00
Chicharo
tir52
non converties n=0
converties n=8 0,70 0,58 0,42 0,00 0,00
tir01
non converties n=38 82,32 0,26 0,25 0,24 0,24
converties n=11 0,53 0,18 0,67 0,00 0,14
Makindu
tir52
non converties n=0
converties n=56 0,33 0,21 0,46 0,08 0,25
tir01
non converties n=0
converties n=10 0,00
Sngale
tir52
non converties n=0
converties n=50 0,47 0,39 0,11 0,07 0,43
tir01
non converties n=15 73,42 0,25 0,24 0,26 0,25
converties n=11 0,49 0,35 0,65 0,00 0,00
testicules
Zimbabwe
tir52
non converties n=0
converties n=48 0,45 0,33 0,30 0,08 0,30
tir01
non converties n=0
converties n=10 0,75 0,79 0,00 0,00 0,21
Chicharo
tir52
non converties n=0
converties n=37 0,53 0,31 0,00 0,16 0,53
tir01
non converties n=14 84,62 0,27 0,24 0,25 0,24
converties n=25 0,35 0,87 0,00 0,00 0,13
Makindu
tir52
non converties n=0
converties n=57 0,70 0,18 0,21 0,27 0,34
tir01
non converties n=0
converties n=26 0,46 0,14 0,19 0,48 0,19
Sngale
tir52
non converties n=0
converties n=44 0,85 0,16 0,14 0,32 0,38
tir01
non converties n=4 95,80 0,27 0,25 0,22 0,25
converties n=23 0,66 0,46 0,00 0,40 0,14
ovaires
Zimbabwe
tir52
non converties n=0

t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
162

Tableau supplmentaire 4. Rsultats complmentaires de vrification de la prsence de biais
exprimentaux.
Tissus Amorces Conditions Nombre de squences 5-MedC (%) CpA CpC CpG CpT
converties n=14 0,51 0,26 0,00 0,21 0,53
testicules
non converties n=0
converties n=14 0,75 0,00 0,00 0,78 0,22
ctir
non converties n=0
converties n=14 0,40 0,25 0,18 0,44 0,12
Standard
non converties n=4 75,47 0,27 0,23 0,24 0,26
converties n=6 0,62 0,45 0,33 0,00 0,22
+ prot K
non converties n=1 81,31 0,23 0,24 0,26 0,27
converties n=17 0,23 0,42 0,00 0,37 0,21
ovaires
tir01
+ prot K
+ Rnase H
non converties n=0

Tableau supplmentaire 5. Frquence de mthylation des dinuclotides pour les lments F,
Roo et 412 dans la population de Makindu.
Tissu Population amorces nombre de squences 5-MedC (%) CpA CpC CpG CpT
converties n=40 0,69 0,21 0,00 0,00 0,79
Roobisu
non converties n=0
converties n=40 0,72 0,29 0,21 0,31 0,19
Fbisu
non converties n=0
converties n=29 0,55 0,26 0,11 0,32 0,31
ovaires Makindu
412bisu
non converties n=0


Figure supplmentaire 3. Schma de la copie de tirant M2 de la population de Makindu,
insre dans lintron du gne tkv.
Le gne tkv et la copie de tirant sont insrs dans le mme sens sur le chromosome 2L. Les
exons sont reprsents par des rectangles noirs. Ce gne de 52 kb produit quatre transcrits A,
B, C et D. Les rsultats de ChIP prsents dans le chapitre 2 concernent la rgion promotrice
du transcrit D, localise 2,5 kb de linsertion de tirant.
tkv-8u
tkv-88
tkv-8C
tkv-8A
1blckvelos qeoe, cbtomosome 2l. 5,218,996-5,271,J5J
10 kb
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
163

Figure supplmentaires 4 6 : Profils de mthylation des lments 412, F et Roo dans les
ovaires de la population de Makindu.


Figure supplmentaire 4. Elment 412.


Figure supplmentaire 5. Elment F.

