Vous êtes sur la page 1sur 798

C

O L L E C T I O N

DIRIGE PAR JEAN BORNAREL

R E N O B L E

C I E N C E S

BIODGRADATIONS ET MTABOLISMES
LES BACTRIES POUR LES TECHNOLOGIES DE L'ENVIRONNEMENT
Jean PELMONT

Grenoble Sciences
Grenoble Sciences poursuit un triple objectif : raliser des ouvrages correspondant un projet clairement dfini, sans contrainte de mode ou de programme, garantir les qualits scientifique et pdagogique des ouvrages retenus, proposer des ouvrages un prix accessible au public le plus large possible. Chaque projet est slectionn au niveau de Grenoble Sciences avec le concours de referees anonymes. Puis les auteurs travaillent pendant une anne (en moyenne) avec les membres dun comit de lecture interactif, dont les noms apparaissent au dbut de louvrage. Celui-ci est ensuite publi chez lditeur le plus adapt. (Contact : Tl. : (33)4 76 51 46 95 - E-mail : Grenoble.Sciences@ujf-grenoble.fr) Deux collections existent chez EDP Sciences : la Collection Grenoble Sciences, connue pour son originalit de projets et sa qualit Grenoble Sciences - Rencontres Scientifiques, collection prsentant des thmes de recherche dactualit, traits par des scientifiques de premier plan issus de disciplines diffrentes. Directeur scientifique de Grenoble Sciences Jean BORNAREL, Professeur l'Universit Joseph Fourier, Grenoble 1

Comit de lecture pour "Biodgradations et mtabolismes


Paulette VIGNAIS, Directrice de recherche CNRS au CEA de Grenoble Pierre CAUMETTE, Professeur l'Universit de Pau et des Pays de l'Adour Yves JOUANNEAU, Directeur de recherche CNRS au CEA de Grenoble Philippe NORMAND, Professeur l'Universit Claude Bernard de Lyon

Grenoble Sciences est soutenu par le Ministre de l'ducation nationale le Ministre de la Recherche et la Rgion Rhne-Alpes Grenoble Sciences est rattach lUniversit Joseph Fourier de Grenoble

Ralisation et mise en pages : Centre technique Grenoble Sciences Illustration de couverture : Alice GIRAUD

ISBN 2-86883-745-X EDP Sciences, 2005

BIODGRADATIONS ET MTABOLISMES
LES BACTRIES POUR LES TECHNOLOGIES DE L'ENVIRONNEMENT

Jean PELMONT

C
17, avenue du Hoggar Parc dActivit de Courtabuf, BP 112 91944 Les Ulis Cedex A, France

Ouvrages Grenoble Sciences dits par EDP Sciences


Collection Grenoble Sciences
Chimie. Le minimum savoir (J. Le Coarer) Electrochimie des solides (C. Dportes et al.) Thermodynamique chimique (M. Oturan & M. Robert) Chimie organomtallique (D. Astruc) De l'atome la raction chimique (sous la direction de R. Barlet) Introduction la mcanique statistique (E. Belorizky & W. Gorecki) Mcanique statistique. Exercices et problmes corrigs (E. Belorizky & W. Gorecki) La cavitation. Mcanismes physiques et aspects industriels (J.P. Franc et al.) La turbulence (M. Lesieur) Magntisme : I Fondements, II Matriaux et applications (sous la direction dE. du Trmolet de Lacheisserie) Du Soleil la Terre. Aronomie et mtorologie de lespace (J. Lilensten & P.L. Blelly) Sous les feux du Soleil. Vers une mtorologie de lespace (J. Lilensten & J. Bornarel) Mcanique. De la formulation lagrangienne au chaos hamiltonien (C. Gignoux & B. Silvestre-Brac) Problmes corrigs de mcanique et rsums de cours. De Lagrange Hamilton (C. Gignoux & B. Silvestre-Brac) La mcanique quantique. Problmes rsolus, T. 1 et 2 (V.M. Galitsky, B.M. Karnakov & V.I. Kogan) Analyse statistique des donnes exprimentales (K. Protassov) Description de la symtrie. Des groupes de symtrie aux structures fractales (J. Sivardire) Symtrie et proprits physiques. Du principe de Curie aux brisures de symtrie (J. Sivardire) Exercices corrigs d'analyse, T. 1 et 2 (D. Alibert) Introduction aux varits diffrentielles (J. Lafontaine) Analyse numrique et quations diffrentielles (J.P. Demailly) Mathmatiques pour les sciences de la vie, de la nature et de la sant (F. & J.P. Bertrandias) Approximation hilbertienne. Splines, ondelettes, fractales (M. Attia & J. Gaches) Mathmatiques pour ltudiant scientifique, T. 1 et 2 (Ph.J. Haug) Bactries et environnement. Adaptations physiologiques (J. Pelmont) Enzymes. Catalyseurs du monde vivant (J. Pelmont) La plonge sous-marine l'air. L'adaptation de l'organisme et ses limites (Ph. Foster) Endocrinologie et communications cellulaires (S. Idelman & J. Verdetti) Elments de biologie l'usage d'autres disciplines (P. Tracqui & J. Demongeot) Bionergtique (B. Gurin) Cintique enzymatique (A. Cornish-Bowden, M. Jamin & V. Saks) L'Asie, source de sciences et de techniques (M. Soutif) La biologie, des origines nos jours (P. Vignais) Naissance de la physique. De la Sicile la Chine (M. Soutif) Le rgime omga 3. Le programme alimentaire pour sauver notre sant (A. Simopoulos, J. Robinson, M. de Lorgeril & P. Salen) Gestes et mouvements justes. Guide de l'ergomotricit pour tous (M. Gendrier) Listening Comprehension for Scientific English (J. Upjohn) Speaking Skills in Scientific English (J. Upjohn, M.H. Fries & D. Amadis) Minimum Competence in Scientific English (S. Blattes, V. Jans & J. Upjohn)

Grenoble Sciences - Rencontres Scientifiques


Radiopharmaceutiques. Chimie des radiotraceurs et applications biologiques (sous la direction de M. Comet & M. Vidal) Turbulence et dterminisme (sous la direction de M. Lesieur) Mthodes et techniques de la chimie organique (sous la direction de D. Astruc) L'nergie de demain. Techniques - Environnement - Economie (sous la direction de J.L. Bobin, E. Huffer & H. Nifenecker)

AVERTISSEMENT
Cet ouvrage sadresse aux chercheurs, ingnieurs et tudiants intresss par le rle des bactries dans la dfense de lenvironnement et le mcanisme biochimique des biodgradations de substances polluantes varies. Pour tenter de prsenter un aperu du problme partir de la masse norme des informations sur le sujet, souvent disperses parmi les sources nombreuses parpilles dans les publications scientifiques, il a fallu sappuyer sur les notions fondamentales en biochimie mtabolique, en enzymologie et en microbiologie. Il n'tait pas question de faire double emploi avec les traits gnraux qui sont souvent excellents et bien adapts la formation scientifique. Il convenait donc de rester dans un cadre modeste en renonant toute tentative de raliser un essai encyclopdique, qui de toute faon aurait t hors de porte de lauteur. La difficult est vite apparue de trouver les limites entre les donnes de base et les rappels jugs indispensables. Aussi a t-on ajout la fin des quatorze chapitres un glossaire assez volumineux pour accompagner les rubriques traites, en rappelant les dfinitions et proprits essentielles. On peut estimer nanmoins que cet ouvrage ne conviendra quaux tudiants ayant lexprience dau moins trois annes de cursus universitaire avec un bagage de biochimie et de microbiologie. Par contre les connaissances de chimie requises restent simples et le programme du Premier Cycle suffira gnralement. Le but est de crer un outil utile pour les diffrents spcialistes intresss par la dfense de lenvironnement et les biodgradations, afin de leur permettre de se documenter rapidement sur des sujets qui sortent un peu de leur domaine habituel. Lidal serait videmment dapporter des ides qui pourraient enrichir leur travail. On a donc pris soin dapporter une bibliographie assez abondante, arrte sauf quelques exceptions la fin 2002, et il a fallu naturellement effectuer des choix assez arbitraires. La facilit daccs Internet et aux grandes bases de donnes fait que les informations peuvent tre rapidement collectes ou retrouves, notamment par Medline. On a donc privilgi les rfrences trouves dans les journaux dont on peut se procurer en un temps trs court le contenu des articles en ligne. Il a paru inutile dintroduire des adresses de sites Internet, parfois volatiles, que chacun peut se procurer en toute libert avec les moteurs de recherche du type Google. Lintervention des bactries dans les biodgradations a t privilgie, parce quelle est en gnral la fois essentielle et bien documente. Ce choix comporte une part darbitraire, puisque les champignons, levures et autres ensembles dacteurs apportent leur part. Il y a donc t fait parfois allusion dans plusieurs rubriques o cela tait indispensable.

INTRODUCTION
LES DONNES DU PROBLME
Comment les bactries liminent-elles les dchets de l'activit humaine ? Le thme de ce livre est la biochimie du nettoyage de l'environnement qu'elles effectuent. Le problme est replac dans le cadre des grands cycles naturels. Ils nous aident mieux comprendre comment les procds mis en jeu dans le recyclage des substances naturelles ont t adapts et mis au service de l'limination des composs artificiels, c'est--dire la bioremdiation. L'accumulation de rejets de toutes sortes dans l'environnement est devenue un sujet de proccupation majeure depuis plusieurs dcennies. Elle a donn lieu une forte prise de conscience dans les pays dvelopps qui en sont les premiers responsables. La course pourrait sembler perdue d'avance au vu de la formidable progression des activits industrielles, de la consommation et du dveloppement de l'agriculture intensive. La pollution va des emballages aux produits chimiques utiliss comme pesticides et herbicides, en passant par les nitrates, les hydrocarbures et les mtaux lourds. Les micro-organismes contribuent largement les dtruire ou les neutraliser malgr leurs limites. Tous les tres vivants participent des degrs divers au recyclage des matires organiques et minrales de l'environnement. Par leur aptitude coloniser tous les milieux, les micro-organismes viennent au premier rang. Bactries, champignons, microalgues et protistes forment une gigantesque usine chimique plantaire dont les produits se propagent tout au long des chanes nutritionnelles. Un premier choix a t de ne considrer majoritairement que les bactries, ou plus exactement les procaryotes en gnral, c'est--dire les protobactries ou bactries au sens strict, les cyanobactries et les archaebactries. Pourquoi cette limitation ? Les procaryotes sont presque toujours en premire ligne. Ce sont les organismes les plus simples dont on connat plutt bien la machinerie mtabolique et assez souvent la gntique. Les mcanismes rgulateurs sont moins complexes que chez les eucaryotes mais peuvent mettre en jeu un bouleversement de l'expression de nombreux gnes qui n'est pas sans rappeler les diffrenciations cellulaires des organismes plus volus. La prsence des procaryotes est universelle et leur participation aux grands cycles naturels est essentielle. Parmi les bactries du sol se trouvent les actinomyctes aux potentialits particulirement riches et complexes qui excellent en mme temps dans l'art de faire des antibiotiques. L'extrme versatilit de tous ces organismes et leur facult d'adaptation en font des acteurs trs actifs dans la lutte contre les pollutions. Ce livre en est une premire approche.

BIODGRADATIONS ET MTABOLISMES

Depuis les annes 1960 a paru une abondante littrature scientifique sur les biodgradations lorsque les chercheurs, au dpart incrdules, se sont aperus que de nombreux produits organiques jugs toxiques ou rbarbatifs comme le benzne, les phnols, le ptrole brut et autres, taient effectivement dgrads activement par les bactries, parfois avec la collaboration d'autres organismes dont les levures. Les rsultats ne sont accessibles en gnral que dans des revues disperses et spcialises. Une pollution peut avoir des causes naturelles comme artificielles. Pour lutter contre ses effets pervers, il est bon de connatre les mcanismes de son limination qui peut s'oprer parfois spontanment par oxydation l'air, hydrolyse ou destruction photochimique. La microflore de l'environnement s'est habitue traiter les polluants naturels par des facteurs enzymatiques appropris slectionns au cours des priodes gologiques. La vgtation est une des premires responsables de l'mission d'une immense varit de substances, des terpnes, flavonodes, alcalodes et autres composs qui sont des dchets ou des agents de dfense contre les autres organismes. L'industrie humaine n'a fait que compliquer les choses en introduisant des molcules qui n'existaient pas auparavant dans la nature. On dsigne ces composs artificiels sous le vocable de xnobiotiques. Il peut arriver qu'un xnobiotique ne soit qu'un "analogue" qui ne diffre d'un compos naturel que par un dtail de sa formule chimique le rendant acceptable par les enzymes des micro-organismes. Le xnobiotique devenu biodgradable est trait comme un substrat naturel et son limination est possible si les ractions du mtabolisme en acceptent tous les intermdiaires. Dans les cas les plus favorables, la substance trangre est minralise, c'est--dire transforme en gaz carbonique, ammoniac et eau. Un cas de figure trs important est celui du comtabolisme. L'agent microbien dgrade effectivement le xnobiotique, mais ne peut pas l'utiliser seul pour sa croissance. Les transformations ont alors lieu paralllement celles des substrats normaux en utilisant les mmes outils. Dans bien des cas, le comtabolisme peut avoir un caractre fortuit. Il est videmment intressant dans la mesure o il permet d'liminer des produits gnants. Des complications naissent quand un xnobiotique a une action toxique sur la microflore et les plantes. Sa destruction, partielle ou non, est alors une raction de dfense, une dtoxification du poison. La gamme des situations rencontres est vaste, et nous en trouverons de nombreux exemples. Dans un cadre gnral, un substrat donn se trouve en prsence, non pas d'une entit biologique unique, mais de populations mixtes de bactries ou d'autres espces. Tous ces organismes apportent leurs propres potentialits. Les premires transformations sont catalyses par une espce donne et les produits forms sont reus par d'autres qui prennent le relais. Des changes ont lieu, minralisation et dtoxification sont ventuellement simultanes. C'est la situation la plus commune dans l'environnement mais aussi la plus difficile dmler sur le plan exprimental puisqu'il n'est pas simple de reproduire artificiellement et de faon stable la cohabitation des diffrents acteurs. Il existe dans la littrature scientifique un grand nombre d'articles faisant tat de la disparition de tel ou tel contaminant dans un milieu naturel, interprt comme l'activit d'une association microbienne (un "consortium" dans les articles anglosaxons). Ces recherches sont intressantes et rassurent sur la nature de tel ou tel produit, mais n'apportent pas

INTRODUCTION

toujours d'information prcise sur les mcanismes impliqus. De plus la principale qualit d'un rsultat scientifique est d'tre reproductible par d'autres. En gnral les descriptions faites sur le terrain ne sont jamais reproduites en l'tat, puisqu'il s'agit de milieux complexes variables dans le temps et l'espace. Reconnatre le caractre biodgradable d'un produit est nanmoins essentiel. Son valuation par diffrentes mthodes standards, comme la BOD* 1, est recherche par les industriels dsireux de se mettre en conformit avec la lgislation. La disparition de certains polluants est conditionne par leur solubilit, leur caractre volatil (mission dans l'atmosphre et destruction photochimique), ou leur adsorption sur les particules du sol (humus et argiles). Un produit fortement adsorb reste plus longtemps dans le sol alors qu'un produit trs soluble est entran rapidement vers la nappe phratique et les cours d'eau. Ce n'est pas forcment avantageux. Un lessivage trop rapide ne laisse pas le temps aux microorganismes du sol de s'adapter et d'entamer le nettoyage, et le produit polluant ira contaminer les rivires. La tendance plus ou moins importante s'adsorber est mesure par le coefficient Koc*. Elle est rgle entre autres par la nature des molcules, leur caractre plus ou moins hydrophobe et leur ionisation. La rcalcitrance intgrale de certains polluants qui rsistent toute attaque microbienne est videmment la situation la plus nfaste et ncessite le recours, quand on le peut, l'incinration ou au recyclage. Il s'agit principalement de certaines matires plastiques, de goudrons, de noyaux chimiques d'une stabilit exceptionnelle et d'lments minraux tels que les mtaux : cadmium, zinc, mercure et autres. La pollution par les hydrocarbures est l'ordre du jour. La biodgradation de bon nombre de ces composs est connue, parfois rapide et a fait l'objet d'une exprimentation trs vaste. Malheureusement certains hydrocarbures, polycycliques ou haute masse molculaire, sont de vritables dangers. Tout le monde pense videmment aux bitumes lourds de l'Erika ou du Prestige. La lenteur de leur limination naturelle est telle que leur prsence, longtemps aprs les rcentes mares noires, constitue la calamit que l'on sait. Les mtaux offrent un cadre part. Lorsqu'ils sont prsents sous forme d'oxydes, d'hydroxydes, de sulfures ou de combinaisons organiques, les mtaux peuvent tre solubiliss et entrans par les eaux avant d'tre dilus dans l'environnement. La gestion des concentrations mtalliques est un problme pineux en biologie. Un chapitre montrant comment les bactries traitent ce problme a t inclu dans ce livre, car la pollution mtallique est loin d'tre absente des problmes contemporains. Enfin il convient de mentionner la participation des plantes dans tout ceci. Elles ne sont pas le sujet de ce livre, mais leur prsence ne saurait tre ignore car leurs racines attirent dans ce qu'on appelle la rhizosphre des bactries et des champignons avec lesquels elles collaborent activement. En outre la majorit des plantes hbergent dans leurs racines des champignons formant les mycorhizes, qui prsentent eux-mmes des interactions avec les bactries. Limiter le sujet aux bactries, quelques exceptions prs, est donc une premire simplification qui ne doit pas faire oublier que lenvironnement est un tout faisant participer un grand nombre dorganismes diffrents. 1 - Les mots reprs par * sont dfinis dans le glossaire situ la fin de l'ouvrage.

10

BIODGRADATIONS ET MTABOLISMES

L'PURATION
La lgislation actuelle oblige toutes les communes se raccorder une station d'puration. Certaines industries ont leur propre installation. Lpuration biologique permet de dbarrasser l'eau de ses principales impurets. Son vocation trs succincte ici ne sert qu' nous mettre dans le bain du sujet. La mthode la plus ancienne est le lagunage, qui utilise des plans d'eau o s'effectuent les processus naturels de dgradation et de recyclage des polluants grce au dveloppement de bactries, de levures, de protozoaires et d'algues. Il s'tablit une chane alimentaire naturelle oxygne en surface. On utilise au besoin la capacit d'auto-puration des terres cultives. La mthode a l'inconvnient d'occuper des surfaces assez vastes et sa capacit de traitement est devenue trop faible pour les grandes agglomrations. Les stations d'puration fonctionnent sur un principe similaire mais avec une plus grande efficacit. Les eaux uses sont dcantes puis brasses et ares en prsence des micro-organismes qui s'agglomrent en boues et granules destins sdimenter, tandis que les eaux clarifies sont peu peu dbarrasses de leurs matires organiques dissoutes. La prsence de l'oxygne est essentielle et garantit les biodgradations les plus rapides. Selon la technologie utilise, ces cultures bactriennes peuvent tre libres (boues actives) ou fixes (lits bactriens et biofilms). L'emploi des boues actives est le plus classique. Les microorganismes se dveloppent et se rassemblent en flocons ou "flocs", maintenus en suspension par brassage accompagn d'une aration. Une dcantation limine les boues, dont une partie est rinjecte en amont, le restant tant limin, opration qui demande souvent des solutions techniques dlicates. Il existe maintenant une varit de techniques et le schma symbolise le principe de base.
eau use dcanteur primaire aration des boues actives eau traite dcanteur secondaire

sable particules boues en excs dchets

La demande en eau recycle de haute qualit a stimul les progrs techniques. Une conomie des volumes traits est recherche dans les villes par la sparation des eaux uses et pluviales. La charge minrale et organique d'une eau est estime par la MES ou teneur en matires en suspension, et par la DBO5* qui permet d'estimer la teneur en matire organique. La MES d'une eau urbaine ne dpasse gure 200-300 mg . L1, et la DBO5 varie de 100 400 mg . L1. Ces valeurs peuvent tre fortement augmentes, de 10 50 fois la sortie de certaines industries alimentaires (brasseries, conserveries, fromageries, abattoirs). Deux autres paramtres sont la DCO (demande chimique en oxygne) et le COT (carbone

INTRODUCTION

11

organique total). Des mesures rapides et automatises permettent ainsi d'valuer la pollution. Il est gnralement intressant de pouvoir estimer la nature prcise des polluants prsents comme les pesticides ou les hydrocarbures. Les techniques analytiques modernes y parviennent. Parmi celles-ci figurent des enzymes immobilises dans des lectrodes polarographiques. Diverses socits se sont spcialises dans la production de biocapteurs. La conception des biocapteurs s'est diversifie et perfectionne depuis une vingtaine d'annes. La dtection automatique d'une pollution permet de dclencher un systme d'alerte et de commander le rglage des installations. Divers procds ont t mis au point pour traiter certains effluents en anarobiose, comme le procd UASB*. Des efforts mens en vue de diminuer les cots d'investissement et d'entretien ont conduit de nombreuses amliorations dans la filtration, l'immobilisation des bactries et l'vacuation des boues. La conduite d'une station d'puration sur le principe de base voqu prcdemment connat plusieurs catgories de problmes, dont le rejet des boues ou la qualit des microbes purateurs. La nature de ces micro-organismes est cruciale. On trouve gnralement des Pseudomonas, Alcaligenes, Micrococcus, Flavobacterium et autres espces dont le nom reviendra frquemment dans le courant de ce livre comme acteurs des biodgradations. L'arrive des polluants slectionne des espces comptentes qui se dveloppent plus vite que d'autres et sont capables d'changer de l'information gntique sous forme de plasmides. On s'efforcera sans doute dans l'avenir d'introduire des bactries gntiquement modifies spcialises dans le traitement de certaines pollutions. Toutes ces recherches reposent la base sur des tudes exprimentales utilisant les mthodes de culture afin d'tudier les proprits physiologiques des germes. Les mthodologies sont bien dcrites dans les manuels de microbiologie pratique. Cela va du plus simple par des cultures axniques discontinues (en batch) aux cultures continues en chmostat* ou en turbidostat*. Ces techniques ont t largement perfectionnes et automatises. Malheureusement elles ne rendent encore compte qu'imparfaitement des conditions naturelles o de nombreuses espces de micro-organismes sont en association et en comptition. L'tude des cultures mixtes stables se heurte de grandes difficults mais devrait concentrer les efforts de recherche l'avenir.

CHAPITRE 1 LA COLLECTE DE L'NERGIE


Ce premier chapitre a pour objet de dresser un rappel des mcanismes nergtiques fondamentaux situs la base des cycles naturels et de toute biodgradation. Que l'nergie soit tire des oxydations ou de la lumire, elle apparat invariablement sous forme d'un potentiel lectrochimique membranaire ou de composs nergtiques comme l'ATP. 1.1 - Respirations et fermentations 1.2 - Le rle des fermentations 1.3 - ATPases, ATP synthases 1.4 - Cytochromes 1.5 - Complexes de type bc1 1.6 - Oxydases respiratoires terminales 1.7 - Phototrophie non-oxygnique 1.8 - Les cyanobactries 15 20 26 30 34 38 46 56

1 LA COLLECTE DE L'NERGIE
1.1 - RESPIRATIONS ET FERMENTATIONS
Toute cellule dispose invariablement de deux rservoirs d'nergie de base, reprsents par un potentiel membranaire et un stock de composs nergtiques comme l'ATP. Le potentiel est aliment par le passage de protons prfrentiellement dans un seul sens, avec pour rsultat une dissymtrie de pH et de charges des deux cts de la membrane, avec un excdent de protons et de charges positives hors du cytoplasme. L'ATP est l'archtype des molcules nergtiques dites haut potentiel et source d'nergie chimique directe. Ces deux rservoirs communiquent par une pompe membranaire rversible, qui est l'ATPase/ATP synthase. L'hydrolyse de l'ATP en ADP et phosphate peut gnrer un potentiel de membrane. Inversement ce potentiel, qui voque celui d'un condensateur charg, peut actionner une synthse en retour de l'ATP. L'ide fondamentale est donc de voir que toute l'nergie immdiatement disponible pour la cellule est rpartie entre ces deux rservoirs. Le potentiel lectrochimique membranaire ou force protonmotrice (p) est aliment essentiellement par les respirations et les oxydorductions lies la photosynthse. De l'autre ct, le rservoir ATP reprsente les molcules haut potentiel nergtique produites par les fermentations. Celles-ci engendrent de l'ATP en phase soluble par couplage direct avec des ractions du mtabolisme. Une autre fraction d'ATP est produite par la pompe rversible qui est l'ATPase/ATP synthase. Elle permet de recharger le potentiel membranaire par l'hydrolyse de l'ATP, ou au contraire de faire une synthse d'ATP partir d'ADP et de phosphate au dtriment du potentiel membranaire.
ATP synthase potentiel p

++++++++
ATPase

ATP

Ce schma est utile aux microbiologistes et biochimistes, car il fait appel au mcanisme mis en jeu au cours de la conservation d'nergie. Les modalits sont parfois plus complexes et le mcanisme des changes d'nergie n'est pas toujours connu

16

BIODGRADATIONS ET MTABOLISMES

avec certitude. La notion de fermentation adopte ici est restrictive. Dans la pratique industrielle, la rcupration de produits utiles partir d'une culture de microorganismes est considre comme une fermentation au sens large. L'oxydation de l'alcool en acide actique dans la prparation du vinaigre est ainsi dsigne comme une fermentation, alors qu'au sens biochimique du terme c'est le rsultat d'oxydations respiratoires. Le potentiel membranaire est bti par des oxydorductions capables de coupler le transport d'lectrons avec une translocation de protons. Ce principe de conservation d'nergie est rversible. Le potentiel membranaire peut contribuer aux courants d'lectrons inverses, gnrateurs de molcules rduites comme le NADH ou le NADPH. Il actionne de faon gnrale un retour des protons travers la membrane, coupl un certain nombre d'activits comme la rotation des flagelles ou le transport de substances et d'ions travers la membrane. Ce sont les transports actifs dits de type 1. Ainsi la permase du lactose dans le colibacille fait entrer simultanment une molcule de glucose et un proton. La pression exerce sur l'entre du proton tire la molcule de lactose vers l'intrieur. La permase agit donc comme synporteur. Si l'entre des protons tait couple la sortie d'une autre entit, il s'agirait d'un antiporteur. La contribution essentielle du potentiel membranaire consiste videmment coupler la synthse d'ATP par phosphorylation de l'ADP grce au retour des protons vers le cytoplasme. Le rservoir ATP renferme une nergie convertible en diffrentes molcules haut potentiel nergtique dont l'actyl-coenzyme A. L'ATP actionne de nombreuses synthses, actionne la mobilit cellulaire chez certaines espces, ainsi que des transports actifs, notamment les transporteurs ABC* des bactries. Dans la ralit l'ATP n'est pas le seul nuclotide nergtique, mais il faut introduire en toute rigueur l'ADP, ou encore des nuclotides susceptibles d'changer leur phosphate comme l'UDP, le CDP et le GTP. L'hydrolyse de l'ATP en ADP et phosphate libre 32 kJ . mol1 dans les conditions standards. L'nergie relle est bien suprieure (50-70 kJ . mol1). Elle crot avec le rapport ATP/ADP, ou mieux avec la "charge nergtique" dfinie par ATKINSON comme (ATP + 0,5 ADP) / (ATP + ADP + AMP). Comparable en quelque sorte la charge d'une batterie, ce rapport serait troitement rgul par les cellules dans une fourchette d'environ 0,85-0,95 dans les conditions normales de croissance. On sait que la variation d'nergie libre au cours d'une oxydorduction est donne par la loi de NERNST*. Une oxydation chimique quelconque devrait dgager essentiellement de la chaleur. Les biomembranes offrent un milieu hydrophobe favorable la conservation de l'nergie par translocation unidirectionnelle d'entits ioniques. On admet que cette conversion s'opre avec un rendement trs lev par le canal de protines membranaires transporteurs d'ions, animes de changements de conformation. L'nergie des oxydations est donc consacre des changements de conformations cycliques au sein de ces transporteurs, qui leur permettent de se charger d'un ion sur une face de la membrane, et de le rejeter de l'autre ct, crant un potentiel lectrochimique. Dans les cas les plus courants, le potentiel s'tablit par une translocation de protons. Des ions sodium peuvent jouer le mme rle. Les protons, ou noyaux

1 LA COLLECTE DE L'NERGIE

17

d'hydrogne, ne sont pas des entits libres comme le serait un ion sodium anhydre, par exemple. En milieu aqueux, un proton est prsent combin des molcules d'eau, sous forme H3O+ (ou H5O2+ et autres), alors que dans les molcules organiques et en particulier les protines, sous forme de groupes ionisables caractre acide (cystine, tyrosine, aspartate, glutamate), basique (arginine, lysine, histidine) 1. Les transferts de protons dans les protines se font de groupe donneur vers groupe accepteur (acide vers base). Lorsque les protons parviennent l'extrieur, ils sont accepts par des molcules d'eau et leur prsence contribue faire baisser le pH. Ils peuvent tre aussi retenus la surface de la membrane sous forme de charges positives changeables. La translocation des protons revient donc acidifier le milieu extrieur, ou crer un excdent de charges positives, ou les deux la fois. Le potentiel lectrochimique membranaire a donc deux composantes : une acidit par rapport l'autre face, une charge globale positive par rapport celle-ci. La tendance qu'ont les protons faire ce mouvement inverse dpend la fois du pH et de la rpartition asymtrique des charges. C'est pourquoi on a coutume de reprsenter le potentiel membranaire par une force protonmotrice, analogue une force lectromotrice, dsigne par p ou H, et exprime en volts : p = 2,3 (RT/F) pH. La diffrence de potentiel lectrique entre les deux faces de la membrane est positive si l'extrieur est charg positivement par rapport au cytoplasme. La diffrence pH du pH entre les deux compartiments est ngative si l'extrieur est le ct le plus acide. Le coefficient 2,3 (RT/F) vaut peu prs 0,059 volt. Selon ces conventions de signe, une p positive tend faire entrer des protons et donc faire synthtiser de l'ATP. Beaucoup d'auteurs prfrent l'exprimer en millivolts. Elle est couramment de 200 250 millivolts dans les systmes biologiques. On voit tout de suite que pH peut tre nul si toute la force protonmotrice est tablie par une diffrence de charges entre les deux faces de la membrane qui peut provenir d'une distribution ingale d'ions sodium, potassium ou autres. Des interconversions plus compliques peuvent avoir lieu par le jeu des mouvements de molcules et d'ions chargs travers la membrane, soit par diffusion, soit l'aide de transporteurs spcifiques. Toute substance rendant la membrane permable certains ions peut donc avoir un effet dcouplant. C'est le cas des ionophores et des protonophores. Par exemple la valinomycine transporte spcifiquement les ions potassium travers la membrane et agit comme dcouplant si ces ions sont prsents. Ce phnomne peut ralentir le dveloppement de la microflore et retarder les biodgradations, quand sont rpandues certaines substances phnoliques qui ont un tel effet dcouplant. Les oxydations respiratoires ont donc une fonction cruciale dans l'tablissement d'un potentiel membranaire. Les oxydations lies la photosynthse fonctionnent

1 - Rappel - la notion d'acide ou de base donne ici correspond aux dfinitions de BROENSTED, trs commode pour les biochimistes. Un acide est donneur de proton, une base un accepteur. Par exemple l'acide glutamique se dissocie rversiblement en acide glutamique glutamate + H+, le proton tant accept par une base (molcule organique, eau).

18

BIODGRADATIONS ET MTABOLISMES

sur le mme principe. La figure symbolise le modle de base d'une chane de transporteurs d'lectrons dbouchant sur un accepteur final qui est suppos ici tre le dioxygne.
succinate SDH UQ NADH NDH NQ quinones oxydases terminales et rductases cyt. bc1 O2 et accepteurs cyt. c

DH substrats varis

Chanes respiratoires

Les rectangles ombrs sont des sites de conservation d'nergie. Ils correspondent des systmes enzymatiques complexes o le passage des lectrons contribuent btir un potentiel membranaire par la translocation sens unique de protons. On y voit la NADH dshydrognase (NDH) qui est un systme complexe avec un composant flavinique et des noyaux fer-soufre, le cytochrome bc1 et la cytochrome c oxydase terminale ou cytochrome aa3 2, remplaable en anarobiose par des rductases (comme la nitrate rductase). Vers les quinones respiratoires de la membrane convergent les lectrons venant du NADH, du succinate et de donneurs varis par le canal de diverses dshydrognases ou de l'hydrognase, systmes enzymatiques qui ont tous des noyaux fersoufre dans leur structure. Les quinones forment un rservoir d'lectrons qu'elles distribuent en aval dans diffrentes directions.
NADH formiate 0 0 rservoir des quinones OH DMSO TMAO ttrathionate nitrite OH fumarate nitrate lactate

H2 dshydrognases

glycrol-3P

rductases

Anarobiose (E. coli)


2 - Une nomenclature traditionnelle mais vieillie appelle "complexe I" de la mitochondrie animale la NADH dshydrognase (NDH), "complexe II" la SDH, "complexe III" le bc1 et "complexe IV" la cytochrome c oxydase.

1 LA COLLECTE DE L'NERGIE

19

Elles canalysent les lectrons vers une quinone respiratoire dissoute dans la phase lipidique membranaire. En bas du schma sur l'anarobiose figurent diffrents accepteurs. Les rductases correspondantes ont galement des noyaux fer-soufre et sont ventuellement associes des cytochromes. L'accepteur le plus favorable est le nitrate (E' = + 420 mV). D'autres ont un potentiel plus bas, comme le dimthylsulfoxyde (DMSO, E' = + 160 mV), le trimthylamine-N-oxyde (TMAO, E' = + 130 mV) et le fumarate (E' = + 30 mV). La quinone respiratoire n'est plus une ubiquinone (E' = + 100 mV), mais une mnaquinone potentiel plus bas (E' = 74 mV). Les ubiquinones (une des plus communes est l'ubiquinone-8 ou UQ-8, de potentiel E' = + 100 mV), sont des molcules trs lipophiles 3, en excs dans la membrane par rapport aux autres transporteurs d'lectrons. Une de leurs caractristiques essentielles est de pouvoir changer les lectrons un un en passant par un stade intermdiaire radicalaire ou semiquinone.
O O O O OH e + 2 H+ e + 2 H+ O e e O

OH quinol

O semiquinone

O quinone

Ubiquinone-8
En absence d'oxygne dans les respirations dites anarobies, les ubiquinones sont souvent remplaces par des naphtoquinones (NQ), appeles aussi mnaquinones, au comportement similaire mais avec un potentiel redox plus bas. Leur forme rduite, ou mnaquinol, n'est pas roxyde par un cytochrome bc1, car ces derniers sont caractristiques des chanes arobies, sauf chez certains phototrophes o ils sont des pices essentielles dans les changes d'nergie. Le complexe bc1 sera dcrit plus loin. Leur quivalent chez les cyanobactries s'appelle b6f. La participation d'un bc1 aux oxydorductions n'est pas absolument gnrale. Dans certaines chanes respiratoires bactriennes s'effectue une oxydation directe des quinols par l'oxydase terminale, dont nous retrouverons plus loin des exemples.

3 - Solubles dans le pentane ou l'hexane.

20

BIODGRADATIONS ET MTABOLISMES

1.2 - LE RLE DES FERMENTATIONS


Les mcanismes respiratoires pratiqus avec l'oxygne ou des accepteurs de remplacement sont gnralement les meilleures sources d'nergie pour les cellules. Mais quand aucune respiration n'est possible, une fermentation s'impose et produit de l'ATP en phase soluble, sans passer par un potentiel membranaire. Les fermentations consomment beaucoup de matires premires, les oxydations sont trs incompltes et librent en excs des produits caractristiques. Leur importance directe dans les biodgradations est parfois secondaire quand les conditions ncessaires sont loignes des conditions relles. Elles participent cependant au recyclage de la matire organique et interviennent au moins indirectement au nettoyage de l'environnement. Le principe de base d'une fermentation est illustr de faon exemplaire par la trs classique fermentation lactique. La voie glycolytique ou voie EMP 4 transforme une molcule de glucose en deux molcules de pyruvate, consomme 2 ATP mais en produit 4. Il y a 2 oxydations qui librent au total 4 lectrons emports dans 2 molcules de NADH.
NADH ATP ATP FBP NADH COO C=O CH3 NADH COO HCOH CH3 lactate La fermentation lactique proprement dite TrioseP NADH ATP PGA ATP ATP ATP COO C=O CH3 pyruvate

La voie glycolytique ordinaire


Tout le problme des fermentations est de roxyder le NADH. Si les oxydations se poursuivaient au-del du pyruvate, il y aurait davantage de NADH produit. La fermentation lactique fait deux choses essentielles : roxyder tout le NADH et obtenir un gain net en ATP. Le bilan est quilibr, mais le rsultat est une production d'nergie modeste pour un grand gchis de matire premire. Dans la ralit il y a un peu moins de lactate form, soit 1,8 1,9 moles par mole de glucose, parce qu'une partie du carbone est prleve aux stades FBP, PGA et pyruvate, pour les synthses carbones de la cellule. Le tableau suivant n'est qu'un simple rappel pour montrer les fermentations effectues partir du pyruvate, les flches paissies dsignant des phases rductrices produisant 2 lectrons par mole.

4 - Voie d'EMBDEN-MEYERHOF-PARNAS ; FDP : fructose-1,6-bisphosphate ; Triose-P : dihydroxyactone-phosphate et 3-phosphoglycraldhyde ; PGA : acide 3-phosphoglycrique. Les voies classiques sont l'EMP, la voie des pentose-phosphates et celle d'ENTNER-DOUDOROFF.

1 LA COLLECTE DE L'NERGIE
glucose CO2 oxaloactate CO2 pyruvate CO2 actaldhyde CO2 formiate lactate CO2 H2 actyl-CoA fumarate acrylate actoactyl-CoA CO2 succinate CO2 propionate isopropanol butanol butyrate actone butyryl-CoA acides gras thanol actate butanediol actolactate CO2 actone thanol

21

malate

Grandes fermentations partir du pyruvate


La principale difficult d'un mtabolisme de fermentation est de roxyder entirement le NADH ou quivalent form au cours des oxydations qui doivent fournir une nergie rentable. Le mtabolisme cellulaire doit tre compatible avec ces exigences. C'est pourquoi les voies de fermentation sont en gnral ramifies, celles du lactate de Lactobacillus ou de l'thanol dans la levure tant plutt des exceptions. La multiplicit des voies autorise une meilleure adaptation aux conditions comme on peut s'en rendre compte par l'exemple trs simple de la transformation du pyruvate par le colibacille en anarobiose. Les produits sont l'thanol, l'actate et le formiate, qui est transform en CO2 et H2. Seule est productrice d'ATP la voie de l'actate.
HCOO formiate H2 CO2 COSCoA HSCoA CH3 actyl-CoA HSCoA actaldhyde thanol actyl-phosphate Pi HSCoA ADP actate ATP

COO C=O CH3 pyruvate

Le passage du pyruvate l'actyl-coenzyme A est une oxydation classique dcrite dans tous les manuels, mais elle a ici une particularit : les lectrons sont vacus sous forme d'hydrogne gazeux par l'intermdiaire du formiate. Seule la voie passant par l'actyl-phosphate est nergtique. Elle ne permet pas la cellule de roxyder le NADH produit avant la fabrication du pyruvate. La seconde voie s'en charge. Un aiguillage au niveau de l'actyl-CoA va orienter le mtabolisme plutt

22

BIODGRADATIONS ET MTABOLISMES

vers une voie ou l'autre en fonction des impratifs cellulaires du moment. Il y a finalement quatre produits de fermentation en proportions variables : l'hydrogne, le gaz carbonique, l'acide actique et l'thanol. L'quilibrage entre roxydation du NADH et production d'nergie n'est pas le seul impratif. La cellule a besoin de certains substrats carbons de dpart pour ses synthses. Par exemple l'oxaloactate est le prcurseur de plusieurs acides amins dont l'aspartate, et le succinate est l'origine des porphyrines. Une voie de fermentation peut donc en profiter pour produire au passage de tels prcurseurs. Elle est dite voie anaplrotique. Le petit dtournement ainsi effectu ne compromet pas la fermentation proprement dite puisque la matire premire est disponible en grande quantit. Les fermentations produisent ventuellement de grandes quantits de gaz et de produits volatils tels que gaz carbonique, hydrogne, des alcools, des acides carboxyliques courte chane Les manations s'ajoutent aux produits forms par d'autres routes, comme l'ammoniac et H2S. L'hydrogne gazeux est un vecteur extrmement important dans l'environnement mais ne s'accumule pas, car il diffuse facilement vers la surface du sol et des eaux. En outre il est rapidement roxyd en arobiose par des germes qui l'utilisent comme substrat nergtique. Enfin une concentration trop forte en H2 abaisse le potentiel redox du milieu des valeurs basses et se montre inhibitrice sur de nombreuses ractions de fermentation. Le diagramme de SCHINK [1] indique le potentiel redox pH 7 de l'hydrogne en fonction de sa pression partielle exprime en pascals (Pa). Le potentiel standard pH 7 de plusieurs couples d'oxydorduction a t repr. On voit que le potentiel de l'hydrogne est plus bas que la majorit d'entre eux.
E (mV)
0

fumarate/succinate glyoxylate/glycolate oxaloactate/malate actaldhyde/thanol NAD+/NADH pyruvate + CO2/malate actyl-CoA/actaldhyde + CoA 2 H+/H2 actyl-CoA + CO2/pyruvate + CoA

200

400

10

10

10

10

10

PH2 (Pa)

Variations du potentiel de l'hydrogne


La ligne de dmarcation entre fermentation et oxydation respiratoire n'est pas toujours vidente. Le meilleur exemple est celui de la fumarate rductase membranaire sur laquelle nous reviendrons par la suite. Le fumarate est utilis comme accepteur et fait du succinate par un mcanisme qui s'accompagne d'une translocation de protons. Un autre cas subtil est celui d'une apparente fermentation propionique par des espces anarobies strictes telles que Propionigenium modestum et Veillonella alcalescens. La premire est une bactrie marine, la seconde se rencontre dans la plaque dentaire. DIMROTH a montr en 1982 que Propiogenium tirait son nergie d'un systme indit [2].

1 LA COLLECTE DE L'NERGIE

23

On la cultive sur succinate dans un milieu contenant 20 g . L1 de NaCl. La transformation du succinate peut s'crire 5 : succinate + propionyl-CoA

succinyl-CoA + propionate succinyl-CoA (R)-mthylmalonyl-CoA (R)-mthylmalonyl-CoA (S)-mthylmalonyl-CoA (S)-mthylmalonyl-CoA + H+ propionyl-CoA + CO2

(1) (2) (3) (4)

Les enzymes catalysant ces ractions sont une coenzyme A transfrase (1), la mthylmalonyl-CoA mutase (2), une racmase (3) et la mthylmalonyl-CoA dcarboxylase (4). La raction (1) fait entrer du succinate, et le propionate est rejet audehors comme produit de la fermentation. Or ce sont deux charges ngatives qui entrent pour une seule qui sort. Consquence : une charge ngative supplmentaire du ct interne de la membrane. La raction (4) est la partie la plus intressante. Elle consomme un proton du ct interne. Elle fonctionne avec la biotine comme cofacteur et couple la dcarboxylation du substrat avec une translocation d'ions sodium vers l'extrieur de la cellule. Les bactries font donc un gradient d'ions sodium comme d'autres feraient un gradient de H+. La dcarboxylation est "exergonique" 6 (E' = 30 kJ . mol1). Comment la cellule rcupre-t-elle l'nergie correspondante ? Par une translocation en retour d'ions sodium et synthse d'ATP. Le passage des ions sodium en sens inverse actionne une ATP synthase trs comparable l'enzyme courante (dite de type F0F1 qui utilise les protons), et le rsultat est donc une synthse d'ATP par l'intermdiaire du potentiel membranaire. Le gradient de sodium est effaable exprimentalement par la nigricine et la monensine. On a montr avec des membranes isoles que le systme pouvait fonctionner dans les deux sens ! La dcarboxylase reprsente un modle qu'on retrouve dans plusieurs espces [3].
2 Na+ extrieur membrane intrieur H+ CH3

n Na+

D C

A B

CO2 H3CCH2 CSCoA ADP Pi n Na+ ATP

OOCCHCSCoA 2 Na+

O mthylmalonyl-CoA

O succinyl-CoA

Mthylmalonyl-CoA dcarboxylase (P. modestum)


Les fermentations s'accompagnent parfois de l'entre et de la sortie de molcules organiques ioniques par le jeu de transporteurs, avec pour rsultat un dsquilibre

5 - La notation R,S des configurations carbones est celle des chimistes. La notation usuelle D,L est encore traditionnellement admise dans certains cas, par exemple pour dsigner les acides amins. 6 - C'est--dire productrice d'nergie libre.

24

BIODGRADATIONS ET MTABOLISMES

des charges de part et d'autres de la membrane et naissance d'un potentiel. Un exemple classique est fourni par la fermentation malolactique 7 qui comporte en mme temps une oxydation du malate en actate et une dcarboxylation en lactate dans Oenococcus oeni. La figure montre comment l'change des deux produits cre une dissymtrie de charge. Un phnomne du mme genre se produit dans Oxalobacter formigenes dans la transformation de l'oxalate. L'excdent extrieur de charges positives permet d'actionner la synthse d'ATP par l'ATP synthase F0F1.
extrieur ++++++ membrane intrieur lactate malate2 n H+ oxalate2 formiate

lactate CO2

F0 F1 malate2 H+ ADP + Pi nH
+

oxalate2 ATP H+

formiate CO2

Oenococcus oeni

Oxalobacter formigenes

Terminons cette vocation des fermentations par les bactries Gram-positives du genre Clostridium. Ce sont des germes sporulants prsents dans tous les milieux, strictement anarobies, trs sensibles O2, totalement dpourvus de transporteurs d'lectrons comme les cytochromes. Leurs ressources nergtiques sont souvent fondes sur des fermentations sophistiques. L'une d'elles est la raction de STICKLAND.
alanine COOH Donneurs alanine histidine isoleucine leucine valine Accepteurs arginine glycine histidine hydroxyproline ornithine tryptophane H2NCH CH3 [2 H] [2 H] 2 NH3 2 Pi 2 actyl-P 2 glycine COOH HOOC H2NCH2 H2CNH2

COOH C=O CH3 CO2 COOH CH3

2 ATP HOOC COOH H3C CH3 3 actates

Fermentation de STICKLAND
7 - La fermentation malolactisque est d'importance dans la maturation des vins, dont elle abaisse lacidit et assouplit le got. Elle doit se produire immdiatement aprs la fermentation alcoolique, de faon pouvoir raliser rapidement la stabilisation biologique du vin, de 10 25C, pH 3-3,5, en prsence d'thanol de 10 13% en V. On peut inhiber le processus par SO2, l'acclrer par des bactries lyophilises.

1 LA COLLECTE DE L'NERGIE

25

Un acide amin, comme la L-alanine, est oxyd par dshydrognases gnratrices de NADH, symbolis par [2H]. La roxydation du NADH se fait par une voie rductrice portant sur 2 molcules d'un autre acide amin, ici la glycine. L'nergie est rcupre sous forme d'ATP partir de l'actyl-phosphate comme indiqu par le tableau ci-dessus. Le bilan entre le donneur alanine et l'accepteur glycine est donc ici de 3 molcules d'acide actique formes et de 2 ATP. Plusieurs acides amins pouvant intervenir comme donneurs ou accepteurs ont t indiqus. Nous retrouvons ici l'actate comme un produit de fermentation. Une classe particulire de bactries dites actognes font de l'acide actique comme principal produit de leur activit, mais se dtachent par des caractres particuliers. Dans ce groupe figurent des bactries du genre Clostridium. Nous examinerons les actognes dans un chapitre ultrieur. Une phase critique de ce mtabolisme est la rduction dsaminante de la glycine par la glycine rductase. L'enzyme de Clostridium sticklandii n'a pas d'quivalent ailleurs, et l'une de ses particularits est de fonctionner l'aide de slnium. On y trouve plusieurs parties appeles A, B et C, qui ont chacune un ple ractif caractristique. La partie A (17,1 kDa) contient un thiol essentiel et surtout un rsidu de slnocystine [4]. La protine B renferme du pyruvate comme cofacteur attach par lien covalent. Le site ractif essentiel est le carbonyle (C=O) du pyruvate. La protine C est un ttramre de formule 22 ( : 58 kDa, : 49 kDa) [5]. Elle contient un thiol indispensable et catalyse la dernire tape de la raction. La figure ci-dessous reprsente le cycle de faon simplifie.
glycine HOOC A SeH CO B actyl-P Pi SeH CO B C H2O 2 e + 2 H+ S O CCH3 A C H2O SH H2N CH2 HOOC CH2 SeH N A C B C

SH

NH3

SeCH2COOH CO B C

SH

Cycle de la glycine rductase


Le substrat est charg sur la protine B, forme une liaison covalente temporaire de type ctimine, appele aussi base de SCHIFF. Celle-ci est hydrolyse et il y a transfert sur la slnocystine de la protine A, avec dsamination. Une tape rductrice sous la dpendance de la thiordoxine rduite* s'effectue avec transfert sur le thiol de la protine C. La thiordoxine oxyde sera rduite nouveau par la thiordoxine rductase. Enfin une phosphorolyse termine le cycle, o le phosphate est entran

26

BIODGRADATIONS ET MTABOLISMES

sous forme d'actyl-phosphate. On voit que l'acide amin, H2NCH2COOH, a t transform en CH3COOH et NH3 et il y a bien eu un apport de deux lectrons et deux protons. L'actyl-phosphate sera la source de phosphate pour la synthse d'une molcule d'ATP.