Figure supplmentaire 6. Elment Roo.
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
164

Figure supplmentaire 7. Alignements des squences traites au bisulfite de sodium.




















t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
165

t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
166

t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
167

t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
168

t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
169

t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
170

t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
171

t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
172

t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
173

t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
174

t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
175

t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
176

t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
177

t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
178

t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
179

t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
180

t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
181

t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
182

t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
183

t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
184

t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
185

t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
186

t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
187

t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
188

t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
189

t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
190

t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
191

t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
192

t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
193

t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
194

t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
195

t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
196

t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
197

t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
198

t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
199

t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
200

t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
201

t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
202

t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
203

t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
204

t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
205

t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
206

t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
207

t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
208

t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
209

t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
210

t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
211






t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
212











t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
213

t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
214






















t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
215



t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
216

t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
217

t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
218


t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
219









t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
220



t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
221

t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
222

t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
223

t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
224



t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
225

t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
226







t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
227


t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
228






t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
229

t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
230

t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
231

t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
232



t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
233

t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
234

t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
235

t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
236

t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
237

t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
238








t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
239

t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
240

t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
241

2. HPLC et spectromtrie de masse

t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
242
Figure supplmentaire 8. . Chromatogrammes en courant ionique total et UV obtenus par
HPLC pour les 12 gnomes squencs de drosophiles.


D. pseudoobscura
min
0
5 10 15 20 25 30 35 40
1000000
2000000
3000000
4000000
5000000
6000000
7000000
min
0
5 10 15 20 25 30 35 40
1000000
2000000
3000000
4000000
5000000
6000000
7000000
8000000
min
0
5 10 15 20 25 30 35 40
mAU
0
50
100
150
200
250
300
TIC positif frag 60
TIC positif frag 120
Chromatograme UV 280 nm
min
0
5 10 15 20 25 30 35 40
1000000
2000000
3000000
4000000
5000000
6000000
min
0
5 10 15 20 25 30 35 40
1000000
2000000
3000000
4000000
5000000
6000000
7000000
min 0 5 10 15 20 25 30 35 40
mAU
0
50
100
150
200
250
D. melanogaster
min
0
5 10 15 20 25 30 35 40
1000000
2000000
3000000
4000000
5000000
6000000
min
0
5 10 15 20 25 30 35 40
1000000
2000000
3000000
4000000
5000000
6000000
7000000
min
0
5 10 15 20 25 30 35 40
mAU
0
50
100
150
200
250
300
350
D. willistoni
TIC positif frag 60
TIC positif frag 120
Chromatograme UV 280 nm
TIC positif frag 60
TIC positif frag 120
Chromatograme UV 280 nm
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
243


D. persimilis
min 0 5 10 15 20 25 30 35 40
1000000
2000000
3000000
4000000
5000000
6000000
min 0 5 10 15 20 25 30 35 40
1000000
2000000
3000000
4000000
5000000
6000000
7000000
min 0 5 10 15 20 25 30 35 40
mAU
0
50
100
150
200
D. erecta
min 0 5 10 15 20 25 30 35 40
1000000
2000000
3000000
4000000
5000000
6000000
min 0 5 10 15 20 25 30 35 40
1000000
2000000
3000000
4000000
5000000
6000000
7000000
min 0 5 10 15 20 25 30 35 40
mAU
0
50
100
150
200
250
min 0 5 10 15 20 25 30 35 40
1000000
2000000
3000000
4000000
5000000
6000000
min
0
5 10 15 20 25 30 35 40
1000000
2000000
3000000
4000000
5000000
6000000
7000000
min 0 5 10 15 20 25 30 35 40
mAU
0
50
100
150
200
250
300
D. virilis
TIC positif frag 60
TIC positif frag 120
Chromatograme UV 280 nm
TIC positif frag 60
TIC positif frag 120
Chromatograme UV 280 nm
TIC positif frag 60
TIC positif frag 120
Chromatograme UV 280 nm
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
244


D. yakuba
min 0 5 10 15 20 25 30 35 40
1000000
2000000
3000000
4000000
5000000
6000000
min 0 5 10 15 20 25 30 35 40
1000000
2000000
3000000
4000000
5000000
6000000
7000000
min 0 5 10 15 20 25 30 35 40
mAU
0
50
100
150
200
250
300
350
min 0 5 10 15 20 25 30 35 40
0
1000000
2000000
3000000
4000000
5000000
6000000
min 0 5 10 15 20 25 30 35 40
1000000
2000000
3000000
4000000
5000000
6000000
7000000
min 0 5 10 15 20 25 30 35 40
mAU
0
50
100
150
200
250
300
D. ananassae
D, simulans
min 0 5 10 15 20 25 30 35 40
1000000
2000000
3000000
4000000
5000000
6000000
min 0 5 10 15 20 25 30 35 40
1000000
2000000
3000000
4000000
5000000
6000000
7000000
min 0 5 10 15 20 25 30 35 40
mAU
0
100
200
300
400
TIC positif frag 60
TIC positif frag 120
Chromatograme UV 280 nm
TIC positif frag 60
TIC positif frag 120
Chromatograme UV 280 nm
TIC positif frag 60
TIC positif frag 120
Chromatograme UV 280 nm
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
245