1.3 - ATPASES, ATP SYNTHASES


L'ATP est un donneur de phosphate haut potentiel et sert de substrat pour les phosphorylations catalyses par les kinases. L'hydrolyse de l'ATP est couple d'autres ractions dans de trs nombreuses tapes du mtabolisme et fait figure d'agent moteur pour maintes synthses. L'ATP et l'ADP fonctionnent toujours sous form chlate par un magnsium dont la prsence est sous-entendue. L'hydrolyse est reprsente par : ATP4 + H2O ADP3 + PO4H2 + H+ (1) G' = 29,4 kJ . mole1 (25C) Une hydrolyse en AMP et pyrophosphate libre une nergie comparable, la valeur indique tant celle qui correspond l'tat standard. C'est un point de repre qui est trs loign de la ralit car l'nergie d'hydrolyse de la molcule d'ATP dpend du rapport [ATP] / [ADP] que les cellules s'efforcent de maintenir un niveau lev par des mcanismes rgulateurs prcis. Le graphique montre les variations de l'nergie ATP en fonction de ce rapport. On voit que l'nergie a presque doubl quand le rapport est de 100.
G' (kJ . mol 1)
0

20

concentration de phosphate 10 mM 1 mM

nergie d'hydrolyse de l'ATP croissante

40

60

80

106

102

102

106

[ATP]/[ADP]

Les ATPases membranaires* appartiennent plusieurs catgories dsignes par H ou F0 F1, A0 A1, P et V. Celles qui nous intressent ici sont les pompes rversibles de type H qui font communiquer les deux rservoirs d'nergie. Elles synthtisent de l'ATP en faisant entrer des protons dans la cellule. Inversement lorsquelles consomment de lATP, elles expulsent des protons lextrieur et btissent un potentiel de membrane. C'est pourquoi on dsigne ce type d'enzyme par ATPase/ATP synthase, dont le modle unique est tir de la membrane interne mitochondriale ou du colibacille. Ce modle prvaut, semble-t-il, dans la totalit du monde vivant. L'ATP synthase est toujours un complexe volumineux de plus de 450 kDa.

1 LA COLLECTE DE L'NERGIE

27

L'enzyme est compose de deux parties, dsignes par F0 et F1. La portion basale F0 est membranaire, de formule a b2 c12, avec un cylindre de sous-units c disposes en couronne, avec les sous-units et situes latralement par rapport au cylindre. La tte F1 est de composition 3 3 et fait saillie dans le cytoplasme des procaryotes, dans la matrice des mitochondries ou dans le stroma des thylakodes. Le socle F0 fonctionne comme un canal pour le passage des protons. La partie F1 peut tre dtache sous forme soluble. ATP Cest la mieux connue sur le plan structural. Les sousunits et se ressemblent ADP + Pi par leur structure, mais les 3 sites actifs sont ports F1 essentiellement par les . Les lient aussi des nuclb otides, et auraient un rle b + 4 H rgulateur.

a c 12

F0

ATPase/ATP synthase mitochondriale

+ + +
4 H+

+ + +

De nombreuses techniques biochimiques et gntiques ont t mises en uvre pour une cartographie des sites catalytiques. La partie F1 a t cristallise et analyse aux rayons X avec des analogues non hydrolysables de l'ATP en place dans les sites de la protine. L'ATP synthase est une des mcaniques molculaires les plus extraordinaires que la nature nous ait permis d'entrevoir. La synthse d'ATP, par ADP + Pi ATP + H2O, ne peut se faire qu' contre-courant thermodynamique. Pour que l'quilibre soit dplac effectivement du ct de la synthse de lATP, il faut que celui-ci soit limin au fur et mesure de sa formation. La solution observe est originale. Les units sont animes, en mme temps que le reste de l'enzyme, de changements de conformation. Cela signifie que l'affinit de la protine pour les diffrents substrats et produits peut varier en fonction de changements structuraux. Une faon d'carter l'ATP form des conditions d'quilibre est de former un lien haute affinit entre lui et l'enzyme : ATP + enzyme

complexe [enzyme-ATP] haute affinit.

Cette situation devrait conduire normalement un blocage, puisque le site enzymatique ne pourrait plus se dbarrasser du produit de la raction. Une action extrieure est donc ncessaire et consistera faire un nouveau changement de conformation qui aura pour effet de faire tomber l'affinit pour l'ATP et de faciliter sa libration avant un nouveau cycle ractionnel. Ces changements ne sont pas

28

BIODGRADATIONS ET MTABOLISMES

gratuits, et ncessitent un apport d'nergie qui tire sa source de la force protonmotrice p. C'est la partie F0 qu'il appartient d'effectuer ce couplage. F0 fonctionne comme un canal protons et commande les changements de conformation de la partie F1. Cette fonction est clairement mise en vidence aprs l'enlvement de F1, qui laisse un vide rendant la membrane permable aux protons par le canal de F0. On peut bloquer le passage par des agents dcouplants comme l'oligomycine et le DCCD, qui forment un lien covalent avec les sous-units c en un site acide plac mi-chemin des deux faces de la membrane et conserv dans l'volution. Une fois dtach de F0, le bloc F1 est soluble et ne fonctionne plus que comme une vulgaire ATPase. Une recombinaison de F0 et F1 sur la membrane reconstitue lATP synthase. Le fonctionnement de l'ATP synthase est fond par des variations de conformation subies par les trois sites actifs l'un aprs l'autre, modifiant leurs affinits pour l'ADP, le phosphate et l'ATP. Ces changements sont commands par la sous-unit qui occupe avec le centre de l'anneau et qui explore successivement les trois paires par un mouvement de rotation autour de l'axe . Une pice tournante ! Cette rotation est actionne par le courant de protons tabli au niveau de la pice de base F0 et affecte la sous-unit , qui confre l'anneau de F1 une structure gnrale asymtrique. La explore successivement les trois sites catalytiques appartenant aux qui passent tour tour par au moins trois conformations au cours de la rotation, principe que le schma symbolise de manire simplifie, montrant les tapes successives et les rapports avec la sous-unit l'intrieur de l'anneau [6].
Pi g ADP Pi ADP ATP Pi Pi g ATP ADP

ADP Pi

ATP ADP ATP ADP Pi

Cycle de l'ATP synthase

La conversion de l'ADP + Pi en ATP provoque une modification du site qui retient l'ATP avec une haute affinit. L'apport nergtique consiste donc ouvrir le site pour relcher l'ATP et admettre une nouvelle molcule d'ADP. L'ide avait t mise depuis longtemps par BOYER [7], qui voyait dans certaines conformations

1 LA COLLECTE DE L'NERGIE

29

molculaires un mode essentiel de stockage de l'nergie dans les changes biologiques 8. En somme l'ADP arrive, puis le phosphate, l'ATP se fait et sa forte rtention sur le site tire l'quilibre ractionnel en faveur de sa formation. La sousunit reoit alors un coup d'paule qui la force librer l'ATP et le cycle recommence. Cette notion n'est devenue plausible que par l'avance des connaissances sur la dynamique des protines en gnral. Il y a un couplage mcanique entre et les successives qu'elle voit dfiler au cours de la rotation [8]. La rotation subie par la chane a t vrifie par des techniques spectaculaires avec le secours de la microscopie de fluorescence, en particulier dans le laboratoire de Masasuke YOSHIDA [9]. L'exprience a consist immobiliser les particules F1 sur le verre l'aide d'un lien histidine par l'extrmit N-terminale des chanes 9. La partie avait t soude un filament d'actine porteur d'un groupe fluorescent afin de le rendre visible plus facilement. Une camra vido fixe au microscope permettait de voir tourner les filaments d'actine pendant l'hydrolyse de l'ATP ! La direction de rotation n'tait pas quelconque, toujours dans le sens inverse des aiguilles d'une montre vu du ct F0. On peut penser que la rotation seffectue en sens inverse au cours de la synthse dATP. La structure trs dtaille de la par tie F0 loge dans la membrane reste ADP ATP dterminer, mais on a une ide assez Pi prcise de la topologie des units c qui forment une couronne solidaire [10]. Ce F1 sont des polypeptides assez courts (79 acides amins) replis en deux hlices alpha formant pingle cheb b veux. Les units c sont des barreaux e H+ intrieur organiss en dodcamres et sont orients peu prs perpendiculairemembrane ment la membrane. Leur structure H+ H+ H+ H+ est dduite d'tudes faites en RMN. c Elles subissent un changement de conc c c c a formation et d'orientation en fonction F0 de leur protonation et dprotonation. H+ Ces changements ont fait l'objet d'une analyse trs fouille par RASTOGI et GIRVIN [11]. Ils arrivent la conclusion que l'ensemble des units c forme effectivement une pice tournante entranant dans son mouvement l'axe qui pntre dans F1. Le rle des sous-units b et reste incertain, mais leur prsence a t montre comme indispensable. Il s'agit peut-tre d'lments stabilisateurs (par exemple pour empcher F1 d'tre entran par le mouvement de rotation de l'axe ). La

8 - BOYER a reu tardivement le prix NOBEL en 1997, aprs que ses ides eussent t confirmes par les travaux sur l'ATP synthase mitochondriale. 9 - Ces prouesses sont autorises par la connaissance de la structure de la protine et par les techniques de modification covalente des protines de plus en plus perfectionnes.

30

BIODGRADATIONS ET MTABOLISMES

protine b est sous la forme d'un dimre. Sa structure est assez exceptionnelle. Chaque sous-unit est une hlice alpha unique trs allonge (95 ), et les deux hlices b sont torsades en une super-hlice dont la structure a t dtermine haute rsolution [12]. Ce systme tonnant est, semble-t-il, fortement conserv dans toute l'volution, et va continuer susciter un important courant de recherche. D'autres possibilits sont galement dbattues. N'oublions pas que loriginalit de se systme est de pouvoir fonctionner comme une pompe protons rversible, caractristique essentielle, car elle permet aux cellules dpourvues de chane respiratoire et tirant toute leur nergie par fermentation de reconstituer un potentiel membranaire partir de leur ATP. Ce potentiel est vital pour tous les procaryotes et indispensable au fonctionnement des mitochondries et plastes chez les eucaryotes.

1.4 - CYTOCHROMES
Les protines hminiques appeles cytochromes ont pour activit la plus courante de transfrer des lectrons d'un donneur vers un accepteur. Ils tirent parti de l'alternance du fer entre les tats Fe(II) et Fe(III), et sont des outils cellulaires omniprsents dans maintes biodgradations. Nous en rappelerons quelques proprits. Leur intervention est pratiquement obligatoire chez les organismes arobies, mais de nombreuses espces vivant en absence d'oxygne se servent aussi de cytochromes pour des transformations importantes au sein de l'environnement. Certains cytochromes ont mme une activit enzymatique intrinsque, comme les cytochromes P450. D'autres ont une structure complexe associant divers cofacteurs comme des ions mtalliques, des noyaux fer-soufre et des flavines.
absorbance (M1 cm1)

rduit
10000

a
oxyd

300

500

(nm)

5000


300 500

(nm)

L'identification des cytochromes est relativement aise grce au spectre diffrentiel d'absorption, qui tire parti du dplacement spectral par oxydorduction. La figure a montre les spectres du cytochrome c de cheval, petite protine soluble souvent utilise pour des tests enzymatiques l'tat oxyd (ox.) et l'tat rduit (red.). En b, la courbe mesure la diffrence d'absorption toutes les longueurs d'onde du visible entre la prparation rduite par dithionite et la mme l'tat oxyd. Cette technique est indispensable dans le cas des cytochromes lis une membrane, car elle permet d'effacer le bruit de fond caus par la turbidit du milieu. Un raffinement consiste effectuer ces tracs de spectre la

abs. (rd. ox.)

1 LA COLLECTE DE L'NERGIE

31

temprature de l'azote liquide (77 K), car les bandes obtenues, plus hautes et plus fines, accordent une meilleure rsolution. Une autre spectroscopie utilise est la RPE qui mesure les variations de spin* du fer. La structure molculaire des porphyrines est une des plus stables de la biosphre, son origine remonte aux origines les plus lointaines de la vie. Les porphyrines se distinguent par la nature des chanes latrales qui entourent la couronne azote ttrapyrrolique. Une des plus importantes est la protoporphyrine IX, porteuse de 4 mthyle, 2 propionyle, 2 vinyle. L'insertion du fer donne l'hme B, qu'on aperoit dans le petit formulaire. On sait que l'hme B porteur de Fe(II) est prsent dans l'hmoglobine 10. L'hme O drive de l'hme B : un groupe vinyle est remplac par une longue chane hydroxythyl-farnsyle (rectangle ombr) [13]. Une nouvelle transformation catalyse par une oxygnase sur un mthyle engendre l'hme A. Ce schma reste provisoire, vu l'existence de plusieurs varits d'hme A dans le monde bactrien.
H2C CH2 HOCH N Fe2+ N CH2 CH2 COOH N CH2 CH2 COOH N N N O CH2 CH2 COOH H H2C CH2 HOCH N N

Fe2+ N N CH2 CH2 COOH

Fe2+ N N C CH2 CH2 COOH CH2 CH2 COOH

Formules des hmes B, O et A


L'hme C est un hme B attach la protine par deux liens covalents tablis par les chanes latrales vinyle et le soufre de la cystine. L'attachement se fait sur un fragment de squence conserv Cys-x-x-Cys-His (ou Lys), l'histidine formant la sixime coordinence sur le fer. La cinquime coordinence de l'autre ct est le plus souvent l'histidine (la mthionine dans le cytochrome c mitochondrial). Les cytochromes c* sont typiquement des transporteurs d'lectrons extra-cytoplasmiques, logs dans le priplasme des Gram-ngatifs ou accols la face externe de la membrane cytoplasmique, mais des espces comme le colibacille en sont dpourvues. On distingue les cytochromes c en classes I, II et III. Certains contiennent 2, 6, 8 hmes C et davantage, formant des chanes de transfert intramolculaires. l'examen d'une squence, la prsence de deux cystines espacs de deux autres rsidus et voisin d'un histidine ou d'un rsidu basique est un indice srieux de la prsence d'un hme C. 10 - Lorsque le fer s'oxyde le Fe (III), l'hme est transform en hmine. Pour des raisons de simplicit, on a coutume d'appeler hme la porphyrine contenant du fer sans prciser son degr d'oxydation, qui alterne entre + 2 et + 3 dans les cytochromes.

32
Cys Cys polypeptide Cys Fe His N CH2 CH2 COOH S X X Cys S His N Fe
2+

BIODGRADATIONS ET MTABOLISMES

His N N

HO N Fe2+ N N N CH2 CH2 COOH

N N CH2 CH2 COOH

C Cytochrome c

CH2 CH2 COOH

L'hme D est un cas particulier rencontr dans une oxydase terminale de E. coli et diverses espces bactriennes. Il remplace l'hme O ou un hme A dans certaines oxydases en fonction des conditions physiologiques. Il est gnralement facile dtecter grce sa bande alpha exceptionnellement dporte vers le rouge (630 nm). Un tableau simplifi indique plusieurs catgories de cytochromes en fonction du type d'hme qu'ils hbergent. Les cytochromes qui ragissent avec des substrats tels que O2, NO, NO2 sont facilement inhibs par CO, l'ion cyanure ou azoture ("azide"), qui prennent la place du substrat normal. Dans d'autres cas (cytochromes b ou c), l'inhibiteur peut s'installer en dplaant une des liaisons de coordinence. Les potentiels d'oxydorduction ne sont donns qu' titre indicatif. Cyt. a b c d o a (nm)
585 - 605 555 - 565 545 - 554 630 554 - 565

Type d'Hme
Hme A Hme B Hme B Hme D Hme O

E' (mV)
vers 300 - 350 50 + 100 + 200 250 vers 300 - 350 > + 250

Observations
lipophile lien covalent bactrien bactrien

Inhibiteurs
CO, CN, N3 raction lente avec CN CO, CN, N3 CO, CN, N3

Le cytochrome c mitochondrial est une des premires protines analyses en dtail. Sa faible masse molculaire en faisait un modle idal. En outre elle prsente un conservatisme remarquable au cours de l'volution, la squence et la structure ayant gard de fortes ressemblances des bactries la levure de bire et l'homme. Autrement dit l'tude d'un cytochrome de mammifre donne une ide assez prcise du fonctionnement des cytochromes en gnral chez les micro-organismes. La rduction du fer dans le cytochrome c s'accompagne d'un changement structural de la molcule. Il y a des mouvements de certaines chanes latrales et une lgre rorientation de la charpente polypeptidique certains endroits, au point que la protine rduite ne cristallise plus dans le mme systme gomtrique que la protine oxyde, comme l'ont montr TAKANO et DICKERSON [14] La structure du cytochrome c de cheval est illustre ici l'tat oxyd et l'tat rduit 11. 11 - Les structures ont t tablies manuellement ici comme ailleurs dans ce livre, avec les coordonnes compltes tlcharges de la Brookhaven Data Base, et en utilisant le programme RasMac (Rasmol pour Mac) 2.7.1 crit par R. SAYLE.

1 LA COLLECTE DE L'NERGIE

33

hme

Oxyd, avec chanes latrales

Oxyd

Rduit

Cytochrome c de cheval
Les modifications de conformation du cytochrome c au cours des oxydorductions ouvrent une fentre sur le mcanisme des transferts d'lectrons dans les protines de ce type. La porphyrine et la chane polypeptidique assurent des changes radicalaires d'un lectron entre le fer et la surface. Le changement conformationnel aurait une fonction fondamentale. Le transfert d'un lectron entre le donneur (complexe bc1) et l'accepteur (cytochrome c oxydase) entrane le cytochrome c dans un cycle dcrit par un dessin. L'oxydorduction correspond au dplacement vertical, le changement structural dans le sens horizontal. La protine qui s'oxyde n'est donc plus tout fait la mme que celle qui restitue un lectron l'oxydase, un peu comme s'il y avait alternance entre deux couples redox diffrents. Le cycle est ici parcouru dans le sens des aiguilles d'une montre, il ressemble un cycle d'hystrsis accompagn d'un change d'nergie, celui qui est requis par la modification de conformation. tat rduit Ce principe quivaut pour les chimistes un A B nivellement de l'nergie d'activation de la rduction de l'oxydase par le donneur.
e bc1 oxydase e

A tat oxyd

L'ide est de voir le cytochrome comme une sorte d'enzyme catalysant l'change d'lectrons et utilisant les mmes rgles de mouvements conformationnels que les protines en gnral. On retrouve cette proprit dans l'azurine de Pseudomonas aeruginosa qui est une petite protine contenant du cuivre servant de transporteur coupl un cytochrome c551. La structure dtaille de l'azurine est connue et bascule entre deux conformations alternes au cours de l'change d'un lectron et d'un proton avec le cytochrome [15].

34

BIODGRADATIONS ET MTABOLISMES

Les cytochromes c fonctionnent invariablement l'extrieur du cytoplasme chez les procaryotes. Ils sont libres dans le priplasme des bactries Gram-ngatives, ou attachs la face externe de la membrane cytoplasmique. De mme ils sont logs du ct lumen dans les thylakodes des cyanobactries et des chloroplastes. Les mitochondries animales et vgtales portent leurs cytochromes c dans le compartiment intermembranaire. Il semble donc que pour devenir fonctionnel un cytochrome c doive franchir obligatoirement les limites du cytoplasme o il est synthtis. Il y a un principe gnral qui veut que l'apocytochrome c (la protine sans sa porphyrine) soit transport destination avant de recevoir son groupe hminique. Comme celui-ci est synthtis dans le cytoplasme, il faut donc qu'il traverse la membrane avant d'tre soud la protine par des rsidus de cystine. La dernire tape de la synthse de l'hme est l'insertion du fer dans la porphyrine l'aide d'une ferrochlatase, donnant l'hme B, et c'est l'tat rduit que l'hme sera insr dans un cytochrome c et soud pour devenir un hme C. La fabrication des cytochromes c montre diffrents niveaux de complexit dans la nature et demande au moins 9 facteurs dans les protobactries et , les archaebactries et les mitochondries des plantes. Le processus est plus simple dans les mitochondries animales, ou encore chez les champignons qui ont un mcanisme particulier [16]. La complexit est intermdiaire dans les chloroplastes, les bactries Gram-positives et les cyanobactries. La fonction des diffrents facteurs et leur volution gardent encore beaucoup de points d'ombre [17].

1.5 - COMPLEXES DE TYPE BC1


Les cytochrome bc1 canalisent les lectrons des ubiquinones vers le cytochrome c dans les chanes respiratoires qui en possdent. C'est le complexe III dans les mitochondries. L'oxydorduction correspondante s'accompagne d'une translocation de protons d'un ct de la membrane, et offre un exemple emblmatique de la conservation de l'nergie sous forme de potentiel lectrochimique membranaire coupl aux oxydations. La constitution d'un complexe bc1 semble universelle par sa composition. On y rencontre un cytochrome b intgr la membrane et contenant deux hmes B proches l'un de l'autre , un cytochrome c1 dont la plus grande partie se trouve l'extrieur et une protine fer-soufre ou ISP ("iron-sulfur protein"), noyau [2Fe-2S] d'un type spcial dit de RIESKE*. Le complexe mitochondrial bovin a t obtenu cristallis et porte d'autres polypeptides extrieurs la membrane qui sont absents dans les bactries [18]. Le complexe semble fonctionner partout sous forme de dimre. Le dessin ne reprsente que la charpente des polypeptides l'exclusion des chanes latrales d'acides amins. Les trois sous-units sont figures ensemble en II, soit le cytochrome b, la partie fer-soufre (lISP, avec [2Fe-2S]) et la partie c1 ont respectivement 42, 22 et 27 kDa. Les autres chanes reprsentent environ 154 kDa au total dans le complexe bovin (ajoutes en III). Les bc1 sont donc les intermdiaires obligs entre les quinones respiratoires (ubiquinones) et le cytochrome c. La rduction d'une quinone en quinol, puis sa roxydation par un cytochrome bc1 donne lieu par elle-mme une conservation

1 LA COLLECTE DE L'NERGIE

35

d'nergie. On l'explique aisment par la disposition asymtrique du donneur et de l'accepteur dans la membrane, soit d'un ct une dshydrognase et de l'autre le complexe bc1 ou tout autre accepteur.
[2 Fe2 S]

hme C extrieur hmes B

intrieur

cytochrome b cytochrome c1

I
I : cyt. b et c1 seuls (sans hmes) II : aprs addition de l'ISP III : monomre complet

II

III

Monomre bc1 mitochondrial


La rduction complte de la quinone consomme deux protons, la roxydation les restitue. Si par suite de cette asymtrie, la rduction a lieu prs de la face interne de la membrane et sa roxydation du ct externe, le cycle des quinones produira chaque tour un flux net vers l'extrieur de deux protons pour deux lectrons, en faveur d'un potentiel de membrane (une p).
face externe UQH2 2 H+ accepteur

donneur face interne 2 H+

UQ

Le cycle ractionnel du complexe bc1 permet d'augmenter ce bilan. L'oxydation de l'ubiquinol se fait en deux tapes avec passage par le stade semiquinone, et envoi chaque fois d'un lectron vers les deux hmes B, puis au noyau fer-soufre de l'ISP (la protine de RIESKE), et enfin l'hme C de la sous-unit c1. la fois l'ISP et la sous-unit c1 sont ancres la membrane par des hlices alpha, mais leurs parties

36

BIODGRADATIONS ET MTABOLISMES

essentielles dbordent largement vers l'extrieur 12. Le cytochrome c1 occupe donc la sortie. Il entre en contact avec l'accepteur final du complexe qui est un cytochrome c faible masse molculaire. Chose intressante, l'ISP porte son noyau fer-soufre dans une tte porte par un axe flexible, et l'on pense qu'elle peut basculer alternativement du cytochrome b vers la partie c1. Les deux hmes B sont dsigns habituellement dans la littrature par bL et bH (L et H pour low et high potential). Ils sont orients l'un au-dessus de l'autre peu prs perpendiculairement au plan de la membrane et se distinguent par leurs proprits 13. Le premier est un b566 bas potentiel (-30 mV), l'autre (bH) est un b560 potentiel plus lev (+90 mV). Le fonctionnement du complexe est inhib par deux sries d'agents qui se lient des endroits diffrents : l'antimycine et le HQNO d'une part, le myxothiazol, la stigmatelline et le MOA-stilbne de l'autre. En outre la partie cytochrome b a deux sites o peuvent s'installer les quinones/quinols, l'un tant prs de l'extrieur (ct P ou ct positivement charg), l'autre de la face interne (ct N ou ngatif)... Le fonctionnement du complexe bc1 est encore controvers. Le cycle ractionnel appel cycle Q, propos par MITCHELL [19] est certainement rvisable mais ses grandes lignes font la base des discussions. Au dpart est une molcule de QH2 sur le complexe. Le modle est fond sur deux oxydations successives en 1 et 2 transformant QH2 en semiquinone puis en quinone.
2 H+ e QH2 QH2 Q 1 Q ct extrieur (P) 2 H+ e QH2 e Q 2 Q Q 3 face interne (N)

.
QH2

e QH2

Q e QH2 Q 4 2 H+ QH2 e Q e 5

Cycle Q (interprtation simplifie


La premire oxydation rduit l'ISP, la deuxime l'un des hmes B. Deux protons sont expulss. En 3, un hme B transmet un lectron l'autre, dans un ordre qui est controvers. Une quinone changeable avec la membrane est prsente. En 3 et 4, le processus se rpte et deux protons sont jects nouveau. Deux molcules de QH2 ont t oxydes et deux lectrons stocks sur le tandem des hmes B. En 5, ces deux lectrons sont rutiliss pour rduire une des deux 12 - Donc dans le priplasme pour les bactries Gram-ngatives, dans l'espace intermembranaire pour les mitochondries. 13 - Rappel : deux structures chimiques identiques, ici les hmes B, peuvent avoir des proprits physiques et ractionnelles diffrentes en fonction de leur environnement molculaire au sein de la protine, et diffrentes de celles qu'elles auraient en solution.

1 LA COLLECTE DE L'NERGIE

37

molcules de quinone en quinol QH2, l'autre tant change avec la membrane. Tout se passe donc comme si l'une des deux molcules de QH2 traites tait rgnre sous sa forme initiale. Au point de vue bilan, une molcule de quinol a t oxyde avec envoi de 2 lectrons un par un sur l'ISP, 2 protons ont t prlevs dans le cytoplasme et 4 protons ont t jects. Le cycle Q est dfendu notamment par TRUMPOWER et associs [20]. Pour d'autres chercheurs, en particulier HATEFI, une rvision du cycle Q comme modle s'impose nanmoins [21]. Une proprit capitale du bc1 est de pouvoir fonctionner de faon rversible. Dans le sens de l'oxydation d'un quinol par le cytochrome c, il gnre un gradient de protons. Inversement, par le retour de protons du ct extrieur vers l'intrieur, il engendre un courant d'lectrons en sens inverse vers la rduction des quinones. Il y a donc utilisation de la p pour renvoyer les lectrons vers des valeurs plus ngatives du potentiel, une disposition particulirement importante dans le mtabolisme des autotrophes. Le cycle Q a t pass au crible des tudes cintiques utilisant des inhibiteurs. L'antimycine et le myxothiazole avaient t supposs initialement se comporter comme des analogues des quinones et quinols. La premire s'installerait du ct N et l'autre du ct P, ceci en considrant l'existence des deux sites de fixation (QH2 et Q) comme explicit antrieurement. Le site quinonique plac du ct P (extrieur, prs de ISP) permettant la fixation QH2 n'a pas t localis sur les structures dtermines par cristallographie, et son existence est conteste. En outre la cintique du courant d'lectrons inverse, en partant de ISP et c1 pralablement rduits, indique un transfert d'lectrons de bL vers bH. Le transfert des lectrons partir de l'ubiquinol aurait donc lieu de bH vers bL, en sens contraire de celui qui tait prvu par le modle du cycle Q. La tendance est de considrer que les inhibiteurs ne prennent pas la place des quinones, mais contribuent verrouiller la structure en empchant les mouvements ncessaires l'accomplisement du cycle.
IPS (Fe/S)

N N

N N

c1 ct P +++++++++

++++++++
N N N N

bL

N N

N N

bH

ct N

Modle simplifi du complexe bc1

Les changements conformationnels au cours du cycle sont devenus vidents grce aux indications convergentes de la cristallographie, de l'analyse gntique, des mesures spectrales et cintiques [22]. L'un d'eux parat admis par tous les auteurs. La sous-unit ISP avec son noyau fer-soufre possde l'extrieur de la membrane une tte porte par une tige flexible, qui l'amne tantt dans le voisinage de bL, tantt vers le cytochrome c1. On peut comprendre l'importance de ce mouvement de la faon suivante. Quand deux lectrons arrivent en provenance du quinol membranaire (QH2), la partie flexible ISP s'carte en direction du cytochrome c1 ds

38

BIODGRADATIONS ET MTABOLISMES

qu'elle a reu un premier lectron. Le mouvement empche le deuxime lectron de suivre le mme chemin et permet son envoi vers la paire des hmes (bH/bL). Celle-ci peut stocker deux lectrons en tout, soit un sur chaque hme. En somme quand le quinol cde ses lectrons, l'un va d'un ct (sur ISP), le second de l'autre ct sur la paire bH/bL. Cet aiguillage est essentiel pour que le cycle effectue un deuxime tour, augmentant le nombre de protons relchs vers l'extrieur, soit quatre en tout au lieu de deux. Des mouvements plus compliqus du complexe sont envisags, en particulier dans l'association au sein du dimre. Divers spcialistes considrent les cytochromes complexes bc1 comme les reprsentants d'un dispositif molculaire ancestral de valeur universelle, appartenant une chane respiratoire primitive, dont le plan se retrouve chez les eubactries et les archaebactries : une courroie de transmission gnratrice d'nergie lectrochimique entre quinones rduites et oxydase terminale.

1.6 - OXYDASES RESPIRATOIRES TERMINALES


Les oxydases terminales reoivent les lectrons d'une chane de transporteurs respiratoire, et catalysent la raction : O2 + 4 e + 4 H+ 2 H2O. L'oxygne parvient par la face cytoplasmique de la membrane bactrienne. Le donneur direct est un cytochrome c ou une quinone respiratoire rduite ou quinol. Ces enzymes se rpartissent donc en cytochrome c oxydases et quinol oxydases. En outre la plupart des oxydases respiratoire effectuent une translocation de protons couple la rduction d'O2 et autorise une conservation d'nergie sous forme de potentiel membranaire. La cytochrome c oxydase ou cytochrome aa3 des mitochondries animales ou de levure appartient la membrane interne et ne renferme pas moins de 13 sous-units diffrentes, numrotes par ordre de mobilit croissante l'lectrophorse. Les bactries n'ont en gnral que les trois premires (I, II et III), qui sont les sous-units fondamentales trouves chez tous les tres vivants. Les parties I et II sont essentielles au transfert des lectrons, tandis que la III est surtout stabilisatrice au niveau de la membrane. Celles des mitochondries sont codes par l'ADN des particules que l'on sait avoir driv de lointains procaryotes. Les cytochromes c oxydases de Paracoccus denitrificans et Rhodobacter sphaeroides ont servi de bons modles d'tude. Elles sont associes une chane respiratoire dont le plan est grosso modo calqu sur celui de la mitochondrie, o l'ubiquinone rduite est roxyde par l'intermdiaire d'une chane de cytochromes bc1 et c. Les quinol oxydases sont au bout d'une chane plus simple et ne sont pas toujours conservatrices d'nergie par translocation de protons. Leur fonction peut consister ponger rapidement l'excs d'O2 dans les conditions de plthore d'nergie ou lorsque l'oxygne en excs se montre toxique pour la cellule 14.

14 - L'activit des chanes respiratoires est souvent trs facile doser sur des suspensions de fragments de membrane par oxydation du NADH (test de la "NADH oxydase"). On peut, soit examiner la disparition du NADH 340 nm, soit utiliser un test colorimtrique base de DCIP et PMS, ou encore un sel de tetrazolium.

1 LA COLLECTE DE L'NERGIE

39

Les oxydorductions internes de l'oxydase respiratoire se font selon un dispositif commun moyennant quelques variantes. Dans les cas typiques, il existe 4 noyaux mtalliques : deux renferment du cuivre et sont dsigns par CuA et CuB, les deux autres sont hminiques. Donc deux 2 Cu et 2 Fe. Le noyau CuA peut tre bimtallique, avec deux atomes de Cu, ou tre absent. Le contenu est alors de 5 atomes mtalliques ou seulement de 3, et non pas quatre. La varit des situations est importante ce niveau et le dessin ne servira que de repre. La partie gauche symbolise les sous-units I et II dans un cytochrome aa3 dans la mitochondrie de la levure de bire, de Paracoccus denitrificans et de Rhodobacter sphaeroides . La partie droite reprsente le ba3 d'Acetobacter aceti, l'aa3 de Bacillus subtilis et le bo de E. coli. Les hmes sont symboliss par des traits noirs comme vus par la tranche, orients perpendiculairement au plan de la membrane.
n H+ ct extrieur Fe Fe CuB membrane ct cytoplasmique QH2 e Fe Fe CuB n H+

cyt. c Fe

CuA e

II

II

n H+ Cytochrome c oxydase

n H+ Quinol oxydase

Les deux types d'oxydases terminales


Les sigles tels aa3 et bo, font rfrence la nature des deux hmes de la sousunit I. C'est l que se font la rduction de l'oxygne et la translocation de protons. Ces hmes sont de type A, O, B ou D selon les cas. Comme on pouvait s'y attendre, la structure des units I et II ancres la membrane a t fortement conserve dans l'volution. Dterminer la structure du complexe qu'elles forment ne fut pas chose facile, car il s'agit de protines membranaires trs insolubles difficiles cristalliser autrement qu'en prsence de dtergent et de facteurs trangers comme des anticorps. La structure des oxydases aa3 dans les mitochondries bovines et Paracoccus denitrificans est maintenant connue en dtail et constitue un pas important pour comprendre le mcanisme de ces tonnantes machineries molculaires [23]. Les lectrons arrivent du ct priplasmique et sont livrs un un par le cytochrome c sur la partie II qui dpasse hors de la membrane. Deux lectrons sont provisoirement emmagasins au niveau de CuA grce au deux ions cuivre qui sont rduits en Cu(I). Le cheminement se fait par l'hme A hexacoordonn dans la partie II, puis vers l'hme A3 penta-coordonn 15. Le fer de celui-ci est 4,5 de CuB. Il forme avec celui-ci une paire mtallique diamagntique (pas de signal en On mesure alors essentiellement la NDH. Le test est stimul par le cyanure, qui supprime la comptition avec le reste de la chane respiratoire en aval et oblige tous les lectrons aller vers les colorants. Chez les bactries dtentrices d'un bc1, on peut mettre en vidence l'oxydation de l'ascorbate ou du TMPD par la partie aval de la chane. 15 - Hexa-coordonn : 6 liaisons dont 4 dans le plan de la porphyrine, et deux perpendiculaires de chaque ct. Penta-coordonn : la sixime position est libre et peut s'tablir avec un ligand tranger.

40

BIODGRADATIONS ET MTABOLISMES

RPE) et constitue la zone essentielle o s'effectue la rduction de l'oxygne. On a dcouvert un site supplmentaire recevant un mtal divalent (M2+), comme le calcium, le magnsium ou le manganse, dont la fonction reste inconnue. Les pices I et II de la cytochrome oxydase traversent la membrane par une fort d'hlices alpha hydrophobes au sein desquelles s'effectue le passage des protons. Il faut 4 protons prlevs du ct interne pour former aprs rduction d'O2 les deux molcules d'eau. Un nombre de protons supplmentaires estim 4 sont exports de l'intrieur vers l'extrieur, pendant que 8 lectrons sont reus et rduisent O2 en 2 H2O. Le flux total est donc de 8 protons prlevs l'intrieur et 4 mis l'extrieur, la diffrence de charges ainsi cre tant la base de la conservation de l'nergie lie l'oxydorduction.

II
Met Cys CuA His His Cys Glu M2+ CuA CuB

site O2 membrane His His CuB Tyr His His His His a3 a

hme a hme a3

Parties I et II de l'oxydase de Parococcus denitrificans


Un travail exprimental important a t effectu depuis la dcouverte de cette translocation de protons par WIKSTRM [24] et a conduit dterminer la voie de passage probable des protons travers le systme, la translocation tant actionne l'vidence par des changements alterns de conformation de tout l'difice chaque cycle ractionnel. Les quinol oxydases fonctionneraient sur le mme principe. L'oxydase bo de E. Coli a une sous-unit II homologue de celle de Paracoccus sur le plan structural, mais n'a pas de cuivre. Les lments rducteurs sont achemins par une ubiquinone (UQ8) qui oscille entre tat oxyd et rduit en passant par un stade radicalaire (semiquinone), les lectrons tant transmis un par un.

1 LA COLLECTE DE L'NERGIE
4 e 4H+ cyt. c 4 e CuA 4 H+ 4 e hme A3 4 e hme A O2 2 H2O 4 H+ 4 H+ CuB O2 2 H2O

41

cytochrome c

Cytochrome c oxydase

4 H+ (chimie)

4 H+ (translocation)

Le cycle catalytique de l a cytochrome oxydase [25] est indiqu ici de faon simplifie. Les symboles O, R H ont t maintenus pour faire le lien avec la littrature scientifique. Dans les rectangles, le tandem Fe-Cu symbolise le couple bi-mtallique form par l'hme a3 et le CuB dans le site actif.

O
H2O H+ Fe(III) Cu2+ e e

H
Etats successifs O : oxyd R : rduit 2 lectrons A : fixation de O2 sur Fe(II) P : stade "peroxy" F : stade "oxoferryl" H : stade "hydroxy"

Fe(III) Cu2+ OH H+

Fe(II) Cu+ O2

Fe(II) Cu+ e O=O

Fe(IV) Cu2+ O2 H2O 2 H+ Fe(III) Cu+ O O e Fe(III) Cu2+ O O

Cycle de la cytochrome c oxydase

42

BIODGRADATIONS ET MTABOLISMES

Une des principales difficults est l'identification des tapes de changement de conformation que l'on crot tre responsables de la translocation des protons. On voit que le tandem Fe/Cu est d'abord pleinement rduit l'tat R, et que l'oxygne se fixe ensuite sur l'hme A3 au niveau du fer 16. Au stade P, l'oxygne diatomique est rduit au niveau peroxyde. Aprs l'arrive d'un troisime lectron, la liaison entre atomes d'oxygne est rompue. L'opration est une sorte de dismutation : il y a d'un ct une rduction deux lectrons qui donne une molcule d'eau, le groupe restant est oxyd en donnant le stade F. Un quatrime lectron rduit celui-ci en H, et l'hydroxyle est limin sous forme de la deuxime molcule d'eau. Nous avons donc 4 lectrons arrivant dans le cycle en ordre dispers, production de 2 molcules d'eau avec entre de 4 protons, qui sont prlevs du ct interne. Les 4 protons supplmentaires soumis translocation ne sont pas inscrits sur le diagramme. quels stades la translocation a-t-elle lieu ? En se fondant sur les donnes spectroscopiques, il a t prouv que des changements de conformation ont lieu au cours du cycle, chaque transition tant couple une jection de protons dans un seul sens [26]. Un seul serait mis lors de la rduction de O vers R, deux au cours de la transition de P F, et un dernier de F O. Pendant que fonctionne cette subtile mcanique, chaque molcule d'O2 atteint le noyau Fe/Cu par un chenal qu'on crot avoir identifi dans la structure, tandis que les molcules d'eau s'chappent l'oppos par un autre chenal. Nanmoins la nature des changements de conformation pendant le cycle est controverse et l'existence de changements structuraux d'ensemble a t conteste. KANNT et coll. ont prsent un modle labor qui ne fait appel qu'aux changements d'ionisation de plusieurs groupes [27]. Tout ceci est un schma moyen qui ne s'applique pas exactement aux quinol oxydases. Le cytochrome bd de E. Coli est une ubiquinol oxydase spciale ne contenant que deux sous-units et trois noyaux mtalliques comprenant les hmes b558, b595 et D. Son fonctionnement est radicalaire (lectron par lectron) comme celui du cytochrome bo [28]. L'architecture de la protine est diffrente, sa ligne volutive est distincte, et sa rsistance des inhibiteurs comme le cyanure ou l'azoture est plus marque.
quinol oxydases dshydrognases D-lactate L-lactate succinate NADH pyruvate L-proline glycrol-P OH Cu2+ b562 FAD FMN Fe/S OH O b558 b595 d
NO3

o555 O2

NO 3 b 556

nitrate rductase

Chanes respiratoires de E. coli

16 - Rappel : l'oxygne diatomique est li dans les porphyrines par le fer ferreux, comme dans l'hmoglobine.

1 LA COLLECTE DE L'NERGIE

43

Un caractre saillant des chanes respiratoires bactriennes arobies est leur multiplicit dans une mme cellule. Diffrentes voies sont utilises en parallle ou en alternance en fonction des conditions. Le poste d'aiguillage est au niveau des quinones respiratoires loges dans la membrane et constituant l'tat rduit un rservoir d'lectrons jouant le rle de tampon entre les substrats oxyds en amont et les accepteurs en aval. Le colibacille offre le cas le plus simple. Les lectrons sont prlevs par les dshydrognases sur des substrats varis et canaliss sur l'ubiquinone. La forme quinol (ou semiquinone, non figure) est roxyde en arobiose vers une quinol oxydase, sans passer par un cytochrome c. Les bactries renferment plusieurs dshydrognases membranaires ragissant avec les quinones, comme celles du lactate, du succinate et autres. La plus importante est la NADH dshydrognase, ou NDH. Ce systme est particulirement complexe et ne contient pas moins de 14 sous-units, si on en juge par le nombre des gnes et de polypeptides identifiables. Les cofacteurs sont FMN, non li de faon covalente, et au moins 8 noyaux fer-soufre de type [2Fe-2S] et [4Fe-4S]. Le passage des lectrons s'accompagne d'une translocation de protons, une situation qu'on retrouve dans la NDH mitochondriale, appele site I, et qui est encore plus complexe puisqu'elle n'a pas moins de 42 sous-units! Du ct oppos de la chane, l'aiguillage des quinones favorise la quinol oxydase bo en milieu fortement ar dans une population soumise des divisions rapides. La voie de la quinol oxydase bd (cytochrome bd) prend la relve en oxygne limitant ou en culture surpeuple. Ce cytochrome possde une affinit trs leve pour l'oxygne par rapport au cytochrome o 17. En outre la voie de l'oxydase bd n'est inhibe par le cyanure qu' des doses 100 fois plus fortes (de l'ordre de 0,5 mM). L'emploi en parallle de ces deux systmes arobies est rgul avec prcision au sein de la bactrie. La surpopulation et la baisse de l'oxygne disponible induisent la synthse du cytochrome bd et rpriment celle du cytochrome bo. Le systme rgulateur deux composants ArcB/ArcA participe au contrle. Comment ? Chez E. coli, ArcB fait deux choses, dtecter la chute du potentiel d'oxydorduction dans la cellule lorsque O2 devient limitant, et se phosphoryler elle-mme en ArcB-P l'aide d'ATP. La protine est ancre dans la membrane et dpasse vers l'extrieur. Sa squence de 778 acides amins chez E. coli est symbolise sur le schma comme une succession de domaines 18. Une petite structure rpte note PAS* est courante dans ce genre de rcepteur. La phosphorylation se fait sur un premier site not H (pour histidine) la position 292. Le phosphate est transmis sur un second site not D (pour aspartate) en 576, ou directement sur la protine ArcA. Le phosphate peut aussi gagner l'autre bout de la squence, en un site H la position 717. Celui-ci peut aussi phosphoryler ArcA. En somme ArcA devient ArcA-P la position D en 54, par deux voies diffrentes. ArcA-P se lie par un domaine terminal l'ADN et fonctionne comme rgulateur de transcription [29].

17 - Son coefficient Km pour l'oxygne est 0,38 M, contre 2,9 M dans le cas du cytochrome o. 18 - La structure de la protine est constitue de plusieurs modules articuls entre eux et replis chacun de faon plus ou moins autonome (comme s'il y avait un chapelet de plusieurs protines diffrentes plus petites).

44
ADP ATP P

BIODGRADATIONS ET MTABOLISMES

P D 576

P H 717

ArcB

H 292 PAS tat mtabolique dfavorable P

778

taux faible de O2 chute du potentiel redox

ArcA

D 54

se lie l'ADN

Le systme ArcB/ArcA du colibacille


ArcB est une sorte de capteur qui transmet son signal en agissant comme kinase sur lui-mme, puis sur ArcA. En somme, ArcB sert de dtecteur et rpercute les signaux sur ArcA comme activateur de transcription. La zone PAS aurait un rle dans la dtection du manque d'oxygne, mais il n'y a aucune certitude sur le mcanisme. Une fois phosphoryl, ArcB-P active une collection d'oprons impliqus dans la physiologie de lanarobiose : synthse de dshydrognases flaviniques ; induction d'enzymes de la bta-oxydation des acides gras ; modification de la carte enzymatique du cycle de KREBS et de la voie appele "shunt glyoxylique" ; inhibition de l'amorage de la rplication de l'ADN ; remplacement du cytochrome terminal bo par le cytochrome bd. Tous les gnes concerns correspondent un rgulon*. Parmi les oprons ainsi rguls sont cyoABCDE et cydAB qui codent respectivement pour les quinol oxydases bo et bd, comme indiqu un peu plus loin. Une rgulation supplmentaire dtecte la fois la disparition d'O2 et la prsence du nitrate. Elle est sous la dpendance de protines rgulatrices telles que FNR 19 et Nar, que nous retrouverons en examinant la dnitrification, celle-ci tant une respiration de remplacement quand l'oxygne fait dfaut. De faon gnrale, les protines rgulatrices telles que ArcB-P ou FNR interviennent sur la transcription des gnes en se liant sur l'ADN au voisinage immdiat ou petite distance des gnes concerns. La figure montre qu'une diminution de l'oxygne favorise le recours l'oxydase bd code par cydAB et met en veilleuse l'autre oxydase. L'anarobiose inhibe la synthse des deux oxydases devenues inutiles. L'activateur FNR entre alors en lice et induit la nitrate rductase ncessaire la respiration sur nitrate. Nous verrons que FNR est un rgulateur majeur du passage l'anarobiose. Le dessin rsume le principe de ce double contrle. La baisse du taux d'O2 favorise 19 - FNR = "fumarate-nitrate-reduction".