D. grimshawi
min 0 5 10 15 20 25 30 35 40
1000000
2000000
3000000
4000000
5000000
6000000
min 0 5 10 15 20 25 30 35 40
1000000
2000000
3000000
4000000
5000000
6000000
7000000
min 0 5 10 15 20 25 30 35 40
mAU
0
50
100
150
200
min 0 5 10 15 20 25 30 35 40
1000000
2000000
3000000
4000000
5000000
6000000
min 0 5 10 15 20 25 30 35 40
1000000
2000000
3000000
4000000
5000000
6000000
7000000
min 0 5 10 15 20 25 30 35 40
mAU
0
50
100
150
200
250
300
350
D. sechellia
min 0 5 10 15 20 25 30 35 40
1000000
2000000
3000000
4000000
5000000
6000000
min 0 5 10 15 20 25 30 35 40
1000000
2000000
3000000
4000000
5000000
6000000
7000000
8000000
min 0 5 10 15 20 25 30 35 40
mAU
0
50
100
150
200
250
300
350
D. mojavensis
TIC positif frag 60
TIC positif frag 120
Chromatograme UV 280 nm
TIC positif frag 60
TIC positif frag 120
Chromatograme UV 280 nm
TIC positif frag 60
TIC positif frag 120
Chromatograme UV 280 nm
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
246

t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
247

BIBLIOGRAPHIE
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
248

t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
249


Arabidopsis Genome Consortium, 2000. Analysis of the genome sequence of the flowering
plant Arabidopsis thaliana. Nature, 408(6814), p.796-815.

Aravin, A.A., Hannon, G.J. & Brennecke, J., 2007. The Piwi-piRNA Pathway Provides an
Adaptive Defense in the Transposon Arms Race. Science, 318(5851), p.761-764.

Azuara, V. et al., 2006. Chromatin signatures of pluripotent cell lines. Nature Cell Biology,
8(5), p.532-538.

Berdasco, M., Fraga, M.F. & Esteller, M., 2009. Quantification of global DNA methylation
by capillary electrophoresis and mass spectrometry. Methods in Molecular Biology
(Clifton, N.J.), 507, p.23-34.

Berger, S.L., 2007. The complex language of chromatin regulation during transcription.
Nature, 447(7143), p.407-412.

Bernstein, B.E. et al., 2006. A bivalent chromatin structure marks key developmental genes in
embryonic stem cells. Cell, 125(2), p.315-326.

Bessereau, J., 2006. Transposons in C. elegans. WormBook.

Bibikova, M. & Fan, J., 2010. Genome-wide DNA methylation profiling. Wiley
Interdisciplinary Reviews. Systems Biology and Medicine, 2(2), p.210-223.

Bourc'his, D. & Bestor, T.H., 2004. Meiotic catastrophe and retrotransposon reactivation in
male germ cells lacking Dnmt3L. Nature, 431(7004), p.96-99.

Brennecke, J. et al., 2008. An epigenetic role for maternally inherited piRNAs in transposon
silencing. Science (New York, N.Y.), 322(5906), p.1387-1392.

Brown, S.E. et al., 2007. Variations in DNA methylation patterns during the cell cycle of
HeLa cells. Epigenetics: Official Journal of the DNA Methylation Society, 2(1), p.54-
65.

Brummel, T.J. et al., 1994. Characterization and relationship of Dpp receptors encoded by the
saxophone and thick veins genes in Drosophila. Cell, 78(2), p.251-261.

C. elegans Sequencing Consortium, 1998. Genome sequence of the nematode C. elegans: a
platform for investigating biology. Science (New York, N.Y.), 282(5396), p.2012-2018.

Caizares, J. et al., 2000. Tirant is a new member of the gypsy family of retrotransposons in
Drosophila melanogaster. Genome / National Research Council Canada 43(1), p.9-14.

Cassidy, S.B., Dykens, E. & Williams, C.A., 2000. Prader-Willi and Angelman syndromes:
sister imprinted disorders. American Journal of Medical Genetics, 97(2), p.136-146.

Chambeyron, S. et al., 2008. piRNA-mediated nuclear accumulation of retrotransposon
transcripts in the Drosophila female germline. Proceedings of the National Academy
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
250
of Sciences of the United States of America, 105(39), p.14964-14969.