1 LA COLLECTE DE L'NERGIE

45

la phosphorylation de ArcA, active la sortie de l'une des oxydases et refoule la synthse de l'autre.
arcB ArcB O2 + O2 ArcB ArcA arcA

P ArcA

+
cydAB

cyoABCDE

enzymes diverses du mtabolisme anarobie

FNR fnr + O2 O2

FNR

ArcA/ArcB, FNR
En absence d'oxygne, FNR active la production de diverses enzymes du mtabolisme anarobie, rprime ici la sortie des deux oxydases devenues inutiles. En outre FNR rprime en permanence sa propre synthse, ce qui fait que cette protine rgulatrice reste taux faible dans la cellule. Nous retrouverons FNR propos de la dnitrification. Cette protine agit la fois comme capteur dans la dtection d'O2, et comme rgulateur de transcription. Nous finirons par un deuxime modle qui sera celui de Paracoccus denitrificans. Il atteint un niveau de sophistication lev, car ces bactries sont adaptables toutes sortes de conditions quand elles oscillent entre l'arobiose et l'anarobiose.

c mthylamine mthanol formaldhyde formiate FMN Fe/S OH Fe/S c552 OH O b c1 amicyanine mthylamine c550 b b3

Cu2+ Cu2+

O2

a a3 cytochrome c oxydases

NADH

complexe bc1

Cu2+ b a3 quinol oxydase

Paracoccus denitrificans en arobiose

46

BIODGRADATIONS ET MTABOLISMES

Elles sont capables de rduire des nitrates et autres oxydes d'azote (nitrites, NO, N2O), oxyder l'hydrogne molculaire et se dvelopper sur des substrats monocarbons (mthanol, mthylamine). Cette espce est donc mthylotrophe. Le dessin montre la chane de transfert des lectrons allant de gauche droite partir de divers donneurs, transmis par NADH, le complexe NADH dshydrognase (marqu FMN-Fe/S), les quinones, le complexe bc1, des cytochromes c, des oxydases terminales. L'originalit est ici la prsence simultane en arobiose de cytochrome c oxydases et de quinol oxydases. Deux portes de sortie sur le dioxygne. Les pices supplmentaires par rapport aux transferts d'lectrons du colibacillle sont le complexe bc1 et plusieurs cytochromes c. Toutes ces relations fonctionnelles ont t dtermines par la slection de mutants [30]. Comme dans le colibacille, une oxydase affinit plus faible pour O2 est la principale utilise quand l'oxygnation est forte (aa3), tandis que la cbb3 est davantage synthtise dans les conditions inverses. Un aiguillage important est le cytochrome c552. La quinol oxydase ba3 correspond la bo de E. coli. Pourquoi une troisime oxydase ? Une hypothse est de la considrer comme une valve rgulatrice, qui permet de dsengorger la rserve des quinones rduites lorsque les oxydations sont trop intenses en amont [31]. Une autre particularit est la synthse en prsence d'une mthylamine dshydrognase qui produit du formaldhyde et de l'ammoniac. Est induite galement une petite protine contenant du cuivre, l'amicyanine, qui rduit les diffrents cytochromes c. La dichotomie des chanes respiratoires se rencontre chez les Pseudomonas et espces relies, qui se caractrisent par une gamme immense de potentialits dans les biodgradations de substrats trs nombreux. La plupart des espces qui privilgient la vie arobie sont munies d'une voie contenant un complexe bc1, un cytochrome c et une cytochrome oxydase. Une chane de cette sorte, qui rappelle celle de la mitochondrie, est typiquement inhibe par l'antimycine A. En outre elle est facilement repre par un test microbiologique courant, qui consiste vrifier l'oxydation du TMPD, avec apparition d'une zone colore en bleu violet autour des colonies sur bote glose. Cette raction caractrise les espces "oxydasepositives" et dnote la prsence d'un cytochrome c. En conclusion, nous constatons un formidable pouvoir d'adaptation aux conditions de vie arobies et une multiplicit de solutions aux problmes poss. La principale fonction est la rcupration d'nergie mais ce n'est pas la seule. Les oxydases terminales ont aussi pour rle d'ponger l'oxygne excdentaire afin d'en viter les effets toxiques.

1.7- PHOTOTROPHIE NON-OXYGNIQUE


Le principe de la photosynthse est connu de tous les biologistes. Il est gnralement dcrit en dtail dans le cas des vgtaux verts pour des raisons videntes. La photosynthse des procaryotes a des caractres particuliers mais garde la mme finalit. L'nergie lumineuse capte par des pigments fait apparatre des

1 LA COLLECTE DE L'NERGIE

47

entits assez rductrices pour l'assimilation du dioxyde de carbone. Nanmoins les modalits de la photosynthse des plantes et des algues ne sont pas extrapolables telles quelles aux procaryotes. Deux cas de figure bien nets sont observs chez ces derniers. Le premier est une photosynthse non oxygnique parce que l'eau n'est pas un donneur d'lectrons. Elle fonctionne essentiellement en anarobiose. Le second est la photosynthse oxygnique pratique par les cyanobactries. Le principe est en gros celui qu'utilisent les plantes mais avec des modalits originales. On le laissera de ct provisoirement. Les bactries phototrophes sont souvent strictement anarobies, mais certaines espces montrent une plus grande tolrance O2 et acceptent parfois l'arobiose complte. La plupart peuvent utiliser comme source d'lectrons l'hydrogne et diverses entits minrales comme le soufre et les sulfures, ou encore des composs organiques. L'assimilation du gaz carbonique permet au plus grand nombre de vivre en autotrophie. Ce sont donc des photo-autotrophes. Le pouvoir rducteur n de l'nergie lumineuse ne sert pas qu' rduire le dioxyde de carbone, mais peut se voir diriger vers la rduction de certains composs organiques. Les bactries photosynthtiques forment un ensemble htrogne aux potentialits complexes et varies dans les eaux douces ou marines. On les trouve en abondance dans les mares et les tangs, les mangroves, dans les milieux non brasss mais exposs la lumire. Le tableau offre quelques points de repre. Grand groupe
I - Pourpres sulfureuses

Proprits
Anarobies strictes, autotrophes par cycle de CALVIN, utilisent H2, le soufre, les sulfures. Accumulent des granules de soufre intra-cellulaires. Flagelles Anarobies mais supportant parfois une certaine arobiose, autotrophes par cycle de CALVIN, utilisent H2, des composs organiques. Htrotrophie possible la lumire ou avec O2 l'obscurit. Flagelles. Sensibles aux sulfures. Anarobies strictes, autotrophes par cycle spcial des acides tricarboxyliques, utilisent H2, le soufre, les sulfures. Chlorosomes. Croissance possible en lumire trs faible. Anarobies ou arobies photo-htrotrophes, utilisent des sulfures et composs organiques, mobiles par glissement dans les sources chaudes, ont des chlorosomes.

Types
Chromatium, Thiospirillum, Thiocapsa (-protobactries) Rhodobacter, Rhodospirillum, Rhodopseudomonas (-protobactries) Chlorobium, Pelodictyon

II - Pourpres non sulfureuses

III - Vertes sulfureuses

IV - Vertes non sulfureuses

Chloroflexus

V - Hliobactries Anrobies strictes proches des Gram-positives, photo-htrotrophes, vivent dans le sol dessch et non sulfureux des rizires [32]

Heliobacterium, Heliobacillus, Heliochlorum

Ces diffrentes catgories sont gnralement bien dcrites dans les manuels de microbiologie, mais il a fallu ajouter rcemment un nouveau groupe rassemblant des espces trs htrognes. On y relve un nombre important d'-protobactries marines qui prennent une part notable, peut-tre de 5%, la photosynthse

48

BIODGRADATIONS ET MTABOLISMES

du picoplancton des ocans [33]. Ce sont donc des arobies plus htrotrophes qu'autotrophes. Aucune n'utilise l'eau comme donneur d'lectrons et aucune ne libre de l'oxygne. Elles utilisent des composs soufrs et surtout des composs organiques. La dcouverte tonnante de ces organismes sans liens taxonomiques les uns avec les autres a t facilite par des techniques fluorimtriques perfectionnes autorisant l'identification prcise des pigments chlorophylliens. Toutes ces bactries sont surtout des photo-htrotrophes qui se servent d'O2 pour oxyder des matires organiques. D'autre part la prsence d'oxygne serait ncessaire la synthse de la chlorophylle. Il y a donc une sorte de paradoxe. Quel est le rle de la lumire? Il est probable que le bas potentiel gnr est utilis pour rduire des molcules organiques en composs qui seront oxyds ensuite par l'oxygne. En somme il s'agirait de tirer une meilleure nergie des oxydations en partant de substrats rendus un potentiel plus bas qu'au dpart. Les bactries de cette catgorie ont souvent moins de pigments chlorophylliens et davantage de carotnodes* que les bactries phototrophes anarobies, sans doute parce que leur mtabolisme ne dpend pas uniquement de la lumire. On les considre provisoirement comme capables de jouer simultanment sur les deux tableaux au cours de l'clairement diurne, par un mtabolisme mixte la fois autotrophe et htrotrophe [34]. Il est devenu clair que ces espces participent avec les cyanobactries l'conomie carbone des ocans. Leur dcouverte tend remettre en cause les modles climatiques et la prise en compte du cycle du carbone. Leur intervention dans les biodgradations reste cependant dterminer. Nous revenons maintenant aux phototrophes les plus classiques, savoir les bactries pourpres et vertes des lignes I III. Elles utilisent comme pigment rcepteur des bactriochlorophylles (BChl) trs proches des pigments utiliss par les plantes et contenant comme eux du magnsium comme mtal. La plus commune est la bactriochlorophylle a, qui drive de la chlorophylle a des vgtaux par des modifications mineures. D'autres pigments, BChl b, c et d sont des variantes. Une longue chane latrale hydrophobe est faite par estrification avec un alcool insatur. Les pigments chlorophylliens sont gnralement accompagns de carotnodes. Ces pigments participent la collecte de la lumire, mais n'y sont pas essentiels, car des mutants bactriens sans carotnodes continuent faire une photosynthse malgr une plus grande fragilit aux conditions externes. Les carotnodes sont des anti-oxydants contre les radicaux libres ou l'oxygne singulet et participent une dfense contre O2. La nature des pigments et leurs relations avec les protines dterminent les caractristiques spectrales des rcepteurs. Ainsi les chlorophylles a et b des plantes absorbent dans le bleu au-dessous de 450 nm et dans le rouge, respectivement 680 et 675 nm, tandis que les bactriochlorophylles vont plus loin dans le rouge et le proche infrarouge : 805 et 850-910 pour la BChl a, et 840, 1020-1035 pour la Bchl b. Les carotnodes contribuent combler partiellement les trous du spectre par leur absorbance dans la zone des 450-510 nm. Les proprits spectrales ont d'importantes rpercussions sur le plan cologique. En effet les bactries pourpres et vertes, spcialises dans une photosynthse anarobie, se placent en milieu aquatique l'cart de la surface, sous les zones habituellement colonises par les vgtaux verts, les algues et les cyanobactries. Leurs caractristiques spectrales les aident capter

1 LA COLLECTE DE L'NERGIE

49

des tranches du spectre qui n'ont pas t arrtes par d'autres. Les bactries sulfureuses vertes adoptent une autre stratgie. Leurs chlorophylles spcialises absorbent dans la zone 715-760 nm, o la comptition est svre, mais compensent par une extraordinaire adaptation un clairement trs faible. En eau calme s'tablit une stratification thermique entre les eaux de surface, les mieux claires et les plus chaudes, et les eaux profondes, plus froides, enrichies par les manations sulfureuses des sdiments et pauvres en oxygne. Les bactries pourpres se tiennent au-dessous de la zone de transition appele thermocline. Leur rpartition s'tablit en fonction de la lumire, du taux d'O2, de celui du sulfure et des mati1,0 res organiques. Les zones cyanobactrie les plus sombres, totalement anarobies et riches bactrie en sulfure sont favorables pourpre aux sulfureuses vertes du genre Chlorobium. Cyano0,5 bactries, algues et vgtaux comme les lentilles d'eau (Lemna) s'tablissent au-dessus de la thermocline.
absorbance (u.a.)

400

600

800

1000

(nm)

Une telle rpartition dans les milieux aquatiques est rarement stable. Les perturbations sont de nature saisonnire ou mtorologique, le brassage des couches provoque une redistribution des germes et des constituants dissous, avec des remontes de matriaux venant du fond. Ce phnomne trs important, appel "upwelling", redistribue les matires organiques dposes sur le fond. Il s'effectue grande chelle dans les milieux marins. Le terme de photosynthse recouvre videmment deux phases. La premire est la collecte de la lumire et sa transformation en nergie chimique. La seconde est le mtabolisme d'assimilation de CO2 en molcules organiques et relve de la biochimie classique 20. Nous ne retiendrons ici que la premire pour ses caractres particuliers. La conversion de l'nergie lumineuse en nergie chimique sous forme d'un bas potentiel d'oxydorduction se fait dans des complexes membranaires dits centres ractionnels. Ces derniers sont entours par une nappe de pigments associs des protines et constituant l'antenne. L'ensemble form par un centre ractionnel et son antenne est dsign comme photosystme (PS) et les bactries non oxygniques n'en renferment que d'une seule catgorie. Grce aux pigments antennaires, une plus grande surface rceptrice est obtenue pour capter la lumire. Celle-ci engendre des excitons* qui convergent grande vitesse de pigment pigment jusqu'au centre ractionnel dans un laps de temps de l'ordre de la

20 - Le cycle de CALVIN est rsum en glossaire, l'exclusion du cycle rducteur des acides tricarboxyliques.

50

BIODGRADATIONS ET MTABOLISMES

picoseconde. L'ensemble de ces transferts n'est ralis que par une architecture molculaire trs stricte des complexes antennaires et du centre ractionnel. Celui-ci est charg de matrialiser un exciton sous forme d'un lectron potentiel trs rducteur. La conversion se fait alors au niveau d'une paire de molcules de bactriochlorophylle (BChl/BChl). Le mcanisme fondamental est celui de la sparation de charges. L'arrive d'un exciton (astrisque) se traduit par la sparation des charges positive et ngative dans la paire de Bchl. Un lectron est vacue dans une chane de transferts qui est d'abord interne au centre ractionnel laissant un trou (la charge positive) qui sera combl par retour d'une charge venant de l'extrieur.
* e cascade de transferts BChl/BChl* BChl+/BChl BChl+/BChl e (recharge)

BChl/BChl

Le trou form dans la paire de Bchl par le dpart d'un lectron se traduit par un affaiblissement du signal spectral dans la partie rouge lointain du spectre. Par exemple ce phnomne sobserve 870 nm chez Rhodobacter sphaeroides, et le centre ractionnel est dsign comme P870, tandis qu'un Chlorobium a un P840 et une plante verte un P700. La figure symbolise chaque centre ractionnel par un rectangle gris. Les potentiels rducteurs sont vers le haut. Les dimres de Bchl ayant reu un exciton (P870, P840)* sont ports un trs bas potentiel et amorcent un courant d'lectrons partiellement cyclique faisant retour aux dimres chargs positivement et ports un potentiel oxydant (P870+, P840+).
pourpres (et vertes non sulfureuses)
E' (mV)
1500

vertes sulfureuses P840* e A1 e

P870*
1000

Bph h QA QB e Q e c bc1 c2 NADH NDH p P840+ h

Fe/S

Fd MQ

e NADH bc1 p

500

P870+
+ 500

c553

source d'lectrons

e source d'lectrons

Bph - bactriophophytine QA, QB, Q, MQ - quinones transporteurs d'lectrons A1, Fe/S - noyaux fer-soufre Fd - ferrdoxine bc1 - complexe cytochrome bc1 NDH - NADH dshydrognase fonctionnant en courant d'lectrons inverse

L'nergie lumineuse apporte par un exciton fait jaillir le P870 et le P840 un niveau d'nergie suprieur qui amorce un courant lectronique visible dans les deux cas sur la figure, un peu comme fonctionnerait une photopile. Les lectrons ont deux destinations. La premire est de faire retour au niveau de base par un circuit ferm qui passe par un cytochrome complexe bc1 de mme nature que celui qui a t dcrit. Cette tape est capitale, car elle est translocatrice de protons et charge

1 LA COLLECTE DE L'NERGIE

51

le potentiel membranaire signal par p. L'nergie ainsi rcupre conduira une synthse d'ATP. La deuxime voie des lectrons sert rduire le NAD+ en NADH par la dshydrognase note NDH. Dans le cas des bactries pourpres, la sortie des lectrons se fait par quinones interposes (Q) un potentiel moins ngatif que celui du NADH. En consquence un courant d'lectrons inverse est ncessaire, actionn par l'nergie de la force protonmotrice p. Dans le cas des bactries vertes comme Chlorobium limicola, droite sur la figure, ce retour n'est pas ncessaire car les lectrons sortent du centre ractionnel par une ferrdoxine rduite un potentiel suffisamment ngatif (Fd). Il est vident que la synthse de NADH dans les deux cas dtourne une part des lectrons du circuit. La source d'lectrons extrieure est l pour combler le dficit. Il s'agit de l'hydrogne, des composs soufrs, et dans le cas des bactries pourpres de substances organiques. L'ensemble du dispositif met donc en jeu des molcules de pigments (BChl, Bph), des quinones, des complexes protiques (bc1, NDH), divers cytochromes c qui n'ont pas tous t indiqus. Les bactries vertes fonctionnent un potentiel plus ngatif que les pourpres, utilisent une ferrdoxine et font appel de prfrence une mnaquinone (MQ). Le centre ractionnel des bactries pourpres non sulfureuses, Rhodobacter sphaeroides et Rhodospirillum rubrum, est le mieux connu aprs les tudes cintiques, la dtermination de la structure [35] et l'usage de mutants. C'est une petite merveille molculaire. Chaque centre contient deux polypeptides fondamentaux, L et M (ou A et B) de structure similaire. Ils sont associs au dimre de BChl, et plusieurs pigments, des bactriophophytines (BphA, BphB) et bactriochlorophyles (BChlA et BChlB). Ils comportent aussi un ion Fe2+ et deux sites de fixation pour quinone (QA, QB). La prsence de peptides supplmentaires du ct cytoplasmique, comme H, n'est pas gnrale. Chez la plupart des espces sauf Rhodobacter capsulatus, le centre ractionnel est troitement associ du ct priplasmique un cytochrome c.
(Bchl)2 BchlB BchlA

L
BphB Fe2+ QB QA BphA

ct chane H et cytoplasme

Centre ractionnel de Rhodobacter sphaeroides

52

BIODGRADATIONS ET MTABOLISMES

Les lectrons retournent au cycle des oxydorductions par ce canal. La pice essentielle est videmment le dimre form des deux molcules de BChl dsignes dans la littrature par DA et DB. C'est l que se fait la sparation des charges, qui survient en quelques picosecondes aprs l'arrive de chaque exciton. Le croquis est une image simplifie du centre ractionnel de R. sphaeroides o seuls sont indiqus les chanes L, M, et leurs cofacteurs. Les autres cofacteurs forment deux chanes de transport d'lectrons vers le site QB, l'une tant utilise plus souvent dans L que l'autre. Les transferts sont trs rapides (infrieurs la nanoseconde). Les deux sites de fixation des quinones n'auraient pas la mme valeur. Une quinone en QA est fermement lie au complexe, alors qu'en QB elle apparat comme changeable avec les quinones de la membrane. Le rle du fer n'est pas clairement cern. La symtrie de l'ensemble n'est pas parfaite. Le cheminement prfr des lectrons est du ct L par BchlA et BphA, QA et QB. Cette dernire est le vritable point de sortie du pouvoir rducteur vers la membrane. Les quinones membranaires font partie d'une chane de transport d'lectrons analogue une chane respiratoire faisant appel un cytochrome bc1, qui effectue une translocation de protons hors du cytoplasme bactrien. Pour approvisionner le centre ractionnel en excitons, les antennes des bactries pourpres sont constitues de complexes LH (pour "light-harvesting") disposs tout autour par un assemblage qui est une autre merveille. Les LH sont de deux sortes. Les LH-1, appels aussi B875, entourent directement le centre ractionnel. Les LH-2 (ou B800-850) forment un ensemble priphrique d'importance variable en fonction des conditions. La structure d'ensemble prsente de profondes analogies dans tous les cas de figure, avec quelques variantes seulement [36] Les similitudes sont soulignes par les homologies de squence entre les polypeptides. Ces complexes ont une organisation rigoureuse de telle sorte que les excitons peuvent se transmettre de l'une l'autre trs grande vitesse jusqu'au centre ractionnel sans dissipation en chemin avec un rendement de 95%. La structure des LH est faite d'un multiple de paires o les chanes et sont organises en hlices alpha traversant la membrane. Ainsi dans chaque LH-1 de R. sphaeroides, chaque paire est associe 2 molcules de bactriochlorophylle et 2 molcules de carotnode, tous les dimres formant une couronne de 16 units autour du centre ractionnel. De la mme faon, les paires des LH-2 sont arranges en couronne avec un nombre dfini de molcules de pigment (3 BChl) [37]. Un nouveau croquis tente d'expliquer la nature des relations entre les complexes antennaires LH et les centres ractionnels o se fait la sparation des charges. En a, le centre ractionnel est symbolis comme vu latralement dans la membrane et on reconnat la disposition de la figure prcdente. En b, le plan de la page est celui de la membrane. Le dimre de BChl est symbolis par les deux petites barres noires et le signe +/. Les 16 sous-units de LH-1 entourent le centre ractionnel, les excitons voyagent rapidement d'un pigment l'autre vers le centre ractionnel qui les "traite" un un.

1 LA COLLECTE DE L'NERGIE
h cyt. c priplasme M BchlB membrane BPhB QB cytoplasme Fe H h LH-2 LH-1 QA DB DA L BchlA BPhA h
+/

53

II

centre ractionnel

a - Centre ractionnel

b - Complexes antennaires

Tout cet appareillage molculaire est mis en place selon des rgulations trs strictes obissant aux diffrentes conditions, et varie avec les espces. Ainsi chez Rhodopseudomonas capsulatus une chute brusque de l'intensit lumineuse entrane l'arrt de la croissance. De nouvelles synthses sont induites. Le nombre des centres ractionnels est multipli par 5, et la masse des pigments antennaires qui entoure chaque centre est double [38]. Il y a en mme temps augmentation d'efficacit gnrale de la collecte d'nergie lumineuse. L'acclration de la synthse concerne la fois la formation des pigments et des polypeptides associs. Les nouvelles molcules de protine s'assemblent dans la membrane autour des molcules de pigment pour former des complexes fonctionnels. Les bactries pourpres sont en gnral dpigmentes en arobiose et l'obscurit. Certaines espces continuent faire du pigment dans le noir complet condition qu'il n'y ait pas d'oxygne. Celui-ci est donc un facteur critique et l'appareil photosynthtique ne se dveloppe la lumire que si le taux d'oxygne est faible ou nul. La synthse de la bactriochlorophylle apparat comme l'opration la plus sensible l'oxygne, avec de grandes diffrences selon les espces. Rhodobacter capsulatus est trs arotolrant et fait encore un peu de pigment dans un milieu en quilibre avec l'air ambiant, tandis que Rhodospirillum rubrum n'en fait plus.

n H+

n H+

cytoplasme

ATP

priplasme extrieur ATP synthase chromatophore

Chromatophores

54

BIODGRADATIONS ET MTABOLISMES

Finalement, tout l'appareil photosynthtique des bactries pourpres est log dans des excroissances membranaires internes, de dveloppement plus ou moins grand avec les conditions, de forme variable selon les espces, appeles chromatophores (a), et disposes comme en b. Les protons rejets par les oxydorductions entrent nouveau en dterminant une synthse d'ATP. Nous n'voquerons que trs rapidement le cas des bactries vertes. Elles sont remarquables par leur phobie absolue de l'oxygne et leur capacit se dvelopper en lumire trs faible grce leurs chlorosomes contenant un pigment antennaire particulier (BChl c), polymris en grande quantit dans des btonnets membranaires. Les chlorosomes, symboliss par le diagramme b, apparaissent comme un sac allong d'une longueur d'environ 200 nm, bourr principalement de BChl c polymrise en cordons ou en btonnets. Les chlorosomes sont relis la face interne de la membrane par une plaque basale contenant de la BChl a et des protines organises en trimres appeles FMO dans la oligomre littrature 21. plaque basale
cytoplasme P840 protine FMO

Chlorosome

La bactriochlorophylle c n'est prsente que dans les chlorosomes. On estime que chacun contient plus de 200 000 de ces molcules, de telle sorte que le rapport serait de 10 000 20 000 BChl c par centre ractionnel. Les chlorosomes apparaissent donc comme les dispositifs antennaires les plus tendus et les plus performants connus pour capter la lumire. Les bactries vertes sulfureuses peuvent se dvelopper dans des eaux anoxiques profondes et riches en sulfure, o la lumire parvient difficilement sous la vgtation aquatique et les particules en suspension. Un certain nombre de protines des chlorosomes ont t rpertories, une dizaine au moins, parmi lesquelles trois sont en quantit majeure [39]. Ces antennes sont adaptables. Un mcanisme rgulateur supprime toute photosynthse en cas d'exposition des traces d'O2, et les trimres FMO seraient des valves charges de ce rglage [40]. Les excitons ns dans les chlorosomes parviennent en quelques picosecondes aux centres ractionnels par la plaque basale et les trimres FMO, et cette norme efficacit passionne de nombreuses recherches en biophysique, avec l'espoir de concevoir des modles artificiels. Chose curieuse, C. tepidum peut se passer de ses chlorosomes. Il suffit pour cela qu'une mutation empche la synthse de la BChl c. Les bactries ncessitent alors un clairement plus fort et leur photosynthse repose sur la BChl a et des carotnodes [41].

21 - Ou protines FENNA-MATTHEWS-OLSON, du nom des dcouvreurs. Elles sont absentes dans les bactries vertes non sulfureuses du type Chloroflexus.

1 LA COLLECTE DE L'NERGIE

55

Les centres ractionnels des sulfureuses vertes ont des analogies structurales avec ceux des bactries pourpres, notamment par l'existence de deux sous-units principales porteuses de cofacteurs assurant les transferts d'lectrons. Alors que chez les bactries pourpres existe une dissymtrie fondamentale (chanes L et M) portant deux voies de transfert, dont l'une est privilgie par rapport l'autre, le centre ractionnel de Chlorobium limicola ou de C. tepidum apparat comme symtrique. En effet il n'y a qu'un seul gne pour coder les deux parties essentielles. La structure de base est un homodimre auquel s'ajoutent plusieurs sous-units.

cytochrome c555 P840

priplasme A'0 BChla A'1 FB FMO FX A1 FA FMO A0 BChla FB FA

Centre ractionnel de bactrie verte sulfureuse


Deux voies de transfert d'lectrons partent du donneur primaire (le P840 constitu de deux BChl a), avec bactriophophytine (A0, A'0), des sites occups par des quinones (A1, A'1), un noyau fer-soufre (Fx) occupant la position o se trouve du fer chez les bactries pourpres. Du ct cytoplasmique se trouve une partie dtaille en B, construite comme une ferrdoxine, portant deux noyaux [4Fe-4S] et dsigns par FA et FB . Le centre ractionnel renferme 2 molcules de carotnode. De nombreuses molcules antennaires de BChl a (16 au total) l'entourent. Il est au contact de deux trimres FMO contenant 42 BChl a et placs au contact du chlorosome [42]. En conclusion de cette partie, nous voyons que les bactries photosynthtiques non oxygniques vivent le plus souvent sinon exclusivement en anarobiose. Leur importance dans les cycles naturels et les biodgradations est sans doute plus faible que celle des cyanobactries, par lesquelles nous terminerons ce chapitre. Mais elles nous aident sur le plan fondamental mieux comprendre les mcanismes de la captation de l'nergie lumineuse dans la photosynthse. Ces bactries reprsentent sans doute des dispositifs ancestraux, antrieurs la monte de l'oxygne dans l'atmosphre terrestre, et repris par les cyanobactries dont des formes cousines ont conduit aux chloroplastes des plantes. Les cyanobactries et les chloroplastes, support d'une photosynthse oxygnique, on copi la structure des centres ractionnels vus prcdemment. Cette photosynthse utilisant deux photosystmes diffrents, le PS1 et le PS2, driverait pour le premier du photosystme des bactries pourpres, et pour le second de celui des bactries vertes.

56

BIODGRADATIONS ET MTABOLISMES

1.8 - LES CYANOBACTRIES


Il n'existe probablement aucun endroit de la biosphre qui ne soit pourvu de cyanobactries. On les appelait algues bleu-vert, cyanophyces, cyanophytes. Elles ne font que ressembler aux algues sans appartenir cette catgorie, car ce sont des procaryotes. Leur importance, ou plutt celle des formes ancestrales des cyanobactries, semble avoir t colossale dans l'histoire de la vie. Les formes les plus anciennes remonteraient plus de trois milliards d'annes. Elles sont rvles par les stromatolites fossiles, figures feuilletes ou ondoyantes en pelures d'oignon inscrites dans la pierre. On en connat la signification parce que des formes vivantes quivalentes se trouvent sur la cte Nord-Ouest de l'Australie (Shark Bay). Les cyanobactries forment ces structures par alternance de prolifrations cellulaires et de dpts de carbonate de calcium. Une nouvelle couche se formait au-dessus, et ainsi de suite. Des stromatolites fossiles ont t dtects dans des terrains d'ge vari 22. Ces organismes ont t probablement les initiateurs de la photosynthse oxygnique, productrice d'oxygne molculaire. Ils n'taient sans doute pas les premiers faire une photosynthse. Ils auraient pris la relve d'organismes antrieurs qui devaient utiliser les ions ferreux et H2S comme donneurs d'lectrons, et auraient t l'origine des deux types de centres ractionnels appels PS1 et PS2. Une baisse de l'anhydride carbonique atmosphrique sous l'effet de la photosynthse a sans doute t le rsultat de leur activit, provoquant une diminution de l'effet de serre et un important refroidissement 23. Les chloroplastes des algues et plantes vertes sont les hritiers d'anciennes cyanobactries symbiotiques. Cette hypothse est corrobore par un large faisceau d'observations biochimiques et gntiques convergentes. Les cyanobactries les plus anciennes ont laiss leur signature chimique sous forme de bactriohopane-polyols (PHP). Ces produits servent rigidifier la paroi et sont souvent mthyls en position 2, tels les 2-mthylhopanes dont les cyanobactries actuelles ont pratiqueOH OH ment l'exclusivit au sein 21 de la microflore (R dsigne une partie glucidique).
H3C OH R
2 3 1

2-Mthylhopanes
22 - Les stromatolites fossiles bien conservs sont nanmoins peu communs. Il y en a dans le Trias en Allemagne (rgion de Hanovre). Un beau gisement prcambrien se trouve en Mauritanie prs d'Atar. Parmi les plus anciens se trouvent ceux du Canada. Les formations australiennes actuelles sont ctires et juste au-dessous de la limite des mares. 23 - Cette hypothse mise par JL. KIRSCHCINK et autres chercheurs californiens, est celle de le "Terre boule-deneige". Une longue glaciation aurait affect une grande partie du globe au Prcambrien jusqu' l'Ordovicien. Son origine est probablement plus complexe, ainsi que le rchauffement qui s'est accompagn d'une explosion de formes animales regroupant dj toutes les grandes lignes animales modernes.

1 LA COLLECTE DE L'NERGIE

57

Le noyau principal est peu de chose prs celui des strols eucaryotiques dont la structure est donc particulirement "ancienne", car des lipides de structure trs voisine ou gohopanes ont rsist au temps et ont t vus dans des schistes bitumineux gs de 2,5 milliards d'annes, jusqu'aux terrains sdimentaires du Tertiaire. Le noyau des hopanes est extrmement stable, rsistant la biodgradation, li du soufre et incorpor aux krognes, supportant un lger mtamorphisme avec des modifications mineures comme la rorientation du mthyle. Les cyanobactries forment un groupe d'organismes particulirement rsistants et adaptables toute sorte de conditions. La squence gnomique complte d'un Anabaena est disponible [43] ainsi que celle d'une espce, Nostoc punctiforme, remarquable par la diversit de ses habitats et sa capacit d'entrer en symbiose avec divers vgtaux [44]. Capables de supporter de grands carts de temprature et de salinit, les cyanobactries contribuent de manire importante la microflore des dserts et reprsentent une part majeure de la biomasse ocanique. Les espces les plus abondantes dans les ocans sont des Synechococcus unicellulaires et des Trichodesmium filamenteuses. Le picoplancton des ocans renferme des quantits prodigieuses de cyanobactries dans une zone comprise entre la surface et 100 m. Leur impact sur les cycles du carbone et de l'azote est probablement norme, non seulement par la photosynthse, mais aussi par l'assimilation de l'azote. Les cyanobactries sont galement trs communes dans les lacs, les eaux courantes et les sols. Les formes filamenteuses sont abondantes en zone littorale et dans les mers peu profondes. Une espce comme Nostoc commune est rpandue sur tout le globe, des rgions polaires aux rgions tropicales. Une autre forme, Cyanidium caldarium, peut se dvelopper dans des sources chaudes plus de 60-70C. Elles compensent leur multiplication plus lente par rapport d'autres organismes en exerant une comptition vitale acharne o est mise en jeu la fabrication d'une grande varit de substances vocation antibiotique. Une proprit commune aux cyanobactries et aux algues marines comme les Rhodophytes (algues rouges) est la synthse de composs halogns partir des chlorures, bromures et iodures de l'eau de mer l'aide de chloro- et bromoperoxydases [45]. Les cyanobactries prsentent un certain nombre de caractres essentiels rsums ici brivement. Leurs cellules procaryotiques vivent l'tat spar ou en filaments pluricellulaires selon les espces. Divers critres biochimiques, comme la prsence de peptidoglycanes, les rapprochent des protobactries. l'instar des vgtaux suprieurs, les cyanobactries ont deux photosystmes PS1 et PS2, mais ne contiennent que la chlorophylle a (pas de chlorophylle b comme chez les plantes). Les pigments antennaires sont constitus de chlorophylle et de phycobilines, qu'on ne retrouve que dans des groupes trs limits d'eucaryotes (algues rouges). Ces pigments participent la collecte de la lumire, et entrent dans la composition de complexes particuliers appels phycobilisomes. L'assimilation du gaz carbonique la lumire se fait par le cycle de CALVIN, et des particules intra-cellulaires spciales, ou carboxysomes, sont des rservoirs de la Rubisco*. Une anhydrase carbonique intracellulaire puissante jointe un transport du bicarbonate 24 permet aux

24 - Le gaz carbonique traverse facilement les membranes biologiques, la diffrence des ions.

58

BIODGRADATIONS ET MTABOLISMES

cyanobactries d'utiliser ce dernier comme source de carbone et de s'adapter aux milieux alcalins plus facilement que les algues vertes (voir DIC*). La photo-autotrophie est un rgime quasi obligatoire pour la majorit des cyanobactries. Elles n'ont gnralement qu'une aptitude limite consommer les substrats organiques carbons qu'on leur offre l'obscurit en culture. La vie htrotrophe en prsence d'oxygne, est possible chez certaines espces, mais ne donne lieu qu' une croissance lente, quelques exceptions prs comme Oscillatoria terebriformis, une espce thermophile qui peut survivre sans oxygne et l'obscurit en faisant une fermentation lactique du glucose ou du fructose [46]. L'htrotrophie des cyanobactries repose gnralement sur l'utilisation des rserves internes et facilite leur adaptation l'alternance entre le jour et la nuit On a tent d'expliquer cette proprit par l'absence de systmes de transport adquats ou d'enzymes cls du mtabolisme intermdiaire. En fait la situation relle parat plus complexe. Certaines cyanobactries tirent un bnfice de l'alternance jour/nuit, et paraissent adapter leur mtabolisme carbon l'absence de lumire [47]. Anabaena variabilis pousse lentement l'obscurit sur saccharose, glucose, fructose ou autres glucides [48], et des facilits du mme genre ont t maintenant reconnues dans plus d'une vingtaine d'espces. L'oxydation des glucides l'air en l'absence de lumire existe chez des espces spcialises qui utilisent de prfrence la voie des pentose-phosphates, le cycle de KREBS y tant gnralement incomplet par dfaut de la 2-oxoglutarate dshydrognase. L'enzyme essentielle est la glucose-6-phosphate dshydrognase, qui est active par oxydation et inhibe par rduction. Elle pourrait donc avoir une fonction rgulatrice dans un mcanisme de contrle dont l'oxygne serait le signal initial [49]. La dsactivation de l'enzyme en anarobiose obligerait les cellules concernes se rabattre sur une fermentation de survie produisant de l'ATP comme nergie de secours. De nombreuses espces rduisent l'azote atmosphrique et librent de l'hydrogne par la nitrognase, mais celle-ci craint la prsence d'O2. Une adaptation spciale consiste ne faire fonctionner la nitrognase que lorsqu'il n'y a pas d'oxygne. cela existent deux solutions majeures. La premire est de ne faire fonctionner la nitrognase qu'au cours de l'obscurit nocturne quand la photosynthse est arrte et ne produit plus d'O2. La seconde est de faire assimiler l'azote par des cellules spciales, appeles htrocystes, dont la diffrenciation met en jeu le rglage de plus de 60 gnes. Le mtabolisme y est modifi, la nitrognase y est induite et la production d'O2 est ramene au minimum par arrt du photosystme 2 (PS2). Les cyanobactries dans leur ensemble fabriquent une varit considrable de produits secondaires comme des toxines ou des terpnes volatils comme la gosmine et le 2-mthyl-isobornol qui sont connus pour donner dose infime un mauvais got l'eau. Les espces toxiques se trouvent surtout dans les eaux douces 25 en provoquant parfois des intoxications chez les animaux. L'anatoxine-a est un poison neuromusculaire produit par certaines souches d'Anabaena flosaquae, les microcystines sont des neurotoxiques de Microcystis aeruginosa [50]. La 25 - En milieu marin, les intoxications estivales des bords de mer par des floraisons intempestives d'"algues" sont dues principalement des dinoflagells.

1 LA COLLECTE DE L'NERGIE

59

nodularine est un pentapeptide de Nodularia spumigena. La structure dtaille de ces produits est connue [51]. Leur action toxique est de bloquer les protine phosphatases srine et thronine (PP-1, PP-2A) dont l'intervention est cruciale dans les rgulations mtaboliques cellulaires. Ces toxines sont le plus souvent des polypeptides structure cyclique comportant des acides amins inhabituels. Diverses toxines restent incompltement caractrises. Elles accompagnent des prolifrations priodiques constates dans des lacs ou tangs partiellement eutrophiss, et ont des effets dommageables sur la faune piscicole. La cyanobactrine est un compos de nature aromatique qui s'avre toxique une dose de 5 M pour d'autres formes cyanobactriennes et permet Scytonema hofmanni de se maintenir malgr la concurrence d'espces plus performantes. La cyanobactrine agit comme un herbicide naturel sur le photosystme 2 et fait sentir ses effets sur les plantes vertes. Un taux de 1 M suffit inhiber la prolifration des lentilles d'eau (Lemna gibba) [52], pourtant rputes trs envahissantes sur les plans d'eau. Enfin l'espce coloniale Microcystis flos-aquae est une forme abondante dans les lacs d'eau douce alcalins o elle prolifre volontiers au sein d'une gangue muqueuse de polysaccharides forte teneur en acide galacturonique. Elle contribue ainsi former ce qu'on appelle les "fleurs d'eau". Cette gangue fortement anionique fixe facilement des ions mtalliques et se comporte comme un agent glifiant aux proprits qui rappellent les pectines des plantes [53]. Retenons donc les cyanobactries comme des colonisateurs agressifs, capables de lutter contre la concurrence en s'aidant de substances toxiques ou antibiotiques varies, et de vivre dans une multiplicit de milieux difficiles. Leur prsence dans l'environnement est donc bien loin d'tre neutre. La prolifration des cyanobactries conjointement celle des algues devient importante dans les milieux aquatiques eutrophiss par le dversement de matires organiques et de phosphate. Le croquis et le graphique reprsentent une coupe dans un milieu aquatique o s'tablit une stratification thermique entre les eaux plus chaudes en surface (en t) et une zone profonde plus dense et plus froide.

vgtaux

surface

10

20

cyanobactries thermocline bactries pourpres

3 bactries pourpres sulfureuses mthanogense boues


0 5 10

CH4

O2 ou H2S (mg/L)

profondeur

60

BIODGRADATIONS ET MTABOLISMES

Un gradient de sparation en eau calme, la thermocline, spare aussi la partie la plus oxygne prs de la surface et la profondeur, plus ou moins anoxique et riche en sulfure prs du fond. Le graphique reprsente la temprature (1), l'oxygne dissous (2) et la teneur en H2S (3). La photosynthse non oxygnique se tient dans la zone la moins oxygne ou compltement anarobie sous la thermocline. Munies de vacuoles gaz qui leur permettent de monter et descendre dans l'eau la manire d'un ludion, les cyanobactries libres sont capables d'ajuster en mme temps la sensibilit spectrale et l'tendue de leurs pigments antennaires, de faon optimiser la captation de la lumire. Les cyanobactries ressemblent des chloroplastes isols. Leur appareil photosynthtique est log comme ceux-ci dans la paroi de sacs membranaires internes appels thylakodes. Le schma en "Z" de la photosynthse avec les deux photosystmes PS1 et PS2 ressemble celui des plantes vertes.
E'0 (mV) e
1000

P700*

A1 P680* e pheo PQA 2H+ PQB PQH2 b6f h H2O e

A2 NADPH 2H+ fdred Fe/S h pc c553 cyt. aa3 e P700

500

1/2 O2
500

PS1

1000

P680

PS2
b6f - cytochrome complexe de type bc1 Fd - ferrdoxine A1, A2, Fe/S - noyaux fer-soufre

Pheo - phophytine PQ - phylloquinones Pc - plastocyanine

PS1 et PS2 des cyanobactries


On note dans ce schma un dtail important qui est la prsence d'une vritable chane respiratoire dont le cytochrome complexe b6f fait partie. L'accepteur final est O2 par une cytochrome c oxydase. Le b6f, qui est en fait un complexe bc1, permet une rcupration d'nergie comme prcdemment chez les bactries pourpres et vertes. Les cyanobactries peuvent donc oxyder des substrats exognes sur l'oxygne sans utiliser la lumire. Les PS1 et PS2 des cyanobactries sont homologues sur le plan structural des photosystmes trouvs respectivement chez les bactries vertes et pourpres. La structure dtaille des centres de Synechococcus a t dtermine par cristallographie avec une rsolution de 2,5

1 LA COLLECTE DE L'NERGIE

61

(PS1) [54] et de 3,8 (PS2) [55] L'avance considrable des connaissances sur la question devrait clairer la structure des PS des chloroplastes. Les centres ractionnels ont toujours deux sous-units fondamentales de structure hydrophobe avec une charpente d'hlices alpha traversant la membrane, et portant les cofacteurs essentiels comme nous l'avons vu chez les bactries. Autour de ces noyaux centraux sont disposes d'autres sous-units et l'ensemble est entour par les complexes antennaires. Les centres ractionnels PS1 sont organiss en trimres, comme sur la figure dans la partie a, o la membrane serait dans le plan de la page. Chacun des monomres a 12 sous-units, les plus importantes appeles PsaA, PsaB et PsaC autour desquelles gravitent 9 plus petites et 3 places au-dehors de la membrane. Les cofacteurs sont nombreux, soit 127 au total. Qu'on en juge : 96 chlorophylles a, 3 noyaux fer-soufre [4Fe-4S], 2 molcules de phylloquinone, 22 molcules de carotnode et 4 de lipides !
ct lumen

PsaB
sous-unit antennaire centre ractionnel organis en trimre B2 B3

A1

B1

PsaA

A2 A3

QKB FX ct stroma FB

Q KA

PsaC
FA

b
PS1 de Synechocystis

Parmi les molcules de chlorophylle a, six sont loges dans les sous-units principales PsaA et PsaB, et leur disposition relative est reprsente dans la partie b de la figure. Les lettres A et B font rfrence sous-unit qui les lie, notamment par leur magnsium. Le dimre essentiel de chlorophylle o se fait la sparation de charges est A1B1 et reprsente le P700. Sont prsentes galement les deux molcules de phylloquinone (QKA, QKB), un centre fer-soufre cheval sur les deux parties et deux autres, FA et FB, localiss dans la sous-unit PsaC faisant saillie dans le stroma. La structure est hautement conserve dans l'volution jusqu'aux plantes, notamment les acides amins qui coordonnent le magnsium des molcules de chlorophylle. Il y a donc deux branches par lesquelles peuvent s'effectuer les transferts d'lectron. Par suite de la petite dissymtrie entre PsaA et PsaB, les deux voies ne fonctionnent probablement pas avec la mme frquence.

62

BIODGRADATIONS ET MTABOLISMES

Les excitons achemins par les pigments antennaires arriveraient prfrentiellement du ct PsaB. Le P700 est recharg du ct lumen (en haut de la figure), donc sur la face externe par rapport au cytoplasme. Les lectrons sont mis de l'autre ct par PsaC (en passant par Fx) et pris en charge par une ferrdoxine. Cet difice molculaire est extraordinaire. Les sous-units PsaA et PsaB portent en plus des 6 molecules A et B, un total de 79 molcules de chlorophylle a, dont la plupart, non reprsentes, font office de pigments antennaires. Restent 11 sur les 96, attaches aux petites sous-units priphriques. Le PS1 fonctionne donc comme une unit intgre, recevant l'nergie lumineuse par sa chlorophylle et son carotne, mettant un un dans le stroma des lectrons trs bas potentiel, et recharg du ct lumen par la plastocyanine, une petite protine contenant du cuivre, et le cytochrome c6. Le PS2 est la seconde pice de l'appareil photosynthtique des cyanobactries. Sa double originalit et d'tre muni d'un dispositif manganse permettant la photolyse de l'eau, et de complexes antennaires spciaux o l'on trouve la chlorophylle a, des carotnodes, et surtout des phycobilisomes. Ces derniers renferment des pigments particuliers appels phycobilines. Les carotnodes ont comme ailleurs un double rle de rcepteur et de protecteur contre la formation d'oxygne singulet. Ils sont gnralement difficiles localiser dans les structures dduites de la diffraction des rayons X, car ils sont souvent trop mobiles pour occuper une place rigoureusement constante d'un PS2 un autre. Le PS2 ne renferme pas moins de 17 sous-units dont 14 sont dans la membrane du thylakode. L encore, le centre ractionnel renferme deux sous-units majeures porteuses des cofacteurs essentiels, dsignes par D1 (PsbA) et D2 (PsbD), selon un arrangement "pseudo-symtrique". Ces deux protines sont homologues l'une de l'autre par la squence et la structure, et il est visible que les gnes psbA et psbD drivent d'une duplication ancestrale, qui a d conduire un avantage slectif puisqu'on retrouve ce caractre dans tous les centres ractionnels que nous avons rencontrs l'exclusion de celui des bactries sulfureuses vertes (o l'arrangement est symtrique). Il faut donc s'attendre trouver l encore deux voies possibles pour le transfert des lectrons un un l'intrieur du centre, l'une tant privilgie par rapport l'autre. Il est vraisemblable que ces deux voies correspondent une possibilit d'adaptation en fonction des conditions, par exemple un effet rgulateur ou amortisseur permettant le transfert des lectrons sans -coups. Le schma s'inspire d'un article de RUTHERFORD et FALLER [56] et reprsente le cur du PS2, constitu par les polypeptides fondamentaux D1 et D2, leurs cofacteurs et quelques pices annexes. Le PS2 est homologue du photosystme des bactries pourpres mais en plus compliqu. Une pice essentielle est le noyau manganse qui contient 4 ions Mn2+ capables de s'oxyder en Mn3+. L'ensemble peut donc acheminer successivement 4 lectrons par une chelle de transferts radicalaires, catalysant la photolyse de l'eau : 2 H2O O2 + 4 H+ + 4 e. Ces lectrons transitent jusqu'au P680 par l'intermdiaire d'une position radicalaire essentielle porte par TyrZ. Chaque lectron mis par le 680 aprs sparation de charge voyage par une phophytine vers QA puis QB, qui oscille entre l'tat QB, et l'tat radicalaire QB.Chaque fois que

1 LA COLLECTE DE L'NERGIE

63

cette plastoquinone "mobile" QB a reu un lectron deux fois de suite, elle est transforme avec l'apport de deux protons en QBH2, abandonne le PS2, et une nouvelle molcule de QB la remplace. La plastoquinone est donc le point de sortie des lectrons provenant de l'eau. Le PS2 est bord par des sous-units internes fonction antennaire, dsignes par CP43 et CP47, contenant respectivement 12 et 14 molcules de chlorophylle a, organises en 2 couches parallles au plan de la membrane. Dans cet environnement complexe s'observent deux molcules de chlorophylle particulires, notes sur le schma par ChlZD1 et ChlZD2. Leur fonction est peut-tre d'acheminer les excitons partir des pigments antennaires vers le P68O, mais cela ne reste qu'une hypothse.
QA Fe QB b559 Pheo membrane ChlZD1 Chl D1 site tyrosine essentiel noyau manganse PsbO TyrZ (Mn)4 Pheo Chl D2 ChlZD2

P680

D2 D1
c550

H2 O

O2 + 4

H+

PS2 de Sybecchoccus elongatus


La forte originalit de l'antenne de PS2 est la prsence des phycobilines, des ttrapyrroles apparents aux porphyrines, mais non referms en couronne comme ces dernires. Les phycobilines sont rattaches des protines porteuses par une ou deux liaisons covalentes sur fonction thiol. Les protines sont les phycobiliprotines et les pigments leur sont lis par des segments de squence que l'volution a conservs. La plupart des cyanobactries en ont au moins trois, caractrises par leur maximum d'absorption. Les voici en ordre d'abondance dcroissante : des phycocyanines ou PC (620 nm), proches des phytochromes vgtaux, l'allophycocyanine ou APC (650 nm), et l'allophycocyanine B ou APCB (670 nm). De nombreuses espces ont en outre de la phycorythrocyanine ou PE (568 nm) et des phycorythrines B et R (546 et 565 nm). Voici deux exemples de ces pigments reprsents attachs leur protine par un ou deux ponts thiother 26. 26 - Le lien s'tablit chimiquement par une raction d'addition du thiol sur une chane latrale vinylique -CH=CH2. Une disposition semblable existe aussi dans les cytochromes c entre porphyrine et protine.