Chan, S.W., Henderson, I.R. & Jacobsen, S.E., 2005. Gardening The Genome: DNA
Methylation in Arabidopsis thaliana. Nat Rev Genet, 6(7), p.590.

Clark, A.G. et al., 2007. Evolution of genes and genomes on the Drosophila phylogeny.
Nature, 450(7167), p.203-218.

Cokus, S.J. et al., 2008. Shotgun bisulphite sequencing of the Arabidopsis genome reveals
DNA methylation patterning. Nature, 452(7184), p.215-219.

D'vila, M.F. et al., 2010. Sex-specific methylation in Drosophila: an investigation of the
Sophophora subgenus. Genetica. Available at:
http://www.ncbi.nlm.nih.gov.gate1.inist.fr/pubmed/20640488 [Accd Aot 14,
2010].

Desset, S. et al., 2008. In Drosophila melanogaster the COM locus directs the somatic
silencing of two retrotransposons through both Piwi-dependent and -independent
pathways. PloS One, 3(2), p.e1526.

Dowsett, A.P. & Young, M.W., 1982. Differing levels of dispersed repetitive DNA among
closely related species of Drosophila. Proceedings of the National Academy of
Sciences of the United States of America, 79(15), p.4570-4574.

Drosophila 12 Genomes Consortium, 2007. Evolution of genes and genomes on the
Drosophila phylogeny. Nature, 450(7167), p.203-218.

Eads, C.A. & Laird, P.W., 2002. Combined bisulfite restriction analysis (COBRA). Methods
in Molecular Biology (Clifton, N.J.), 200, p.71-85.

Edwards, J.R. et al., 2010. Chromatin and sequence features that define the fine and gross
structure of genomic methylation patterns. Genome Research.

Elango, N. et al., 2009. DNA methylation is widespread and associated with differential gene
expression in castes of the honeybee, Apis mellifera. Proceedings of the National
Academy of Sciences of the United States of America, 106(27), p.11206-11211.

Fablet, M. et al., 2009. Genomic environment influences the dynamics of the tirant LTR
retrotransposon in Drosophila. The FASEB Journal: Official Publication of the
Federation of American Societies for Experimental Biology, 23(5), p.1482-1489.

Fablet, M. et al., 2006. Ongoing loss of the tirant transposable element in natural populations
of Drosophila simulans. Gene, 375, p.54-62.

Feschotte, C., 2008. Transposable elements and the evolution of regulatory networks. Nature
Reviews. Genetics, 9(5), p.397-405.

Field, L.M. et al., 2004. DNA methylation in insects. Insect Molecular Biology, 13(2), p.109-
115.

t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
251
Finnegan, D.J., 1989. Eukaryotic transposable elements and genome evolution. Trends in
Genetics, 5, p.103-107.

Fraga, M.F. et al., 2005. Epigenetic differences arise during the lifetime of monozygotic
twins. Proceedings of the National Academy of Sciences of the United States of
America, 102(30), p.10604-10609.

Fugmann, S.D., 2010. The origins of the Rag genes--from transposition to V(D)J
recombination. Seminars in Immunology, 22(1), p.10-16.

Garcia, R.N. et al., 2007. First evidence of methylation in the genome of Drosophila
willistoni. Genetica, 131(1), p.91-105.

Genereux, D.P. et al., 2008. Errors in the bisulfite conversion of DNA: modulating
inappropriate- and failed-conversion frequencies. Nucl. Acids Res., 36(22), p.e150.

Girton, J.R. & Johansen, K.M., 2008a. Chromatin structure and the regulation of gene
expression: the lessons of PEV in Drosophila. Advances in Genetics, 61, p.1-43.

Girton, J.R. & Johansen, K.M., 2008. Chapter 1 Chromatin Structure and the Regulation of
Gene Expression: The Lessons of PEV in Drosophila.

Goffeau et al.1997. The yeast genome directory. Nature, 387(6632 Suppl), p.5.

Goll, M.G. et al., 2006. Methylation of tRNAAsp by the DNA methyltransferase homolog
Dnmt2. Science (New York, N.Y.), 311(5759), p.395-398.

Goodman, M. et al., 1998. Toward a phylogenetic classification of Primates based on DNA
evidence complemented by fossil evidence. Molecular Phylogenetics and Evolution,
9(3), p.585-598.

Gou, D. et al., 2010. SETDB1 Is Involved in Postembryonic DNA Methylation and Gene
Silencing in Drosophila. PLoS ONE, 5(5), p.e10581.