64
protine HOOC H3C H3C H O H N H N H N H N H S H O H 3C H O COOH H3C

BIODGRADATIONS ET MTABOLISMES
protine HOOC S H H N H N H N H H N H O COOH H3C S H

phycocyanobiline

phycorythrobiline

Exemples de phycobilines
Les phycobiliprotines absorbent donc diffrentes longueurs d'onde et sont loges dans des complexes antennaires spciaux associs au PS2 et appels phycobilisomes. Leur nom et les bilines associes sont indiqus en glossaire. L'organisation des phycobilisomes obit un plan caractristique. Les principales protines porteuses de phycobilines (1, 2 ou 3 molcules par peptide, attaches par pont thiother) correspondent deux catgories de sous-units et . Ces protines sont groupes en trimres de composition ()3 formant un anneau muni d'un trou central d'un diamtre d'environ 100 . Deux anneaux ()3 superposs en ()6 s'emmanchent sur une sous-unit spciale dpourvue de pigment et appele "linker " (L). L'unit lmentaire ainsi forme a donc pour formule ()6L . Les phycobilisomes portent ainsi sur un noyau central des btonnets dirigs en ventail (il y en a habituellement 6), constitus par des chanes d'units ()6L.
phycobilisome L ()3 phycorythrine phycocyanine

()6L

noyau du phycobilisome

stroma membrane du thylakode lumen 2 H2O O2 PS1 PS2 Mn PS1

Appareil photosynthtique des cyanobactries


Le noyau central a une composition spciale. Il est constitu d'un trimre d'allophycocyanine, absorbant dans le rouge lointain du spectre, li un linker particulier de masse molculaire leve et dsign dans la littrature par LCM. L'nergie capte par les btonnets est canalise vers le noyau qui la transmet directement au PS2. Ce dispositif est extraordinaire, car le dveloppement et la composition en pigments des phycobilisomes est tributaire des conditions

1 LA COLLECTE DE L'NERGIE

65

physiologiques. Les phycobilisomes rgressent en cas de carence nutritionnelle (les pigments servent de rserve azote et sont recycls). Ils rgressent galement en lumire vive, qui a pour effet de provoquer un fort abaissement du potentiel redox interne. De nombreuses espces de cyanobactries vivant en milieu aquatique, comme les Anabaena, sont dcolores sous un clairement fort. La composition des btonnets en phycobilines varie en fonction de la qualit spectrale de la lumire. C'est le phnomne le plus intressant, appel adaptation chromatique. Les units les plus proches du noyau contiennent essentiellement de la phycocyanine dont le maximum d'absorption est dans le rouge. Les zones priphriques ont comme constituant principal une phycorythrine, dont l'absorption est dans le vert. L'adaptation joue sur le dveloppement de la phycorythrine par rapport la phycocyanine. La premire prend le pas sur la seconde en lumire verte. C'est l'inverse en lumire rouge.
PE lumire verte (500 560 nm)

lumire rouge (650 700 nm) PC PE PC

Adaptation chromatique
Les cyanobactries sont donc capables de se dvelopper la lumire verte tamise des milieux aquatiques quand l'clairement de surface est en partie intercept par des vgtaux verts. Cette partie du spectre est celle o la chlorophylle est la moins efficace. Il y a un autre aspect, avec l'action conjointe de la turbidit du milieu et de la profondeur de l'eau. Un milieu trouble devient de plus en plus opaque au fur et mesure que la longueur d'onde de la lumire diminue. Le rouge passe donc mieux que le bleu. Inversement les radiations rouges sont plus fortement absorbes par l'eau que les courtes longueurs d'onde. Consquence : la lumire verte est un moyen terme, une eau profonde et trouble est claire en vert. Les cyanobactries ont donc la possibilit de moduler la composition de leurs phycobilisomes en fonction de la qualit de l'clairement [57].
chl.a + carot. PE PC AP

absorbance relative

absorbance

PC

PE en lumire verte en lumire rouge

400

500

600

700 (nm)

400

500

600

700

(nm)

Absorbance de F. diplosiphon en suspension

66

BIODGRADATIONS ET MTABOLISMES

Le graphique montre en a les zones d'absorption des diffrents pigments : la chlorophylle a et les carotnodes, la phycorythrine (PE), la phycoyanine (PC) et l'allophycocyanine (AP). En b, changement d'absorbance des cellules en suspension selon la couleur de la lumire incidente. La puissance d'adaptation des cyanobactries est donc remarquable et les rend comptitives dans nombre de niches cologiques. Leur facult de se dvelopper dans des milieux hostiles en font des acteurs importants dans les grands cycles naturels.

CONCLUSION
Ce chapitre nous a fait passer en revue les principales recettes utilises par les micro-organismes bactriens pour se procurer l'nergie dont ils ont besoin pour se dvelopper. Sans cela bien des biodgradations ne pourraient avoir lieu. Les modes utiliss sont probablement trs anciens et se sont perptus dans l'volution en conservant la fois les mcanismes de base et la structure de maints composants. Ces mcanismes sont extraordinaires par leurs performances. Ils se montrent souvent adaptables toute sorte de conditions. Les formidables ressources en nergie apportes par les oxydorductions et la lumire vont actionner les transformations et biodgradations varies que nous examinerons dans les chapitres suivants.

RFRENCES
[1] S C H I N K B (1997) Microbiol. Mol. Biol. 61 : 262-280. [2] D I M R O T H P (1982) Eur. J. Biochem. 121 : 443-449 ; H I L P E R T W & D I M R O T H P (1984) Eur. J. Biochem. 138 : 579-583 ; H I L P E R T W & D I M R O T H P (1991) Eur. J. Biochem. 195 : 79-86. [3] B U C K E L W (2001) Biochim. Biophys. Acta 1505 : 15-27. [4] G A R C I A G E & S T A D T M A N TC (1992) J. Bacteriol. 174 : 7080-7089 ; G R A E N T Z D O E R F F E R A, P I C H A & A N D R E E S E N JR (2001) Arch. Microbiol. 175 : 8-18. [5] S T A D T M A N TC & D A V I S JN (1991) J. Biol. Chem. 266 : 22147-22153. [6] D U N C A N TM, B U L Y G I N VV, Z H O U Y , H U T C H E O N ML & C R O S S RL (1995) Proc. Natl. Acad. Sci. 95 : 10964-10968. [7] B O Y E R PD , C R O S S RL & M O M S E N W (1973) Proc. Natl. Acad. Sci. 70 : 2837-2839. [8] I K O Y , S A M B O N G I Y , T A N A B E M, I W A M O T O - K I H A R A A, S A I T O K, U E D A I, W A D A Y & F U T A I M (2001) J. Biol. Chem. 276 : 47508-47511. [9] N O J I H , Y A S U D A R, Y O S H I D A M & K I N O S I T A K (1997) Nature 386 : 299-302. [10] G I R V I N ME, R A S T O G I VK, A B I L D G A A R D F, M A R K L E Y JL & F I L L I N G H A M E RH (1998) Biochemistry 37 : 8817-8824. [11] R A S T O G I VK & G I R V I N ME (1999) Nature 402 : 263-268.

1 LA COLLECTE DE L'NERGIE [12] D E L R I Z Z O PA, B I Y , D U N N S D & S H I L T O N BH (2002) Biochemistry 41 : 6875-6884. [13] P U U S T I N E N A & W I K S T R M M (1991) Proc. Natl. Acad. Sci. 88 : 6122-6126 ; M O G I T, S A I K I K & A N R A K U Y (1994) Molec. Microbiol. 14 : 391-398. [14] T A K A N O T & D I C K E R S O N RE (1981) J. Mol. Biol. 153 : 79-84 et 95-115. [15] N A R H , M E S S E R S C H M I D T A, H U B E R R, V A N D E K A M P M & C A N T E R S G W (1991) J. Mol. Biol. 221 : 765-772 ; W I L L I A M S RJP (1995) Eur. J. Biochem. 234 : 363-381. [16] P A G E MD , S A M B O N G I Y & F E R G U S O N S J (1998) Trends Biochem.Sci. 23 : 103-108. [17] K R A N Z R, L I L L R, G O L D M A N B, B O N N A R D G & M E R C H A N T S (1998) Molec. Microbiol. 29 : 383-396. [18] I W A T A S , L E E JW , O K A D A K, L E E JK & I W A T A M (1998) Science 281 : 64-71 ; K I M H , X I A D , Y U C - A , X I A J- Z , Z H A N G L, Y U L & D E I S E N H O F E R J (1998) Proc. Natl. Acad. Sci. 95 : 8026-8033 ; H U N T E C , K O E P E J, L A N G E C , R O S S M A N I S H T & M I C H E L H (2000) Structure with Folding & Design 8 : 669-684. [19] M I T C H E L L P (1976) J. Theor. Biol. 62 : 327-367. [20] S N Y D E R C H & T R U M P O W E R BL (1999) J. Biol. Chem. 274 : 31209-31216 ; S N Y D E R C H , G U T I E R R E Z - C I L L O S EB & T R U M P O W E R BL (2000) J. Biol. Chem. 275 : 13535-13541. [21] M A R S U N O - Y A G I A & H A T E F I Y (1999) J. Biol. Chem. 274 : 9283-9288 ; M A R S U N O - Y A G I A & H A T E F I Y (2001) J. Biol. Chem. 276 : 19006-19011. [22] D A R R O U Z E T E, M O S E R C C , D U T T O N L & D A L D A L F (2001) Trends Biochem. Sci. 26 : 445-451. [23] O S T E R M E I E R C , H A R R E N G A A, E R M L E R U & M I C H E L H (1997) Proc. Natl. Acad. Sci. 94 : 10547-10553 ; T O M I Z A K I T & 8 auteurs (1999) Acta Crystallogr. D Biol. Crystallogr. 55 : 31-45 ; F E I MJ, Y A M A S H I T A E, I N O U E N, Y A O M, Y A M A G U C H I H , T S U K I H A R A T, S H I N Z A W A - I T O H K, N A K A S H I M A R & Y O S H I K A W A S (2000) Acta Crystallogr. D Biol. Crystallogr. 56 : 529-535. [24] W I K S T R M M (1977) Nature 266 : 271-273. [25] B A B C O C K G T & W I K S T R O M M (1992) Nature 356 : 301-309. [26] M I C H E L H (1998) Proc. Natl. Acad. Sci. 95 : 12819-12824. [27] K A N N T A, L A N C A S T E R C RD & M I C H E L H (1998) Biophys. J. 74 : 708-721. [28] K O B A Y A S H I K, T A G A W A S & M O G I T (1999) Biochemistry 38 : 5913-5917. [29] M A T S U S H I K A A & M I Z U N O T (1998) J. Bacteriol. 180 : 3973-3977. [30] O T T E N MP, V A N D E R O O S T J, R E I J N D E R S W NM , W E S T E R H O F F H V, L U D W I G B & V A N S P A N N I N G RJM (2001) J. Bacteriol. 183 : 7017-7026. [31] O T T E N MP, R E I J N D E R S W NM , B E D A U X JJ, W E S T E R H O F F H V, K R A B K, L U D W I G B & V A N S P A N N I N G RJM (1999) Eur. J. Biochem. 261 : 767-774. [32] G E S T H & F A V I N G E R JL (1983) Arch. Microbiol. 136 : 11-16. [33] K O L B E R ZS , V A N D O V E R C L, N I E D E R M A N RA & F A L K O W S K I PG (2000) Nature 407 : 177-179. [34] Y U R K O V VV & B E A T T Y JT (1998) Microbiol. Mol. Rev. 62 : 695-724. [35] E R M L E R U, F R I T Z S C H G , B U C H A N A N S K & M I C H E L H (1994) Structure 2 : 925-936 ; D E I S E N H O F E R JO , E P P K, M I K I R, H U B E R R & M I C H E L H ( 1985) Nature 318 : 618- 62 4.

67

68 [36] Z U B E R H (1985) Photochem. Photobiol. 42 : 821-825.

BIODGRADATIONS ET MTABOLISMES

[37] M C D E R M O T T G , P R I N C E S M, F R E E R AM, H A W T H O R N E T R H W A I T E - L A W L E S S AM, P A P I Z AZ, C G D E L L RJ & I S A A C S NW (1995) Nature 374 : 517-521. [38] R E I D L H & coll. (1983) Biochim. Biophys. Acta 725 : 455-463 ; Biochim. Biophys. Acta 808 : 328-333. [39] V A S S I L I E V A RV, S T I R E W A L T VM, J A K O B S C U, F R I G A A R D NU, I N O U E - S A K A M O T O K, B A K E R MA, S O T A K A & B R Y A N T D A (2002) Biochemistry 41 : 4358-4370. [40] Z H O U W , L O B R U T T O R, L I N S & B L A N K E N S H I P RE (1994) Photosynth. Res. 41 : 89-96. [41] F R I G A A R D NU, V O I G T G D & B R Y A N T D A (2002) J. Bacteriol. 184 : 3368-3376. [42] H A U S K A G , S C H O E D L T, R E M I G Y H & T S I O T I S G (2001) Biochim. Biophys. Acta 1507 : 260-277. [43] K A N E K O T, N A K A M U R A Y & 20 auteurs (2001) DNA Res. 8 : 205-213, 227-253. [44] M E E K S JC & coll. (2001) Photosynthesis Res. 70 : 85-106. [45] F E N I C A L W (1982) Science 215 : 923-928. [46] R I C H A R D S O N & C A S T E N H O L Z (1987) Appl. Environ. Microbiol. 53 : 2151-2158. [47] M U R LR (1983) Annales Microbiol. (Paris) 134B : 61-72 ; P O S T AF & c ol l . (1985) FEMS Microbiol. Ecol. 31 : 97-102. [48] W O L K C P & S H A F F E R PW (1976) Arch. Microbiol. 110 : 123-127. [49] U D V A R D Y J & coll. (1984) J. Bacteriol. 157 : 681-683. [50] T H O R N PM & coll. (1991) Chem. Res. Toxicol. 4 : 535-540 ; [51] A N N I L A A, L E H T I M K I J, M A T T I L A K, E R I K S S O N JE, S I V O N E N K, R A N T A L TT & D R A K E N B E R G T (1996) J. Biol. Chem. 271 : 16697-16702. [52] G L E A S O N FK & B A X A C A (1986) FEMS Microbiol. Lett. 33 : 85-88 ; G L E A S O N FK & C A S E D E (1986) Plant. Physiol. 80 : 834-838. [53] P L U D E JL & coll. (1991) Appl. Environ. Microbiol. 57 : 1696-1700. [54] J O R D A N P, F R O M M E P, W I T T H T, K L U K A S O , S A E N G E R W & K R A U B N (2001) Nature 411 : 909-917. [55] Z O U N I A, W I T T H - T , K E R N J, F R O M M E P, K R A U S S N, S A E N G E R W & O T H P (2001) Nature 409 : 739-743. [56] R U T H E R F O R D AW & F A L L E R P (2001) Trends Biochem. Sci. 26 : 341-344. [57] T A N D E A U D E M A R S A C N & H O U M A R D J (1993) FEMS Microbiol. Rev. 104 : 119-190.

CHAPITRE 2 GNOMES - ADAPTATIONS - COMMUNICATIONS


S'adapter : c'est l'impratif essentiel de la survie dans la comptition infernale de l'environnement, o celui qui gagne est gnralement celui qui va vite, ou sait faire ce que d'autres ne font pas. Pour cela il faut acqurir la bonne information gntique. Il faut aussi disposer d'un arsenal performant de protines, se prmunir contre les agressions, rparer, se dbarrasser des outils inutiles. Enfin il est profitable de s'installer aux endroits les plus favorables. La cartographie complte du gnome d'un nombre grandissant de micro-organismes permet de se faire une ide prcise de leur organisation gntique et de comprendre comment une population microbienne peut s'adapter rapidement par des transferts de gnes de cellule cellule, modifier son patrimoine par des transposons et intgrons. Contrairement aux apparences, une cellule bactrienne n'est pas livre elle-mme, mais construit avec d'autres de vritables cits qui sont les biofilms, o sa physiologie est modifie. En outre les bactries s'informent mutuellement de conditions particulires par des changes de signaux chimiques. 2.1 - La gnomique des micro-organismes 2.2 - Protomique et complexes multi-protiques 2.3 - Transferts gntiques horizontaux 2.4 - Plasmides 2.5 - Squences d'insertion - Transposition 2.6 - Les transposons simples et composites 2.7 - Intgrons et cassettes 2.8 - La biologie particulire des biofilms 2.9 - Communication et bioluminescence 71 80 84 90 95 99 107 115 119

2 GNOMES - ADAPTATIONS - COMMUNICATIONS


S'adapter : c'est l'impratif essentiel de la survie dans la comptition infernale de l'environnement, o celui qui gagne est gnralement celui qui va vite, ou sait faire ce que d'autres ne font pas. Pour cela il faut acqurir la bonne information gntique. Il faut aussi disposer d'un arsenal performant de protines, se prmunir contre les agressions, rparer, se dbarrasser des outils inutiles. Enfin il est profitable de se dplacer vers les endroits les plus favorables.

2.1 - LA GNOMIQUE DES MICRO-ORGANISMES


Depuis quelques annes, un nombre grandissant d'espces vivantes ont vu leur gnome complet squenc, des bactries l'homme, en passant par la levure, des plantes et des invertbrs. Une rvolution dans l'analyse gntique, une meilleure comprhension des rgulations mtaboliques et du dveloppement, et pour divers procaryotes pathognes, la nature du pouvoir infectieux. l'origine d'une somme colossale de donnes obtenues sont des associations de nombreux laboratoires dans le monde. Parmi les outils de base essentiels figurent les nuclases de restriction, la constitution de banques gnomiques, l'amplification par PCR, le perfectionnement des techniques d'lectrophorse et le renfort capital de l'informatique. Ces progrs sont mettre en parallle avec ceux de l'analyse structurale des protines par cristallographie, RMN et maintenant spectromtrie de masse. Quelques ralisations techniques de base ont dclench la plus grande perce des connaissances de tous les temps sur les mcanismes vitaux de base. Le but n'est pas ici d'en retracer le droulement, mais de comprendre comment les micro-organismes ont pu voluer de faon s'adapter aux contingences du milieu, en particulier pour s'accommoder des diffrentes ressources nergtiques et nutritives qui lui sont offertes, soit partir des constituants naturels, soit l'aide des produits rpandus artificiellement par l'activit humaine. La taille des gnomes varie normment des animaux aux plantes et aux microorganismes. Le gnome d'un animal aussi rudimentaire qu'un nmatode (Caenorhabditis elegans) fait plus de 100 millions de pdb avec 16384 gnes, et le gnome de la petite plante Arabidopsis thaliana est du mme ordre de grandeur, alors qu'il atteint 170 millions pour la Drosophile. Du ct des champignons, Aspergillus niger et Neurospora crassa ont des gnomes de 31 et 47 millions de pdb respectivement.

72

BIODGRADATIONS ET MTABOLISMES

Le gnome des bactries est d'ordinaire plus petit, car son importance s'chelonne de 0,5 prs de 6 millions de pdb. La recherche s'est attaque en priorit des souches pathognes, dont certaines ont un gnome assez court, le plus simple tant celui du Mycoplasma genitalium long de 580 kb seulement. Il s'agit de comprendre comment des organismes parfois trouvs dans l'environnement banal peuvent devenir de redoutables agents infectieux. On cherche aussi savoir par quels mcanismes les germes de l'environnement ont pu voluer, et acqurir parfois de formidables potentialits dans le domaine des biodgradations. Les donnes permettent de voir qu'il y a plusieurs chemins possibles. Le tableau est une srie d'exemples donnant la longueur du gnome, et le nombre de gnes dtects chez la levure, une cyanobactrie, des bactries Gram-positives (G+) et ngatives (G). Gnome
Saccharomyces cerevisiae Schizosaccharom. pombe Anabaena PCC 7720 Pseudomonas aeruginosa Ralstonia solanacearum Escherichia coli Bacillus subtilis Caulobacter crescentus Synechocystis PCC 6803 Lactococcus lactis Neisseria meningitidis Thermotoga maritima Streptococcus pyogenes Haemophilus influenzae M. thermoautotrophicum 1 Treponema pallidum Chlamydia trachomatis Mycoplasma genitalium

pdb

Gnes

Observations
Eucaryote, levure de bire, bourgeonnante Eucaryote, levure fissipare Cyanobactrie, avec 6 plasmides, de 5 408 kb G, ubiquiste, pathogne opportuniste G, en 2 parties, chromosome et grand mgaplasmide G, entrobactrie, quelquefois pathogne G+, protines scrtes, mtabolisme secondaire, abondant G, cycle entre stade fix et stade libre Cyanobactrie, avec plusieurs plasmides G+, lactobactrie, fermentation aro-tolrante du lait G, un agent pathogne de la mningite Thermophile primitif proche des archaebactries G+, pathogne, plus de 40 gnes de virulence G, pathogne occasionnel, transformable Archaebactrie mthanogne thermophile G, spirochte agent de la syphillis G agent du trachome, proche des rickettsies G, rpandus, parasites intracellulaires, sans paroi

14 213 386 6231 12 462 637 4929 6 413 771 6 264 403 5 810 922 4 639 221 4 214 810 4 016 942 3 573 470 2 365 589 2 272 231 1 860 725 1 852 442 1 830 137 1 751 377 1 138 006 1 042 519 580 070 5400 5570 5129 4288 4100 3767 3168 2310 1158 1877 1752 1703 1855 1041 894 470

Comment dnombrer les gnes dans la squence ? La dmarche procde de l'identification des ORFs*. En principe chaque ORF reprsente une protine ou une des

1 - Methanobacterium autotrophicum.

2 GNOMES - ADAPTATIONS - COMMUNICATIONS

73

sous-units d'une protine si celle-ci a une structure quaternaire dote de polypeptides diffrents. La totalit de ces ORF ne reprsente pas toute la longueur du gnome, car il existe des sections non transcrites. Ce sont des promoteurs, ou des squences codant pour des fonctions rgulatrices sur l'expression des autres parties, ou encore des squences codant pour des ARNr et des ARNt. Pseudomonas aeruginosa possde un gnome relativement volumineux, et la rpartition des ORF rpond un diagramme qui rsume quelques interprtations [1] :
A - gnes dont la fonction est dmontre

B - gnes homologues de gnes dont on connat la fonction dans dautres organismes C - gnes dont la fonction relle est rendue probable par des homologies limites

D - gnes homologues dautres gnes dont on ignore la fonction E - gnes sans homologies trouves dans les bases de donnes, fonction inconnue

Affectation des gnes chez Pseudomonas aeruginosa


On voit que l'affectation des gnes reconnus dans la squence n'est dtermine que pour un quart des ORF, dont moins de 7% avec certitude (par mutations, comparaison avec la squence d'acides amins de la protine, etc.). La proportion des gnes auxquels on peut attribuer une fonction est de 54%. Comme d'autres espces classes dans le groupe des Pseudomonas, ce germe bactrien a un pouvoir d'adaptation exceptionnel. Il habite les sols, marais et milieux littoraux, peut dgrader une foule de composs (phnols, hydrocarbures, halodrivs), rsiste un srie d'antibiotiques et de dsinfectants, se dveloppe sur les plantes, forme volontiers des biofilms (section 8), et se comporte comme un pathogne opportuniste tous azimuts, en particulier pour l'homme o il est responsable d'infections graves chez les blesss et en milieu hospitalier. Un trs gros palmars ! Le mtabolisme cellulaire de base met en jeu environ 750 gnes, dont 119 pour fabriquer des cofacteurs et transporteurs. Le plus remarquable est l'importance du matriel gntique consacr aux protines rgulatrices, soit 403 gnes reconnus. Cette valeur leve accompagne logiquement le grand pouvoir d'adaptation des conditions varies. cela s'ajoutent les systmes de rgulation deux composants* qui sont actionns par 118 gnes supplmentaires. l'autre extrmit de l'chelle, les gnomes les plus simples, comme ceux des mycoplasmes, accompagnent des espces parasites, qui n'ont pas besoin d'une chimie de synthse aussi complique puisque la plupart des lments sont soutirs de la cellule hte [2]. Comment les espces ont-elles pu voluer pour s'adapter un changement de milieu ? On possde des lments de rponse en ce qui concerne les bactries grce aux donnes de la gnomique. Des bactries grand pouvoir d'adaptation comme les Pseudomonas et le colibacille ont de nombreux gnes concernant des fonctions rgulatrices, des mcanismes de rparation et de recombinaison, ainsi

74

BIODGRADATIONS ET MTABOLISMES

que de nombreux facteurs anti-stress. Les mutations elles-mmes sont rgules. Une trs longue slection s'exerce au sein des populations pour faire merger peu peu les lignes les mieux adaptes alors que l'environnement est trs riche en antibiotiques 2 et en substances organiques de dfense d'origine vgtale. Les bactries s'adaptent par slection, par rgulations pousses, parfois par une certaine redondance dans leur arsenal enzymatique. Un intrt considrable est soulev par l'tude des micro-organismes thermophiles et hyperthermophiles. Ce sont gnralement des archaebactries et des formes bactriennes primitives qui ont conserv un souvenir de leur parent avec les archaebactries. Les thermophiles n'ont pas qu'un intrt purement acadmique, car on recherche des enzymes thermostables et des espces pouvant faire des biodgradations temprature leve. Un thermophile clbre est Thermus aquaticus, qui a permis la mise au point de dpart de la mthode PCR. Thermotoga maritima et un Aquifex aeolicus sont des habitants des sources chaudes et sont connus comme des reprsentants particulirement primitifs du groupe des bactries sur la base de leur ARN 16S. Leurs gnomes ont t squencs et rvlent une parent avec les archaebactries. Les gnomes archaebactriens dj squencs sont l'objet d'une grande curiosit car on peut y dceler des ressemblances avec les autres grandes divisions du monde vivant. Les archaebactries constituent un vaste groupe qui a buissonn normment au cours de l'volution. Prs de la moiti des gnes ont une ressemblance de squence avec ceux des protobactries, et 10-15% ont manifestement des affinits avec des gnes de type eucaryote. Dans le premier cas, les analogies se trouvent principalement dans les gnes de la synthse de cofacteurs et de petites molcules, d'enzymes du mtabolisme intermdiaire, de transporteurs, de protines rgulatrices et des enzymes de fixation de l'azote. Dans le second cas, les ressemblances concernent le mtabolisme de l'ADN, la cription et la traduction sur les ribosomes, sans oublier des ATPases. Ces indices ont fait supposer que les premires cellules d'eucaryotes taient des organismes anctres des archaebactries actuelles. Elles auraient acquis secondairement par endosymbiose les organismes prcurseurs des mitochondries et des plastes. L'acquisition en bloc de gnes trangers est la voie d'adaptation des gens presss. Il s'agit d'acqurir d'un seul coup une information gntique extrieure par ce qu'on appel un transfert horizontal, autorisant une adaptation prcipite sans attendre le hasard des mutations. Les acquisitions peuvent tre compenses par des liminations, qui font que le gnome n'augmentera pas ncessairement dans des proportions dmesures. Les bactries ont trois modes d'acquisition de ce type : une transformation, un change de plasmide, une infection virale. Le ct remarquable de l'accumulation des squences gnomiques est de permettre la dtection des traces laisses par les diffrents apports, parfois anciens, tel point qu'on a pu parler d'une "archologie" du gnome. Elle se fonde sur l'examen de la composition en bases, l'usage des codons, la prsence de squences homologues avec d'autres espces, des squences d'insertion, des traces de prophages

2 - Les antibiotiques utiliss en thrapeutique ne reprsentent qu'un pourcentage trs faible parmi ceux qui ont t dcouverts.

2 GNOMES - ADAPTATIONS - COMMUNICATIONS

75

Nous en citerons des exemples. Ces phnomnes sont particulirement frquents chez les pathognes, mais existent aussi chez les bactries capables de faire des biodgradations. L'apport de voies mtaboliques entires n'y est sans doute pas exceptionnel. Peut-on reproduire artificiellement l'volution au sein d'une mme espce ? Le problme pourrait paratre a priori saugrenu, car l'volution est un processus extrmement lent. Pourtant les bactries offrent un terrain d'tude favorable cause de la brivet de leur temps de gnration. Une constatation remarquable a t faite. Elles savent grer le taux des changements dans leur patrimoine gntique. Le choix exprimental s'est port sur Escherichia coli, car c'est l'espce dont on connat le mieux la physiologie et la gntique. Elle a cependant l'inconvnient d'tre relativement spcialise, et on peut craindre que les donnes ne soient pas automatiquement gnralisables aux autres espces. Le principe exprimental de dpart est trs simple. Une souche de E. coli gntiquement homogne et asexue (un clone) est cultive sur un milieu dfini aussi simple que possible : du glucose dans un mlange salin. Les bactries sont cultives en milieu liquide et repiques priodiquement en diluant chaque fois un chantillon de la culture dans du milieu frais, et ainsi de suite des milliers de fois. L'exprience a t faite sur plusieurs annes et sur 12 lignes diffrentes. Plus de 20.000 gnrations ont ainsi t obtenues. Comme les bactries ont eu l'occasion de se multiplier abondamment avant chaque transfert, c'est en fait un trs grand nombre de divisions qu'elles ont subi. Des chantillons sont examins pour la drive de leurs proprits et les changements de leur appareil gntique. Une faon d'observer l'volution en chambre et en raccourci. La difficult de cette exprimentation vient de la mthode de mesure. Beaucoup de mutations ponctuelles sont "silencieuses", c'est--dire qu'elles n'amnent aucun changement phnotypique et ne seraient dtectables que par un squenage prohibitif. L'absence d'effet immdiat d'une mutation peut survenir deux niveaux. Le premier est le passage d'un triplet de bases ou codon un autre de mme signification, par exemple le changement de CUG en CUA, ces deux codons tant pour la leucine. Le plus souvent les mutations de ce type portent sur la troisime base d'un triplet pour donner un synonyme. Le deuxime niveau est plus complexe, car il concerne l'activit biologique et la stabilit du polypeptide form. Certains remplacements d'un acide amin par un autre dans une protine restent neutres. D'autres entranent un changement de proprits ou mme l'inactivation du produit. Il existe bien entendu d'autres types de mutations*, et les changements ont d'autant plus de chance de crer des perturbations immdiates dans la descendance, voire tre ltales, qu'ils sont plus importants ou concernent des zones sensibles. Dans une ligne bactrienne ne recevant aucune information de l'extrieur (ni virus, ni transformations, ni plasmides), on peut mesurer l'accumulation des mutations par la disparition de certaines voies mtaboliques. La mthode de COOPER et LENSKI consiste analyser le pouvoir du colibacille crotre sur diffrentes sources carbones au cours de son volution [3], les tests tant faits

76

BIODGRADATIONS ET MTABOLISMES

sur des galeries Biolog 3. Au fil des nombreux transferts, les lignes tudies cultives sur glucose perdent peu peu toute une srie de proprits. Cette dgradation apparente s'accompagne-t-elle d'une perte de comptitivit ? Pas forcment. Une amlioration des performances par rapport la souche mre semble se dessiner. Les deux schmas simplifis symbolisent l'volution d'une population dans deux cas extrmes. Les segments reprsentent les sous-populations au cours du temps. Chaque embranchement est une mutation. En a, la pression slective est faible ou inexistante, la dpart population se diversifie en rameaux buissona b nants. En b, une pression slective s'exerce chaque mutation et donne la prpondrance une ligne. Au cours de chaque volution, des rameaux viennent extinction face la concurrence exerce au sein des populations. En b l'arbre volutif passe par plusieurs goulots d'tranglement, figurs par les cercles aux embranchements. Les populations finales observes drivent d'une srie d'anctres successifs communs. Il va sans dire que l'volution au sein du rgne animal et chez les eucaryotes en gnral pose des problmes sans commune mesure avec celle d'une population bactrienne de laboratoire. Les changes sexuels, changements du milieu, pidmies et migrations apportent autant de facteurs supplmentaires. Une conclusion intressante faite la suite des cultures long terme du colibacille est l'influence bnfique que peut avoir l'abandon de certaines voies mtaboliques. Cette disparition intervient tt dans ces expriences et s'accompagne d'un rythme acclr des mutations. En somme les bactries, quand elles se dbarrassent des voies inutiles, ne s'en portent que mieux aprs avoir trouv par chance les bons numros. O les mutations se produisent-elles et quand ? Une autre voie d'approche utilisant aussi les nombreuses gnrations successives du colibacille consiste fragmenter le gnome par des nuclases de restriction. Dans le chromosome de E. coli sont disperses des squences spciales en exemplaires multiples (1-10 et davantage) appeles squences d'insertion ou IS, examines plus loin dans ce chapitre. Ces IS servent ici de marqueurs [4]. Quand le gnome a t dcoup en fragments par une nuclase de restriction qui les laisse toutes intactes, on peut reprer les morceaux porteurs de ces IS. Le reprage se fait par hybridation par une sonde spcifique pour chaque IS. Par exemple la prsence dans la population des morceaux contenant une squence IS3 sera identifie aprs dnaturation 4, lectrophorse et rcupration sur filtre (voir Southern*). Une sonde nuclique approprie pourra s'hybrider avec IS3 et rvler sa prsence. On obtient ainsi une sorte d'empreinte digitale spcifique. Toute mutation qui drange le dcoupage initial par la nuclase, par exemple une dltion ou une inversion, se traduit par une modification de l'empreinte. Les tests utilisant plusieurs nuclases de restriction et les sondes spcifiques des divers IS permettent de se faire une ide, aprs analyse
final

3 - Faites sur le mme principe que les galeries API System de Biomrieux, comme API 50. 4 - Transformation de l'ADN bicatnaire en ADN un brin.

2 GNOMES - ADAPTATIONS - COMMUNICATIONS

77

statistique, de la pluralit de ces mutations et de leur importance au cours du temps. La prsence des IS est d'ailleurs responsable d'une partie des variations constates, et nous verrons ultrieurement pourquoi. Les expriences d'volution en chambre ont toutes montr que le gnome bactrien tait extraordinairement plastique en absence de tout lment gntique tranger. la base est la comptitivit des cellules et leur volution par slection. On mme se demander pourquoi le gnome n'volue pas plus vite et pourquoi les mutations ne sont pas plus nombreuses. Or l'intgrit du gnome, en l'occurrence de l'ADN, est surveile constamment dans la cellule par diverses protines, les erreurs ventuelles, qui se traduisent gnralement par la perte d'une base ou un dfaut d'appariement au cours de la rplication, tant rpares par des systmes complexes. L'exactitude des copies est tout aussi importante dans nos ordinateurs quand nous enregistrons ou recopions un fichier ! On citera seulement deux types de lsion dans l'ADN. La premire est d'ordre chimique, la plus classique tant l'action photochimique de l'ultraviolet. Cette lsion dclenche notamment l'induction d'un systme de rparation qu'on appelle la rponse SOS*. Elle induit l'expression de nombreux gnes qui consistent rparer un dfaut dans un brin d'ADN, exciser la partie malade et refaire la partie manquante. Les bactries ont plusieurs systmes de rparation qui se compltent et mettent en commun certains facteurs. Un cas particulirement intressant est celui des protines MutS, MutL et MutH. Nous nous limiterons ici cet exemple. Ces protines sont charges de corriger une erreur de rplication, l o une base errone aurait t place en face du modle. Par exemple A en face de C au lieu de G. La protine MutS reconnat le dfaut d'appariement, active MutH qui est une endonuclale et MutL qui dcide sur quel brin aura lieu la rparation. Cette dtection suivie de rparation n'a pas lieu n'importe quand. Elle survient de prfrence aprs le passage de la fourche de rplication, o le brin d'ADN nouveau est appari au brin parental par une exacte complmentarit. Si un dfaut survient, le systme Mut doit tre capable de reconnatre le nouveau et l'ancien, puisqu'il s'agit de remplacer une base qui n'est pas sa place. Si l'enzyme se "trompait", elle provoquerait un changement dans le brin parental et serait cause d'une mutation. Comment les deux brins sont-ils distingus ? Par le systme Dam. Il est fond sur la prsence de nombreux motifs GATC, chelonns le long de l'ADN. Cette petite squence est symtrique, elle se lit dans les deux sens. Chaque site GATC se prsente au mme niveau sur les deux brins d'ADN. Il est la cible d'une mthylase, code par le gne dam, qui mthyle l'adnine ces positions. Quelle est la signification de cette opration ? Quand la rplication de l'ADN dpasse ce motif, il y a sparation des brins parentaux qui emmnent chacun leurs sites GATC mthyls. Le passage de la fourche de rplication fait donc apparatre des motifs dam nouveaux, qui n'ont pas encore eu le temps de se faire mthyler. Ils le seront au bout de quelques minutes mais la prsence d'adnine non mthyle est un signal qui veut dire que la rplication vient d'avoir lieu cet endroit.

78

BIODGRADATIONS ET MTABOLISMES

5' 3'

* GATC
CTAG

3' 5'

5' 3'

G T C

*A TA G
site dam temporairement hmimthyl

site dam doublement mthyl

G C A T T A C * G

Rgulation par mthylation


Un site GATC non mthyl sert de motif de reconnaissance MutS pour distinguer le brin nouveau du brin parental. Les dfauts que MutS est charge de dtecter ne se trouvent pas ncessairement au voisinage immdiat. MutS est une protine dimre dote d'une structure flexible. Elle fait plusieurs choses : se lier l'ADN, reconnatre un dfaut, lier et hydrolyser de l'ATP, puis aprs avoir rencontr un dfaut, lier l'ATPase MutL, et l'endonuclase MutH. C'est une mcanique molculaire trs intressante car on connat la structure de ces diffrentes protines. MutS (2 811 rsidus) a une affinit naturelle pour l'ADN, mais cette affinit devient 20 fois plus forte quand elle rencontre un dfaut qui se traduit par une dformation de la double hlice d'ADN. MutS est le dtecteur. La protine est en mme temps une ATPase. La rencontre d'un dfaut lui fait lier de l'ATP. Elle subit un changement de conformation qui lui permet de se cramponner l'ADN et de coulisser sur sa longueur, tout en hydrolysant de l'ATP. On pense que cette consommation d'nergie sert de moteur ce dplacement de la protine, mais le mcanisme exact est encore dbattu. MutS est donc une protine qui patrouille la longueur de l'ADN jusqu' ce qu'elle rencontre un dfaut. Ces mouvements molculaires ncessitent de l'nergie apporte par l'ATP. La structure dtaille de MutS a t publie et permet de se rendre compte du fonctionnement de l'enzyme [5].
attachement de MutL et MutH site "clamp"

ADN
site de reconnaissance connecteur

ATPase

a - Complexe form avec l'ADN

b - Sous-unit isole

MutS sur l'ADN

2 GNOMES - ADAPTATIONS - COMMUNICATIONS

79

Les deux sous-units de la protine sont vues sur le schma structural a en direction de l'axe de l'ADN. Elles sont embotes de faon lgrement dissymtrique l o l'ADN prsente une distorsion structurale due une base non apparie. La protine s'accroche l'ADN par des portions flexibles formant le "clamp", indiqu sur la structure d'une sous-unit en b. Il y a un site pour l'ATP par sous-unit dans une rgion o les deux parties sont en contact, et la partie appele connecteur jouerait le rle de courroie de transmission entre les deux extrmits. La rparation fonctionnerait comme ceci. La liaison de MutS avec une anomalie sur l'ADN localement tordu dclencherait un changement conformationnel autorisant la liaison avec l'ATP. Une protine partenaire qui est elle-mme une ATPase, MutL, serait alors active [6] en venant s'accoler MutS et stabiliserait son attachement l'ADN. Elle est accompagne du troisime larron [7], MutH. Le complexe form, MutS-MutL-MutH se dplacerait dans un sens ou dans l'autre le long de l'ADN, jusqu' rencontrer une squence GATC dont il a t question plus haut. Si le site contient un GATC non mthyl, celui-ci est coup par l'endonuclase H. D'autres protines vont alors parachever le travail. Une hlicase dbobine l'ADN coup sur un brin, en direction de la zone malade, des exonuclases dcapent toute cette partie et mme un peu au-del. Une nouvelle synthse rparatrice par la polymrase III a lieu, et la ligase fait la soudure.
ADN

*
GATC MutS MutL

*
MutH + ATP exonuclase polymrase III ligase ADN rpar

Les bactries mutes dans leur gne mutS restent viables, mais prsentent un taux de mutation accru. Ce systme un rle majeur dans la rparation des erreurs de rplication chez E. coli, mais n'est certainement pas spcifique cette espce. MutS est le chef de file d'une famille structurale de protines rpandue chez les procaryotes et les eucaryotes et toutes les espces vivantes pourraient rparer leur ADN sur un principe similaire. Les rares mutations qui chapent la rparation ont une fonction utile. Elle est sans consquence dans une population de milliards d'individus et le mutant a toute chance d'tre limin. Mais si une mutation tire le bon numro, celui qui va lui permettre par exemple de dgrader un produit nouveau du milieu, l'avantage slectif sera tel que le mutant inondera rapidement de sa descendance la population, et ce sera un facteur d'adaptation considrable de celle-ci.

80

BIODGRADATIONS ET MTABOLISMES

2.2 - PROTOMIQUE ET COMPLEXES MULTI-PROTIQUES


Alors que la liste des gnomes compltement squencs ne cesse de s'allonger pour atteindre la centaine, des avances considrables ont eu lieu dans la protomique, qui est l'tude des protines d'un organisme dans leur ensemble, ainsi que l'examen de toutes les interactions qu'elles prsentent entre elles. Chaque protine n'est pas une pice isole travaillant pour son propre compte dans le contexte cellulaire, mais peut s'associer de faon temporaire ou permanente d'autres en formant des units fonctionnelles plurivalentes, pouvant par exemple catalyser, lorsque chaque partenaire est une enzyme, une succession de ractions mtaboliques dans le mme mtabolisme. L'existence de complexes multi-enzymatiques a t reconnue depuis longtemps. Dans les cas les plus sophistiqus s'observent des protines haute masse molculaire dont les chanes sont formes de plusieurs domaines, chacun d'eux renfermant un site catalytique distinct. Un exemple classique est le complexe de synthse des acides gras saturs chez la levure et les mammifres, o 7 ractions catalyses soit autant de sites enzymatiques sont regroups dans une mme macromolcule. Dans d'autres cas l'association est non covalente. Deux protines peuvent s'associer ainsi la faveur d'un quilibre entre le complexe form et les entits spares. La formation du complexe est favorise en milieu concentr comme celui du cytoplasme cellulaire. La dilution encourage au contraire la sparation, comme dans les manuvres d'extraction et de purification courantes. C'est pourquoi beaucoup d'associations sont perdues dans l'exprimentation habituelle. La preuve de l'existence du complexe repose gnralement sur l'apparition d'une proprit nouvelle que les protines n'ont pas lorsqu'elles ne sont pas associes. L'analyse biochimique de ces problmes est souvent laborieuse, la slection des mutants gntiques appropris n'est pas toujours facile ni mme ralisable. Un grand progrs a t ralis sur la levure. Son gnome contient plus de 6000 gnes. Le but est de rechercher les relations spcifiques entre protines, par des contacts qui ne se font pas au hasard mais impliquent une connection la fois structurale et fonctionnelle. L'ide est symbolise par un dessin en forme de diagramme. Certaines protines fonctionnent en solitaire, d'autres, en majorit, sont relies fonctionnellement 3,4 partenaires et mme davantage. La consquence est trs importante. La dotation de la cellule en protines, son protome, apparat comme un norme rseau o certaines protines occupent des nuds, et ont probablement une importance critique. Comme par hasard, toute mutation concernant l'un de ces nuds risque d'avoir des incidences beaucoup plus graves que les mutations touchant les protines priphriques par rapport au rseau. On a mme compar le principe de ces rseaux la carte d'Internet.

2 GNOMES - ADAPTATIONS - COMMUNICATIONS

81

Consquences immdiates : chaque mutation sur l'un des nuds risque d'tre ltale pour la cellule (cercles foncs), et le taux d'volution des protines correspondantes sera beaucoup plus lent que pour les autres. Comme une mutation leur niveau a une probabilit trs grande de lser une ou plusieurs relations essentielles, le conservatisme de leur squence et de leur structure nen sera que plus marqu. La tche de dtecter les interactions au sein d'un trs grand nombre de produits serait paru premire vue insurmontable. Peter UETZ et coll. [8] ont obtenu environ 6000 transformants de levure par insertion d'un nombre quivalent de gnes ou d'ORF, soit des chantillons de la quasi-totalit du gnome. La technique de base utilise est celle des doubles hybrides*. Son principe est sommairement expliqu en glossaire avec un croquis explicatif. Une levure recombinante est capable d'exprimer la -galactosidase du colibacille 5 condition de possder un activateur de transcription appel GAL4. Ce facteur permet l'amorage de la transcription grce deux domaines structuraux, l'un qui interagit avec l'ARN-polymrase, l'autre qui se lie l'ADN. GAL1-LacZ est un gne recombin artificiellement dont l'expression se traduit par des colonies de couleur bleue sur les botes de milieu, alors que les autres restent blanches. Pour que la transcription ait lieu, il faut que l'ARN-polymrase s'installe en amont sur le site promoteur. Elle peut le faire avec l'aide de l'activateur GAL4 constitu de plusieurs domaines, qui s'attache en amont sur l'ADN sur un site UAS*. L'ide est de remplacer cet activateur par deux protines, l'une contenant le domaine charg de se lier l'ADN et soud une protine X, l'autre contenant le domaine activateur soud une protine Y. Lorsque X et Y peuvent s'associer ensemble parce qu'elles ont une affinit lune pour lautre, elles remplacent toute la partie centrale de l'activateur. La protine chimrique ainsi reconstitue peut jouer le rle d'activateur de transcription. Le criblage de toutes les combinaisons possibles (un norme travail fait par des techniques exprimentales automatises) a permis de dtecter les protines qui peuvent s'apparier ainsi et d'en faire un catalogue. Bien souvent, une interprtation logique de ces associations est possible quand elles concernent deux enzymes impliques dans un mme mtabolisme. Dans d'autres cas, il peut s'agir d'lments de fonction inconnue, qu'on peut deviner cependant si on connat lune des protines partenaires. Au total 957 interactions ont t dtectes impliquant plus de mille protines ! Ainsi se dgage peu peu l'norme architecture en rseau, o certaines protines occupent les nuds d'un vaste filet. La grande question est de savoir si l'agencement gnral est plus ou moins conserv d'un organisme l'autre, et l'avenir nous l'apprendra. On comprend mieux pourquoi certaines protines sont affectes d'un grand conservatisme, des bactries la levure et l'homme. Elles occupent les "nuds" associant plusieurs partenaires. Toute modification de l'une des protines concernes devrait s'accompagner de changements parallles et conformes dans les autres protines, ce qui est trs peu probable statistiquement. 5 - La synthse de l'enzyme se traduit par un test trs simple sur bote, donne des colonies bleues, les autres restant blanches.

82

BIODGRADATIONS ET MTABOLISMES

D'autres mthodologies sont bases sur la spectromtrie de masse. L encore sont testes en nombre norme par un criblage en partie robotis les diffrentes combinaisons possibles. Voici le principe. On veut savoir avec quelles protines de la levure un des composants peut s'associer. On va se servir de celui-ci comme hameon. Dans un premier temps, on allonge lgrement sa squence par recombinaison gntique de faon lui faire porter un fragment qui sera reconnu spcifiquement par un gel d'affinit* (voir chromatographie d'affinit*). C'est la mthode du TAP-tag* [9]. La protine, sur laquelle a t soud une "tiquette" par une partie flexible, est retenue sur gel chromatographique. Si cette protine est associe des partenaires, c'est tout le complexe qui est fix avec toutes ses composantes. Il s'agit donc ensuite de rcuprer le complexe par coupure enzymatique du bras flexible porteur de l'tiquette, de le dissocier et d'en reprer les morceaux spars par une lectrophorse. L'identification des fragments un un se fait par spectromtrie de masse [10].
protine "hameon" tiquette (TAPtag) groupe rcepteur greff sur le polymre protines associes polymre du support chromatographique (billes de gel)

complexe retenu sur le support

Pigeage des associations


Cet norme travail de criblage a port sur 1739 gnes, identifis par leur squence et leur homologie avec des gnes connus chez d'autres espces dont l'homme. Les grands progrs faits dans la spectromtrie de masse des protines depuis une quinzaine d'annes ont facilit le squenage et l'identification de tous les peptides en sappuyant sur des analyses automatises 6. Plus de 200 complexes ont t identifis, avec une taille allant de 2 83 composants relis une mme protine, la moyenne tant de 12. Plus de la moiti des complexes avaient au plus 5 protines. De faon gnrale les regroupements concernaient tous les grands secteurs de l'conomie cellulaire comme l'indique le diagramme.

6 - Les peptides sont dcoups en fragments dfinis, la spectromtrie de masse permet de reconstituer leur squence acide amin par acide amin, et les rsultats sont analyss par ordinateur.

2 GNOMES - ADAPTATIONS - COMMUNICATIONS


1 - Cycle cellulaire 2 3 8 4 7 6 5 2 - Polarit cellulaire et structure 3 - Mtabolisme intermdiaire et nergtique 4 - Synthse et renouvellement des membranes 5 - Synthse des protines 6 - Transport (ARN, protines) 7 - Mtabolisme de lARN 8 - Rgulations 9 - Transcription, rparation dADN, chromatine

83

1 9

Distribution par fonction des complexes de la levure


Les amas de protines contractant des associations entre elles sont dtects par les techniques cites, mais ne sont probablement pas des groupes tanches juxtaposs les uns aux autres. Au contraire les communications entre groupes sont visibles quand une mme protine se retrouve associe plusieurs dentre eux. Ainsi les protines rgulatrices semblent avoir une rpartition complexe. Nous avons bien la notion d'un vritable et immense rseau, comme cit antrieurement, dont toutes les mailles ne sont pas ncessairement connues. Les connections entre les groupes sont considrables. En outre cette volumineuse analyse a permis de dterminer la fonction hautement probable de gnes dont on ignorait totalement l'identit. D'autres auteurs ont mis en vidence de nombreux complexes multiprotiques chez la levure par immunoprcipitation et spectromtrie de masse [11]. Ils ont dtect environ 3600 associations couvrant le quart du protome de levure. Des observations passionnantes permettent de comparer cette extraordinaire rpartition avec le gnome humain. Les protines ayant leurs quivalents orthologues chez l'homme (par comparaison des squences et fonctions) sont prcisment celles qui contractent le plus grand nombre d'associations, et dont l'importance stratgique pour la vie cellulaire est probablement la plus grande. L'existence des normes rseaux de la protomique n'exclut pas les apports gntiques extrieurs. L'entre d'un plasmide porteur de tous les gnes d'une voie mtabolique, par exemple celle qui permet le dgradation du tolune, ne fait que surajouter des protines nouvelles dont l'intgration au rseau existant n'est sans doute pas ncessaire. Le vritable nombre des interactions entre protines chez la levure atteindrait au moins 30 000. Malgr ces avances remarquables, des rserves prudentes doivent tre mises. Les auteurs reconnaissent l'existence d'un bruit de fond non spcifique qui ferait apparatre de fausses interactions. D'autres cas dmontrs par les mthodes traditionnelles ne sont pas dtects. La prcision est donc loin d'tre absolue, mais les perspectives sont trs grandes. Ce volet de la recherche a permis de remettre au premier plan une notion banale, qui est celle de la forte concentration des macromolcules dans une cellule vivante. En fait les enzymes et autres facteurs qui actionnent la chimie cellulaire fonctionnent dans une pure organique concentre qui limite les diffusions et modifie les cintiques ractionnelles. On estime que la concentration des protines et acides nucliques dans

84

BIODGRADATIONS ET MTABOLISMES

une cellule de colibacille quivaut 300-400 g/L. C'est norme par rapport aux conditions habituelles de laboratoire, o ces macromolcules sont manipules des concentrations 100 500 fois plus faibles ! Or les hautes concentrations intracellulaires ont plusieurs rpercussions. Les conditions sont trs loignes des solutions idales examines gnralement en thermodynamique des quilibres. Dans un entassement de macromolcules se produit un effet d'exclusion du solvant conduisant une augmentation des activits d'un facteur d'autant plus considrable que les masses molculaires sont plus leves et l'exclusion du solvant plus marque. L'encombrement du milieu dplace les constantes d'quilibre des associations-dissociations. Il en rsulte qu'en milieu hyperconcentr les associations entre protines sont favorises, ainsi que les dimrisations, oligomrisations. Le systme tendra voluer dans le sens qui diminue l'influence du solvant, rend les protines plus compactes, favorise leur repliment et facilite les associations. La stabilit des protines tend augmenter. Enfin les effets cintiques sur les ractions sont complexes, car l'augmentation d'activit tend les acclrer, tandis que les diffusions de substrats sont entraves. On admet qu'il existe un optimum, celui-ci est difficile dterminer exprimentalement 7. En somme la ractivit intracellulaire des protines peut tre beaucoup plus leve que celle qu'on mesure habituellement dans le tube essai. Ces aspects importants sont discuts dans un article de R.J ELLIS [12]. Ils laissent les biochimistes raliser que pendant longtemps ils ont pu faire fausse route, en tudiant les protines dans des conditions loignes de leur cadre naturel. Les avances de la protomique et la dcouverte des nombreuses associations spcifiques entre protines jettent une lumire nouvelle sur ces problmes.

2.3 - TRANSFERTS GNTIQUES HORIZONTAUX


Les cellules de micro-organismes ne sont pas des botes tanches tout change d'information gntique, qui transmetterait leur descendance une bibliothque inviolable de gnes. Les transferts gntiques horizontaux mettent en jeu des changes de cellule cellule. Le phnomne s'est certainement produit sur une vaste chelle au cours de l'volution. Des changes considrables ont eu lieu galement au sein des cellules des eucaryotes entre l'ADN de leurs plastes, de leurs mitochondries et du noyau. Dans les bactries du sol et des milieux aquatiques, il est devenu vident que l'acquisition en bloc de nouvelles proprits tait possible, venant augmenter les capacits d'adaptation et de biodgradation des diverses lignes. L'acquisition horizontale d'information gntique a notamment attir l'attention par la prolifration de germes pathognes qui prsentaient des rsistances multiples aux antibiotiques. Il est devenu vident que l'acquisition rapide et simultane de multiples facteurs ne pouvait pas se faire par le jeu de

7 - On peut imiter ces conditions dans des solutions de protines in vitro en ajoutant des "crowding agents", macromolcules provoquant l'effet d'exclusion : polythylnes glycols, Ficoll, albumine.

2 GNOMES - ADAPTATIONS - COMMUNICATIONS

85

mutations ordinaires survenues au hasard, mais correspondait l'acquisition globale de segments gntiques importants maintenus dans la descendance par un avantage slectif [13]. Comment se rendre compte de l'tendue de ces transferts ? Un outil capital est l'observation des squences. L'apport d'ADN se fait principalement par plasmides et transposons, dont les caractres seront revus plus loin. Les gnomes bactriens prsentent des longueurs trs ingales. Le diagramme suivant compare les dimensions de quelques gnomes entirement squencs [14]. Les astrisques notent des archaebactries. On peut voir la petite proportion des gnes extrieurs sous forme d'ADN tranger (surtout plasmidique) ou d'ADN mobile (transposons) intgr au gnome principal.
Escherichia coli Mycobacterium tuberculosis Bacillus subtilis Synechocystis PC6803 Deinococcus radiodurans Archeoglobus fulgidus Thermotoga maritima Pyrococcus horikoshii Methanobacterium therm. Haemophilus influenzae Helicobacter pylori Methanococcus jannaschii Treponema pallidum Borrelia burgdorferi Mycoplasma pneumoniae Mycoplasma genitalium
0

* * * * ADN natif ADN tranger ADN mobile

1000

2000

3000

4000

squences codantes (kb)

Longueur de l'ADN codant pour des protines


Cette figure reprise et modifie de l'article de Ochman et coll., ne peut pas donner une vision moyenne de l'ensemble des espces bactriennes. Les efforts de squenage ont port en priorit sur les espces dont on connaissait bien la gntique (le colibacille), qui avaient des gnomes courts (mycoplasmes), qui vivaient dans des environnements exceptionnels (thermophiles) ou qui taient pathognes (trponmes). On peut voir malgr tout que les transferts horizontaux reconnus comme vidents ne sont pas rares. Divers auteurs admettent que, dans le chromosome du colibacille, ils atteignent au minimum 10 16%. Les apports extrieurs les plus visibles sont les plus rcents. Une souche bnigne d'Escherichia coli s'est transforme en pathogne dangereux par l'acquisition en une seule fois d'un lot de pathogncit appel Pais*. De mme l'acquisition des rsistances multiples est considre depuis longtemps comme l'entre de squences entires plutt qu'une srie de mutations ponctuelles affectant des gnes prexistants. Le gnome complet du colibacille MG1655 contient 4 639 221 pdb [15], et a t pass au crible pour dtecter des squences exognes, en utilisant une analyse statistique recherchant les dviations en contenu G + C* et dans l'emploi des codons [16]. L'analyse suggre que 755 cadres de lecture (ORF) sur 4288 sont d'origine

86

BIODGRADATIONS ET MTABOLISMES

externe, ce qui reprsente un total de 548 kb rpartis sur tout le chromosome. Ces insertions se seraient produites un grand nombre de fois au cours de l'volution, et leur dtection ne reprsente peut-tre que la partie merge de l'iceberg, parce que les apports les plus anciens auraient vu leurs particularits effaces. Diffrentes constatations ont donn lieu spculation sur l'histoire du gnome de E. coli. Par exemple, bon nombre d'insertions semblent avoir t ralises proximit immdiate d'un gne commandant la synthse d'un ARNt, et c'est aussi leur voisinage que s'insrent des coliphages lysognes. Ce phnomne se retrouve dans une dizaine d'espces diffrentes. En outre les diffrentes squences d'insertion (IS) trouves dans le gnome du colibacille sont situes pour la plupart au voisinage de l'ADN d'importation. Ces squences d'insertion, sur lesquelles nous reviendrons, sont essentielles la mobilit de l'ADN par transposition. Par consquent les transferts horizontaux d'ADN ont pu s'effectuer la fois par l'apport des virus et des IS. La taille du gnome tend donc augmenter, mais se voit limiter par excisions et dltions liminant les squences nouvelles. Celles-ci seront maintenues nanmoins si elles apportent un avantage slectif suffisant. Le gnome bactrien, au moins celui du colibacille, parat donc extraordinairement dynamique. Des apports extrieurs ont introduit dans la cellule des gnes fonctionnels et des oprons l'origine de sauts importants dans les performances, notamment dans les voies de biodgradation. On admet que l'exprience accumule par l'observation du colibacille, bien qu'il s'agisse d'une espce assez fortement spcialise, nous apporte des indications prcieuses sur l'volution des bactries du sol et des eaux, et le dveloppement de la microflore dans l'environnement. Ces phnomnes intressent aussi particulirement l'tude des maladies infectieuses nes de l'acquisition d'un pouvoir pathogne par les souches dotes d'lots de pathogncit (Pais). Quels sont les mcanismes moteurs des acquisitions de gnes trangers dans la nature ? Les trois principaux sont la transformation, l'infection virale et la conjugaison. Dans une transformation, la cellule reoit des portions d'ADN nu deux conditions. Le nouvel ADN doit pouvoir s'intgrer dans son gnome et la bactrie doit se trouver dans un tat de "comptence" qui est soit permanent (Neisseria gonorrhoeae, Haemophilus influenzae), soit obtenu certains stades de dveloppement (Bacillus subtilis). Ce mode d'acquisition permet aux bactries de renouveler leur stock gntique partir des dbris d'autres cellules. Dans le cas d'Haemophilus, l'ADN doit provenir de cellules identiques ou de souches apparentes. L'analyse du gnome a permis de dcouvrir un caractre trs curieux. L'ADN exogne n'est accept qu' l'aide d'une squence de reconnaissance dite des 9 bases : AAGTGCGGT. Ce motif est prsent 1465 fois dans tout le gnome, au sein d'un consensus plus grand (29 pdb) termin par une rgion riche en A/T. La spcificit de la transformation semble reposer sur ce dispositif [17]. Une infection par bactriophage peut injecter dans l'hte des gnes provenant d'une autre cellule. Ces derniers sont perptus dans la descendance si l'ADN apport par le virus, pouvant atteindre 100 kb, peut s'installer dans l'ADN de l'hte sous forme de prophage, lequel se transmet la descendance aussi longtemps que les fonctions de multiplication du virus restent dormantes (lysognie). Le

2 GNOMES - ADAPTATIONS - COMMUNICATIONS

87

prophage peut avoir amen avec lui des gnes provenant d'autres cellules infectes, et c'est ce qu'on appelle la transduction. Les prophages sont nombreux dans les gnomes bactriens, ils correspondent souvent d'anciens virus devenus incapables de clore leur cycle. Des prophages sont prsents dans beaucoup d'espces virulentes dont Vibrio cholerae et Yersinia pestis. La conjugaison est comparable une sexualit rudimentaire, o un contact physique entre un donneur et un accepteur se traduit par la transmission d'un ADN de lun l'autre. Un cas particulirement important est le transfert des plasmides, units pouvant se perptuer dans la cellule hte en rplicons autonomes, s'intgrer au chromosome ou changer des parties avec celui-ci par recombinaison. Les proprits les plus communment apportes par un transfert gntique horizontal sont multiples. La premire est la rsistance des antibiotiques ou des facteurs toxiques. Les espces microbiennes de l'environnement sont soumises une guerre chimique continuelle qui favorise la slection de moyens de dfense et l'acquisition de gnes codant pour des protines capables de neutraliser les facteurs adverses, par exemple des enzymes (comme la pnicillinase). Les gnes acquis sont souvent cods par des lments mobiles facilement transmissibles, plasmides, et transposons, ventuellement intgrs ou facilement limins ds que le besoin ne s'en fait plus sentir. Les transposons et intgrons pouvant voyager d'un segment d'ADN un autre font partie de l'ADN mobile et transportent volontiers des gnes de rsistance. Les plasmides sont les vecteurs les plus courants. D'autres transferts concernent les facteurs de virulence. Tout comme l'acquisition d'une rsistance aux antibiotiques, celle des facteurs de virulence permet une espce de se maintenir dans un environnement hostile et lui confre des proprits agressives. Il s'agit souvent d'units gntiques importantes qui apportent avec elles leur propre mcanisme rgulateur. Les facteurs de virulence codent pour des toxines, des hmolysines, des protines adhsives (adhsines), des protases, etc. Ils peuvent tre vhiculs par de grands plasmides ou tre apports par des phages comme dans le cas du vibrion du cholra. L'apparition d'une virulence peut aussi provenir, non pas de l'acquisition de gnes nouveaux, mais au contraire de la disparition d'un facteur qui empchait tout comportement pathogne [18]. Les entrobactries ont une protase de surface, OmpT, qui est prsente chez les colibacilles non pathognes mais absente chez Shigella. Cette protase diminue la virulence en s'attaquant la protine VirG, dont Shigella a besoin pour sa dissmination. Ces bactries manquent aussi de CadA, une lysine dcarboxylase qui inhibe le processus infectieux en formant de la cadavrine. Le cas de Shigella est intressant au regard de l'volution, car ces bactries partagent un anctre commun avec le colibacille dont elles sont particulirement proches. Les Shigella ont volu de leur ct. Elles sont devenues des formes pathognes par acquisition d'un trs grand plasmide de virulence (230 kb) et sur le chromosome de plusieurs Pais* dsigns par SHI-1, SHI-2, en remplacement de rgions entires contenant ompT et cadA. Le dessin voque ces transformations (dans un ordre chronologique arbitraire) :

88
SH1-2 SH1-1

BIODGRADATIONS ET MTABOLISMES
plasmide de virulence SH1-1

ompT anctre de E. coli - Shigella

cadA

SH1-2 Shigella flexneri

Acquisition d'une virulence


On connat au moins une douzaine de plasmides de virulence et prs d'une trentaine d'lots de pathogncit chez prs d'une vingtaine d'espces diffrentes [19]. Le SHI-1 de Shigella dtermine la formation d'une entrotoxine et d'une protase, le SHI-2 une synthse d'un transporteur et d'un facteur pour piger le fer qui est arobactine. Le squenage de nouveaux gnomes rvle des situations extraordinaires. Des espces dpourvues de toute action pathogne contiennent des squences voisines des Pais, souvent placs ct de gnes d'ARNt et appeles lots gnomiques. Ces diverses squences rapportes ne sont pas toutes inertes. Elles codent ventuellement pour des protines, des facteurs de symbiose, des transporteurs du fer, une rsistance des antibiotiques ou une dgradation de xnobiotiques. On a l'impression que ces lments ajouts et stabiliss par slection naturelle sont des outils anti-stress, et que la virulence est elle-mme une rponse un stress impos par le combat avec l'hte pour rcuprer du fer. Il apparat que la marge est troite entre une souche inoffensive de l'environnement et une nouvelle forme pathogne. On s'en est rendu compte avec le colibacille. De nouvelles souches virulentes appeles pathotypes sont hmolytiques ou dclenchent des infections hmorragiques intestinales, et sont porteuses de Pais prs du gne selC, qui code pour un ARNt 8. Des espces banales de l'environnement peuvent devenir potentiellement pathognes. Le Listeria monocytogenes prsent en particulier dans les matires en dcomposition est responsable des listrioses qui sont de graves infections d'origine alimentaire. Un transfert qui nous intresse particulirement ici est l'acquisition de proprits mtaboliques. Des germes courants obtiennent les outils leur permettant de coloniser de nouvelles niches cologiques et de profiter des lieux contamins par des xnobiotiques. L'apport de gnes ou d'oprons entiers a sans doute t courante au cours de l'volution. Le colibacille et Salmonella enterica sont des espces trs voisines, l'une a acquis les gnes d'utilisation du lactose et une meilleure adaptation coloniser l'intestin des mammifres, l'autre a reu le pouvoir d'utiliser le citrate. Dans tous les cas o deux espces voisines se distinguent comme ici par deux proprits divergentes, la modification s'observe dans une rgion du chromosome qui n'a pas d'quivalent dans l'autre espce. En gnral l'acquisition d'une voie mtabolique partielle ou complte s'effectue sous forme de gnes groups apports par un plasmide. Il est rare qu'un plasmide s'intgre dans le chromosome autrement que par des recombinaisons de certaines parties ou par 8 - Cet ARNt a un caractre exceptionnel, parce qu'il participe l'insertion de la slnocystine dans certaines enzymes (voir slnocystine*).

2 GNOMES - ADAPTATIONS - COMMUNICATIONS

89

des transpositions. Une condition importante pour que la voie importe fonctionne dans son nouvel environnement est la prsence des modes de rglages essentiels, savoir l'induction et la rpression des gnes en fonction des conditions. Les nouveaux gnes sont donc apports groups en un ou plusieurs oprons accompagns de gnes rgulateurs. Un transfert gntique horizontal par le biais de grandes units comme les plasmides offre un cadre favorable pour l'acquisition globale d'une nouvelle aptitude. Les exemples abondent en examinant les biodgradations. La cohabitation des espces en petit nombre dans des milieux difficiles, comme les sources thermales, favorise probablement des changes importants, comme le suggre la comparaison de Thermotoga maritima avec plusieurs archaebactries [20]. Les transferts paraissent possibles entre organismes n'ayant aucune parent entre eux. Les gnes lis la transcription, la traduction et la rplications sont beaucoup plus rarement transmis que les gnes lis aux fonctions mtaboliques. Les premiers sont les gnes d'information, ils forment des ensembles complexes et les protines produites interagissent troitement les unes avec les autres. On peut donc concevoir que leur exportation en bloc a un caractre beaucoup plus acrobatique, avec un taux de russite faible. La seconde catgorie de gnes concernent des protines de "mnage" (housekeeping proteins) qui agissent seules ou en comit restreint. Leur acquisition est donc moins susceptible de provoquer de grands bouleversements dans le mtabolisme cellulaire. Des constatations intressantes ont t faites partir de Bacillus subtilis, bactrie Gram-positive du groupe des firmicutes, o l'on trouve galement les Clostridium et Streptococcus. Le gnome complet a t publi par des chercheurs de l'Institut Pasteur [21]. Il a l'intrt de concerner une espce trs commune de l'environnement, connue pour diverses biodgradations, figurant dans un groupe qui occupe des niches cologiques varies (certaines espces sont des pathognes). Le gnome a une longueur de 4 214 810 pdb, contient prs de 4100 gnes codant pour des protines, dont beaucoup sont impliques dans la dgradation de molcules d'origine vgtale. Les Bacillus scrtent dans le milieu extrieur une palette de protines comme des protases, dont certaines sont exploites industriellement. Le gnome de B. subtilis rvle 5 signal peptidases* diffrentes sans doute en rapport avec ces scrtions. Il y a aussi des gnes du mtabolisme secondaire, comme ceux qui gnrent des antibiotiques. On dcouvre surtout une dizaine de prophages ou leurs traces, laissant supposer que les transferts gntiques horizontaux ont t abondants et se sont produits la faveur d'infections virales. En conclusion, la gnomique laisse merger une nouvelle conception de la sparation des espces et de leur volution chez les procaryotes, faisant largement appel des transferts gntiques horizontaux capables de se produire grande chelle.

90

BIODGRADATIONS ET MTABOLISMES

2.4 - PLASMIDES
Cette section et la suivante seront vues comme les rsums de notions dcrites dans les manuels de gntique et de microbiologie. Nous l'utiliserons comme aidemmoire car nous en avons besoin pour comprendre la dynamique adaptative des micro-organismes face aux biodgradations. Les plasmides sont communs chez les bactries et se prsentent gnralement comme des units circulaires d'ADN dont la taille est trs variable de 4 kb plus de 100 kb (mgaplasmides), indpendantes du gnome principal ou chromosome et rpliques en mme temps que lui au cours des divisions cellulaires. Chaque cellule bactrienne peut en contenir un ou plusieurs exemplaires. Un plasmide contient les signaux ncessaires sa reproduction sous forme d'units identiques et constitue un rplicon. Le gnome bactrien est lui-mme un norme rplicon, ou "chromosome". Un ADN exogne qui ne respecterait pas ces conditions serait rapidement dtruit. Les gnes acquis de l'extrieur doivent donc tre intgrs un rplicon. Les micro-organismes ont le pouvoir fantastique de modifier leur patrimoine gntique par l'accueil de nouveaux rplicons qui peuvent s'intgrer par recombinaison au chromosome ou se laisser propager comme units indpendantes. Les plasmides se rpandent dans une population par contacts entre cellules au cours d'une conjugaison : un donneur rplique son plasmide, garde une copie et injecte l'autre dans la cellule partenaire. Il en rsulte une propagation dans la population la manire dune infection virale. La prsence des plasmides dans une souche bactrienne est rvle par sparation physique de leur ADN qui est de petite taille et prsent sous forme d'une fraction homogne par rapport l'ADN chromosomique fragment en morceaux de taille htrogne. Sa composition en G + C est ventuellement diffrente, et les cercles plasmidiques non dgrads sont affects de super-tours rendant les molcules plus compactes. Les plasmides sont galement dtects par des sondes nucliques spcifiques, et spars par lectrophorse ou ultracentrifugation. La reconnaissance et la fragmentation des plasmides par nuclases de restriction sont, comme on le sait, des piliers essentiels de la gntique bactrienne moderne. On notera au passage que des organismes eucaryotes, notamment les levures [22] et les plantes [23], peuvent hberger aussi des plasmides. Voici trs sommairement quelques points de repre supplmentaires sur les plasmides. On peut distinguer des caractres communs tous les plasmides, et ceux qui ne se rencontrent pas dans tous mais dont l'importance mrite d'tre mentionne. Les deux caractres fondamentaux communs sont la prsence des fonctions rplicatives et l'appartenance un groupe d'incompatibilit. La rplication exige une ou plusieurs origines de rplication* reconnues par des protines spcifiques, codes par le plasmide lui-mme ou empruntes la machinerie cellulaire, et agissant "en trans". Ce dtail permet au plasmide de se rpliquer ventuellement dans une espce diffrente qui ne reconnat pas les mmes squences origines, car il apporte ses propres outils. Cette situation est mise profit artificiellement dans les vecteurs navettes*. Tous les plasmides se rpartissent en groupes d'incompatibilit. On en connat plus d'une trentaine. Cette proprit est

2 GNOMES - ADAPTATIONS - COMMUNICATIONS

91

lie la possibilit pour un plasmide donn d'tre prsent en exemplaires multiples dans une mme cellule, o leur nombre est rgul. Quand deux plasmides en prsence appartiennent au mme groupe, le mcanisme rgulateur ne fait pas la distinction entre eux et compte en bloc le nombre total des origines. Les deux plasmides entrent donc en comptition et tendent s'exclure mutuellement dans la descendance. Le schma montre la rpartition d'un plasmide une seule copie, lorsqu'il est mis en prsence d'un second plasmide du mme groupe. Les plasmides d'un mme groupe se font concurrence, ils sont dits "gostes". Le nombre des origines reste le mme.
un seul plasmide croissance, rplication du plasmide division cellulaire +

deux plasmides du mme groupe

pas de rplication des plasmides

division cellulaire +

Les proprits particulires appartenant aux plasmides sont nombreuses. Quelques-unes ont dj t cites, notamment la prsence de gnes codant pour un mtabolisme ou un pouvoir pathogne. La plupart des plasmides utiliss en gntique molculaire vhiculent des marqueurs ou gnes de rsistance des antibiotiques qui facilitent le criblage des clones recombinants. Une autre proprit importante des plasmides est de pouvoir intgrer leur ADN par recombinaison dans le chromosome ou de s'en exciser nouveau. La recombinaison peut aussi porter sur des segments limits. La conjugaison permet aux plasmides de promouvoir leur propre propagation de cellule cellule. Ils sont alors dits conjugants (ou conjugatifs). Le plasmide du donneur renferme un site important, oriT ou mob (pour origin of transfer ou mobility). Il sert de point de dpart du transfert. En outre les gnes tra codent pour des protines qui reconnaissent oriT et assurent diffrentes fonctions, dont le rapprochement des deux cellules et leur communication par un pilus. Un mcanisme assez compliqu dclenche une rplication du plasmide partir de oriT, l'mission d'une copie vers le receveur alors que l'autre reste dans le donneur. Le schma de la conjugaison en donne le principe simplifi. L'ADN bicatnaire subit une coupure au site oriT, et se dbobine progressivement sur toute la longueur du cercle, pendant que l'un des brins est mis par un pilus de conjugaison qui forme un pont entre les deux cellules. L'autre brin reste au dpart. L'ADN monocatnaire est rpar des deux cts par une nouvelle synthse du brin complmentaire, rtablissant l'ADN bicatnaire, et celui-ci est de nouveau soud en ADN circulaire. On voit donc que ce systme de rplication, dit par "cercle roulant", fait passer l'ADN d'une cellule l'autre sous forme linaire, avant d'tre circularis nouveau l'arrive aprs la synthse complmentaire. Il peut se faire qu'un plasmide ne

92

BIODGRADATIONS ET MTABOLISMES

soit pas conjugant, mais le transfert peut tout de mme avoir lieu avec un site oriT reconnu par des facteurs tra venant d'une autre source dans le donneur.
pilus de conjugaison oriT 5

donneur

cellule rceptrice

donneur

cellule rceptrice

oriT

synthse du brin complmentaire

Conjugaison, rplication par "cercle roulant"


La conjugaison du colibacille entre cellules F+ dites mles et F dites femelles transmet le plasmide F. Elle a servi de modle historique pour comprendre ce trs important phnomne de transmission gntique [24]. Cette opration est complexe et fait intervenir une srie de facteurs diffrents. Les cellules doivent entrer en contact, tablir un pont entre les partenaires et rpliquer d'une faon programme l'ADN transmettre. Ceci exige plusieurs manipulations molculaires sur l'ADN, catalyses par des enzymes spcifiques. L'ensemble des oprations met contribution la fois des protines codes par le plasmide et des facteurs de l'hte. Il y a aussi synthse de protines de surface TraS et TraT charges d'empcher l'entre de plasmides F supplmentaires dans une cellule qui est dj devenue F+. Le plasmide n'est prsent qu' un seul exemplaire dans la bactrie et entend le rester : la place est prise ! En somme pour faire marcher tout cela, il faut prs d'une trentaine de gnes, soit environ la moiti de tous ceux qui ont t identifis sur le plasmide F. Ils sont tous groups dans une portion d'ADN d'environ 33 kb appele rgion tra. Une vingtaine de ces gnes font partie d'un trs grand opron activ par le produit du gne traJ. Les cellules F deviennent F+ aprs transfert et deviennent des donneurs leur tour. C'est donc toute la population bactrienne qui devient rapidement F+. Le plasmide F n'offre pas le cadre le plus favorable l'tude cause de sa complexit. Il existe heureusement des plasmides conjugants plus simples, comme le R388 du colibacille, d'une longueur de 33 kb. Il dtermine une rsistance aux sulfamides et la trimthoprime. Deux sries de gnes dterminent les protines de conjugaison. La premire ne code que pour trois protines, TrwA, TrwB et TrwC. Elles sont en charge des manipulations sur l'ADN et le mcanisme du "cercle roulant" dj cit. La deuxime srie de gnes code pour une dizaine de protines, de TrwD TrwM, dont la fonction est d'assurer la communication entre les deux

2 GNOMES - ADAPTATIONS - COMMUNICATIONS

93

cellules. Il en rsulte trois pices de machinerie symbolises sur le diagramme suivant. La premire est le relaxosome, un ensemble qui a pour effet de prparer l'ADN au transfert. Le deuxime est un anneau form par TrwB, reprsent de face (a) ou en coupe latrale (b). Cet hexamre constitu d'units implantes dans la membrane forme un canal central large de 8-10 nm. Enfin le translocon* est l'appareil extrieur formant un tube transporteur vers l'autre cellule [25].

ATP TrwB TrwB TrwB TrwB TrwB TrwB TrwC TrwA TrwB

translocon 3

IHF relaxosome

ATP

membrane

L'appareil de translocation
Cet ensemble fonctionne en gros comme ceci. Pour que le transfert d'ADN ait lieu, il faut que l'un des deux brins soit coup au site origine oriT sur le plasmide de dpart, et que les deux chanes soient spares : cette dnaturation de l'ADN prpare le brin qui sera expdi de l'autre ct. Pas n'importe quel brin. C'est le brin T, qui pntre dans le pont intercellulaire extrmit 3' en avant. C'est un peu ce qui se passe quand la cellule rplique son chromosome. L'ADN est dnatur partir du point origine et il se cre une fourche de rplication. Une protine spciale participe cette dnaturation et s'empare de l'un des brins de l'ADN dnatur. La protine TrwB est similaire une hlicase. Sa structure dtaille partielle a t dtermine [26]. La protine dnature l'ADN de proche en proche, s'empare de ce filament d'ADN et l'expdie par une ouverture travers la membrane tandis que l'autre sert de modle une nouvelle synthse (procd du cercle roulant). Pour faire ce travail, TrwB a besoin d'une source d'nergie et rgle le problme en hydrolysant de l'ATP chaque avance de la chane (le mode de couplage n'est pas encore bien connu). La protine TrwC a pour rle de dtortiller la double hlice (relcher les super tours), complte l'action de l'hlicase et peut s'appeler une "relaxase". La protine TrwA est un rgulateur de transcription, elle se lie l'ADN et agit comme un rpresseur. Tout ce dispositif, dont une partie est code par le plasmide, est complt par des facteurs de l'hte. Des mcanismes particuliers rglent la sgrgation des diffrentes copies d'un mme plasmide entre les cellules filles aprs division. La rpartition peut tre ce point ingale que l'une des cellules n'emporte aucun exemplaire. Exprimentalement on peut encourager la perte du plasmide par une action chimique (acridines, bromure d'thidium, novobiocine), opration appele curing. Inversement, la multiplication des cellules bien pourvues en plasmide peut tre encourage en cas d'avantage slectif important. En fait tous les plasmides ne

94

BIODGRADATIONS ET MTABOLISMES

sont pas indfiniment stables, la sgrgation des copies dans les cellules filles peut tre imparfaite et des cellules sans plasmide apparaissent dans la descendance. Elles sont conserves ou limines en fonction de la pression slective du moment. Il peut se faire que plasmides ne portent pas toutes les fonctionnalits autorisant leur rplication intracellulaire ou leur transfert par conjugaison. Ces oprations ne sont alors possibles qu'avec l'aide de facteurs appartenant d'autres lments, par exemple un plasmide tranger, un virus, ou des gnes appartenant l'hte. Donc contrairement au facteur F qui reprsente le sommet de la sophistication, beaucoup de plasmides ont besoin d'tre "aids", en particulier dans le cas des plus petits (moins de 10 kb). Sur le plan exprimental, on peut forcer l'entre d'un ADN plasmidique dans une souche rceptrice par lectroporation ou divers procds physiques ou chimiques qui ont pour effet de crer des lsions momentanes dans la membrane. C'est une possibilit essentielle pour le gnie gntique, car on peut utiliser comme vecteurs d'entre de gnes nouveaux des petits plasmides ou encore des ADN viraux, en s'affranchissement du mcanisme naturel beaucoup plus compliqu. En outre les plasmides les plus petits peuvent exister prs de 50 exemplaires dans la cellule, se rpliquent indpendamment du chromosome et permettent une amplification gntique de l'expression des gnes qu'ils renferment. Une recombinaison peut intgrer un plasmide dans le chromosome et l'information gntique insre en partie ou en totalit est transmise la descendance au fil des divisions cellulaires comme le sont les autres facteurs du gnome.
plasmide

ADN du chromosome

attachement et recombinaison

intgration complte

Intgration d'un plasmide


On pense que ce phnomne a pu jouer un rle important au cours de l'volution pour la diversification des voies mtaboliques. Une cellule peut ainsi acqurir en bloc tout un segment lui confrant des proprits nouvelles. Celles-ci ne seront pas ncessairement exploites. Il faut pour cela que l'expression des gnes nouveaux obisse un certain nombre de conditions, c'est--dire ne pas bouleverser les fonctions existantes et obir des rgulations prcises, moyennant quoi la pression slective du milieu pourra favoriser la nouvelle souche. Le squenage des gnomes a permis de se rendre compte que diverses espces doues de proprits de biodgradations ont probablement reu les gnes ncessaires aprs de telles intgrations. La disposition primitive des gnes n'a pas toujours t conserve comme un segment distinct, et a t brouille par des phnomnes de recombinaison et de transposition. L'identit de ces gnes peut nanmoins tre devine par leur structure particulire, l'emploi des codons (codon-bias) ou par des homologies de squence avec d'autres espces. Un critre remarquable est celui du groupement des gnes, parfois dans un ordre caractristique qui se retrouve dans des espces distinctes. On peut alors supposer que les espces en prsence

2 GNOMES - ADAPTATIONS - COMMUNICATIONS

95

ont t l'origine "contamines" par une mme squence de type plasmidique, et en auraient ainsi gard le souvenir en dpit des remaniements ultrieurs.

2.5 - SQUENCES D'INSERTION - TRANSPOSITION


Les transposons sont des lments d'ADN mobile contenant ce qu'on appelle des squences d'insertion ou IS, capables de sauter d'une position d'ADN une autre. Chez les bactries, ils transportent avec eux des lments variables qui peuvent tre par exemple des gnes de rsistance des antibiotiques. La technique est celle du "couper/coller" des ordinateurs dans un traitement de texte. Un fragment du texte est prlev et insr ailleurs un endroit dtermin. Une autre opration consiste copier le fragment sous forme identique et l'insrer ailleurs en laissant le premier exemplaire en place. Il en est de mme dans une transposition o le fragment d'ADN est transport d'un endroit l'autre sans rplication, ou aprs avoir t rpliqu en laissant une copie en place. En somme ABCDEFGH deviendrait ABECDFGH dans le premier cas, ABECDEFGH dans le second. La transposition n'est pas rserve aux procaryotes. Dcouverte initialement chez le mas par Barbara MCCLINTOCK en 1951, elle a fait l'objet d'observations trs dtailles chez la levure, la drosophile, et vrai dire dans toutes les espces o on l'a cherche [27]. Cela fait partie des outils dont les tres vivants disposent pour grer l'volution de leur patrimoine gntique. Le dplacement d'un lment peut provoquer des insertions et dltions, ou dplacer une squence d'un endroit un autre, en inactivant parfois certains gnes quand l'insertion se produit en leur sein. Une transposition peut aussi avoir des effets plus subtils quand l'insertion drange les rapports d'un gne avec un promoteur ou une squence rgulatrice. Avec les plasmides, les lments transposables apportent d'extraordinaires moyens d'adaptation, et constituent des outils de recherche en gntique d'une valeur inestimable. Les lments mobiles les plus simples sont les squences d'insertion (IS). Elles contiennent de 700 1600 bp, encadres aux extrmits par deux courts segments inverss de 15 25 bp. Un lment IS contient le signal ncessaire la transposition, qui est catalyse par une transposase. L'enzyme se lie aux deux extrmits rptes inverses (ou IR), reconnat la squence cible et y effectue l'insertion. La transposase agit sur la cible en y pratiquant une ouverture formant des "bouts collants" la manire de ce que ferait une nuclase de restriction. Son gne occupe presque toute la longueur intermdiaire de l'lment, et son promoteur se situe en partie dans l'un des segments rpts inverss, qui est dsign par convention comme extrmit gauche IRL (inverted repeat, left). L'autre extrmit est IRR (inverted repeat, right).

96

BIODGRADATIONS ET MTABOLISMES
extrmits rptes inverses

IRL

lment IS

IRR

TACATGCACCAG ATGTACGTGGTC ouverture de la squence cible TACATGCAC ATG

CAG TACATGCAC ATG TACGTGGTC insertion CAG TACGTGGTC rparation

TACATGCAC ATGTACGTG

ATGCACCAG TACGTGGTC

IRL

IRR

rptition directe

Insertion d'un lment IS


On voit que la petite squence servant de cible l'insertion subit une duplication en tandem et l'IS s'installe entre les deux copies. Chaque IS possde ses caractres propres et le petit tableau en donne une ide en ce qui concerne le colibacille. IS
IS1 IS2 IS3 IS4 IS5 IS10R*

Nombre (E.coli)
6-10 5 5-16 1 ou 2 abondant

(pdb)
768 1327 1258 1426 1296 1329

Cible, pdb
9 5 3-4 11-12, 14 4 9

Rpt. inverses, pdb


18-23 32-41 29-40 16-18 15-16 17-22

ORF
2 1 2 1 1 1

* Chez Salmonella typhimurium, dans la structure du tranposon Tn10.

Le colibacille renferme d'autres IS non ports dans ce tableau, comme IS30, IS150, IS186. De nombreux IS ont t rpertoris hors du colibacille. Par exemple IS3 se retrouve dans Caulobacter crescentus, Enterococcus faecalis, Lactococcus lactis, Pseudomonas aeruginosa, ainsi que chez des pathognes (Neisseria meningiditis, Mycobacterium tuberculosis, Vibrio cholerae), des cyanobactries (Synechocystis sp.) et d'autres espces. En 1998 on rpertoriait dj environ 500 lments d'insertion dans 159 espces groupant la fois des eubactries et des archaebactries [28]. Le plasmide F renferme une copie d'IS2 et trois de IS3. Les lments d'insertion sont classs par famille sur la base de caractres communs de structure et de squence. Les IS3 et IS5 sont les plus rpandus, IS1 est le plus anciennement connu et le plus petit. Il a la particularit d'avoir deux

2 GNOMES - ADAPTATIONS - COMMUNICATIONS

97

cadres de lectures, A et B, commands par un promoteur localis au niveau de l'extrmit gauche (IRL). La vraie transposase serait B. L'existence de deux cadres de lecture s'observe aussi dans la nombreuse famille des IS3. Le dispositif particulier de IS1 nous permettra d'introduire une proprit importante d'un lment d'insertion. Pour illustration voici sa carte schmatique. Le promoteur est marqu d'une petite flche sur la gauche de la figure.
insA IRL InsA InsAB' stop insB IRR les deux protines produites

His Leu Lys Asn Ser

Gly

Arg Ser Pro

Arg

GCCAUUUAAAAAACUCAGGCCGCAGUCGGUAACCUCGCGCAUACAG
Lys Leu Arg Gln Ser Val Thr Ser Arg Ile Gln

Les deux cadres de lecture de ISI


La transcription partir de ce promoteur s'effectue en bloc sur toute la longueur de l'lment d'insertion, en ne s'arrtant qu'un peu en avant de IRR. Malgr l'existence des extrmits rptes et inverses (IRL et I R R), les squences d'insertion ou IS ont donc une polarit dicte par le sens de transcription du gne de la transposase. Ce dtail est important pour comprendre le fonctionnement des transposons. Dans 99% des cas, la traduction par les ribosomes ne s'effectue que sur la partie insA, car elle y rencontre un codon Stop (UAA). La partie situe en aval ne devrait donc pas tre traduite, ce qui interdirait la synthse de la transposase ! Un mcanisme particulier permet de contourner l'obstacle dans un petit nombre de cas. Entre les rgions insA et insB' existe une zone de chevauchement dont la squence est dtaille dans le bas de la figure. On peut y remarquer une curieuse rptition de 6 fois la lettre A. On a des preuves exprimentales que ce motif fait draper la transcription en provoquant ce qu'on appelle un changement de cadre de lecture (frameshift) avec la nouvelle squence de codons comme il est indiqu. Les ribosomes semblent ramorcer la lecture de la suite du message la faveur de ce changement de cadre. La protine synthtise est InsAB' et fait office de transposase. La petite protine basique InsA reste majoritaire, mais elle se lie aux squences terminales IRL et IRR sur l'ADN et a pour effet d'entraver la transposition de l'lment d'insertion, car ce sont justement les zones que la transposase devrait reconnatre [29]. La transposase InsAB', qui n'est faite qu' taux rduit, ne peut donc effectuer la transposition (avec ou sans rplication dans le cas d'IS1) qu'avec une frquence trs faible, qui est de l'ordre de 107 par rapport aux divisions cellulaires. Si on ajoute une septime lettre A au motif rpt de la zone de chevauchement, ou si on en retire une, le cadre de lecture qui devrait normalement dboucher sur le codon Stop s'en voit dcal, et la protine InsA n'est plus produite (la traduction continue jusqu'au bout). Elle est remplace par la transposase qui peut fonctionner alors sans entrave [30]. Le dplacement de l'IS

98

BIODGRADATIONS ET MTABOLISMES

intervient avec une frquence bien plus leve qui est de l'ordre de 0,1 1%. Une limitation existe cependant et serait due un deuxime dispositif ne concernant plus la traduction mais la transcription par l'ARN-polymrase. Une rgion en fin de insA tend faire cesser la transcription en aval. Les molcules d'ARN messager sont alors tronques et la transposase n'apparat pas. Une proprit importante d'IS1 et des squences d'insertion en gnral est de s'accompagner de mcanismes ayant pour effet de limiter leur propagation. En effet la multiplication des lments dinsertion dans un gnome bactrien devrait entraner des effets dltres et leur nombre doit tre ramen une valeur acceptable. La destruction de la cellule serait aussi celle de l'IS, qui se compare un parasite rduit sa plus simple expression. Ces lments sautent d'une position l'autre sur l'ADN, soit au sein du chromosome, soit vers un plasmide, avec une frquence faible de l'ordre de 105 107 par rapport aux taux des divisions. tonnant : c'est comme si l'lment IS se munissait de mcanismes rgulateurs avec le souci de freiner le plus possible sa propre multiplication. Il en rsulte un taux moyen d'exemplaires peu prs stable dans le chromosome bactrien. Les effets d'une insertion dans l'ADN peuvent tre multiples. La premire est l'inactivation d'un gne. Une seconde est d'introduire un ou deux promoteurs supplmentaires provoquant des amorages de transcription intempestifs, ou inversement d'introduire des points d'arrt. En outre une insertion peut inactiver ou dvier un mcanisme rgulateur. Des effets secondaires parfois inexpliqus se produisent au voisinage d'un IS, en particulier une dltion laissant l'IS intact. Certains lments peuvent s'isoler en cercles d'ADN au cours de leur transposition [31], comme l'indique le schma. L'excision et l'intgration se font par des mcanismes diffrents d'un IS l'autre, mais ils ne seront pas abords ici pour des raisons de simplicit. Le principal intrt des IS est leur participation la mobilit des transposons, dont il sera question dans la section suivante.
coupure de lun des brins par la transposase

coupure du 2e brin, rplication

circulation insertion par la transposase IS IS squence dADN cible IS IS

Transposition

2 GNOMES - ADAPTATIONS - COMMUNICATIONS

99

La prsence des IS dans un gnome (comme celle des transposons) est responsable d'une proportion importante des mutations chez les bactries, et constitue un facteur d'volution considrable [32]. Les effets des IS compltent ceux des gnes mutateurs. En intervenant taux faible, les mouvements des IS sont autant de ballons d'essai volutifs qui peuvent faire surgir par hasard un avantage slectif [33]. On estime que l'volution des gnomes peut se faire aussi la faveur de squences rptitives se succdant en tandem, distinctes des IS. Il en existe plusieurs catgories, les Rep* tant les plus courtes. Elles sont nombreuses dans le colibacille et diffrentes espces. Les divers lments rpts le long de l'ADN confrent au patrimoine gntique une grande plasticit, en permettant le rapprochement de portions loignes et l'apparition de solutions favorables sous la pression de l'environnement. Ces lments multiples sont frquents dans le gnome des protobactries, le plus souvent sous forme de squences rptes inverses. Les eucaryotes ont aussi des rptitions en tandem et d'autres structures de ce type [34]. Tous ces motifs se rencontrent dans leur quasi-totalit l'extrieur des gnes, et ne sont donc pas dans les rgions traduites en protines. Certains auteurs pensent qu'une partie du travail des IS est de dclencher de temps en temps des transpositions qui viennent inactiver des gnes. Si ces derniers ne sont pas indispensables, la modification est transmise sans inconvnient dans la descendance. Ce phnomne participerait une simplification du gnome en liminant peu peu les squences qui ne servent rien.

2.6 - LES TRANSPOSONS SIMPLES ET COMPOSITES


Un transposon est donc une portion d'ADN mobile utilisant les proprits des lments d'insertion. Dans les transposons de la Classe 1, une portion plus ou moins longue est borde aux extrmits par deux lments IS orients dans le mme sens ou en sens contraire. Ces lments sont responsables de la transposition de l'ensemble, qui renferme typiquement des gnes de rsistance des antibiotiques. Des exemples classiques sont Tn5, Tn9, Tn10, Tn903 . Les transposons de la Classe 2, appels quelquefois transposons complexes ou composites, ressemblent de grands IS qui renfermeraient, outre celui de la transposase, d'autres gnes et des lments rgulateurs plus ou moins compliqus. Des exemples sont Tn3, Tn1, Tn4. La longueur des transposons est donc bien plus grande que celle des IS, allant de 4 21 kb. Tous renferment aussi des gnes supplmentaires qui n'ont rien voir avec la fonction de transposition. Si les chromosomes bactriens ou les plasmides ne renfermaient que de simples lments d'insertion comme les IS de la section prcdente, les avantages physiologiques ne seraient pas toujours vidents. Au contraire la prsence des IS serait plutt nfaste par ses effets ravageurs, l'inactivation de gnes utiles tant plus probable que l'apparition fortuite de formules nouvelles et bnfiques. Le problme prend donc toute sa dimension quand les IS accompagnent des gnes dtermins et les transportent avec eux. Beaucoup de transposons peuvent sauter d'un plasmide vers le chromosome et vice versa. Tous ont des mcanismes rgulateurs pour

100

BIODGRADATIONS ET MTABOLISMES

endiguer le taux de transposition et faire de celle-ci un vnement plutt rare. Enfin il existe pour mmoire des transposons de Classe 3, qui sont des bactriophages multiplis par transposition, leur chef de file tant le bactriophage Mu.
IS10L
TetR

IS10R
ARN "OUT"

IS10 R IS10R
ARN "IN" zone de chevauchement

Tn10
Le transposon Tn10 est un premier exemple. Sa longueur est de 914 bp et il appartient la classe 1. Il correspond la catgorie des transposons composites, du fait qu'il existe un lment IS chaque extrmit. Ces lments ici sont des IS10. Ils diffrent lgrement par quelques paires de bases et on les distingue par les sigles IS10L (gauche) et IS10R 9. Les deux lments I S pourraient thoriquement tre fonctionnels et commander chacun une transposition par leur transposase. En fait seul l'IS10R a ce pouvoir. La transposase d'IS10L n'apparat que dans certaines situations, par exemple quand le transposon est dans un environnement o il existe un promoteur extrieur capable de promouvoir la transcription de IS10L. Le transposon transporte en outre des gnes de rsistance (TetR) aux ttracyclines, la blomycine, la nomycine, et plusieurs cadres de lecture dont quatre sont homologues de gnes bactriens impliqus dans le mtabolisme des acides amins [35]. Au point de vue volutif, ce type de structure aurait pu natre la faveur de la prsence de deux IS voisins encadrant par hasard plusieurs gnes, dont la propagation en bloc rendue possible aurait apport un avantage slectif. Le schma de Tn10 indique le dispositif intressant qui contribue limiter le taux de sa transposition. L'extrmit d'IS10R, seule fonctionnelle, comporte deux promoteurs se chevauchant en partie sur une longueur de 36 pdb, l'un commandant la transcription vers la droite (ARN "OUT") sur 69 bases, l'autre vers la gauche et formant un ARN beaucoup plus long (ARN "IN"). Cette dernire transcription commande la synthse de la transposase. Il y a donc conflit entre deux transcriptions. Mais le combat est quelque peu ingal. Le promoteur "OUT" est un promoteur fort, fonctionnant avec un temps moyen de 70 minutes, alors que l'ARN "OUT" est beaucoup plus instable, avec seulement 40 secondes de vie moyenne. Il se comporte comme un anti-sens* [36]. Cet ARN est susceptible d'empcher la synthse de la transposase, non seulement dans le mme Tn10, mais dans d'autres transposons identiques se trouvant dans la mme cellule. En outre la protine transposase est instable, et n'agit essentiellement qu'en cis courte distance aux extrmits du transposon (sur les deux IS). Aussi lorsque la cellule contient

9 - Le choix d'une gauche et d'une droite tant videmment purement conventionnel !