Gruntman, E. et al., 2008. Kismeth: Analyzer of plant methylation states through bisulfite
sequencing. BMC Bioinformatics, 9(1), p.371.

Haniford, D.B., 2006. Transpososome dynamics and regulation in Tn10 transposition.
Critical Reviews in Biochemistry and Molecular Biology, 41(6), p.407-424.

Hayatsu, H., 2008. The bisulfite genomic sequencing used in the analysis of epigenetic states,
a technique in the emerging environmental genotoxicology research. Mutation
Research, 659(1-2), p.77-82.

Henderson, I.R. et al., 2010. Accurate sodium bisulfite sequencing in plants. Epigenetics :
official journal of the DNA Methylation Society, 5(1), p.47-49.

Hermann, A., Schmitt, S. & Jeltsch, A., 2003. The human Dnmt2 has residual DNA-
(cytosine-C5) methyltransferase activity. The Journal of Biological Chemistry,
278(34), p.31717-31721.
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
252

Holliday, R. & Grigg, G., 1993. DNA methylation and mutation. Mutation
Research/Fundamental and Molecular Mechanisms of Mutagenesis, 285(1), p.61-67.

Huang, Y. et al., 2010. The behaviour of 5-hydroxymethylcytosine in bisulfite sequencing.
PloS One, 5(1), p.e8888.

Jacinto, F.V., Ballestar, E. & Esteller, M., 2008. Methyl-DNA immunoprecipitation (MeDIP):
hunting down the DNA methylome. BioTechniques, 44(1), p.35, 37, 39 passim.

Jenuwein, T. & Allis, C.D., 2001. Translating the histone code. Science (New York, N.Y.),
293(5532), p.1074-1080.

Kapitonov, V.V. & Jurka, J., 2008. A universal classification of eukaryotic transposable
elements implemented in Repbase. Nat Rev Genet, 9(5), p.411-412.

Kazazian, H.H., 2004. Mobile elements: drivers of genome evolution. Science (New York,
N.Y.), 303(5664), p.1626-1632.

Kok, R.M. et al., 2007. Global DNA methylation measured by liquid chromatography-tandem
mass spectrometry: analytical technique, reference values and determinants in healthy
subjects. Clinical Chemistry and Laboratory Medicine: CCLM / FESCC, 45(7), p.903-
911.

Kouzminova, E. & Selker, E.U., 2001. dim-2 encodes a DNA methyltransferase responsible
for all known cytosine methylation in Neurospora. EMBO J, 20(15), p.4309-4323.

Krauss, V., Eisenhardt, C. & Unger, T., 2009. The genome of the stick insect Medauroidea
extradentata is strongly methylated within genes and repetitive DNA. PloS One, 4(9),
p.e7223.

Kriaucionis, S. & Heintz, N., 2009. The nuclear DNA base 5-hydroxymethylcytosine is
present in Purkinje neurons and the brain. Science (New York, N.Y.), 324(5929),
p.929-930.

Kucharski, R. et al., 2008. Nutritional control of reproductive status in honeybees via DNA
methylation. Science (New York, N.Y.), 319(5871), p.1827-1830.

Kunert, N. et al., 2003. A Dnmt2-like protein mediates DNA methylation in Drosophila.
Development (Cambridge, England), 130(21), p.5083-5090.

Kuramochi-Miyagawa, S. et al., 2008. DNA methylation of retrotransposon genes is regulated
by Piwi family members MILI and MIWI2 in murine fetal testes. Genes &
Development, 22(7), p.908-917.

Lachaise, D. & Silvain, J., 2004. How two Afrotropical endemics made two cosmopolitan
human commensals: the Drosophila melanogaster-D. simulans palaeogeographic
riddle. Genetica, 120(1-3), p.17-39.


t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
253
Lander, E.S. et al., 2001. Initial sequencing and analysis of the human genome. Nature,
409(6822), p.860-921.

Larkin, M.A. et al., 2007. Clustal W and Clustal X version 2.0. Bioinformatics (Oxford,
England), 23(21), p.2947-2948.

Le Rouzic, A., Dupas, S. & Capy, P., 2007. Genome ecosystem and transposable elements
species. Gene, 390(1-2), p.214-220.

Lee, Y.C.G. & Langley, C.H., 2010. Transposable elements in natural populations of
Drosophila melanogaster. Philosophical Transactions of the Royal Society of London.
Series B, Biological Sciences, 365(1544), p.1219-1228.