2 GNOMES - ADAPTATIONS - COMMUNICATIONS

101

plusieurs exemplaires de Tn10, aucune augmentation du rythme des transpositions n'est observe. cela s'ajoute une difficult supplmentaire. La transposase n'est active que sous forme multimrique comportant plusieurs sous-units identiques, et la ralisation d'un polypeptide isol reste insuffisante ! Un autre mode de contrle de la transposition tout aussi tonnant agit par mthylation de l'ADN. Celle-ci intervient sur l'adnine dans le motif 5'GATC3', reconnue par la D-adnine mthylase (sites dam). Il a t question de ce systme dans la premire section de ce chapitre. Une squence dam se trouve dans le promoteur de la transposase (dans l'IS10R) et gne le dmarrage de la transcription. Quand cette squence est hmimthyle sur un brin d'ADN, l'ARN-polymrase se lie plus efficacement, l'expression du gne de la transposase est augmente ainsi que le rythme des transpositions. Pourquoi ce dispositif ? Probablement pour favoriser la transposition juste aprs la rplication de l'ADN, ce qui offre au transposon une meilleure opportunit de sauter d'un rplicon l'autre 10. Ce n'est pas tout. Les petites rptitions inverses de l'IS10R contiennent aussi un site dam. Or la transposase qui est charge de reconnatre ces extrmits ne s'y intresse que si elles sont hmimthyles, donc juste aprs le passage de la fourche de rplication. Ce rglage trs subtil veille donc ce que la transposition ne survienne si possible que juste ce moment-l ! En rsum s'exercent au moins quatre actions pour contrler cette transposition : l'apparition d'un ARN anti-sens, une transposase instable constitue de plusieurs polypeptides, une mthylation sur le site dam du promoteur, une mthylation des sites dam aux extrmits de l'IS10R. Le transposon Tn5 (5700 bp) prsente une situation assez comparable. La partie centrale contient aussi un marqueur de rsistance ( la kanamycine) entre deux lments d'insertion, IS50L et IS50R. Ces derniers ne diffrent entre eux que d'une seule base, marqu d'une toile sur le dessin. La transcription centripte pour une transposase part des deux cts partie d'un promoteur (p) et la disposition est presque symtrique.
IS50L kan
x p1 p2 *

IS50R

p2 p1

p3

Tn5
Le fonctionnement de Tn5 met en jeu non seulement les facteurs du transposon luimme, mais des protines trangres provenant de l'hte. Limitons-nous aux faits marquants. Du ct de l'lment de droite, IS50R. La squence renferme deux 10 - Le chromosome apparat en double avant que les deux cellules se sparent. Dans une bactrie en cours de multiplication rapide, comme le colibacille en milieu favorable, la sparation des cellules est en retard sur la synthse d'ADN, ce qui fait que la cellule peut contenir 4 exemplaires du chromosome et plus.

102

BIODGRADATIONS ET MTABOLISMES

promoteurs successifs, p1 qui lance la transcription de l'ARN messager de la transposase, une protine de 476 acides amins, p2 qui est dcal en aval et dtermine un messager plus court tout en utilisant le mme cadre de lecture. Il en rsulte une protine incomplte Inh qui n'a que 421 acides amins au lieu de 476 et n'a pas d'activit comme transposase. Elle se comporte en inhibiteur de la transposition. Son mcanisme d'action est mal connu, mais elle est fabrique en excs par rapport la transposase. Il y a une explication possible. La transposase n'est active que sous forme de multimre (comme celle de Tn10). La protine Inh avec sa longueur un peu plus courte pourrait jouer le rle de sous-unit de la transposase et la protine multimre hybride contenant la fois les sous-units correctes et Inh, serait inactive comme transposase [37]. Par consquent, la prsence de Inh aurait de toute faon une action inhibitrice. Quoiqu'il en soit, c'est probablement un systme de contrle freinant la mobilit de Tn5 comme dans le cas de Tn10. En outre le Tn5 a aussi un contrle de type dam comme dans le cas prcdent. Que fait l'lment d'insertion IS50L dans Tn5 ? La mme disposition est observe puisque la squence est la mme, mis part le remplacement d'une seule base. Or ce changement introduit un codon Stop dans l'ARN messager, une cinquantaine de bases avant le Stop normal. Les protines faites en fonction de p1 et p2 de IS50L sont donc tronques, la transposase est inactive et a une action inhibitrice comme Inh. La transposition dpend donc totalement de la transposase faite par l'autre IS. En outre le changement de base active un nouveau promoteur pour une transcription vers le centre du transposon (de gauche droite sur le schma). L'expression des gnes contenus dans cette partie est alors sous la dpendance de IS50L. En rsum IS50R contrle la transposition, IS50L dirige l'expression des gnes transports par le transposon Tn5. Comment la transposition de Tn5 et Tn10 est-elle ralise ? Ces units et celles du mme type sont mobiles par transposition conservatrice selon le principe du "couper/coller". L'lment transposable est excis du site de dpart en laissant derrire une cassure irrparable entranant la destruction du rplicon donneur.
ADN de dpart Tn1O deux brches ADN cible

coupure sur les 2 brins

insertion

rparation ligation

rptitions directes

2 GNOMES - ADAPTATIONS - COMMUNICATIONS

103

Au site d'insertion sont cres des coupures dcales. L'lment s'y installe, les brches sont rpares et ligatures. Le nombre de transposons n'a pas augment. Il ne le sera qu la faveur des divisions cellulaires. On sait que la transposition entrane une duplication de la petite squence cible. Le transposon Tn10, dcouvert en 1968 par WATANABE et coll., a donn lieu de nombreuses recherches. Il a la particularit de s'installer des endroits dtermins et l'on retrouve donc de chaque ct d'un Tn10 aprs transposition une squence appartenant au mme consensus de 9 bases (o N dsigne n'importe quelle base), soit NGCTNAGCN>, et sur le brin complmentaire NGCTNAGCN> 11. Le passage du transposon d'une molcule d'ADN une autre est un vnement rare par rapport au rythme des divisions celulaires : un Tn5 ou un Tn10 prsent dans le chromosome se voit rpliqu en mme temps que lui. Le mode de transposition garantit qu'il n'y aura pas daugmentation du nombre des transposons. C'est heureux pour la cellule, car la prsence d'un transposon introduit des anomalies, telles que des promoteurs supplmentaires ou des signaux d'arrt de transcription. Il en rsulte au niveau des gnes voisins des expressions sauvages et des perturbations dans les rgulations, affectant les rglages de l'activit cellulaire. Si maintenant on revient la structure des deux IS terminaux de Tn5, chacune est borde comme il se doit par des rptitions inverse de 19 bp, qui devraient tre identiques, au nombre de 4 par transposon. Elles ne le sont pas exactement. La squence la plus externe de chaque IS diffre de celle qui est en contact avec la partie centrale de Tn5 par 7 positions. Cependant ces deux morceaux de squence sont reconnus par la transposase dans IS50R aussi bien que dans IS50L. La transposase est une enzyme perfectionne qui catalyse plusieurs rarrangements dans l'ADN. Elle est aide par d'autres protines provenant de la cellule hte : Dam (la mthylase dj rencontre), DnaA implique dans l'amorage de la rplication du chromosome, et des protines qui ont la proprit d'induire des courbures dans l'ADN (Fis, IHF). Il s'agit de mcanismes de reconnaissance trs subtils, car le simple changement d'une base dans ces portions de squence relativement courtes amne immdiatement de fortes perturbations ou abolit l'activit de la transposase. Lentre d'un transposon dans un plasmide est certainement un facteur d'volution dans une population. Voici un dessin montrant les deux faons qu' un Tn10 de s'insrer dans un plasmide. L'opration peut conduire l'apparition d'un nouveau transposon de grande taille, ici avec des lments d'insertions retourns mais fonctionnels. Un dtail retenir, parce que l'analyse des gnomes rvle que des segments importants dans les plasmides ou le chromosome figurent dans ce qui semble tre un ancien trs grand transposon.

11 - Lu dans lautre sens sur lADN, le consensus est donc symtrique.

104
Tn10 tet+ IS10L IS10R IS10L IS10L

BIODGRADATIONS ET MTABOLISMES

Tn10

IS10R Tet+ IS10R

gnes plasmidiques gnes plasmidiques

Plasmide porteur de Tn10


Le Tn3 est un transposon de Classe 2, dcouvert en 1974 par HEDGES et JACOB, par son pouvoir de transmettre un facteur de rsistance la pnicilline de plasmide plasmide ou de plasmide chromosome. Le Tn3 est non-composite, car il correspond une seule squence d'insertion qui aurait t dilate jusqu' 5 kb environ de faon hberger des gnes supplmentaires non ncessaires la transposition.
tnpA ITR tnpR res ampR ITR

GUA
58

II

III

AUG
+ 105

ARN

ARN

Transposon Tn3
Aux extrmits se trouvent des squences rptes inverses de 38 bp (ITR). Ici intervient une situation nouvelle : Tn3 subit une transposition rplicative, o un exemplaire reste au dpart tandis que le second s'installe ailleurs. Deux protines essentielles sont codes par le transposon dans des directions divergentes : une transposase (TnpA) et une rsolvase (TnpR). La rgion res a une fonction particulire dans la rplication, et c'est l que se chevauchent les deux promoteurs, un pour la transcription de tnpA, l'autre pour tnpR, comme l'indique le dessin. La rgion res est dtaille. Les sites I, II et III sont reconnus par la rsolvase, le site I tant res proprement dit. Les deux ARN divergents sont indiqus, ainsi que la position relative du codon marquant le dbut de la traduction, aux bases 58 et + 105 du site res. La rplication s'effectue par une succession de coupures et d'changes. Une jonction runit l'ADN donneur et l'ADN cible au niveau des brches formes. La structure forme est dite en X d'aprs les images en microscopie lectronique. Elle est soumise ensuite rplication et rparation. Elle correspond deux fourches de rplication qui avanceraient l'une vers l'autre. Le transposon et l'ADN cible tant

2 GNOMES - ADAPTATIONS - COMMUNICATIONS

105

initialement sur deux rplicons diffrents (par exemple deux plasmides), une recombinaison faisant suite la rplication forme un cercle unique, le co-intgrat. On y retrouve les deux rplicons et deux exemplaires du transposon. La rplication n'a pas affect que le transposon de dpart, mais aussi la squence cible qui apparat maintenant en double.

transposon cible

coupures

soudures bout bout

figure en X

co-intgrat rplication, rparation

Figure en X, rplication, formation d'un co-intgrat


Le co-intgrat correspond deux cercles d'ADN entortills l'un dans l'autre et incapables de se sparer. Pour mener bien la sparation, il est ncessaire de faire dans un cercle une coupure suivie immdiatement d'une nouvelle soudure. Cette tche dlicate revient la rsolvase, assiste par des protines cellulaires qui participent l'entretien de l'ADN. Lorsque le co-intgrat a t dml, le transposon initial se retrouve intact dans son environnement de dpart, mais sa nouvelle copie transporte dans l'autre rplicon est borde de deux squences rptes de mme orientation.

cointgrat

deux rplicons

recombinaison

+
transposon de dpart nouveau transposon

La transposase dmle le co-intgrat


Ces mcanismes comportent donc une rplication et la rsolution du co-intgrat. Ils dterminent une multiplication du transposon qui est plus rapide que le seul rythme

106

BIODGRADATIONS ET MTABOLISMES

des divisions cellulaires. L encore interviennent des mcanismes rgulateurs qui empchent une multiplication trop intense des transposons qui aboutirait la mort cellulaire. Des complications supplmentaires surgissent quand certaines bactries, contrairement la majorit d'entre elles, ont plusieurs chromosomes. Ceci facilite les recombinaisons et les transpositions. Certains Brucella ont deux chromosomes (2100 et 1200 kb) portant l'un et l'autre des gnes essentiels la survie. D'autre part les bactries en croissance rapide ne sont pas strictement haplodes et plusieurs copies du gnome peuvent coexister diffrents stades de la rplication quand celle-ci est en avance sur les divisions. Chez certaines espces la polyplodie est la rgle mme au repos. C'est le cas de Deinococcus radiodurans, o il y a 4 ou 5 copies du chromosome, ce qui lui permet de reconstruire rapidement des exemplaires corrects aprs une exposition prolonge des radiations. L'ADN du bactriophage Mu est comparable un trs grand transposon de classe 2 (38 kb). Il est capable de s'intgrer peu prs n'importe o dans le chromosome du colibacille, contrairement l'ADN Lambda qui s'installe en un site prcis. Le transposon Mu nat de l'entre d'une particule infectieuse, s'intgre en prophage par un mcanisme de transposition conservatrice partir de l'ADN viral, et se transmet comme un prophage au cours des divisions cellulaires. Comme dans Lambda, la plupart des gnes du transposon Mu restent dormants pendant le stade lysogne. Ils s'expriment aprs induction au cours de la phase lytique, conduisent alors de nombreuses transpositions rplicatives et la synthse de nouvelles particules infectieuses. La prsence du prophage Mu dans un gnome provoque un certain nombre d'accidents gntiques, notamment des dltions. Il existe donc une vaste gamme d'lments d'ADN mobiles, allant des I S rudimentaires au transposons de la classe 1, ceux de la classe 2 jusqu' des difices gntiques au programme perfectionn comme Mu. On peut s'interroger sur la signification des lments transposables dans la nature et leur maintien dans les cellules o leur prsence pourrait s'accompagner de divers dsordres. Nous avons vu que la transposition est limite un taux faible, le cas du phage Mu en phase lytique mis part. En fait il existe dans les populations de microorganismes un impratif trs important qui est celui de connatre des mutations leur permettant d'voluer. Dans une population contenant un nombre immense de cellules, chaque vnement mutationnel a de grandes chances d'apporter des effets dltres, et les cellules correspondantes seront limines par slection sans que le volume de la population s'en ressente vraiment. Mais les mutations nouvelles peuvent aussi amener des combinaisons favorables, permettant par exemple de mieux rsister des conditions adverses ou d'acqurir une activit enzymatique nouvelle ou plus performante. Il existe de nombreux mcanismes mutationnels. La mobilit de l'ADN est l'un d'eux. Toute cellule amene se multiplier plus rapidement peut engendrer une descendance capable de conqurir peu peu le milieu. Le passage d'information gntique d'une cellule une autre par insertion dans des plasmides et conjugaison est un mcanisme capable d'acclrer la propagation des trouvailles utiles. La transposition fait donc partie des moteurs de l'volution, en particulier dans l'apparition de formes comptentes pour effectuer une biodgradation.

2 GNOMES - ADAPTATIONS - COMMUNICATIONS

107

Il est intressant de constater que toute situation de stress impose une population tend stimuler la fois les mcanismes de rparation et les changes d'ADN. Par exemple la rponse SOS dclenche chez le colibacille par irradiation ultraviolette provoque l'induction de nombreux gnes dont celle des gnes umu dont l'expression conduit une augmentation du taux de mutation. Un tat de stress augmente aussi le taux de transposition de certains lments. Il s'agit donc bien d'une rponse de dfense permettant d'explorer des issues possibles. Sur des milliards et des milliards d'individus, peu importe que la plupart des mutants disparaissent aprs mutation pouvu que quelques cellules tirent le numro gagnant et perptuent la ligne 12.

2.7 - INTGRONS ET CASSETTES


Comment un micro-organisme peut-il devenir rsistant un facteur toxique tranger ? Pour que sa proprit de rsistance reste stable dans la population considre, il est ncessaire que la modification gntique soit transmise la descendance. Les individus rsistants seront donc slectionns et leur proportion ne fera quaugmenter au sein de la population. Il y a plusieurs faons de rsister lagression chimique exerce par les antibiotiques ou par des polluants divers. Lune delles est de modifier la cible intracellulaire que lagent toxique vient perturber. Un exemple classique est la streptomycine, dont laction paralyse la synthse protique des procaryotes en agissant au niveau de la protine S12 des ribosomes. Une mutation gntique altrant cette protine sans lser le fonctionnement des ribosomes rend les cellules rsistantes. Un autre mcanisme de rsistance apparat lorsquune ou plusieurs mutations rendent la membrane impermable la pntration de lagent hostile. Enfin lacquisition dune enzyme capable de dtruire ou de neutraliser lagresseur est un mcanisme important dans lapparition de souches rsistantes aux antibiotiques. Un bon exemple est celui des bta-lactamases neutralisant les pnicillines. Dans tous les cas la rsistance nat d'une ou plusieurs modifications gntiques par mutation de gnes prexistants ou par l'apport de gnes nouveaux partir dune origine extrieure. Cette deuxime possibilit est examine ici. Les structures gntiques appeles intgrons ont attir l'attention comme supports de rsistances multiples des antibiotiques. Ce phnomne est une calamit faisant natre des souches pathognes, le plus souvent Gram-ngatives, qui ont acquis la capacit de rsister une batterie d'antibiotiques, utiliss en thrapeutique. Il est devenu clair que les bactries devenaient rsistantes par l'acquisition de gnes nouveaux exprims au sein de la cellule. On s'est aperu que certaines espces pouvaient de la mme faon acqurir des facteurs de virulence, c'est--dire des gnes dont l'expression rendait les bactries pathognes, soit par la formation de toxines, soit par d'autres facteurs facilitant la pntration et la

12 - Comme disait la publicit d'une loterie bien connue, tous les heureux gagnants sont des gens qui ont jou !

108

BIODGRADATIONS ET MTABOLISMES

multiplication du germe dans l'organisme infect. Le mme principe utilis par les bactries pour se dfendre peut aussi leur permettre de passer lattaque. Une information gntique trangre ne peut se maintenir et s'exprimer dans la souche rceptrice que si elle s'intgre un rplicon. Encore faut-il que ces gnes soient en aval d'un promoteur ad hoc pour tre exprims. Plasmides et transposons apportent couramment ces promoteurs, et les gnes nouveaux arrivent dans une structure qui est capable d'assurer la fois sa rplication et son expression. Il peut arriver aussi qu'un ou plusieurs gnes soient introduits l'tat "sec" sans tre accompagns du promoteur ncessaire, dans un petit ADN circulaire muni seulement d'une squence d'attachement. Cet ADN porteur est une cassette, incapable de s'exprimer et de se rpliquer si elle n'est pas intgre dans un ADN cible. Ce dernier apporte les fonctions manquantes essentielles, notamment production d'une intgrase, un site spcifique d'attachement et un promoteur. La cassette diffre d'un plasmide par sa taille rduite et son incapacit se rpliquer par ses propres moyens. Elle deviendra fonctionnelle aprs intgration dans un ADN cible servant de structure d'accueil. Celle-ci est appele intgron. Elle assure la fois l'intgration de la cassette et son expression. L'intgration d'une cassette met en jeu une recombinaison spcifique de site 38. On y rencontre trois lments essentiels : une portion codant pour une intgrase (int), un promoteur fort (c'est--dire efficace) et un site d'insertion (attI). L'intgrase travaille spcifiquement sur le site attI, o se fera l'intgration d'une cassette, juste en aval du promoteur, de telle sorte que les nouveaux gnes pourront tre transcrits et exprims. Le dessin indique le modle de base d'un intgron. L'apport d'une cassette constitue la partie variable entre deux zones constantes. Celle de gauche sur le dessin contient les trois facteurs essentiels (int, promoteur fort not (p), et attI). Dans la partie droite figure par le rectangle blanc sont localiss plusieurs facteurs de rsistance. Cette zone caractrise l'intgron. Dans ceux qui ont une structure complexe, cette partie peut tre assez longue.
zone o se feront des insertions de nouveaux gnes p attI

int

gnes de rsistance

La structure de dpart d'un intgron

On peut voir qu'il y a en fait deux promoteurs (p) en partie superposs sur le mme segment d'ADN, mais l'un concerne la transcription du gne de l'intgrase vers la gauche (int et flche en pointill), l'autre vers la droite pour la transcription des nouveaux gnes qui seront introduits dans la rgion indique en amont de gnes prexistants qui sont des facteurs de rsistance [39]. Leur promoteur est efficace et fonctionne beaucoup plus souvent que celui de l'intgrase en direction des gnes introduits partir des cassettes. L'existence de transcriptions divergentes partir de promoteurs partiellement chevauchants est une disposition banale chez les bactries. L'une d'elles commande souvent la synthse d'une protine rgulatrice, qui

2 GNOMES - ADAPTATIONS - COMMUNICATIONS

109

contrle la transcription des gnes en direction oppose. La protine rgulatrice est ici l'intgrase qui permet l'installation de la cassette. Les deux transcriptions opposes n'utilisent pas comme modle le mme filament d'ADN. Un promoteur est reconnu sur l'un d'eux, l'autre sur le brin complmentaire. Comment les cassettes sont-elles constitues ? l'tat libre dans le cytoplasme bactrien, une cassette est donc un petit ADN circulaire dpassant rarement 1 kb, renfermant un gne de rsistance (par exemple un antibiotique) sans promoteur mais avec une squence d'insertion attC. Un gne tranger transport ne peut pas s'exprimer tant qu'il n'a pas t introduit dans un intgron. Le site attC s'appelle aussi lment "59 bases", bien que sa longueur varie d'une cassette l'autre de 57 141 bp. Sa structure est celle d'un palindrome imparfait et contient un lment de squence consensus retrouv dans attI, GTTRR(C ou G)RY (o R dsigne une purine A ou G, et Y une pyrimidine C ou T). L'intgrase reconnat la fois la partie de l'intgron o se trouve attI et le site attC dans une cassette. Celle-ci sera positionne par coupure et recombinaison entre les sites att.
attC premire cassette intgrase

int

attI gne 1 la rgion attI

gnes de rsistance dcals

la rgion attC
3

site p ... AAAACAAAG TTAGATGCAC ... ... RYYYAAC ... TTTTGTTTC AATCTACGTG ... ... YRRRTTG (ICS) int site p point dchange
5

variable

G TTRRGC C AAYYCG (CS) point dchange

Insertion d'une premire cessette


Le dessin montre des dtails de squence aux rgions attI et attC, au niveau du consensus critique GTTRR. Les petits rectangles en noir soulignent les courtes rgions qui se ressemblent entre attI et attC, autorisant ainsi la recombinaison. La sparation se fait entre G et T [40]. Deux rptitions inverses sont visibles aux extrmits de la rgion attC, qui est donc partiellement palindromique aux deux bouts. Elles sont dsignes par CS ( core site) et ICS (inverted core site). Une fois intgr, le gne apport par la cassette peut tre transcrit en mme temps que les gnes qui taient dj prsents. La rgion constante reprsente par le rectangle blanc est transcrite partir de un ou plusieurs promoteurs situs plus loin sur l'ADN qui n'ont pas t reprsents.

110

BIODGRADATIONS ET MTABOLISMES

Une proprit remarquable des intgrons est de pouvoir accueillir successivement plusieurs cassettes, conduisant un empilement de gnes placs la queue leuleu et accumulant des facteurs de rsistance des antibiotiques ou des facteurs toxiques. Comment cela se peut-il ? La rgion attC apporte par chaque cassette contient le mme consensus (CS) que celui qui est dans le site d'intgration initial attI. Ce consensus est donc reconnu comme un site d'intgration. Le dessin montre l'arrive d'une deuxime cassette. L'insertion peut se faire sur attI ou un attC, avec une prfrence pour le premier. La figure montre qu'il y a deux possibilits.
attC deuxime cassette

int attI int attI gne 2 attC gne 1 attC gne 1 attC gne 2 attC

Insertion d'une deuxime cassette


Chaque intgron continue faire son intgrase, laquelle fait partie d'une famille de protines o l'on reconnat dj plus d'une centaine de membres [41], dont celle du phage Lambda. Toutes ces enzymes fonctionnent sur le mme principe qui est potentiellement rversible [42]. Dans un intgron la mme enzyme qui catalyse l'insertion d'une cassette peut inversement la librer. Cette cassette peut se voir nouveau rcuprer par un autre intgron. Deux plasmides porteurs d'intgrons ont ainsi la possibilit d'changer des gnes, et comme les plasmides sont souvent transmissibles d'une cellule l'autre, on peut voir ici l'un des mcanismes de propagation et de regroupement des facteurs de rsistance. Ce mcanisme de base prsiderait l'apparition des rsistances multiples aux antibiotiques et autres agents antibactriens. On sait que l'utilisation des antibiotiques des fins thrapeutiques est devenue une vritable course aux armements o la propagation rapide d'espces pathognes rsistantes cre une situation proccupante. Parmi les germes infectieux isols en milieu hospitalier sont des souches rsistantes une gamme tendue d'antibiotiques, notamment Pseudomonas aeruginosa et Staphylococcus aureus. Tout porte croire qu'il s'agit de l'exploitation par le monde microbien d'un dispositif prexistant en rponse des agressions de toutes sortes. On ne sait pas encore quelle est l'importance exacte des intgrons dans l'adaptation des bactries, mais plusieurs niveaux de complexit leur sont connus [43]. Il y a trois classes d'intgrons distingues par les homologies entre gnes d'intgrase.

2 GNOMES - ADAPTATIONS - COMMUNICATIONS

111

Les diffrents types d'intgrase conservent une homologie de squence (45-58%) qui laisse supposer une divergence volutive ancienne, certainement bien antrieure l'utilisation des antibiotiques des fins thrapeutiques par l'homme. La multiplication des rsistances multiples dans les lignes bactriennes pathognes aurait bnfici d'un terrain favorable utilis vraisemblablement lors de la propagation d'autres gnes. Les intgrons ne sont pas mobiles par eux-mmes, et n'occupent pas une place quelconque sur l'ADN. En fait ils sont souvent associs des squences d'insertion appartenant des transposons ou des plasmides transmissibles par conjugaison. Il devient alors vident que leur transfert de cellule cellule, voire entre espces distinctes, n'en est que facilite. Les intgrons de classe 1 correspondent grosso modo la structure de base indiqu par la figure, et comportent une zone variable entre deux segments constants. La rgion conserve comprend classiquement un gne de rsistance au bromure d'thidium (qacE), un gne de rsistance aux sulfamides (sul I) et un gne de fonction non connue (ORF5). La rgion variable peut ne contenir aucun gne, ou au contraire renfermer la suite 8-10 gnes de rsistance provenant d'autant de cassettes.
promoteur qacE sul I ORF5

int intgrase

attI rgion variable (insertion de facteurs de rsistance)

attC rgion conserve

Intgron de classe 1
On sait maintenant que les intgrons sont rpandus dans les populations bactriennes et que les gnes transports ne concernent pas uniquement la rsistance aux antibiotiques. La dissmination et l'insertion de facteurs mtaboliques par intgrons interposs sont des mcanismes plausibles d'adaptation gntique [44]. On s'interroge sur l'origine volutive d'un tel appareil. Le modle de base que nous avons rencontr, sans gnes nouveaux intgrs, se rencontre dans l'intgron In0 du plasmide pVS1 transport par Pseudomonas aeruginosa. Les gnes conservs (par exemple sul I) auraient une origine commune. L'intgron aurait ensuite volu par apport de nouvelles cassettes 13, et les structures produites auraient t conserves par pression slective [45]. Les choses se compliquent un peu dans le cas des intgrons de classe 2, car ils contiennent des gnes de transposition. Ils font partie du transposon Tn7 et de ses

13 - La plupart des intgrons de ce type descendent d'une version o le gne qacE a t tronqu par l'arrive du gne de rsistance aux sulfamides, sans doute postrieure. On remarque en effet que l'introduction de qacE a pu se produire vers 1920, alors que l'acridine orange tait utilise des fins thrapeutiques. L'avnement des sulfamides est postrieure (aprs 1930). L'intgron ainsi constitu est peut-tre un ancien transposon, ou le reste d'un phage lysogne.

112

BIODGRADATIONS ET MTABOLISMES

analogues. On y retrouve les mmes gnes imports que dans les intgrons de type 1, mais en nombre plus limit. Les gnes de rsistance codent pour des enzymes capables d'hydrolyser leur cibles (exemples : bta-lactamases), de les modifier (cas des aminoglycosides). Parfois ils portent d'autres fonctions. Citons le gne cmlA qui dtermine une rsistance au chloramphnicol par le jeu d'une protine membranaire qu'on pense tre une protine d'expulsion de l'antibiotique 46. La superposition de la transposition et du mcanisme de propagation de cassettes constitue une redoutable machine de guerre assurant la slection rapide de formes pathognes rsistantes une quantit de choses ! On a assist une diversification des bta-lactamases qui hydrolysent les pnicillines. Il en rsulte une course aux armements thrapeutiques avec production de nouvelles pnicillines de synthse. Rcemment est apparue une rsistance au carbapenem (ou meropenem) et produits similaires par une bta-lactamase d'un nouveau type. Transport par plasmide, son gne se propage chez Serratia et Shigella par intgron interpos, porteur d'une intgrase appartenant une famille d'un troisime type. Nous avons remarqu que les intgrases catalysent les allers et retours des gnes entre intgrons et cassettes. la base de ces changes se trouvent les segments 59 bases signals plus haut, dsigns par attC. Des squences homologues de attC (de l'ordre d'une centaine de bp, symtrie imparfaite, et portant aux extrmits GTTRRRY) sont trouves chelonnes rptition sur le chromosome de certaines bactries, et localises sur ce qui semble tre un prophage. On pense donc un vaste intgron qui serait vhicul par transmission virale. La situation se complique lorsque ces chapelets de gnes peuvent contribuer aussi bien une adaptation physiologique nouvelle qu' l'acquisition d'une virulence comme agent pathogne. Nous en arriverons donc la notion de super-intgron. Le cas le plus remarquable est celui de Vibrio cholerae. Deux srovars seulement sont les agents du cholra, diarrhe pidmique souvent mortelle. Le genre Vibrio hberge de nombreuses espces bactriennes htrotrophes dans les ocans, les eaux ctires et les estuaires. Leur intervention dans les cycles nutritifs serait considrable en milieu marin [47]. Bien qu'elles soient responsables d'invasions infectieuses chez les poissons, les mollusques et les mammifres, leur biologie est incompltement connue. L'agent du cholra, V. cholerae, se maintient en milieu aquatique entre les pidmies, se diversifie en nombreuses souches, passe par des phases de dormance o sa prsence est sournoise, et circule avec le zooplancton. Son gnome a t entirement squenc [48], et l'on espre en obtenir une moisson de renseignements sur l'adaptation gntique et la variabilit en gnral. Ce gnome est constitu de deux ADN circulaires, le chromosome 1 (2961 kb) et le chromosome 2, plus petit (1072 kb). Celui-ci serait peuttre un ancien mgaplasmide acquis au cours de l'histoire trs ancienne de l'espce. La notion de super-intgron a t forge pour dsigner une situation tonnante concernant le chromosome 2. Il renferme une multitude de squences de 123-126 kb, imparfaitement symtriques et homologues d'une squence de type "59 bases" du genre attC, associe un intgron de Pseudomonas. Ces lments de squence sont dsigns par VCR (ou Vibrio cholerae repeated sequence) et alternent avec

2 GNOMES - ADAPTATIONS - COMMUNICATIONS

113

des gnes qu'on suppose reprsenter autant de cassettes insres dans un norme intgron [49]. Les squences VCR sont reconnues par l'intgrase de type 1 cite antrieurement. Le nombre de ces petites squences est considrable, suprieur une centaine, et l'on y rencontre chaque fois le consensus GTTRRRY considr comme une cible d'intgrase. De bonnes candidates pour recevoir des cassettes ! L'ensemble reprsente 125 kb, et contient 216 ORF dont les fonctions n'ont pas toutes t dtermines [50]. Il y a des facteurs de rsistance, une hmagglutinine, une toxine thermostable, une lipoprotine, des nuclases et mthylases de restriction ainsi que divers facteurs mtaboliques. Certaines cassettes sont orientes en sens inverse, d'autres sont prsentes en exemplaires multiples. L'une d'elles, de fonction inconnue, a 532 pdb et il en existe 24 exemplaires. Mais la plupart de ces cassettes intgres ne sont prsentes qu'une seule fois et ont la mme orientation en amont d'une squence VCR. Si un tel ensemble est bien un intgron, il est forcment sous la dpendance d'une intgrase. Le gne de celle-ci, intI4, a t localis et prsente la mme disposition que dans un intgron classique [51]. Au voisinage se trouvent aussi un promoteur et un site appel attI4. Tout porte croire qu'il s'agit d'une norme machine gntique pour incorporer des cassettes.
intI4 intgrase gnes impliqus dans la synthse des protines RYYYAAC attI4 cassettes (ORF)

VCR 123126 pdb

GTTRRRY

Le gne intl4 et les squences rptes (VCR) chez Vibrio cholerae


Cependant la situation est probablement plus complique que dans les intgrons ordinaires, et la transcription d'ensembles aussi grands ne peut se faire qu'au moyen de promoteurs secondaires chelonns ici et l. Une recherche systmatique a rvl que d'autres espces de Vibrio, notamment V. mimicus et V. metschnikovii, contenaient des squences VCR et des structures comparables. Certaines cassettes se retrouvent chez plusieurs espces, d'autres sont plus spcifiques. Pour rsumer de faon simplifie, on peut tirer les conclusions gnrales suivantes. Les ensembles gntiques interprts comme des super-intgrons se retrouvent dans une varit d'espces dbordant le cadre de Vibrio (Xanthomonas, des Pseudomonas), mais paraissent provisoirement plus dvelopps chez les espces pathognes. Les ORF des cassettes intgres dans le gnome concernent essentiellement des facteurs de dfense ou d'adaptation. Leurs fonctions restent souvent obscures, dans la mesure o elles ne peuvent pas encore tre dtermines par comparaison avec des squences de facteurs connus. L'examen des squences et des intgrases suggre que l'acquisition des super-intgrons est dj ancienne, bien antrieure l're industrielle et le dveloppement de la chimie

114

BIODGRADATIONS ET MTABOLISMES

moderne. Les caractristiques des cassettes sont en faveur d'une acquisition externe. Le mcanisme d'entre et d'installation de cet ADN tranger reste obscur, mais confre probablement un pouvoir d'adaptation important qui pourrait jouer un grand rle dans l'environnement et amliorer lefficacit des bactries au cours des biodgradations. Le Vibrio Cholerae prsente une particularit capitale en rapport avec son caractre infectieux dangereux. Ce sont les lots de pathogncit (ou Pais), dont la nature a dj t signale dans ce chapitre. Ils sont indpendants du super-intgron. Ce sont des regroupements considrs comme des apports gntiques extrieurs o les facteurs ncessaires la virulence forment un seul bloc. La liste des cas rpertoris de ces lots ne cesse de grandir. Les premiers ont t dcouverts chez les entrobactries [52] avant d'tre observs chez le vibrion [53]. Les espces pathognes concernent aussi bien les plantes que le rgne animal et nous intressent ici dans la mesure o les mcanismes mis en jeu pourraient expliquer ladaptation des espces de lenvironnement aux conditions nouvelles. Nous retrouvons encore le principe des transmissions horizontales de linformation gntique, et pas seulement entre bactries. La dissmination toujours possible de gnes d'une espce une autre est apparue soudain comme un phnomne inquitant mis en avant dans les polmiques concernant les plantes cultives gntiquement modifies, et les risques possibles de dispersion intempestive de facteurs gntiques. Mais, dira-t-on, les super-intgrons sont-ils aussi courants que cela ? La rponse est trs probablement oui, au moins chez les bactries de la famille des vibrions. Le dveloppement de la gnomique permet de reconnatre des super-intgrons dans divers groupes de protobactries gamma : Pseudomonas, Nitrosomonas, Xanthomonas, Photobacterium, etc. Chaque structure possde son gne d'intgrase intI transcrit en sens oppos. Ces intgrases sont spcifiques. On se trouve maintenant devant un grand nombre d'intgrases rpertories. On en a une preuve convaincante de lanciennet des intgrons et super-intgrons en construisant un arbre volutif l'aide des squences intI connues, et en le comparant ceux qu'on peut dj btir avec des marqueurs peu enclins subir un transfert horizontal, celui de l'ARN 16S et rplT, un gne qui code pour la protine L20 des ribosomes. Les arbres obtenus montrent de fortes ressemblances [54], ce qui montre que leur diversification ne date pas d'hier. Dans le super-intgron de V. cholerae, les squences rptes ou VCR sont lies la spcificit de l'intgrase correspondante. Autres intgrases, autres squences rptes. La recherche systmatique de ces squences a conduit une nomenclature conventionnelle (voir XXR*). Toute rptition de squence favorise les changes par recombinaison homologue, ou encore peut conduire des dltions. Les intgrons ne sont pas essentiels aux transferts de gnes si d'autres mcanismes effectuent ce travail, et semblent ne concerner que des fonctions adaptatives, non pas des fonctions essentielles du mtabolisme. Les entrobactries ont peut-tre perdu l'usage des intgrons, conservs dans d'autres groupes. Les rapports frquents entre super-intgrons et bactriophages restent expliquer.

2 GNOMES - ADAPTATIONS - COMMUNICATIONS

115

Tout ceci montre quen introduisant des xnobiotiques dans lenvironnement, on offre la possibilit de nombreux systmes bactriens de mettre profit des mcanismes gntiques sophistiqus qui existaient certainement bien avant lre industrielle.

2.8 - LA BIOLOGIE PARTICULIRE DES BIOFILMS


Un tourbillon d'changes gntiques permet aux populations bactriennes de s'adapter et de slectionner ceux de leur membres qui vont perptuer au mieux l'espce. Mais les cellules ne sont pas isoles et livres elles-mmes. Elles contractent des associations, changent des informations et font collaborer leurs mtabolismes. On ne peut pas examiner valablement le mcanisme des biodgradations dans la nature sans porter un regard sur ces problmes. De trs nombreux organismes des milieux aquatiques et terrestres forment des associations attaches un support, qui peut tre une plante ou un lment du sol. Le rsultat est un biofilm, qui peut se dfinir comme le dveloppement d'une population de micro-organismes adhrente un support et consolide par un ciment commun. La masse des cellules associes peut excder celle du support, et celui-ci peut la limite tre pratiquement inexistant. Par extension, la notion de biofilm est gnralisable des associations formes en eau libre ou une interface, notamment dans ce qu'on appelle le floc ou les granules dans les stations d'puration. Ces regroupements peuvent mettre en contact des champignons, des algues et des protistes et sont cimentes par des substances extracellulaires. Ils contribuent non seulement former le floc mais produire des dpts souvent nuisibles sur la paroi des canalisations. La formation de biofilms a des consquences pratiques importantes, qui vont de la dtrioration de certaines installations industrielles des effets pathologiques. L'inclusion des micro-organismes dans un biofilm leur confre une protection contre les antibiotiques et les antiseptiques et tend rendre leur radication plus difficile. Les microbiologistes ont constat que la plupart des espces microbiennes de l'environnement sont capables de participer la constitution de biofilms. Diffrentes espces se regroupent en scrtant des polysaccharides extracellulaires qui peuvent former 85% de la masse totale, jusqu' constituer de formidables cits poly-ethniques, si on peut dire, ou chacun interagit avec les voisins. Il en rsulte des avantages physiologiques importants dans le domaine des biodgradations, parce que les cellules changent des mtabolites et peuvent tablir un syntrophisme*. Pour amorcer un biofilm, les bactries doivent adhrer au support par des structures de surface, les fimbriae et pili [55]. Les entrobactries (Salmonella, E. coli) ont aussi des fibres distinctes appeles curlis 56. Ces structures se lient des protines faisant partie du ciment entre cellules. Les bactries mobiles par flagelles comme Pseudomonas aeruginosa, migrent la surface du support la recherche d'un terrain favorable. Les cellules se dposent et tendent ventuellement migrer les unes vers les autres en mettant des curlis et des

116

BIODGRADATIONS ET MTABOLISMES

filaments protiques rtractiles appels pili de type IV qui les aident se regrouper. L'adhsion doit vaincre les forces lectrostatiques rpulsives entre leur surface communment anionique et les nombreux matriaux porteurs de charges ngatives. Les polymres extracellulaires contribuent rduire ces forces contraires. L'adhsion ou adhrence peut tre passive ou active. Dans l'adhrence passive, les bactries ont dj des proprits de surface qui permettent leur attachement immdiat. Dans l'adhrence active au contraire, les bactries sont attires par des forces de VAN DER WAALS ou autres mais ne s'attachent pas aussitt trs solidement. Une faible agitation du milieu (ou le mouvement des flagelles) suffit les dtacher rversiblement. L'adhrence active devient efficace dans une deuxime phase o l'attachement prend un caractre irrversible et obit un mcanisme complexe fond sur un changement des proprits de la surface cellulaire. Ce rsultat dpend de l'expression d'un ensemble de gnes et rappelle le phnomne de diffrenciation des cellules qu'on voit dans les tissus animaux et vgtaux. Ce phnomne a t bien mis en vidence l'aide de Pseudomonas marins sur des surfaces de polystyrne [57]. Certaines espces comme les Planctomyces* ont un cycle d'alternance entre stade mobile et stade fix. On peut voir la fixation des bactries et la fabrication d'un biofilm comme la rponse un tat de stress. Le biofilm une fois form est un havre de protection contre des conditions adverses prsentes en milieu libre. Les surfaces colonises, qu'il s'agisse de verre, de silicates, de plastiques, de bois ou autres, ne sont jamais absolument "propres", mais rapidement tapisses par de fins dpts de molcules organiques. Celles-ci sont reconnues par la surface des bactries. Un clairage intressant a t apport par un groupe lyonnais (P. LEJEUNE l'INSA) oprant sur le colibacille [58]. Dans les cultures en milieu libre de E. coli K12, dpourvu de tendance se fixer, apparaissent progressivement des colonies sur les parois de verre ou de plastique. Ces biofilms sont forms de cellules qui ont subi une mutation. L'tude a montr que celle-ci a eu lieu dans OmpR, une protine de contrle pour laquelle des explications sont donnes en glossaire. Elle est un peu la gardienne des conditions extrieures comme la pression osmotique, l'agent de contrle de la synthse des porines et d'autres facteurs. Dans le colibacille K12 libre, OmpR entrave la formation des curlis et c'est pourquoi sa modification par une mutation ponctuelle lve l'inhibition et encourage la prparation d'un biofilm. La protine OmpR fait partie d'une large gamme de rgulateurs dont nous trouverons des exemples dans les autres chapitres. Le principe de base est presque toujours celui-ci. Une protine dtecte une situation et sert de capteur. Elle modifie une protine rgulatrice qui intervient sur la transcription d'une srie de gnes, donc sur leur expression. OmpR transmet son signal dans plusieurs direction. Dans le cas de l'adhsion, la seconde protine rgulatrice est RpoS. Celui-ci a une action multiple dont la philosophie gnrale est d'accrotre la rsistance des cellules, et c'est bien ce qui se passe quand elles forment un biofilm, la formation des curlis tant encourage par RpoS quand OmpR lui en a donn l'ordre. Quels sont les signaux perus pour l'installation d'un biofilm ? Il y en a plusieurs. On a pu montrer que certaines bactries peroivent un contact comme un signal qui va les inciter passer du stade de nageuses libres la formation d'un difice multicellulaire. Un autre signal est le stress dclench par une surpopulation. Les

2 GNOMES - ADAPTATIONS - COMMUNICATIONS

117

cellules communiquent entre elles par mission de substances fonctionnant un peu la manire des hormones (quorum-sensing signals) et reconnues par des rcepteurs de surface. Les molcules de signalisation sont du type acylhomosrinelactone 59. Elles sont produites en continu par les cellules, traversent la membrane et s'accumulent dans le milieu o leur taux est jaug par les cellules individuelles. Au-dessus d'un certain seuil d'intensit du signal sont induits des gnes qui commandent une rponse la surpopulation. La formation d'un biofilm fait partie de ces rponses qui peuvent prendre plusieurs formes selon les espces. Chez Ps. aeruginosa, l'induction du gne algC commande l'laboration dans le biofilm du principal polymre de la matrice, qui est l'alginate. Le dmarrage d'un biofilm est donc une affaire complexe dont on a pu montrer qu'il tait sous la dpendance d'une modification du taux d'expression d'un grand nombre de gnes [60]. Cette question a des prolongements assez graves quand il s'agit d'espces pathognes dont le pouvoir infectieux est pilot en grande partie par un tat de stress. La scrtion de toxines est l'une de ces ractions adaptatives en rponse un dficit en fer ou en nutriments, ainsi qu'aux ractions de dfense de l'hte. Un aspect fascinant des relations entre les cellules est l'existence de signaux capables de dtecter la proximit de cellules trangres. Une bactrie individuelle serait capable distinguer les signaux mans de la mme espce de ceux des autres [61]. L'emploi de substances analogues capables de flouer ces mcanismes de reconnaissance pourraient servir d'outils pour lutter contre la formation de biofilms partout o leur prsence cre des problmes. Un biofilm n'est pas un milieu homogne. Au sein des biofilms peuvent se concentrer des relations physiologiques complexes entre espces. Par exemple la biodgradation de l'alcool benzylique par Acinetobacter peut associer celui-ci Pseudomonas putida qui consomme l'acide benzoque produit par le premier et l'en dbarrasse. D'importantes diffrences de conditions physiologiques existent dans la masse du biofilm. Les couches les plus profondes proches du support sont beaucoup plus pauvres en oxygne que les couches superficielles. Des mesures par micro-lectrode ont montr que la teneur en O2 peut varier sur des distances extrmement courtes, de moins d'un dixime de millimtre. Les bactries sont organises au sein de la matrice sous forme de microcolonies parcourues par de minuscules veines de liquide assurant le transport des nutriments. Enfin chaque biofilm apparat comme un monde o ses occupants ne restent pas des emplacements figs, mais migrent au sein de la masse et en change avec l'extrieur selon des rgles encore mal cernes. L'effet protecteur exerc sur les cellules au sein d'un biofilm a des consquences importantes [62]. Les substances antibiotiques doivent diffuser dans la matrice compacte et leur concentration en profondeur est plus faible qu' la surface. Leur efficacit est rduite d'autant. Dans le cas des pnicillines, il peut arriver que le biofilm contienne des germes comme les staphylocoques, dtenteurs d'une bta-lactamase. L'antibiotique est alors dtruit plus rapidement avant d'atteindre les couches profondes du biofilm. En outre ces antibiotiques n'ont que peu d'action sur les cellules des couches profondes qui ont cess de se diviser. Les cellules qui ne se divisent pas ou sont fatigues gardent leur vieille paroi en l'tat et ne sont pas inquites. Elles restent insensibles l'antibiotique tant qu'elles ne font pas de nouvelle paroi.