Lesage, P. & Todeschini, A.L., 2005. Happy together: the life and times of Ty
retrotransposons and their hosts. Cytogenetic and Genome Research, 110(1-4), p.70-
90.

Lin, M. et al., 2005. DNA methyltransferase gene dDnmt2 and longevity of Drosophila. The
Journal of Biological Chemistry, 280(2), p.861-864.

Lippman, Z. et al., 2004. Role of transposable elements in heterochromatin and epigenetic
control. Nature, 430(6998), p.471-476.

Lister, R. et al., 2008. Highly integrated single-base resolution maps of the epigenome in
Arabidopsis. Cell, 133(3), p.523-536.

Lyko, F., Ramsahoye, B.H. & Jaenisch, R., 2000. DNA methylation in Drosophila
melanogaster. Nature, 408(6812), p.538-540.


Lyko, F., Whittaker, A.J. et al., 2000. The putative Drosophila methyltransferase gene
dDnmt2 is contained in a transposon-like element and is expressed specifically in
ovaries. Mechanisms of Development, 95(1-2), p.215-217.

Malone, C.D. et al., 2009. Specialized piRNA pathways act in germline and somatic tissues of
the Drosophila ovary. Cell, 137(3), p.522-535.

Marhold J.[1] et al., 2004. Conservation of DNA methylation in dipteran insects. Insect
Molecular Biology, 13, p.117-123.

Marsano, R.M. et al., 2000. The complete Tirant transposable element in Drosophila
melanogaster shows a structural relationship with retrovirus-like retrotransposons.
Gene, 247(1-2), p.87-95.

Mathieu, O. & Bender, J., 2004. RNA-directed DNA methylation. Journal of Cell Science,
117(Pt 21), p.4881-4888.

Matzke, M. et al., 2007. Targets of RNA-directed DNA methylation. Current Opinion in
Plant Biology, 10(5), p.512-519.

t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
254
Miki, Y. et al., 1996. Mutation analysis in the BRCA2 gene in primary breast cancers. Nature
Genetics, 13(2), p.245-247.

Miura, A. et al., 2001. Mobilization of transposons by a mutation abolishing full DNA
methylation in Arabidopsis. Nature, 411(6834), p.212-214.

Morgan, H.D. et al., 2005. Epigenetic reprogramming in mammals. Human Molecular
Genetics, 14 Spec No 1, p.R47-58.

Olivieri, D. et al., 2010. An in vivo RNAi assay identifies major genetic and cellular
requirements for primary piRNA biogenesis in Drosophila. The EMBO Journal,
29(19), p.3301-3317.

Pardue, M. et al., 2005. Two retrotransposons maintain telomeres in Drosophila. Chromosome
Research: An International Journal on the Molecular, Supramolecular and
Evolutionary Aspects of Chromosome Biology, 13(5), p.443-453.

Parks, A.R. & Peters, J.E., 2009. Tn7 elements: engendering diversity from chromosomes to
episomes. Plasmid, 61(1), p.1-14.

Pasyukova, E.G., Nuzhdin, S.V. & Filatov, D.A., 1998. The relationship between the rate of
transposition and transposable element copy number for copia and Doc
retrotransposons of Drosophila melanogaster. Genetical Research, 72(1), p.1-11.

Pavlopoulou, A. & Kossida, S., 2009. Phylogenetic analysis of the eukaryotic RNA (cytosine-
5)-methyltransferases. Genomics, 93(4), p.350-357.

Peng, J.C. & Karpen, G.H., 2009. Heterochromatic genome stability requires regulators of
histone H3 K9 methylation. PLoS Genetics, 5(3), p.e1000435.

Peng, J.C. & Karpen, G.H., 2007. H3K9 methylation and RNA interference regulate nucleolar
organization and repeated DNA stability. Nat Cell Biol, 9(1), p.25-35.

Phalke, S. et al., 2009. Retrotransposon silencing and telomere integrity in somatic cells of
Drosophila depends on the cytosine-5 methyltransferase DNMT2. Nature Genetics,
41(6), p.696-702.

Picot, S. et al., 2008. The mariner transposable element in natural populations of Drosophila
simulans. Heredity, 101(1), p.53-59.

Pomraning, K.R., Smith, K.M. & Freitag, M., 2009. Genome-wide high throughput analysis
of DNA methylation in eukaryotes. Methods (San Diego, Calif.), 47(3), p.142-150.

Ponger, L. & Li, W., 2005. Evolutionary diversification of DNA methyltransferases in
eukaryotic genomes. Molecular Biology and Evolution, 22(4), p.1119-1128.