118

BIODGRADATIONS ET MTABOLISMES

L'antibiotique reste alors sans effet sur les couches profondes du biofilm. Un effet protecteur existe aussi pour les antiseptiques, qui doivent neutraliser progressivement les diffrentes couches du biofilm avant d'accder certaines cellules [63]. La formation d'un biofilm offre des facteurs favorables aux changes gntiques entre cellules. On a pu montrer que la prsence de plasmides et la conjugaison cellulaire induisent le dveloppement de tels rassemblements [64]. Pourquoi ? La conjugaison bactrienne est un moteur efficace de la transmission horizontale de gnes, en particulier de ceux qui autorisent une biodgradation. Autant dire qu'elle facilite l'adaptation d'une population entire s'attaquer de nouveaux substrats. Inversement la conjugaison ne peut avoir lieu qu'au hasard de la rencontre entre cellules partenaires. Sa probabilit est faible dans une population dilue. La propagation d'un plasmide est au contraire beaucoup plus facile quand les cellules sont en contact les unes avec les autres. Comme les plasmides codent communment pour des adhsines et pili, l'induction des gnes responsables ne fait que renforcer le pouvoir conjugatif et l'adhsion des cellules les unes aux autres.
cellules donneurs

cellules transconjugantes (en noir) dans un biofilm cellules rceptrices

support

Le dessin en voque le principe. La conjugaison partir d'un donneur entrane la propagation du plasmide et des facteurs qui lui sont lis. Les transconjugants expriment les proprits qui permettent au biofilm de se consolider, en particulier la production de polysaccharides. En mme temps ces transconjugants acquirent le pouvoir de fabriquer de nouvelles enzymes dont les gnes sont ports par le plasmide. On peut voir que cette question a de profondes rpercussions sur la comprhension de certains mcanismes environnementaux. Les micro-organismes, trs souvent associs sur des particules solides, notamment dans les sols, forment de vritables cits multicellulaires o s'tablissent des changes gntiques ainsi que des relations mtaboliques complexes. C'est pourquoi les recherches sur les biofilms ont pris depuis quelques annes une importance de premier plan, en particulier pour mieux comprendre et piloter certaines biodgradations. L'immobilisation artificielle des cellules sur un support permet d'exploiter les proprits spciales constates dans les biofilms. L'avantage des bactries immobilises est souvent leur meilleure rsistance aux conditions adverses. On a dcrit de nombreuses techniques d'immobilisation, qui consistent notamment

2 GNOMES - ADAPTATIONS - COMMUNICATIONS

119

inclure les cellules dans un gel, ou crer des ponts covalents entre les constituants de la surface cellulaire et le support. Il est ventuellement question de reproduire de faon contrle les proprits constates dans le floc des stations d'puration. La formation de ces flocs est une opration tout fait essentielle du traitement des eaux uses. Elle est assure par des bactries floculantes qui s'agrgent entre elles pour donner des assemblages qui sont la base des boues. Ces flocs sdimentent et se concentrent au cours de la phase de dcantation, en entranant des matires organiques, des phosphates, etc. Parmi les bactries floculantes sont des nitrifiantes, qui jouent un rle cl dans l'oxydation de l'ammoniac en nitrite puis en nitrate. La structure des flocs est encore imparfaitement comprise. Des recherches sont faites pour amliorer leur efficacit et permettre une meilleure diffusion des substances dissoutes dans la masse des particules. La dcantation des flocs est parfois perturbe par le dveloppement de bactries filamenteuses, dont Microthrix parvicella et Sphaerotilus natans, qui perturbent le bon fonctionnement des stations d'puration. La gestion de ces problmes est videmment un challenge important, avec l'extension du volume de dchets et des pollutions de toute nature.

2.9 - COMMUNICATION ET BIOLUMINESCENCE


Cette section prolonge la prcdente car les bactries peuvent changer des renseignements laide des substances qu'elles mettent au sein du milieu. Les interactions par phromones sont nombreuses et peuvent avoir une influence ici et l sur la rpartition de la microflore et son activit dans l'environnement. La communication est importante pour la survie des espces quand il s'agit de lutter contre une surpopulation, un dficit en ressources, une agression, ou lorsqu'il faut mettre en commun des outils de dgradation pour amliorer leur efficacit. Ce sujet est devenu extrmement important pour comprendre le comportement des populations bactriennes.
OH O 1 3 O N H O

3 hydroxy-octanoyl-homosrine-lactone

Les premires phromones bactriennes connues sont les N-acyl-L-homosrinelactones ou AHLs , dont il existe toute une famille chez les Gram-ngatifs en fonction de la nature de leur formule. Une mme espce peut librer dans le milieu plusieurs AHLs reconnues par diffrentes protines rceptrices. Les AHLs sont typiquement des signaux indiquant une forte concentration cellulaire. Leur spcificit est dtermine par la longueur de la chane carbone et la nature de la position 3, qui est soit un alcool secondaire comme ici, soit une fonction ctonique. Ces produits sont hydrophobes et traversent facilement la membrane. Lorsque les bactries se multiplient en milieu confin, la concentration des AHLs augmente. partir d'un certain seuil, variable de 105 109 M selon les cas, des

120

BIODGRADATIONS ET MTABOLISMES

rgulateurs de transcription sont activs spcifiquement, provoquant l'expression d'un ou plusieurs gnes groups en oprons. Le phnomne est ce qu'on appelle le quorum sensing [65] en somme le rsultat d'un effet de foule. Il conduit une sorte d'tat de crise dans la population bactrienne, et peut se manifester dans les espces pathognes par un accroissement de la virulence. La bioluminescence de Photobacterium fischeri a permis de se faire une premire ide sur l'effet de foule. Cette espce ocanique met de la lumire grce une oxydase flavinique agissant sur des composs aldhydiques longue chane (de 7 11 carbones) appels lucifrines*. L'mission de lumire rsulte de leur oxydation. Cette question est mentionne ici essentiellement pour sa valeur en tant que modle. L'accumulation des bactries dans des organes spciaux appartenant certains poissons et cphalopodes cre le confinement et provoque l'augmentation de la lumire mise. La rgulation de ce systme a stimul l'tude de divers phnomnes biologiques qui ne se limitent pas l'mission de lumire et concernent les biodgradations. La bioluminescence est fonde sur une structure gntique qui nous servira d'illustration du phnomne. La lumire est mise condition que soient exprims les gnes luxA et B codant pour une lucifrase 14, et les gnes luxC , D et E codant pour trois protines contribuant la synthse partir d'une lucifrine, qui est ici un aldhyde.

luxR

luxI

E ACP synthtase

AI

acyle transfrase I acide gras rductase

lucifrase

synthse de lauto-inducteur

Opron lux de Vibrio fischeri


Le gne luxG coderait pour une flavine rductase [66]. Quant la protine code par luxI, elle participe la synthse d'un inducteur interne ou auto-inducteur (AI), un produit du type N-acylhomosrine lactone qui diffuse et s'accumule au dehors de la cellule L'expression de l'opron des gnes lux est sous la dpendance de la protine rgulatrice LuxR et de LuxI, enzyme implique dans la synthse de l'auto-inducteur AI. LuxR est un activateur de transcription pour son propre gne et pour cet opron luxICDABEG. Le gne rgulateur luxR et l'opron sont transcrits dans des directions opposes partir d'une mme rgion promotrice, une disposition que nous retrouverons souvent. L'auto-inducteur est prsent en quantit infime dans les cellules isoles mais commande sa propre production. Il en rsulte un effet amplificateur. Quand la population cellulaire devient dense, par exemple dans les organes lumineux des calmars, sa concentration s'accrot dans des proportions normes. 14 - Le principe est expliqu en glossaire Lucifrine.

2 GNOMES - ADAPTATIONS - COMMUNICATIONS

121

LuxR est fixe la membrane et fonctionne comme dimre. La protine peut se lier l'ADN par le domaine C-terminal de chaque monomre sur une squence palindromique appele "bote lux" dans la rgion du promoteur. L'association ne se fait pas en temps normal, parce que la partie N-terminale de la squence recouvre dans la mme molcule la partie C-terminale responsable de l'attachement. La rgion N-terminale fait office de couvercle qui empche l'attachement et entrane une inhibition interne. Ce blocage cesse quand l'auto-inducteur AI se fixe sur cette rgion de LuxR, provoque un changement de conformation, et dvoile la partie qui doit s'attacher l'ADN. Chez Vibrio fischeri, c'est donc AI qui fait sauter le bouchon. L'association forme entre LuxR et AI est le vritable activateur transcriptionnel. Il fait deux choses : dclencher l'expression de l'opron, et acclrer celle du gne luxR. Ceci est ralis une condition expresse qui est l'aide d'une protine supplmentaire appele CRP* [67]. La protine CRP (ou CAP) est un activateur de transcription supplmentaire agissant comme pour divers sites gntiques lorsqu'elle a li de l'AMP cyclique (AMPc). Son attachement sur l'ADN ne se fait que si le taux d'AMPc est suffisant. Ce taux baisse en milieu glucos, avec pour effet une diminution de la bioluminescence. Le maximum de lumire mise s'observe donc : quand l'acylhomosrine-lactone (AI) se lie LuxR ; quand le tandem LuxR + AI se lie l'ADN ; quand le rgulateur CRP se lie galement l'ADN partir d'un taux suffisant d'AMPc. Un diagramme montre la zone cruciale de 240 kb o se fait la rgulation chez V. fischeri. Sont indiqus les deux promoteurs (caractriss chacun par les botes 10 et 35, les botes o s'installent CRP et LuxR (lux), et les points de dpart des transcriptions (flches).
transcription de lopron 35 10 luxR transcription de LuxR 10 35 CRP LuxR luxI

La zone rgulatrice sur l'ADN


Ce systme ne peut fonctionner que s'il y a en permanence assez d'autoinducteur AI pour activer la protine LuxR. L'auto-inducteur AI est apport de l'extrieur par les autres cellules de la colonie et il y a en mme temps une petite transcription de fuite de l'opron luxICDABEG, de telle sorte que AI est produit en permanence mais au ralenti. L'ensemble de la population fabrique donc de l'autoinducteur en continu et c'est pourquoi il tend s'accumuler progressivement. La brusque acclration se fait au-del d'un certain niveau avec l'entre en lice du rgulateur LuxR et la formation du complexe activateur avec AI. L'activation produite par la monte de l'auto-inducteur AI devrait avoir une allure explosive, avec expression massive des gnes concerns. Il n'en est rien, car un mcanisme secondaire en limite les excs. Quand le complexe LuxR-AI s'accumule, il tend se limiter lui-mme, car la protine inhibe alors l'expression de son gne luxR. Elle limite elle-mme sa propre production ! C'est donc une boucle de rtro-

122

BIODGRADATIONS ET MTABOLISMES

contrle. D'autres mcanismes assez compliqus semblent intervenir. Vibrio fischeri ne fait pas qu'un seul AI mais trois, AI-1, AI-2 et AI-3, qui diffrent par leur chane latrale. AI-1 et AI-3 sont des acylhomosrine-lactones ou AHL, fabriqus par la mme enzyme, alors qu'AI-2 est produit par une voie indpendante. Tous ces composs drivent du mme prcurseur mtabolique, qui est la S-adnosylmthionine*. Or AI-2 n'active que faiblement LuxR. Il entre en comptition avec les autres AI et se comporte en fait comme un inhibiteur [68]. Il y a donc un jeu subtil entre tous ces facteurs, et un rglage sophistiqu qui peut clairer, c'est le cas de la dire, d'autres rgulations bactriennes du mme genre. Des variantes de ce mcanisme s'observent en fonction des espces. Oprentelles de la mme faon ? Le vibrion V. harveyi produit et reoit deux auto-inducteurs, dsigns par AI-1 et AI-2, mais distincts de ceux de V. fischeri. Ces deux produits rgulent l'opron de la luminescence, mais la situation repose sur une cascade de protines rgulatrices un peu plus compliques. Les deux autoinducteurs sont reconnus par des rcepteurs diffrents LuxN et LuxQ, et les signaux sont intgrs par une mme protine rgulatrice. Nous ne dcrirons pas cette cascade ici, mais on pourra en trouver les dtails dans les articles de FREEMAN et BASSLER [69]. L'auto-inducteur AI-1 de V. Harveyi est une homosrine lactone spcifique de l'espce. Par contre AI-2 est fabriqu par de nombreuses espces, y compris le colibacille et les salmonelles. On a identifi l'enzyme catalysant la dernire tape de la synthse de AI-2 et baptise LuxS. Cette question est exemplaire car la connaissance du gne luxS permet de faire une recherche systmatique de ce type de facteur dans les populations bactriennes. Il a t constat avec surprise que des gnes fortement homologues de luxS sont trs rpandus dans la nature. La conclusion logique est que AI-2 reprsente un signal interspcifique du quorum sensing, chang au sein des populations mixtes. La rvlation de la nature exacte de AI-2 a t une surprise. Cet auto-inducteur contiendrait du bore [70]. Ce dtail est soulign ici pour la curiosit. Le bore, apport en gnral sous forme de borate, est ncessaire de nombreux organismes, mais il est trs rare de lui attribuer une fonction prcise. Or l'AI-2 fait maintenant figure de signal bactrien universel compris par un grand nombre d'espces [71].
B(OH)4 LuxS OH O OH O O O OH CH3 HO O HO AI-2 HO O B OH O CH
3

S-adnosyl-mthionine

HO 4,5-dihydroxy-2,3-pentanedione

prcurseur de A1-2

Le bore dans un signal universel ?


Les deux auto-inducteurs de Vibrio harveyi reprsentent peut-tre une situation trs rpandue. Un premier signal de surpopulation, AI-1, est rserv l'espce concerne. Le second, AI-2, s'change entre bactries d'espces diffrentes. On pense que de tels changes d'information ont lieu au sein des populations mixtes responsables de biodgradations dans l'environnement. Le quorum sensing ou effet de

2 GNOMES - ADAPTATIONS - COMMUNICATIONS

123

foule ne gouverne pas qu'une fonction physiologique, mais peut moduler les effets d'une protine rgulatrice qui exerce son action sur des activits divergentes commandes par des oprons diffrents [72]. Ces derniers forment ce qu'on appelle un rgulon*. De nombreuses activits physiologiques sont modules par la concentration bactrienne. Le tableau en cite quelques uns. Espce bactrienne
Photobacterium fischeri, Vibrio harveyi Pseudomonas aeruginosa Pseudomonas aureofaciens Erwinia carotovora Agrobacterium tumefaciens Serratia marcescens Yersinia enterocolitica

Activit stimule par une AHL


mission de lumire Induction de l'lastase et de facteurs de virulence Induction de phnazines antibiotiques Induction d'enzymes lytiques et de carbapenem Induction du transfert de plasmide Ti entre cellules Changement de mobilit, swarming Induction de protines non caractrises

Les N-acylhomosrine-lactones (NAHs) ne sont pas les seuls agents de communication du monde bactrien. Chez les Streptomyces comme S. griseus, le signal se transmet par un produit un peu plus simple, la gamma-butyrolactone. Le rsultat est une tendance mettre des antibiotiques ou sporuler. Les Gram-positifs ont souvent des mcanismes particuliers qui mettent en jeu des oligopeptides de 5 25 acides amins (dont certains sont modifis par rapport aux formules classiques). Voici quelques exemples. Dans le cas de B. subtilis, les effets constats sont dclenchs par plusieurs peptides. Espce bactrienne
Bacillus subtilis Bacillus subtilis Lactococcus lactis Lactobacillus plantarum Lactobacillus sake Enterococcus faecalis Staphylococcus aureus

Activit stimule par un peptide


Comptence la transformation Sporulation Production de nisine (lantibiotique) Production de plantaricine (antimicrobien) Production de sakacine (antimicrobien) Agglutination, transfert de plasmide Exotoxine, virulence...

Bacillus subtilis est l'archtype des bactries sporulantes rpandues dans l'environnement, et offre un cas de figure complexe. La densit de population favorise la fois la comptence (voir transformation*) et la sporulation. La comptence est stimule par deux facteurs extracellulaires, la phromone ComX (un dcapeptide), et CSF, un pentapeptide qui agit galement sur la sporulation [73]. Dans les deux cas, il s'agit d'une rponse qui intgre plusieurs situations adverses comme un dficit de ressources nutritives, des atteintes l'intgrit de l'ADN (la transformation est un moyen de rparer), une atteinte toxique ou l'inhibition d'une tape du mtabolisme. Les signaux sont pris en charge par une permase (SpoK) et par le rcepteur de CSF. Leur action dbouche en fin de compte sur des rgulateurs de transcription, soit ComK pour la comptence, et SpoA pour la sporulation. Un jeu

124

BIODGRADATIONS ET MTABOLISMES

complexe entre les diffrentes rgulations oriente le comportement des cellules. Il dclenche ou inhibe la sporulation. Chez les Gram-positifs, ces polypeptides sont gnralement fabriqus sous forme de chanes plus longues, dont une partie est limine par une coupure hydrolytique. La partie restante est alors prise en charge et exporte dans le milieu par un transporteur ABC*, avant d'tre reconnue par une autre cellule qui se sert d'un rcepteur appropri. Ce dernier peut faire partie d'une rgulation deux composants* avec capteur et rgulateur. D'autres agents de communication sont des acides gras, des macrolides (antibiotiques de Streptomyces alboniger) et autres produits. Ces communications sont nombreuses et trs diverses chez les actinomyctes et organismes capables de faire des filaments mycliens ariens et des fructifications. Un des aspects les plus intressants des communications entre bactries est l'existence d'une organisation collective, qu'on a souvent compare au dveloppement des organismes pluricellulaires. Ceci avait t remarqu par l'examen des colonies d'Escherichia coli sur bote glose [74]. La rgle qui gouverne l'organisation de la colonie semble tre d'augmenter au maximum les contacts de cellule cellule, avec des diffrences sur l'longation et la mobilit des cellules individuelles. Le point le plus important est peut-tre la scrtion des polysaccharides extracellulaires formant une matrice dans laquelle la population s'organise. C'est exactement ce qu'on observe dans un biofilm, et probablement un facteur majeur qui rgle le dveloppement des populations denses de microorganismes dans l'environnement. Une application spectaculaire est le swarming. Certaines espces, comme Proteus vulgaris et P. mirabilis, ont la proprit bien connue des microbiologistes de s'taler trs rapidement sur bote glose. L encore cette question est voque par sa valeur comme modle. Il y a division du travail entre des cellules allonges et hyperflagelles, qui se migrent dans une matrice de polysaccharides externes, et des cellules nageuses qui ne sont mobiles qu'en milieu liquide. Ce comportement est collectif, dpend de certains facteurs du milieu 15 et ne survient qu'au sein d'une population nombreuse. Une priodicit trs curieuse peut s'tablir, avec des zones d'talement et des alternances de swarming et de repos [75]. Une colonie de Proteus mirabilis s'tablit en cercles concentriques, faisant alterner une phase de swarming (expansion), et une phase de consolidation o les cellules se divisent activement. Les cellules oscillent donc entre deux phases, o les cellules en expansion ont une forme beaucoup plus allonge et se dplacent dans un film de polymre, formant une zone dense pousse par la prolifration des bactries en phase de consolidation, situes en zones plus claires. Ces bactries en voie de division se sont ddiffrencies partir des cellules essaimeuses ou swarming cells. Elles se diffrencieront nouveau en cellules essaimeuses. L'anneau le plus externe en contient. La prolifration des bactries dans le cercle interne adjacent cre une pression qui tend agrandir le cercle, indpendamment des mouvements des cellules essaimeuses.

15 - Le swarming complique l'obtention de colonies isoles sur glose, peut s'inhiber en utilisant un agar plus concentr ou en ajoutant du dsoxycholate.

2 GNOMES - ADAPTATIONS - COMMUNICATIONS

125

cellules en expansion cellules en phase de consolidation

Colonie de Proteus mirabilis


Celles-ci cessent leur migration et entrent en consolidation, prparant un nouveau cercle de cellules vgtatives division rapide, avant que s'tablisse une nouvelle vague de bactries essaimeuses. Le plus trange est la synchronisation du mcanisme dans toute la colonie, qui suppose l'existence d'un programme bien dfini et de communications intercellulaires qui demandent encore tres lucides. Des morphologies diffrentes sont adoptes par les colonies de Bacillus subtilis en cours de croissance sur milieu solide et semblent avoir intress particulirement les physiciens cause des figures formes voquant les fractales.

Croissance fractale : Bacillus subtilis sur agar


Les dendrites apparaissent gnralement sur un milieu carenc en lments nutritifs et concentr en agar. La formation de dendrites permet la colonie d'augmenter sa surface de contact avec le milieu neuf et de faciliter la diffusion interne des ressources. Les dendrites avancent quand la masse cellulaire pousse devant elle la gangue d'exopolymres [76]. Les figures formes ont donn lieu de nombreuses modlisations mathmatiques. Cet exemple nous permettra de conclure sur l'importance des associations bactriennes rgles par des messages chimiques entre cellules et entre espces diffrentes, avec la cl des bnfices adaptatifs importants. On peut en citer

126

BIODGRADATIONS ET MTABOLISMES

quelques-uns. L'un d'eux est la division du travail. On l'observe par la diffrenciation de cellules spcialises, trs marque chez les actinomyctes ou chez les cyanobactries (htrocystes). Un autre avantage est l'utilisation commune d'une source nutritive qui n'est pas suffisamment accessible aux cellules isoles. Dans la plupart des cas, il s'agit de la fabrication d'enzymes lytiques extracellulaires. Chez une espce parasite des vgtaux, Erwinia carotovora, la scrtion d'enzymes attaquant les parois vgtales est sous le contrle d'un quorum sensing par phromone (une AHL) et n'intervient donc qu' partir d'un certain volume de la population. Le regroupement des cellules est un mcanisme de dfense et peut induire la scrtion d'antibiotiques ou augmenter la rsistance des agents extrieurs, comme les peroxydes. C'est un phnomne qu'on observe aussi dans les biofilms, ou dans les cellules immobilises artificiellement. La sporulation est une rponse qui apparat comme une raction de secours pour la population entire. Enfin le regroupement favorise les changes gntiques par conjugaison, transformation, pntration de plasmides. On pense que ces changes gntiques ont une importance cologique capitale en favorisant l'adaptation des populations aux biodgradations. Certains auteurs voient une population bactrienne comme une sorte d'organisme multicellulaire o le patrimoine de chaque individu reste accessible tous les individus de la collectivit [77]. Les bactries et les procaryotes en gnral ne sont donc pas faits uniquement de cellules isoles qui vivent pour leur propre compte, mais s'associent temporairement ou en permanence des ensembles plus grands o s'tablissent changes et communications entre individus. Des niveaux d'association complexes, siges de diverses diffrenciations, sont atteints par les myxobactries*, et surtout par les nombreux actinomyctes du sol qui forment un myclium et des fructifications, en imitant la structure plus complexe des champignons.

CONCLUSION RAPIDE
Le monde des micro-organismes qui prennent part aux grands cycles des substances naturelles et artificielles de l'environnement a une norme plasticit d'adaptation. En se limitant aux bactries, nous avons dj pu voir que des mcanismes diversifis peuvent remanier leur patrimoine gntique et faire natre dans une population des cellules rendues plus aptes grer leur mtabolisme ou leur rsistance face des conditions nouvelles. Les modifications vont de la mutation ponctuelle banale survenant au hasard des bouleversements plus grands par la transmission de matriel gntique de cellule cellule. Dans la comptition vitale l'agressivit et les hautes performances sont de rgle. Le pouvoir infectieux des bactries pathognes est un aspect particulier de ce comportement, qui peut nous donner des indications sur des mcanismes plus gnraux allant jusqu' l'apparition de nouvelles formes aptes effectuer des biodgradations.

2 GNOMES - ADAPTATIONS - COMMUNICATIONS

127

RFRENCES
[1] S T O V E R C K & C O L L . (2000) Nature 406 : 959-964. [2] H E R R M A N N R & R E I N E R B (1998) Curr. Opin. Microbiol. 1 : 572-579. [3] C O O P E R VS & L E N S K I RE (2000) Nature 407 : 736-739. [4] P A P A D O P O U L O S D , S C H N E I D E R D , M E I E R - E I S S J, A R B E R W , L E N S K I RE & B L O T M (1999) Proc. Natl. Acad. Sci. 96 : 3807-3812. [5] O B M O L O V A G , B A N C , H S E I H P & Y A N G W (2000) Nature 407 : 703-710 ; L A M E R S MH , P E R R A K I S A, E N Z L I N JH , W I N T E R W E R P H H K , D E W I N D N & S I W M A TK (2000) Nature 407 : 711-717. [6] B A N C , J U N O P M & Y A N G W (1999) Cell 97 : 85-97. [7] B A N C & Y A N G W (1998) EMBO J. 17 : 1526-1534. [8] U E T Z P & 18 auteurs (2000) Nature 403 : 623-627 et annexe. [9] P U I G O , C A S P A R Y F, R I G A U T G , R U T Z B, B O U V E R E T E, B R A G A D O - N I L S S O N E, W I L M M & S E R A P H I N B (2001) Methods 24 : 218-229. [10] G A V I N A- C & 37 auteurs (2002) Nature 415 : 141-147. [11] H O Y & 45 auteurs (2002) Nature 415 : 180-183. [12] E L L I S RJ (2001) Trends Biochem.Sci. 26 : 597-604. [13] D A V I E S J (1996) Microbiologia 12 : 9-16. [14] O C H M A N H , L A W R E N C E JG & G R O I S M A N EA (2000) Nature 405 : 299-304. [15] B L A T T N E R FR & autres auteurs (1997) Science 277 : 1453-1474. [16] L A W R E N C E JG & O C H M A N H (1998) Proc. Natl. Acad. Sci. 95 : 9413-9417. [17] S M I T H H O , T O M B JF, D O U G H E R T Y BA, F L E I S C H M A N N RD & V E N T E R JC (1995) Science 269 : 468-470. [18] M A U R E L L I AT, F E R N A N D E Z RE, B L O C H C A & R O D E C K V F A S A N O A (1998) Proc. Natl. Acad.Sci. 95 : 3943-3948. [19 D O B R I N D T U & R E I D L J (2000) Int. J. Med. Microbiol. 290 : 519-527. [20] N E L S O N KE & C O L L . (1999) Nature 399 : 323-329 ; L O G S D O N JM & F U G U Y D M (1999) Curr. Biol. 9 : R747-R751. [21] K U N S T F & 25 autres auteurs (1997) Nature 390 : 237-238. [22] H E I N E M A N N JA & S P R A G U E G FJ (1989) Nature 340 : 205-209. [23] S T A C H E L S E & Z A M B R Y S K I P (1986) Cell 47 : 155-157. [24] W I L L E T T S N & S K U R R A Y R (1987) In "Escherichia coli and Salmonella typhimurium", N E I D H A R D T FC ed., Amer. Soc. Microbiol., Washington : 1110-1133. [25] C H R I S T I E PJ (2001) Mol. Microbiol. 40 : 294-305. [26] C H R I S T I E PJ (2001) Mol. Microbiol. 40 : 294-305. [27] B E R G D E & H O W E MM (1989) Mobile DNA, American Soc. For Microbiology, Washington, D.C. [28] M A H I L L O N J & C H A N D L E R M (1998) Microbiol. Molec. Biol. Reviews 62 : 725-774. [29] M A C H I D A C & M A C H I D A Y (1989) J. Mol. Biol. 208 : 567-574.

128

BIODGRADATIONS ET MTABOLISMES

[30] E S C O U B A S JM, P R E R E MF, F A Y E T O , S A L V I G N O L I, G A L A S D , Z E R B I B D & C H A N D L E R M (1991) EMBO J. 10 : 705-712 ; F A R A B A U G H PJ (1996) Microbiol. Rev, 60 : 103-134. [31] P O L A R D P & C H A N D L E R M (1995) Genes Dev. 9 : 2846-2858 ; P O L A R D P & C H A N D L E R M (1995) Mol. Microbiol. 125 : 13-23. [32] B L O T M (1994) Genetica 93 : 5-12. [33] C O O P E R VS , S C H N E I D E R D , B L O T M & L E N S K I RE (2001) J. Bacteriol. 183 : 2834-2841. [34] C O X R & M I R K I N S M (1997) Proc. Natl. Acad. Sci. 94 : 5237-5242. [35] L A W L E Y TD , B U R L A N D V & T A Y L O R D E (2000) Plasmid 43 : 235- 23 9. [36] K L E C K N E R (19 90) Annu.Rev.Genetics 124 : 449-454 ; K L E C K N E R N (1990) Annu. Rev. Cell Biol. 6 : 297-327. [37] D E L A C R U Z NB, W E I N R E I C H MD , W I E G A N D TW , K R E B S MP, R E Z N I K O F F W S (1993) J. Bacteriol. 175 : 6932-6938. [38] S T O K E S H W & H A L L RM (1989) Mol. Microbiol. 3 : 1669-1683. [39] O C H M A N H , L A W R E N C E JG , G R O I S M A N EA (2000) Nature 405 : 299-304. [40] H A N S S O N K, S K L D O , S U N D S T R M L (1997) Molec. Microbiol. 5 : 1941-1959 ; G R A V E L A, M E S S I E R N, R O Y PH (1998) J. Bacteriol. 180 : 5437-5442. [41] N U N E S - D B Y S E, K W O N H J, T I R U M A L A I RS , E L L E N B E R G E R T, L A N D Y A (1998) Nucleic Acids Res. 26 : 391-406. [42] G R I N D L E Y ND F (1997) Curr. Biology 7 : R608-R612. [43] R O W E - M A G N U S D A & M A Z E L D (1999) Curr. Opininion Microbiol. 2 : 483-488. [44] F R A N C I A MV & G A R C I A L O B O JM (1996) J. Bacteriol. 178 : 894-898. [45] B I S S O N E T T E L & R O Y PH (1992) J. Bacteriol. 174 : 1248-1257. [46] B I S S O N E T T E L, C H A M P E T I E R S , B U I S S O N J- P , R O Y PH (1991) J. Bacteriol. 173 : 4493-4502. [47] C O L W E L L RR (1996) Science 274 : 2025-2031. [48] H E I D E L B E R G JF et coll. (32 auteurs au total) (2000) Nature 406 : 477-486. [49] B A R K E R A, C L A R K C A, M A N N I N G PA (1994) J. Bacteriol. 176 : 5450-5458. [50] R O S E - M A G N U S D A, G U E R O U T A- M , M A Z E L D (1999) Res. Microbiol. 150 : 641-651. [51] L E V E S Q U E C , B R A S S A R D S , L A P O I N T E J, R O Y PH (1994) Gene 142 : 48-9-54 ; M A Z E L D , D Y C H I N C O B, W E B B VA, D A V I E S J (1998) Science 280 : 605-608. [52] H A C K E R J, B L U M - O E H L E R G , M H L D O R F E R I, T S C H P E H (1997) Molec. Microbiol. 23 : 1089-1097. [53] K A R A O L I S D KR , J O H N S O N JA, B A I L E Y C C , B O E D E K E R EC , K A P E R JB, R E E V E S PR (1998) Proc. Natl. Acad. Sci. 95 : 3134-3139. [54] R O W E - M A G N U S D A, G U E R O U T A- M , P L O N C A R D P, D Y C H I N C O B, D V I E S J, M A Z E L D (2001) Proc. Natl. Acad. Sci. 98 : 652-657. [55] D A N E S E PN, P R A T T LA, D O V E S L, K O L T E R R (2000) Mol. Microbiol. 37 : 424-432. [56] O L S N A, J O H N S S O N A, N O R M A R K S (1989) Nature 338 : 652-655. [57] P O W E R K & M A R S H A L L KC (1988) Biofouling 1 : 163-174 ; M A R S H A L L KC (1992) ASM News 58 : 202-207.

2 GNOMES - ADAPTATIONS - COMMUNICATIONS [58] V I D A L O , L O N G I N R, P R I G E N T - C O M B A R E T C , D O R E L C , H O O R E M E N M & L E J E U N E P (1998) J. Bacteriol. 180 : 2442-2449. [59] E B E R L S (1999) Syst. Appl. Microbiol. 22 : 493-506 ; M A N E F I E L D M, D E N Y S R, K U M A R N, R E A D R, G I V S K O V M, S T E I N B E R G P & K J E L L E B E R G S (1999) Microbiology 145 (pt2) : 283-291. [60] P R I G E N T - C O M B A R E T C & L E J E U N E P (1999) Methods Enzymol. 310 : 56-79. [61] S U R E T T E MG , M I L L E R MB, B A S S L E R BL (1999) 96 : 1639-1644. [62] S T E W A R T PS & C O S T E R T O N JW (2001) Lancet 358 : 135-138. [63] C O C H R A N W L, M C F E T E R S G A, S T E W A R T PS (2000) J. Appl. Microbiol. 88 : 22-30. [64] G H I G O J- M (2001) Nature 412 : 442-445. [65] M I L L E R MB & B A S S L E R BL (2001) Annu. Rev. Microbiol. 55 : 165-199. [66] L I N JW , C H A O Y F, W E N G S F (1998) Biochem. Biophys. Res. Commun. 246 : 446-452. [67] S T E V E N S AM, D O L A N KM, G R E E N B E R G EP (1994) Proc. Natl. Acad. Sci. 91 : 12619-12623. [68] K U O A, C A L L A H A N S M, D U N L A P PV (1996) J. Bacteriol. 178 : 971-976. [69] F R E E M A N JA & B A S S L E R BL (1999) J. Bacteriol. 181 : 899-906 ; B A S S L E R BL (1999) Curr. Opin. Microbiol. 2 : 582-587. [70] C H E N X, S C H A U D E R S , P O T I E R N, V A N D O R S S E L A E R A,P E L C Z E R I, B A S S L E R BL, H U G H S O N FM (2002) Nature 415 : 545-549. [71] M I L L E R MB & B A S S L E R BL (2001) Annu. Rev. Microbiol. 55 : 165-199. [72] C A L L A H A N S M & D U N L A P PV (2000) J. Bacteriol. 182 : 2811-2822. [73] S O L O M O N JM, L A Z A Z Z E A BA, Grossman AD (1996) Genes Dev. 9 : 547-558. [74] S H A P I R O JA (1987) J. Bacteriol. 197 : 142-156 ; Shapiro JA (1995) J. Bacteriol. 17 : 597-607. [75] R A U P R I C H O , M A T S U S H I T A M, W E I J E R K, S I E G E R T F, E S I P O V S & S H A P I R A JA (1996) J. Bacteriol. 178 : 6525-6538 ; M A T S U Y A M A T, T G A G I Y , N A G A G A W A Y , I T O H H , W A K I T A J & M A T S U S H I T A M (2000) J. Bacteriol. 182 : 385-393. [76] B E N - J A C O B E, S C H O C H E T O , T E N E B A U M A, C O H E N I, C Z I R K A & V I C S E K T (1994) Nature 368 : 46-48. [77] S H A P I R O JA (1998) Annu. Rev. Microbiol. 52 : 81-104.

129

OXYDATIONS MINRALES
Le mthane, l'ammoniac, le monoxyde de carbone, l'hydrogne sulfur, le fer, le cyanure sont autant de substrats trs simples dont l'oxydation par l'oxygne de l'air fournit aux organismes spcialiss toute l'nergie ncessaire leur dveloppement. Ce chapitre passe en revue les principales oxydations de ce type. Les germes responsables sont des chimio-lithotrophes, parfois des autotrophes qui utilisent le gaz carbonique comme seule source de carbone. Tous ces germes acceptent un mode de vie spartiate, mais ce sont des maillons essentiels dans le cycle des lments de la biosphre. Ils contribuent dans une large mesure au nettoyage de l'environnement en limitant l'accumulation de produits indsirables. L'limination des dchets de l'activit humaine a souvent besoin de leur intervention. 3.1 - Un cycle naturel du mthane 3.2 - Le mthane, source de carbone et dnergie 3.3 - Croissance sur mthane et mthanol 3.4 - Mthanotrophes contre organochlors 3.5 - Halomthanes 3.6 - L'oxydation de l'ammoniac 3.7 - Monoxyde de carbone et carboxydotrophes 3.8 - Du sulfure au sulfate 3.9 - limination de composs soufrs simples 3.10 - L'oxydation du fer et du manganse 3.11 - Cyanure - cyanate - thiocyanate 133 135 144 152 155 159 167 171 177 179 184

CHAPITRE 3

3 OXYDATIONS MINRALES
Le mthane, l'ammoniac, l'hydrogne sulfur, le fer, le cyanure sont autant de substrats trs simples dont l'oxydation fournit aux organismes spcialiss toute l'nergie ncessaire leur dveloppement. Ces germes sont des chimiolithotrophes. Il n'est pas rare de trouver parmi eux des autotrophes qui utilisent le gaz carbonique comme seule source de carbone. Tous ces germes acceptent donc un mode de vie spartiate, mais ce sont des maillons essentiels dans le cycle des lments de la biosphre. Ils contribuent dans une large mesure au nettoyage de l'environnement en limitant l'accumulation de produits indsirables, et beaucoup de biodgradations se font avec leur aide...

3.1 - UN CYCLE NATUREL DU MTHANE


Le mthane est somme toute le plus simple des composs carbons, un gaz discret et omniprsent dans la biosphre. Dans l'atmosphre terrestre primitive qui a vu apparatre les premires formes vivantes, le mthane pourrait avoir aid la gense de molcules organiques plus compliques, alors que les conditions taient trs rductrices. On a suppos que les missions volcaniques les plus anciennes contenaient des formes plus rduites (H2, NH3, CH4, H2S) que les exhalations modernes : CO2, H2O, N2, SO2, traces de H2 et CO. Le mthane a t identifi dans latmosphre de Titan [1]. Les expriences de SCHLESSINGER et MILLER [2] ont signal son importance possible pour les premires bauches de la vie en dmontrant une synthse d'acides amins et dautres composs biologiques par dcharges lectriques dans diffrents mlanges de mthane, d'hydrogne, de monoxyde de carbone et de CO2. Ce sujet a t discut, il a quelques annes, par KASTING [3]. L'influence du mthane contemporain sur l'environnement se fait sentir au moins deux niveaux. Le premier correspond l'effet de serre. Le second est l'utilisation du mthane comme source nergtique par des micro-organismes arobies. La source du mthane est en grande partie biologique, partout o l'oxygne fait strictement dfaut, dans le sol, les sdiments et le fond des ocans. Les activits humaines viennent en renfort parce que le mthane est produit dans les cultures (rizires), par l'extension de l'levage ou par l'pandage des dchets. La production de mthane lie aux activits humaines serait de 330 400 millions de tonnes par an. L'examen des gaz emprisonns dans les glaces polaires indique que le mthane atmosphrique a plus que doubl depuis le dbut de l're industrielle. La

134

BIODGRADATIONS ET MTABOLISMES

teneur actuelle du mthane atteint 1,8 ppmv aprs avoir augment de 1% par an depuis trente ans [4]. La contribution du mthane atmosphrique l'absorption de l'nergie solaire et l'effet de serre n'est pas ngligeable. La concentration moyenne en CO2 est passe de 315 358 ppmv entre 1800 et 1995, elle est maintenant proche de 370, soit 50% d'augmentation lie en grande partie la combustion des hydrocarbures fossiles. Malgr sa teneur bien plus faible, le mthane absorbe 24 fois plus d'nergie masse gale et son influence grimpe prs de 12% de leffet total 1. On estime dautre part que d'normes rserves de mthane sont ltat immobilis par association avec leau sous forme dhydrate de mthane*. Les sdiments ocaniques profonds en contiendraient de grandes quantits constituant un rservoir potentiel de gaz.
O2 matires organiques CO2 oxydations microbiennes surface du sol et des sdiments, rhizosphres...

arobiose anarobiose
produits de fermentation actate, formiate, formaldhyde, mthanol... H2, CO2

mthanognse

CH4

Alternance mthane / dioxyde de carbone


Le deuxime niveau d'influence du mthane sur l'environnement tient son oxydation par des micro-organismes qui s'en servent comme source d'nergie. L'apport de mthane dans la biosphre est double. Une partie est d'origine tellurique (mthane gologique) et provient des grandes profondeurs de l'corce. Le reste rsulte de l'activit des bactries mthanognes par rduction du gaz carbonique et de diffrents produits de fermentation. Inversement le mthane est oxyd l'air par les mthanotrophes. Leur action est double par la destruction photochimique qui intervient dans la basse atmosphre par raction du mthane sur les radicaux hydroxyle (OH.), et on estime que cette voie d'limination du mthane atmosphrique est prdominante. La raction produit du monoxyde de carbone, de l'ozone et de l'eau. La dure moyenne de sjour d'une molcule de mthane dans la troposphre n'est pas connue avec certitude. Elle serait d'une dizaine d'annes. Du mthane atmosphrique est rabsorb par le sol et les eaux. 1 - Les diffrentes contributions des gaz effet de serre autres que la vapeur d'eau sont en gros 57% pour le gaz carbonique, 6% pour les oxydes nitreux. Le reste (25%) est d aux chlorofluorocarbones et autres composs d'origine industrielle.

3 OXYDATIONS MINRALES

135

La destruction du mthane revient surtout des micro-organismes. Il y a donc un cycle biologique du mthane qui contribue au brassage du carbone dans la nature au mme titre que les autres changes gazeux de la photosynthse, des fermentations et des oxydations de matires organiques. Le taux de mthane dans la biosphre rsulte de l'quilibre dynamique o s'affrontent la vitesse de sa formation et son taux d'utilisation. Nous savons que la synthse biologique du mthane est la proprit exclusive de micro-organismes strictement anarobies qui sont tous des archaebactries. Ces organismes tirent leur nergie de la synthse du mthane qui se fait par rduction du gaz carbonique, ou encore par dcomposition de l'acide actique et d'autres composs organiques. Les bactries utilisatrices du mthane sont arobies et rcuprent lnergie de son oxydation. Elles se trouvent la surface du sol, dans les eaux et aussi autour des racines des plantes au niveau de la rhizosphre. Une certaine arobiose y est maintenue parce que les racines mettent de l'oxygne que les micro-organismes rcuprent pour leurs oxydations. Cet oxygne est absolument indispensable aux champignons. Ainsi des racines ou des rhizomes baignant dans des sdiments ou des vases anoxiques peuvent nanmoins maintenir leur surface un microenvironnement suffisamment oxygn pour autoriser la croissance des champignons et autres espces arobies. La vgtation flottante des rivires et des tangs n'est pas en reste. On a constat une oxydation significative du mthane au niveau des jacinthes d'eau (Eichornia crassipes) et des lentilles d'eau (Lemna minor). Il y a donc d'un ct les mthanognes et de l'autre les mthanotrophes, deux populations qui ne s'interpntrent pas. On peut remarquer que le cycle du mthane avec son va-et-vient du carbone entre CO2 et CH4 est une affaire exclusive de procaryotes. Un des objectifs de ce chapitre est l'oxydation du mthane. Il nous fera dcouvrir une voie assimilatrice originale du carbone et signalera en mme temps son intrt dans la biodgradation de composs naturels ou artificiels.