Rita Rebollo, Batrice Horard, Benjamin Hubert, Cristina Vieira, 2010. Jumping genes and
epigenetics: Towards new species. Gene.


t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
255
Reik, W., Dean, W. & Walter, J., 2001. Epigenetic reprogramming in mammalian
development. Science (New York, N.Y.), 293(5532), p.1089-1093.

Rein, T. et al., 1997. Absence of an Unusual Densely Methylated Island at the Hamster dhfr
ori-. Journal of Biological Chemistry, 272(15), p.10021 -10029.

Rozhkov, N.V. et al., 2010. Small RNA-based silencing strategies for transposons in the
process of invading Drosophila species. RNA (New York, N.Y.), 16(8), p.1634-1645.

Saito, K. et al., 2006. Specific association of Piwi with rasiRNAs derived from
retrotransposon and heterochromatic regions in the Drosophila genome. Genes &
Development, 20(16), p.2214-2222.

Salzberg, A. et al., 2004. Identification of methylated sequences in genomic DNA of adult
Drosophila melanogaster. Biochemical and Biophysical Research Communications,
322(2), p.465-469.

Sandhu, J. et al., 2009. Determination of 5-methyl-2'-deoxycytidine in genomic DNA using
high performance liquid chromatography-ultraviolet detection. Journal of
Chromatography. B, Analytical Technologies in the Biomedical and Life Sciences,
877(20-21), p.1957-1961.

Schaefer, M. & Lyko, F., 2010. Solving the Dnmt2 enigma. Chromosoma, 119(1), p.35-40.

Schnable, P.S. et al., 2009. The B73 maize genome: complexity, diversity, and dynamics.
Science (New York, N.Y.), 326(5956), p.1112-1115.

Schotta, G. et al., 2002. Central role of Drosophila SU(VAR)39 in histone H3-K9
methylation and heterochromatic gene silencing. The EMBO Journal, 21(5), p.1121-
1131.

Schotta, G. et al., 2004. A silencing pathway to induce H3-K9 and H4-K20 trimethylation at
constitutive heterochromatin. Genes & Development, 18(11), p.1251-1262.

Schubert, D. et al., 2006. Silencing by plant Polycomb-group genes requires dispersed
trimethylation of histone H3 at lysine 27. The EMBO Journal, 25(19), p.4638-4649.

Selker, E.U., Fritz, D.Y. & Singer, M.J., 1993. Dense nonsymmetrical DNA methylation
resulting from repeat-induced point mutation in Neurospora. Science (New York,
N.Y.), 262(5140), p.1724-1728.

Selker, E.U. et al., 2003. The methylated component of the Neurospora crassa genome.
Nature, 422(6934), p.893-897.

Siomi, H. & Siomi, M.C., 2009. On the road to reading the RNA-interference code. Nature,
457(7228), p.396-404.

Slotkin, R.K. et al., 2009. Epigenetic reprogramming and small RNA silencing of
transposable elements in pollen. Cell, 136(3), p.461-472.

t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
256
Stach, D. et al., 2003. Capillary electrophoretic analysis of genomic DNA methylation levels.
Nucleic Acids Research, 31(2), p.E2.

Stoye, J.P., 2009. Proviral protein provides placental function. Proceedings of the National
Academy of Sciences, 106(29), p.11827-11828.

Strahl, B.D. & Allis, C.D., 2000. The language of covalent histone modifications. Nature,
403(6765), p.41-45.

Suganuma, T. & Workman, J.L., 2010. WD40 Repeats Arrange Histone Tails for Spreading
of Silencing. Journal of Molecular Cell Biology, 2(2), p.81 -83.

Sun, H. et al., 2010. Genome-wide mapping of RNA Pol-II promoter usage in mouse tissues
by ChIP-seq. Nucleic Acids Research. Available at:
http://www.ncbi.nlm.nih.gov.gate1.inist.fr/pubmed/20843783 [Accd Octobre 26,
2010].

Suzuki, M.M. & Bird, A., 2008. DNA methylation landscapes: provocative insights from
epigenomics. Nature Reviews. Genetics, 9(6), p.465-476.

Tahiliani, M. et al., 2009. Conversion of 5-methylcytosine to 5-hydroxymethylcytosine in
mammalian DNA by MLL partner TET1. Science (New York, N.Y.), 324(5929), p.930-
935.

Tasheva, E.S. & Roufa, D.J., 1995. A densely methylated DNA island is associated with a
chromosomal replication origin in the human RPS14 locus. Somatic Cell and
Molecular Genetics, 21(6), p.369-383.

Tasheva, E.S. & Roufa, D.J., 1994. Densely methylated DNA islands in mammalian
chromosomal replication origins. Molecular and Cellular Biology, 14(9), p.5636-
5644.

Terracol, R. & Lengyel, J.A., 1994. The thick veins gene of Drosophila is required for
dorsoventral polarity of the embryo. Genetics, 138(1), p.165-178.

Vagin, V.V. et al., 2006. A distinct small RNA pathway silences selfish genetic elements in
the germline. Science (New York, N.Y.), 313(5785), p.320-324.

Valinluck, V. et al., 2004. Oxidative damage to methyl-CpG sequences inhibits the binding of
the methyl-CpG binding domain (MBD) of methyl-CpG binding protein 2 (MeCP2).
Nucleic Acids Research, 32(14), p.4100-4108.

Vaughn, M.W. et al., 2007. Epigenetic natural variation in Arabidopsis thaliana. PLoS
Biology, 5(7), p.e174.

Venner, S., Feschotte, C. & Bimont, C., 2009. Dynamics of transposable elements: towards a
community ecology of the genome. Trends in Genetics: TIG, 25(7), p.317-323.



t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
257
Vieira, C. & Bimont, C., 1997. Transposition rate of the 412 retrotransposable element is
independent of copy number in natural populations of Drosophila simulans. Molecular
Biology and Evolution, 14(2), p.185-188.

Vieira, C. et al., 1999. Wake up of transposable elements following Drosophila simulans
worldwide colonization. Molecular Biology and Evolution, 16(9), p.1251-1255.

Vieira, C. & Bimont, C., 2004. Transposable element dynamics in two sibling species:
Drosophila melanogaster and Drosophila simulans. Genetica, 120(1-3), p.115-123.

Vincze, T., Posfai, J. & Roberts, R.J., 2003. NEBcutter: a program to cleave DNA with
restriction enzymes. Nucleic Acids Research, 31(13), p.3688-3691.

Volff, J., 2006. Turning junk into gold: domestication of transposable elements and the
creation of new genes in eukaryotes. BioEssays: News and Reviews in Molecular,
Cellular and Developmental Biology, 28(9), p.913-922.

Wang, M.B. et al., 2001. Replicating satellite RNA induces sequence-specific DNA
methylation and truncated transcripts in plants. RNA, 7(1), p.16-28.

Wang, Y. et al., 2006. Functional CpG methylation system in a social insect. Science (New
York, N.Y.), 314(5799), p.645-647.

Warnecke, P.M. et al., 2002. Identification and resolution of artifacts in bisulfite sequencing.
Methods (San Diego, Calif.), 27(2), p.101-107.

Waterston, R.H. et al., 2002. Initial sequencing and comparative analysis of the mouse
genome. Nature, 420(6915), p.520-562.

Weiler, K.S. & Wakimoto, B.T., 1995. Heterochromatin and gene expression in Drosophila.
Annual Review of Genetics, 29, p.577-605.

Werren, J.H. et al., 2010. Functional and evolutionary insights from the genomes of three
parasitoid Nasonia species. Science (New York, N.Y.), 327(5963), p.343-348.

Wicker, T. et al., 2007. A unified classification system for eukaryotic transposable elements.
Nature Reviews. Genetics, 8(12), p.973-982.

Wojdacz, T.K., Hansen, L.L. & Dobrovic, A., 2008. A new approach to primer design for the
control of PCR bias in methylation studies. BMC Research Notes, 1, p.54.

Xiang, H. et al., 2010. Single base-resolution methylome of the silkworm reveals a sparse
epigenomic map. Nature Biotechnology, 28(5), p.516-520.

Zemach, A. et al., 2010. Genome-wide evolutionary analysis of eukaryotic DNA methylation.
Science (New York, N.Y.), 328(5980), p.916-919.

Zhang, X. et al., 2006. Genome-wide high-resolution mapping and functional analysis of
DNA methylation in arabidopsis. Cell, 126(6), p.1189-1201.

t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3
258
Zilberman, D. & Henikoff, S., 2007. Genome-wide analysis of DNA methylation
patterns. Development (Cambridge, England), 134(22), p.3959-3965.
t
e
l
-
0
0
8
1
5
9
5
6
,

v
e
r
s
i
o
n

1

-

1
9

A
p
r

2
0
1
3