3.2 - LE MTHANE, SOURCE DE CARBONE ET DNERGIE


Le mthane nest pas seulement un trs bon carburant pour usages domestiques, cest aussi une excellente source dnergie pour des bactries qui sen nourrissent et en tirent tout le carbone pour leurs synthses. Un petit miracle parce qu'il est trs stable et chimiquement peu ractif, inerte pour la plupart des tres vivants, sauf pour les mthanotrophes, qui sont des procaryotes et quelques levures spcialises renfermant une mthane mono-oxygnase. Les bactries sont les acteurs majoritaires de l'oxydation du mthane. Des micro-organismes marins dtects depuis peu prsentent cependant une situation particulire [5]. Le mthane est consomm par une association anarobie entre deux partenaires au sein de sdiments o l'oxygne diatomique n'intervient pas. Des bactries sont capables de catalyser la raction CH4 + H2O CO2 + H2, qui est l'inverse de la mthanognse. Leurs associes sont des sulfato-rducteurs, qui consomment rapidement l'hydrogne form en rduisant le sulfate jusqu'au niveau sulfure. Cette

136

BIODGRADATIONS ET MTABOLISMES

association de deux organismes rsulte d'une syntrophie*. En somme le recyclage du mthane dans la nature fait appel aux deux ractions globales : CH4 + 2 O2 CO2 + 2 H2O (arobie) (1) (association anarobie) (2) CH4 + SO42 HCO3 + HS + H2O

Le premier mcanisme est celui qui nous intresse ici. Le second est un vnement compltement distinct sur lequel nous reviendrons en examinant les sulfato-rducteurs. Les mthanotrophes se caractrisent donc par leur pouvoir de se dvelopper sur mthane comme seule source de carbone et d'nergie. Le principe de base est trs simple. Quatre oxydations successives convertissent le mthane en CO2. La premire engendre du mthanol. Tous les mthanotrophes sont donc en mme temps des mthylotrophes potentiels, mais la plupart des espces ont absolument besoin de mthane pour se dvelopper. Elles sont alors des mthanotrophes obligs [6]. Inversement les mthylotrophes sensu stricto n'utilisent pas le mthane, car ils manquent de l'enzyme essentielle qui est la mthane mono-oxygnase, mais peuvent se dvelopper sur le mthanol et dautres substrats. Le mthane est un substrat nergtique. Les quatre oxydations successives qui conduisent au gaz carbonique mettent en jeu chacune deux lectrons. Le mthane sert aussi de source de carbone sans laquelle aucune croissance ne serait possible. En principe plusieurs solutions sont offertes. La premire est une rduction assimilatrice du gaz carbonique par un cycle de type CALVIN-BENSON, comme le font les plantes. Les autres procdent de l'incorporation dans les molcules organiques d'un stade d'oxydation intermdiaire du mthane. La nature a accord sa prfrence au formaldhyde, qui est assimil selon une biochimie particulire. La raction 1 du schma correspond une mono-oxygnation consommatrice de pouvoir rducteur, qui produit du mthanol plus facile mtaboliser, tandis que les ractions suivantes sont gnratrices d'nergie. CH4 + O2 + NADH + H+ CH3OH + H2O + NAD+
oxydations nergtiques 1 CH4 CH3OH 2 H2C=O 3 HCOO 4 CO2

(3)

assimilation du carbone au niveau formaldhyde

Le mthane est source de carbone et d'nergie


Les bactries tirent lessentiel de leur nergie par les oxydations 2, 3 et 4. Les lectrons sont canaliss par une chane respiratoire complexe construite chez diverses espces par une batterie de cytochromes c qui renferment invariablement plusieurs hmes. Cette particularit se retrouve dans les bactries qui l'oxydent l'ammoniac. Plusieurs cytochromes c "multi-hmes" existent chez Methylococcus

3 OXYDATIONS MINRALES

137

capsulatus. L'un d'eux possde une haute masse molculaire pas moins de 16 hmes de type C [7] ! Cette complexit permettrait une adaptation perfectionne des conditions varies ainsi qu l'usage d'une gamme tendue de substrats. La mthane mono-oxygnase catalyse la raction 1. L'enzyme utilise l'oxygne molculaire et une source d'lectrons qui peut tre NADH. Elle existe sous deux formes, membranaire et soluble. L'enzyme lie la membrane existe chez toutes les espces et reoit les lectrons de la chane respiratoire, tandis que la forme soluble les rcupre sur NADH et n'existe que chez certaines espces. Cette dernire est cependant la plus facile purifier, et par consquent la mieux connue aprs cristallisation et analyse structurale trs dtaille. Son site actif contient du fer. L'oxygnase membranaire fonctionne aussi avec du cuivre. Elle n'apparat d'habitude que lorsque le milieu contient une quantit suffisante de cuivre l'tat de Cu(I) ou de Cu(II). Certains auteurs ont propos que le mtal tait prsent dans le site actif sous forme d'un noyau regroupant trois ions cuivre [8]. Il est peu prs prouv que le cuivre est indispensable la stabilit de l'enzyme. Son intervention directe dans la catalyse est moins vidente. ZAHN et DISPIRITO [9] ont montr que l'oxygnase contenait aussi du fer. Sur la foi de rsultats obtenus par RPE, ces auteurs avancent l'ide selon laquelle le cuivre serait surtout un lment stabilisateur, le site catalytique pouvant contenir un centre bi-mtallique mixte du type fer-cuivre comme celui qui existe dans la cytochrome c oxydase. La question reste donc ouverte. Le facteur le plus performant dans les biodgradations lies l'oxydation du mthane est la mono-oxygnase soluble (ou mthane hydroxylase). Sa biosynthse ne s'observe que dans les conditions o il y a peu de cuivre, soit au-dessous de 1 mol . mg1 de biomasse. Elle rsulte l'vidence d'une volution compltement indpendante de la prcdente. Il n'est plus question ici de la participation du cuivre, mais de celle du fer. Pourquoi cette enzyme est-elle extraordinaire ? Grce son manque de spcificit, elle peut transformer par l'oxygne de l'air bien d'autres substrats que le seul mthane. L'ventail de ses comptences est encore plus large que celui de l'enzyme membranaire. D'o son utilit dans l'environnement. Non seulement l'enzyme aide boucler le cycle du mthane, empchant celui-ci de s'accumuler dans l'atmosphre, mais est trs peu regardante sur son substrat oxyder. On lui connat largement plus de cent substrats possibles o se rencontrent des hydrocarbures saturs ou non, et divers drivs halogns dont le trichlorothylne. L'attaque de celui-ci est l'un des meilleurs fleurons de la monooxygnase soluble, qui est cet gard au moins mille fois plus ractive que la mono-oxygnase membranaire. Parmi les composs dgrads figurent des polluants divers rpandus par l'industrie, et l'on ralise immdiatement tout l'intrt de ce systme. La mthane mono-oxygnase soluble de Methylococcus capsulatus est un complexe de masse molculaire leve (225 kDa) comportant trois parties : une hydroxylase ou protine A, une protine dite de couplage B et une rductase flavinique C contenant du FAD et un centre fer-soufre de type [2Fe-2S]. La prsence de ce centre fer-soufre unique met la puce l'oreille. Elle montre que les lectrons sont canaliss un par un vers l'hydroxylase aprs avoir t prlevs par paires sur le

138

BIODGRADATIONS ET MTABOLISMES

donneur initial qui est NADH ou NADPH, puis transmis par la flavine. Cette disposition est assez caractristique de nombreux systmes du type rductase/oxygnase. L'hydroxylase a le rle essentiel, car elle contient les sites fixant le substrat et l'oxygne. Son fer est non hminique, ce qui la distingue d'autres mono-oxygnases que nous observerons par la suite. Les lectrons transmis par la rductase en provenance du NAD(P)H vont rduire l'atome d'oxygne qui se retrouvera dans la molcule d'eau. La protine B aurait une fonction rgulatrice. Sa prsence acclre normment le cycle catalytique et oriente son fonctionnement vers la mono-oxygnation au dtriment dune action comme oxydase [10]. On a l'impression que la protine B dforme l'hydroxylase et modifie ses performances. Cette ide n'a pas encore reu d'explication claire, mais tout suggre que la prsence de B n'est pas neutre, et qu'elle intervient d'une faon ou d'une autre dans la catalyse. La structure dtaille de la protine A (l'hydroxylase) est connue [11]. Elle est constitue de deux parties symtriques de formule quaternaire totale ()2. L'association des deux protomres se fait surtout par les chanes , et mnage une profonde crevasse centrale vers laquelle sont tourns les deux sites actifs. Le fer est reprsent au niveau de chaque sous-unit sous forme de deux ions Fe(III) relis par un pont hydroxo. Le noyau form par les deux ions mtalliques placs environ 3,1 l'un de l'autre et relis par un atome d'oxygne constitue un ple ractif exceptionnel permettant lactivation d'O2, lanion tant soit du carbonate soit de lactate. Les deux ions Fe ont chacun 6 coordinences avec des donneurs reprsents par Glu, anion O O Asp, His ou des molcules deau. Il y a touGlu Glu jours sur chaque mtal une liaison qui est H O dplaable par le substrat ou par un atome His doxygne appartenant O2. Glu
His H O Asp H Glu

Le noyau bi-mtallique

Les deux ions du fer sont lis par un hydroxyle. Le noyau bi-mtallique du dessin a t caractris en spectroscopie optique, RPE ou MSSBAUER. Il est trs similaire celui que nous retrouverons dans une srie d'enzymes : dioxygnases du benzne et du naphtalne, mono-oxygnases du tolune et du phnol, tolune 2- et 4-monooxygnases et phnol hydroxylase. Toutes ces protines sont apparentes par leur squence renfermant deux motifs consensus (D ou E)-x28-37DExRH qui correspondent chacun aux liens avec un ion fer. Ce type de structure n'est pas rare. Dautres protines ont un centre bi-mtallique du mme type, notamment lhmrythrine et la ribonuclotide rductase. Le fer a pour fonction d'activer l'oxygne diatomique de faon lui permettre de se scinder. Lun des atomes est inject dans le substrat. L'autre atome est emport par une molcule d'eau dans le cas dune mono-oxygnase, ou est plac une autre position du substrat si lenzyme est une dioxygnase comme celle du benzne. Le mcanisme prcis est incompltement lucid. L'oxydation d'une position carbone sature dans un hydrocarbure implique normalement le passage

3 OXYDATIONS MINRALES

139

par un radical intermdiaire. La formation transitoire d'un tel radical est facilite dans une chane carbone au niveau d'une ramification. Le mthane reprsente un cas extrme, puisqu'il y a 4 atomes d'hydrogne autour du carbone sans aucune substitution. Le mthane est donc une molcule stable, peu ractive, relativement trs solide. Son attaque exige les grands moyens, et cest pourquoi l'enzyme a donc une double fonction, qui consiste exacerber la ractivit d'O2 et forcer l'apparition du radical .CH3 partir du mthane. Cet aspect chimique particulier explique peut-tre pourquoi il a t slectionn dans la nature un catalyseur dot d'un ple ractif bi-mtallique o les deux ions Fe(II) ou Fe(III) sont runis par un pont comportant un hydroxyle. Cette question appelle une petite digression. Un site bi-mtallique du mme genre existe dans la ribonuclotide rductase* de la majorit des organismes arobies. Cette enzyme cre le dsoxyribose partir du ribose. Le remplacement d'un hydroxyle la position 2' du ribose par un atome d'hydrogne demande un mcanisme ractionnel particulier o la formation intermdiaire d'un radical carbon est absolument requise. L'enzyme comporte deux parties dsignes par R1 et R2. Le site catalytique est sur R1. Un noyau ferrique double comparable celui de la mthane mono-oxygnase est sur la partie R2. Celle-ci se contente de stabiliser un radical plac sur une chane latrale de tyrosine. Le radical est transmis distance la partie R1 qui l'utilise dans son site catalytique pour modifier le substrat. Le centre bi-mtallique de la ribonuclotide rductase est donc un dispositif charg de maintenir en place le radical ncessaire au cycle catalytique sur R1. On peut penser qu'un dispositif de mme nature a t appel au cours de l'volution pour l'oxydation du mthane, en vue de faciliter l'apparition d'un radical au cours de l'oxydation du substrat. l'vidence l'apport du double noyau ferrique n'a t qu'une solution parmi d'autres, puisque la seconde oxygnase du mthane, localise dans la membrane, a un ple diffrent contenant du cuivre. La mthane oxygnase soluble a des proprits extraordinaires. Son site catalytique n'est qu'une surface d'adhsion non slective, capable de fixer un peu n'importe quoi si des interactions hydrophobes sont possibles. Des molcules hydrocarbones dont la plus simple est videmment CH4, sont susceptibles de venir "scotcher" temporairement la plage hydrophobe de chaque protomre autour du centre bi-mtallique et au contact direct de l'oxygne activ. D'autres exemples sont les peroxydases et diverses protases. Dans la majeure partie des cas, la reconnaissance d'un substrat par une protine se fait sur des critres plus prcis o la taille et l'orientation de la molcule partenaire dans le site sont cruciales. Le facteur essentiel reste ici la possibilit pour la molcule trangre de venir adhrer au voisinage du fer, l o se forme un ple ractif constitu par l'oxygne activ. La mthane oxygnase soluble effectue une transformation efficace du mthane 1 1 (Km = 3 M, Vm = 56 nmol . mg de protine . min ) [12]. Chose curieuse, ce n'est pas le meilleur substrat possible. L'enzyme est mme bien plus active sur le chloroforme ou le dichloro-mthane [13]. Le naphtalne est transform en naphtols, dont la prsence est facilement mesurable par diazotation en composs de couleur violette par l'ortho-dianisidine. Cette proprit tombe pic pour dtecter les monooxygnases solubles dans les mthanotrophes en culture ou sur bote avec un taux minimal de cuivre. L'enzyme membranaire ne fait pas de naphtols et ne donne pas cette coloration.

140

BIODGRADATIONS ET MTABOLISMES

Lattaque des composs halogns est particulirement intressante, puisqu'il s'agit souvent de produits nuisibles pour l'environnement. Le chloroforme et le dichloro-mthane sont dgrads compltement par les bactries en CO2 et H2O, l'halogne tant limin sous forme de chlorure. Cette minralisation par les mthanotrophes survient par comtabolisme sous l'effet initial de la mono-oxygnase soluble. Il y a gnralement corrlation entre le taux d'attaque de diffrents composs halogns et le taux de mono-oxygnase soluble dans les bactries. Une augmentation du cuivre ambiant nuit cette proprit, car l'oxygnase soluble est rprime et l'enzyme membranaire qui tend la remplacer ne peut pas prendre aussi bien le relais de ces biodgradations. Le TCE est reconnu et trait efficacement, avec un Km trs bas (0,35 M) et un taux de conversion presque aussi lev que celui du mthane. Or le TCE est particulirement redoutable, car il peut engendrer des produits toxiques et cancrignes. En outre c'est un rejet industriel frquent dont le grand dfaut est dtre rmanent. Le TCE et le ttrachlorothylne ont t dnoncs comme des contaminants majeurs dans les eaux de certains pays, notamment aux tats-Unis, et sa dure de vie moyenne dans les aquifres atteindrait 300 jours ! L'attaque du TCE par la mthane mono-oxygnase soluble de Methylosinus trichosporium conduit la formation d'un poxyde. Elle est relativement rapide, raison de 680 nmol . mg de protine1. min1, avec un Km gal 35 M. L'poxyde est transform en chloral, acide glyoxylique et chlorure, puis en CO2 et H2O. Le nettoyage du TCE par la mono-oxygnase soluble a ses revers. Celle-ci n'est pleinement exprime dans un biotope contamin qu'en fonction du dveloppement des mthanotrophes, qui est soumis la prsence d'autres substrats (comtabolisme), aux effets toxiques du TCE faible dose et la comptition entre espces dans les sols. Par exemple la prsence d'ammoniac a un effet contraire. En outre le trichlorothylne n'est pas un substrat de tout repos pour la mono-oxygnase, car son oxydation cre des liaisons covalentes avec les sous-units de l'enzyme, dont linactivation devient irrversible. On admet que chaque molcule de protine est inactive aprs avoir oxyd de l'ordre de 200 molcules de TCE. Aussi doit-on s'attendre ce que la disparition du TCE dans l'environnement soit assez lente. Sa vie moyenne dans les nappes phratiques est alors assez longue pour exercer des effets nfastes sur la faune et la flore. Un tableau permet de comparer l'activit de l'enzyme sur le mthane et sur plusieurs substrats chlors dont le TCE et le chloroforme. La mono-oxygnase est d'autant plus efficace que Vm et 1/Km sont plus grands. La faiblesse de l'attaque sur le trichlorothane s'explique probablement par l'encombrement strique local d l'entassement des atomes de chlore. Mme explication pour le ttrachlorothylne, qui ne figure pas dans le tableau. Ce driv totalement halogn rsiste l'action de l'enzyme et se comporte comme un inhibiteur comptitif. La varit des substrats traits par la mthane mono-oxygnase soluble a de quoi sduire. L'enzyme oxyde aussi en alcool benzylique le tolune, qui n'est jamais qu'un driv phnyl du mthane. C'est donc bien le groupe mthyle qui est oxygn. Dans le cas du styrne (vinylbenzne), la double liaison du groupe vinyle est sujette poxydation. Le noyau benznique lui-mme peut tre attaqu, comme dans le cas du nitrobenzne.

3 OXYDATIONS MINRALES
1. trichlorothylne 2. cis-1,2-dichlorothylne 3. trans-1,2-dichlorothylne 4. 1,1dichlorothylne 5. 1,1,1trichlorothane 6. 1,2dichlorothane 7. chloroforme 8. dichloromthane 9. mthane 0 H Cl Cl Cl H Cl H Cl H Cl Cl H Cl Cl 5 H H 10 H Cl H CC Cl H Cl 5 Cl H H CC H H Cl 6 15 (Vm/Km)

141

C=C 1

C=C 2

C=C 3

C=C 4

Cl H C Cl Cl 7

Cl H C H Cl 8

Substrats de la mthane mono-oxygnase


Ce substrat est hydroxyl en un mlange de 3- et 4-nitrophnols. Le tableau rvle la remarquable efficacit de l'enzyme sur le chloroforme, une proprit assez caractristique de l'enzyme soluble par rapport la mono-oxygnase membranaire qui n'attaque le chloroforme que faiblement. L'oxygnase soluble n'est cependant pas une panace utilisable l'limination de n'importe quel substrat chlor. On le voit bien par la faiblesse de son action sur le mthylchloroforme (1,1,1-trichlorothane). Ce solvant largement utilis pour le dgraissage et le nettoyage sec a t mis l'index par le protocole de Montral (1987) par suite de sa rmanence dans la troposphre. Sa vie moyenne y est de plusieurs annes. Il disparat lentement par raction sur les radicaux hydroxyle, mais gagne la stratosphre o il libre du chlore par photolyse. On le considre comme indirectement nocif pour la couche d'ozone. Le cycle catalytique de la mthane mono-oxygnase commence par une rduction deux lectrons qui prcde la venue du substrat dans la poche du site actif. Le noyau bi-mtallique passe l'tat Fe(II). Fe(II) qui reoit une molcule d'O2. Il en rsulte l'apparition d'une entit ractive de type oxne, valence leve : Fe(IV).Fe(IV) = O. Le substrat intervient tardivement dans le cycle reprsent page suivante. Sa transformation comporte l'ablation d'un atome d'hydrogne et l'apparition d'un radical. Le centre bi-mtallique prend alors une valence mixte Fe(III).Fe(IV)OH. Le retour l'tat initial se ferait par la raction du radical avec l'oxygne du noyau bi-mtallique. Ces diffrentes tapes ont t tudies en dtail par RPE et cintique rapide dans le groupe de LIPSCOMB [14], et le cycle indiqu est une interprtation des rsultats du fonctionnement de l'hydroxylation par la protine A. Ltape essentielle est donc la formation dun radical responsable de l'attaque sur divers substrats. Dans le cas du noyau aromatique, l'oxygnation pourrait se faire directement par injection d'un atome d'oxygne sans formation d'un radical intermdiaire [15].

142
H O

BIODGRADATIONS ET MTABOLISMES

produit hydroxyl ROH

2e

rduction
H O H2O2 Fe(IV) Fe(III) Fe(II) R. H O H O ROH H+ H O O2

HO H O H+

HOO

substrat

RH

H 2O O

Le cycle catalytique de la mthane hydroxylase


L'enzyme a le pouvoir d'agir de plusieurs faons. Elle peut court-circuiter l'tape de rduction de l'oxygne et du fer en oxydant le noyau bi-mtallique directement par l'eau oxygne. Cette proprit se retrouve dans les peroxydases et peut seffectuer en absence d'oxygne diatomique. On voit que la mthane mono-oxygnase mrite bien le qualificatif d'"enzyme miracle". L'emploi des souches formant une mthane oxygnase soluble n'est pas trs facile. Son gne dans Methylosinus trichosporium est rprim par des doses faibles d'ions Cu. En outre l'attaque du trichlorothylne est fortement retarde par la prsence du mthane, qui est ncessaire pour la croissance des germes. Pour y remdier, un fragment de squence d'ADN d'une longueur de 5,5 kb contenant les gnes de la mono-oxygnase a t clon dans un plasmide et exprim chez plusieurs Pseudomonas. On a obtenu ainsi des souches croissance relativement rapide, capables de dgrader le trichlorothylne et le chloroforme, sans avoir les inconvnients prsents par la prsence du cuivre et la comptition entre le substrat et le mthane [16]. En somme les mthanotrophes capables de produire la mono-oxygnase soluble offrent de grandes possibilits. La mono-oxygnase membranaire confre des proprits comparables mais distinctes. Les cellules de la premire catgorie peuvent se dvelopper sur alcanes et alcnes chane droite ou ramifie comportant 4 8 atomes de carbone, ainsi que sur divers composs cycliques et aromatiques qui n'interviennent pas comme substrats de croissance. Les bactries ne se dveloppent que sur des hydrocarbures chane courte. Certains substrats, comme les drivs halogns, sont traits par comtabolisme, mais leur transformation n'apporte aucune nergie la cellule. L'enzyme membranaire des mthanotrophes contient donc du cuivre. En prsence des ions Cu, les cellules dveloppent des empilements de membranes internes riches en mthane mono-oxygnase insoluble. Le dveloppement de ces

3 OXYDATIONS MINRALES

143

membranes permet une augmentation de la surface o peut s'insrer l'enzyme essentielle. Cette proprit commune dans les mthanotrophes s'observe aussi chez les bactries capables d'oxyder l'ammoniac et de participer la nitrification des sols. Or l'enzyme membranaire des mthanotrophes a une certaine ressemblance avec la mono-oxygnase qui oxyde l'ammoniac chez des espces comme Nitrosomonas europeae. L'ammoniac mono-oxygnase possde aussi du cuivre. Les deux systmes prsentent une nette homologie au niveau gntique et auraient une origine commune [17]. On manque de donnes structurales prcises parce que ces protines membranaires sont difficiles purifier. Toutefois la monooxygnase de l'ammoniac a t obtenue sous forme homogne chez N. europeae et l'on connat la squence de ses gnes [18]. On suppose que les deux enzymes ont conserv le mme modle d'organisation molculaire avant d'voluer dans deux directions, d'une part vers l'oxydation de NH3, d'autre part vers l'oxydation du CH4. Do la tentation d'extrapoler les proprits de l'une de ces enzymes l'autre. Cependant la physiologie de ces germes de part et d'autre n'est pas identique, et les niches cologiques qu'ils occupent ne se recouvrent que trs partiellement. voquons les rapidement. Nitrosomonas europeae fait partie des bactries nitrifiantes et transforme l'ammoniac en hydroxylamine (NH2OH), laquelle sera oxyde son tour en nitrite par une dshydrognase priplasmique. Le mthane est galement oxyd un taux plus faible. Ces oxydations sont productrices d'nergie et sont couples avec milation de CO2 par un cycle de CALVIN, car ces bactries sont chimio-autotrophes et utilisent l'nergie des oxydations pour assimiler le gaz carbonique, contrairement aux plantes et autres organismes utilisateurs de lumire et dsigns comme photoautotrophes. Une section ultrieure plus dtaille (page 159) sera consacre l'oxydation de l'ammoniac. Les mthanotrophes ont une physiologie trs diffrente, mais oxydent un peu d'ammoniac paralllement au mthane, et renferment d'ailleurs comme les bactries nitrifiantes une oxydorductase capable de transformer l'hydroxylamine en nitrite. Malgr la production de CO2 partir du mthane, beaucoup de mthanotrophes n'ont pas recours au cycle de CALVIN, mais assimilent une grande partie de leur carbone ou mme sa totalit sous forme de formaldhyde (HCHO). Les mono-oxygnases de ces deux sries de germes se ressemblent sur le plan fonctionnel. La source d'lectrons directe n'est pas NADH. Ce rle appartient un cytochrome de type b ou c, ou encore une quinone respiratoire rduite [19]. Les deux enzymes se ressemblent par une proprit intressante. L'actylne les inhibe en crant une liaison covalente avec l'un des polypeptides de la molcule. Cette raction facilite le reprage de ces oxygnases, soit en utilisant de l'actylne marqu au carbone-14, soit l'aide d'un marqueur fluorescent contenant un groupe alknyle. On sait que l'efficacit d'une enzyme dans les conditions optimales de son action dpend de deux paramtres : kcat et Km. Le premier exprime le nombre maximum de molcules de substrat que chaque molcule d'enzyme transforme par seconde. Le second est la concentration de substrat qui permet l'enzyme de fonctionner une vitesse moiti de la vitesse maximale thorique. La constante kcat de la majorit

144

BIODGRADATIONS ET MTABOLISMES

des enzymes est de plusieurs centaines, voire plusieurs milliers par seconde. Pour l'ammoniac mono-oxygnase, kcat ne serait que de 20. s1 sur NH3, une valeur faible. Chose curieuse, l'enzyme a la potentialit d'oxyder le mthane pratiquement la mme vitesse. Il faudrait pour cela que le mthane atteigne un niveau trs lev qui n'est jamais atteint dans la pratique (la valeur du Km de la protine pour le mthane est bien plus grande que pour NH3). L'ammoniac reste donc le substrat prfr de cette mono-oxygnase. La mthane mono-oxygnase prsente une situation analogue, mais inverse. L'enzyme est galement lente et oxyde aussi l'ammoniac, mais le mthane est cette fois le meilleur substrat. Les oxygnases membranaires Cu ont l'intrt d'tre peu spcifiques et de pouvoir transformer une foule de substrats organiques en mme temps que leur substrat normal, ce qui leur confre une participation intressante dans la dfense de l'environnement. Il n'est pas rare dans la nature qu'une faible slectivit des catalyseurs enzymatiques aille de pair avec une lenteur d'action (kcat faible), mais cette relation n'a pas de caractre absolument gnral. Les deux mono-oxygnases cites ont la capacit de transformer divers substrats aliphatiques, notamment des composs halogns du type chloroforme ou trichlorothane [20]. Cette activit est nanmoins assez restreinte. La mthane mono-oxygnase membranaire des mthanotrophes n'est exprime que si la teneur en cuivre atteint un taux suffisant, de l'ordre de 1 mole . mg1 de biomasse. En outre l'oxydation du mthane est sensible l'inhibition exerce par l'ammoniac engendr par la dcomposition des matires organiques ou lapport dengrais. L'influence du cuivre complique les choses, parce que cet lment n'est gnralement prsent l'tat libre dans les sols qu' trs faible concentration. Il est volontiers adsorb par l'humus, les argiles et les composs organiques. En somme les mthanotrophes et les bactries nitrifiantes se partagent le march des oxydations tous azimuts dans l'environnement. Ils oxydent la fois le mthane, l'ammoniac et divers composs organiques selon des modalits diverses trs sensibles aux conditions du milieu et difficiles contrler exprimentalement. On aura une meilleure ide de ces potentialits dans la section suivante. Il existe heureusement des moyens pour valuer la part relle revenant aux mthanotrophes. Par exemple l'oxydation du mthane dans les sols est inhibe par 0,5 mM d'acide picolinique (pyridine-2-carboxylique), alors que la transformation de NH3 en nitrate rsiste des taux trs suprieurs [21]. La prsence des mthanotrophes dans les terrains est galement rvle par amplification par PCR de l'ADN bactrien et l'identification de squences gnomiques relatives des enzymes caractristiques que nous rencontrerons plus loin. Quant aux proprits des bactries nitrifiantes, des donnes supplmentaires seront accessibles plus loin.

3.3 - CROISSANCE SUR MTHANE ET MTHANOL


On connat actuellement plus d'une centaine d'espces bactriennes capables de se dvelopper sur mthane. Toutes ces bactries ont en commun d'avoir une mthane mono-oxygnase transformant le mthane en mthanol, lequel est pris en

3 OXYDATIONS MINRALES

145

charge par une mthanol dshydrognase spciale, une quinoprotine dont le cofacteur est le PQQ*. HANSON et d'autres auteurs ont galement signal l'existence de levures capables de se comporter facultativement comme des mthanotrophes [22], mais cette observation n'a pas t confirme. Par contre les levures mthylotrophes (se dveloppant sur mthanol) ne sont pas rares. La plus tudie est Hansenula polymorpha. Ces germes sont galement capables dutiliser des alcanes. Les bactries utilisatrices de mthane ne forment pas un groupe taxonomique homogne et ont volu en lignes indpendantes. Elles se rpartissent en deux grands groupes, I et II, qui se distinguent par des critres morphologiques et surtout par leur physiologie. Les premires, du type I, (Methylococcus, Methylobacter, Methylomonas) assimilent le carbone partir du formaldhyde, en utilisant un cycle mtabolique spcial appel cycle de l'hexulose monophosphate (XuMP). Les secondes, du type II, (Methylosinus, Methylocystis) assimilent le formaldhyde par une voie compltement diffrente appele cycle de la srine. Ces deux modes seront expliqus plus loin. Sur la base de la comparaison des ARN 16S, le type I fait partie des protobactries gamma*, et le type II aux alpha. On a reconnu depuis un type X, proche du type I, mais contenant la Rubisco du cycle de CALVIN et dot de caractres particuliers. Les mthanotrophes dans leur quasi-totalit ne peuvent se dvelopper qu'en prsence de mthane (mthanotrophes obligs 2). Ils utilisent volontiers une foule de composs monocarbons mthyls, sulfurs ou non (sulfure de mthyle, dimthylsulfure, choline, carbofuran) Voici un tableau trs simplifi pour montrer les diffrences entre les groupes I, X et II. Type I
Groupe de protobactries Cycle du XuMP Cycle de la srine Fixation de N2 Rubisco Morphologie dominante Vsicules membranaires internes Membranes internes concentriques Croissance 45C Gamma OUI non non non btonnets OUI non non

Type X
Gamma OUI quelquefois OUI OUI cocci OUI non OUI

Type II
Alpha non OUI OUI non btonnets non OUI non

Le diagnostic d'appartenance d'un isolat ces diffrents groupes peut se faire par hybridation molculaire avec des sondes nucliques, dtection d'enzymes caractristiques du mtabolisme ou composition en acides gras des phospholipides. Les mthanotrophes sont prsents partout o il y a une source de mthane et d'oxygne. Les espces dotes d'une nitrognase rduisent N2 lorsque le milieu est dpourvu d'azote ammoniacal ou organique, et ne peuvent le faire qu'en prsence 2 - Il y a une incertitude sur ce sujet. Beaucoup de mthanotrophes peuvent oxyder une grande varit de composs organiques (d'o leur intrt dans la dpollution), mais les transformations ont gnralement lieu par comtabolisme, la source carbone principale tant le mthane.

146

BIODGRADATIONS ET MTABOLISMES

d'un taux faible d'oxygne dissous. Les donnes actuelles montrent que ces bactries ont des potentialits extraordinairement varies, mais leur multiplication en culture pure est lente et rend plus difficile l'tude de leur physiologie. La raction limitante de leur mtabolisme est catalyse par les mono-oxygnases du mthane, mais leur coefficient Km pour CH4 est toujours infrieur 10 M traduisant une assez forte affinit pour le substrat. Les mthanotrophes n'ont donc pas besoin de fortes concentrations de mthane pour se dvelopper. Un grand nombre d'tudes ont tent de mesurer le taux de mthane dans divers milieux et la vitesse de sa disparition. La situation la surface du sol est trs diffrente selon que le mthane disponible diffuse partir les couches sous-jacentes o vivent les mthanognes, ou si le gaz est dissous directement partir de l'air ambiant. Dans le premier cas, la concentration en CH4 peut tre de l'ordre de 1 100 M, des taux largement suffisants pour un bon dveloppement des mthanotrophes. Dans le second cas, la teneur est beaucoup plus faible, de l'ordre de 2,5 nM seulement. On s'accorde penser que les mthanotrophes ont malgr tout une activit non ngligeable dans l'oxydation du mthane atmosphrique [23]. Les bactries les mieux adaptes aux faibles taux de mthane appartiennent le plus souvent au type I. Quelques applications pratiques utilisent les mthanotrophes pour le traitement des sols, car un apport relativement restreint de gaz naturel suffit favoriser le dveloppement des mthanotrophes et leur emploi dans les dcontaminations. La plupart des mthanotrophes sont msophiles et se dveloppent des tempratures infrieures 40C, avec un optimum vers 25C. Cependant Methylococcus capsulatus peut se dvelopper prs de 50C. On a isol dans les terres arctiques des souches qui croissent bien au-dessous de 15C. L'optimum de pH est souvent situ du ct lgrement acide (6,0), mais l'oxydation du mthane peut continuer en milieu encore plus acide, notamment dans les tourbires (o le pH peut s'abaisser au-dessous de 4). Elle est partage par des cellules de levure. La forte concentration en sel des marais salants et des lagunes ctires empche pratiquement toute oxydation microbienne du mthane. La plupart des analyses de terrain montrent que les mthanotrophes ont gnralement l'habitude de se dvelopper en association avec d'autres germes qui leur apportent des facteurs de croissance et les aident se dbarrasser de produits secondaires issus des substrats autres que le mthane. Des espces souvent associes aux mthanotrophes sont les Hyphomicrobia utilisatrices de mthanol, des bactries prosthque comme les Caulobacter. Les Hyphomicrobia ont une trs forte capacit fixer les matires carbones volatiles transportes par l'air et prdominent dans les milieux trs pauvres. Ce sont des mthylotrophes facultatifs trs spartiates pouvant se dvelopper sur le formaldhyde, l'thanol et l'acide actique. Leur dveloppement se fait par un cycle de bourgeonnement particulier qui rappelle celui des Caulobacter. La convivialit naturelle des mthanotrophes et la varit de leurs associations expliquent pourquoi il est difficile d'extrapoler les rsultats des cultures pures aux conditions relles de l'environnement. Un problme classique, qui n'est d'ailleurs pas particulier aux mthanotrophes.

3 OXYDATIONS MINRALES

147

Comment le mthane et le mthanol sont-ils mtaboliss ? Les germes qui partent du mthane sont les mthanotrophes et sont exclusivement des bactries, tandis que ceux qui partent du mthanol, ou mthylotrophes, se recrutent la fois chez les bactries et les champignons, notamment les levures. Le stade cl est l'oxydation du mthanol en formaldhyde par une alcool dshydrognase* ou ADH. Ces enzymes acceptent divers alcools. Le mthanol n'est substrat que pour certaines d'entre elles. Contrairement aux levures qui utilisent une mthanol oxydase FAD, les bactries Gram-ngatives ont une mthanol dshydrognase (EC 1.1.99.8) qui a la particularit d'utiliser un cofacteur particulier appel PQQ. Cette enzyme de formule 22 est priplasmique et contient du calcium dont le rle est structural. Elle transmet ses lectrons la cytochrome oxydase membranaire par l'intermdiaire de cytochromes c dont le premier terme (cL) appartient une catgorie spciale. Un dessin reprsente la situation dans Methylobacterium extorquens e t Paracoccus denitrificans [24]. La croissance de celui-ci sur mthanol se fait gnralement en milieu arobie, mais reste possible en absence de O2 avec le nitrate comme accepteur.
2 H+ + 1/2 O2 cytoplasme membrane cytoplasmique PQQ PQQ 2+ Ca2+ PQQ Ca2+ HCHO 2 e 2 H+ cyt. cL CH3OH cyt. c 2 e oxydase H2O

priplasme

2 e

mthanol dshydrognase membrane externe

Oxydation du mthanol
Cette oxydation est moins bien connue chez les Gram-positives et offre des solutions varies avec la participation de PQQ et de NAD+. Bacillus methanolicus est une espce thermo-tolrante capable de se dvelopper sur mthanol plus de 50C [25] et contient NAD+ comme cofacteur fortement li. Une autre espce particulirement tudie est Amycolaptopsis methanolica [26]. Il convient de signaler que le mthanol ne provient pas uniquement de l'oxydation du mthane. Il est produit en abondance par la dgradation de composants naturels du rgne vgtal : esters et thers mthyliques manant des pectines et lignines. Cela explique pourquoi les mthylotrophes sont si nombreux et varis dans le sol. Le formaldhyde occupe une position cl du mtabolisme. Il existe deux grandes stratgies mtaboliques pour l'assimiler chez les bactries. Dans le cycle de l'hexulose-monophosphate, le formaldhyde est soud par aldolisation un accepteur en C5. Le cycle de la srine implique une double incorporation de formaldhyde et de CO2, le premier sur la glycine, le second par carboxylation du PEP.

148

BIODGRADATIONS ET MTABOLISMES

Les levures mthylotrophes ont une stratgie distincte, mais utilisent un cycle similaire (xylulose-monophosphate). Dans le cycle du ribulose-monophosphate des mthanotrophes de type I (Methylosinus, Methylocystis), l'accepteur de formaldhyde est le ribulose-5-phosphate [27]. L'hexulose-6-phosphate synthase (HPS) et l'hexulose-phosphate isomrase (HPI) sont les enzymes caractristiques. Le bilan global de l'entre du formaldhyde peut s'crire : 3 HCHO + ATP Glycraldhyde-3P + ADP
CH2OH HCOH C=0 HCOH HCOH CH2O P 3 hexulose-6-phosphate

CH2OH C=0 HCOH HCOH CH2O P

H C=O H 3 HPS

HPI

CH2OH C=O HOCH HCOH HCOH CH2O P 3 fructose-6-phosphate

3 ribulose-5-phosphate rarrangements CHO HCOH CH2O P

biomasse

6 glycraldhyde-3-phosphate (G3P)

Le cycle du ribulose monophosphate


Le cycle n'a pas t reprsent en entier pour ne garder que l'essentiel. Ce mtabolisme assimilateur est considr comme performant car il consomme peu d'nergie ATP. La succession des transformations du fructose-6-phosphate en ribulose-5-phosphate n'est pas dtaille. Elle met en jeu plusieurs tapes qu'on retrouve dans le cycle de CALVIN 3, mais avec une dpense d'nergie totale bien plus faible. C'est un point important. Divers mthylotrophes sont en mme temps des autotrophes : ils utilisent le dioxyde de carbone form partir du formaldhyde pour l'assimiler par le cycle de CALVIN et profitent justement des enzymes qui fonctionnent en mme temps dans les deux voies. Les mthanotrophes de type II (Methylomonas, Methylobacter) incorporent le formaldhyde dans la srine selon un principe qui n'a rien voir avec le prcdent. La raction de dpart est catalyse par la srine-hydroxymthyl transfrase (STHM) utilisant la glycine et le formaldhyde sous forme d'une combinaison avec le ttrahydrofolate*. Le schma du cycle, assez compliqu, est celui qui reoit le meilleur assentiment malgr diverses incertitudes [28]. L'ensemble de cette voie consiste incorporer deux molcules de formaldhyde sous forme d'actyle (dans l'actyl-CoA). 3 - C'est en quelque sorte une variante de celui-ci. Le fragment monocarbon assimil n'est pas CO2 mais HCHO, et le compos accepteur n'est pas le 1,5-ribulose-diphosphate, mais le monophosphate.

3 OXYDATIONS MINRALES
COO C=O CH2OH 2 srine

149

2 HCHO 2 glycine succinate COO HC=O

STHM

SGAT

2 3-hydroxypyruvate 2 NAD(P)H HPR 2 NAD(P)+ 2 glycrate 2 ATP

ICL

2 glyoxylate

GK MCL

2 ADP

actyl-CoA

2 3-phosphoglycrate

malyl-CoA CoA malate NAD+ Pi NADH oxaloactate

2 2-phosphoglycrate 2 H2O

PEPC
CO2

2 phosphonolpyruvate ATP pyruvate NAD+

actyl-CoA NADH

CoA

Le cycle de la srine
Les tapes enzymatiques importantes ont t indiques en abrg. la suite de la STHM interviennent la srine:glycine aminotransfrase (SGAT), l'hydroxypyruvate rductase (HPR) et la glycrate kinase (GK). Le mtabolisme du 3-phosphoglycrate suit un cheminement classique jusqu' l'actyl-CoA. Une molcule sur deux de phosphonolpyruvate (PEP) est carboxyle par la PEP carboxylase (PEPC) [29], une enzyme qu'on trouve aussi dans les plantes dites C4. On constatera que cette opration ne correspond pas ici une assimilation de CO2, car celui-ci est produit par la dcarboxylation du pyruvate. La fermeture du cycle consiste rgnrer le glyoxylate. Une partie est engendre par la malyl-CoA lyase (MCL), et l'autre par les transformations de l'actyl-CoA par le chemin classique du citrate (par la citrate synthase) et de l'isocitrate. L'enzyme cl est alors l'isocitrate lyase (ICL) dans ce qu'on appelle couramment le shunt glyoxylique, l'isocitrate tant scind en glyoxylate et succinate. Le bilan des oxydorductions de cette srie ractionnelle est globalement nul. Ce n'est pas tonnant du fait que le niveau d'oxydation du formaldhyde est proche de celui du carbone dans la cellule. La facture nergtique en ATP est modique. Une part revient l'activation du formaldhyde en mthylne-FH4 (substrat de la premire tape catalyse par la STHM), une autre la phosphorylation du glycrate. Une molcule d'ATP est restitue par le passage du PEP au pyruvate. On peut donc considrer que ce cycle d'assimilation du formaldhyde est relativement trs

150

BIODGRADATIONS ET MTABOLISMES

performant. Les bactries de type II ne pratiquent pas le cycle de CALVIN d'assimilation de CO2 et n'ont pas de Rubisco. Mais elles ont la possibilit d'assimiler l'azote de l'air par une nitrognase, dont les bactries de type I sont dpourvues. Les bactries de type I et II se rpartissent donc en deux groupes distincts qui diffrent la fois par leurs proprits mtaboliques, leurs potentialits physiologiques et leur origine volutive. Les mthanotrophes de type I se dveloppent plus facilement en prsence d'un faible taux de CH4, tandis que le type II prfre davantage de mthane plus fort et des taux plus faibles d'O2, d'azote organique et de cuivre. Ces diffrences contribuent rgler la rpartition des mthanotrophes dans l'environnement. Ainsi la rhizosphre des plantes aquatiques contient surtout des mthanotrophes de type II, l o il y a beaucoup de mthane et un peu d'oxygne apport par la plante. C'est le cas des lentilles d'eau (Lemna minor) flottant la surface des mares et des tangs, et des jacinthes d'eau (Eichornia crassipes) qu'on voit envahir les plans d'eau et les rivires dans les pays chauds. Ces vgtaux sont souvent gnants par leur prolifration, mais participent indirectement au recyclage du mthane et la dpollution. On a not que les mthanotrophes de type II avaient de fortes potentialits pour dpolluer l'environnement, notamment en oxydant le trichlorothylne (TCE). L'abondance des levures mthylotrophes dans les sols a dj t signale. Elles sont avides de profiter de la dgradation des substances pectiques. Leur mtabolisme du mthanol diffre de celui des bactries. Une premire diffrence est de mettre contribution les peroxysomes de la cellule. La seconde est de transformer le formaldhyde par un cycle du xylulose-5-phosphate (Xu5P). La raction cl indique par le schma est catalyse par une dihydroxyactone synthase (EC 2.2.1.3), qui est une ctolase particulire.
CH2OH C=0 H C OH H C OH CH2O P ribulose-5P (Ru5P) CH2OH C=0 HO C H C OH CH2O P xylulose-5P (Xu5P) H C=O H CH2OH C=0 CH2OH +

C=O H C OH CH2O P

glycrone glycraldhyde-3P (G3P)

Dihydroxyactone synthase
La glycrone ou dihydroxyactone est phosphoryle en dihydroxyactone phosphate. Celui-ci avec le glycraldhyde-3P sont mtaboliss par les voies classiques. Des rarrangements en srie rgnrent cycliquement le xylulose-5P, avec des tapes communes la voie des pentose-phosphates ou au cycle de CALVIN. L'oxydation des molcules monocarbones (mthane, mthanol, formaldhyde) met donc en jeu une biochimie particulire dont les rpercussions sur l'environnement sont considrables. Pour terminer cette section en faisant un peu diversion, on citera une question qui peut n'avoir qu'une importance assez marginale dans la dfense de la biosphre, mais l'histoire mrite tout de mme d'tre conte, car elle met en scne des associations intressantes en milieu marin grande profondeur.

3 OXYDATIONS MINRALES

151

Des programmes de recherche ont t financs aux tats-Unis par la NASA pour tudier l'adaptation des tres vivants au mthane tellurique dgag au fond des mers. Le mthane produit par voie biologique prsente un dficit isotopique en carbone-13, et l'on peut donc dterminer grce cette "signature" si le mthane est effectivement produit par des tres vivants. Dans les grands fonds ocaniques, l'absence de lumire rend impossible toute photosynthse et la vie ne peut se dvelopper qu'en tirant de l'nergie de ractions chimiques. Le long d'accidents tectoniques et de fissures, la circulation de l'eau de mer entrane des constituants du manteau basaltique. Les manations hydrothermales apportent des gaz riches en hydrogne sulfur. Ce dernier est oxyd par des bactries et leur sert de source d'nergie. Plusieurs espces de mollusques et de vers spcialiss s'tablissent autour des sources hydrothermales des grands fonds. Leurs tissus renferment des bactries symbiotiques, qui sont couramment des organismes utilisateurs de sulfure (dits thio-autotrophes), c'est--dire des germes capables d'assimiler le dioxyde de carbone grce l'nergie fournie par l'oxydation des sulfures. Les vers marins du genre Riftia isols prs des souffleurs volcaniques sous-marins prsentent une telle association. Au cours de leur dveloppement, ils perdent leur tube digestif et sont rapidement coloniss par des bactries autotrophes tirant leur nergie de l'oxydation des sulfures. L'animal livre aux bactries qu'il hberge l'oxygne et le gaz carbonique dont elles ont besoin, en utilisant pour cela plusieurs hmoglobines. Le ver tire sa propre nergie l'aide de ses mitochondries tout en profitant des matires organiques produites par les bactries. Celles-ci les ont produites partie du CO2 assimil. Tout se passe donc comme si l'animal tirait son carbone du CO2, et la dviation du rapport isotopique du carbone en apporte la preuve. Il y a d'autres faits tonnants de ce genre. On connat aussi des "souffleurs froids" ramenant de grandes quantits de mthane et permettant le dveloppement de la vie. Au fond du golfe du Mexique au large de la Louisiane ont t dcouvertes des moules particulires (Calyptogena) qui renferment une grande quantit de mthanotrophes symbiotiques au niveau de leurs branchies. On a pu montrer que l'animal hberge des bactries dans ses tissus et s'en nourrit. Les molcules organiques qu'il synthtise sont appauvries en carbone-13, ce qui montre qu'elles tirent leur origine d'un mthane de source biologique. Les mthanotrophes symbiotiques fabriquent une srie de composs insaturs de structure apparente celle des strols et du cholestrol. Or les bactries ne font pas de cholestrol, qui est l'apanage des eucaryotes. Tous ces composs, y compris le cholestrol fait par l'animal, ont t trouvs dficients en carbone-13. On a pu en dduire que le mollusque faisait son cholestrol en profitant de certains prcurseurs intermdiaires (hopanodes, mthyl-strols) synthtiss par les bactries mthanotrophes symbiotiques partir du mthane rcupr dans le milieu. D'autres prlvements faits grande profondeur ont permis de rcolter des moules hbergeant la fois des mthanotrophes et des thio-autotrophes. Elles ont t rcoltes 3476 m de profondeur sur la dorsale mdio-atlantique par le sous-marin exprimental ALVIN. On y dtecte la fois la mthanol dshydrognase caractristique des mthanotrophes et la Rubisco, l'enzyme cl du cycle de CALVIN. Une situation biologique exceptionnelle o apparat une double symbiose [30] entre un animal et deux espces procaryotiques diffrentes !

152

BIODGRADATIONS ET MTABOLISMES

La dcouverte de telles relations biologiques dans des environnements considrs comme hors du commun suscitent de nombreuses spculations. Une hypothse consiste voir les organismes dcouverts comme des reliques de formes ancestrales qui auraient t vinces partout dans la biosphre, mais prserves des endroits privilgis. Une autre interprtation voit les formes vivantes bizarres comme le rsultat d'une volution rgressive partant d'organismes communs sur lesquels se serait exerce une pression slective importante. Ainsi la colonisation des grandes profondeurs aurait ncessit une adaptation pousse par transformation d'espces ordinaires. Cette question suscite actuellement un courant de recherche fascinant.

3.4 - MTHANOTROPHES CONTRE ORGANOCHLORS


Les mthanotrophes dtenteurs de mthane mono-oxygnase soluble sont capables d'liminer une grande varit de produits comprenant des xnobiotiques. Les bactries comptentes sont en gnral de type II ou X. Les mthanotrophes de type II assimilent le carbone du formaldhyde et du CO2 par le cycle de la srine. Ils contribuent dcontaminer les sols pollus par des solvants organochlors comme le trichlorothylne (TCE), le 1,2-dichlorothane et le chloroforme. Les organochlors sont consomms en grande quantit car ils ont l'avantage d'tre d'excellents solvants, de cot modique, stables et peu inflammables. On les rencontre dans les activits de dgraissage, dans la fabrication des matires plastiques, dans les procds d'extraction (comme dans la fabrication du caf dcafin), dans le contrle des parasites et des champignons, et enfin comme anesthsiques. Des produits chlors de ce type apparaissent fortuitement au cours de la purification de l'eau par chloration. Comment ces solvants organochlors sont-ils transforms dans les milieux contamins ? Le principe de base de leur limination diffre selon que les conditions sont arobies ou anarobies. Lorsqu'elle est ralise, l'limination de l'halogne se fait toujours sous forme d'ions chlorure. La partie carbone du substrat est soit minralise jusqu'au stade du CO2, soit convertie en produits secondaires rcuprs par d'autres organismes. Toute dgradation complte est facilite par deux conditions. La premire est celle du comtabolisme. Le substrat chlor n'assure pas la croissance du germe par lui-mme. Il faut qu'une autre source carbone soit transforme par un arsenal enzymatique peu spcifique qui traite le substrat chlor dans la foule [31]. Par exemple le trichlorothylne et le chloroforme sont dans ce cas. L'apport de germes comptents sur le terrain pollu ne sera gnralement pas suffisant pour obtenir un nettoyage efficace. Il faudra prvoir l'introduction de sources nutritives supplmentaires, notamment du mthane pour stimuler les mthanotrophes. En somme on lutte contre une pollution nfaste par une deuxime pollution qui a l'avantage d'tre inoffensive. La seconde condition pour une dgradation complte est le dveloppement d'associations bactriennes. L'limination d'un xnobiotique est souvent impossible avec un seul germe. Un mthanotrophe de type II apporte une contribution qui sera complte

3 OXYDATIONS MINRALES

153

par d'autres organismes comme un Hyphomicrobium. La pice matresse de dpart est videmment la mthane mono-oxygnase soluble. L'enzyme a t examine en dtail chez Methylosinus trichosporium. Nous savons que cette enzyme trois composants contient un noyau bi-mtallique dans son site actif. Si on se reporte au cycle catalytique de la mthane mono-oxygnase indiqu plus haut, on voit que chaque noyau bi-mtallique FeOFe lie O2 aprs avoir subi une rduction. L'opration fait exploser la molcule d'oxygne diatomique et libre une molcule d'eau. Un atome d'oxygne reste alors sur le centre bi-mtallique, qui devient une entit extrmement ractive et stabilise par rsonance, symbolise sur le schma par les trois formules msomres [32]. L'attaque du TCE serait de nature radicalaire.
H O Fe IV Fe IV III H O Fe Fe IV III O. Fe H O Fe III Cl Cl TCE Cl H
+

tape oxydante du cycle catalytique

Cl Cl H O
+

Cl . H Cl Cl
+

O. Fe III III

Cl H O Fe H O Cl III poxydation Fe Cl O H O Fe III III Cl H

III Cl Cl Cl H O III Fe

Fe H O

Fe

migration du chlorure Fe

III

Oxydation du TCE par la mthane mono-oxygnase


Il apparat deux produits de transformation du TCE, l'poxyde de trichlorothylne ( droite sur la figure) et l'hydrate de chloral. L'poxydation est majoritaire et emporte 95% de la transformation. Il n'y a donc pas de dchloration ce stade. Ce n'est pas le seul inconvnient. Quand on a voulu utiliser un mthanotrophe tel que Methylosinus pour liminer le TCE des sols contamins, il a fallu se rendre compte que l'efficacit n'tait pas toujours au rendez-vous. En effet, le TCE par lui-mme ne peut pas assurer la croissance des bactries et le vritable substrat de croissance, qui est le mthane, entre en comptition avec le TCE pour l'oxygnase. Il en rsulte une baisse de rendement, mais plusieurs solutions existent pour y pallier. La premire mthode consiste obtenir des associations de germes, o des Pseudomonas et bactries apparentes liminent le chloral et l'poxyde. Le chloral est oxyd en trichloro-actate, qui est mtabolis en oxaloactate et autres drivs par un mcanisme connu chez un Pseudomonas [33]. L'poxyde est transform

154

BIODGRADATIONS ET MTABOLISMES

son tour par la mthane mono-oxygnase et la tolune 2-mono-oxygnase appartenant des Pseudomonas. L'efficacit tend rester incertaine, cause des dgts causs par la ractivit de l'poxyde. La deuxime solution consiste isoler des mthanotrophes dont les performances ont t amliores par mutation. Cette voie a t explore par FICH et coll. [34]. Ces auteurs ont tout simplement slectionn un mutant de Methylosinus trichosporium qui avait perdu toute sensibilit au cuivre (sans doute par dficience du transporteur spcifique), ce qui lui permettait de fabriquer la mono-oxygnase soluble dans toutes les conditions. La troisime voie relve du gnie gntique. Il s'agit de cloner le groupe de gnes codant pour la mono-oxygnase dans une autre espce, elle-mme dote de potentialits supplmentaires. JAHNG et WOOD ont log les gnes de Methylosinus dans un plasmide, lui-mme introduit dans un Pseudomonas putida [35]. Les bactries modifies transformaient le TCE un peu moins vite que le mthanotrophe de dpart. Lattaque restait partielle (40%), mais ne subissait aucune inhibition par le cuivre. Toute comptition avec le mthane tait absente. En outre ce Pseudomonas minralisait trs activement le chloroforme. La dpollution arobie de solvants chlors comme le TCE nest pas propre la mthane mono-oxygnase. Elle est ralise gnralement par des enzymes trs peu slectives. Nous la retrouverons au Chapitre 8 avec la tolune dioxygnase et la tolune 2-mono-oxygnase. Cette dernire a des similitudes avec l'oxygnase du mthane par sa structure et l'existence d'un noyau de type FeOFe dans chaque site catalytique. L'enzyme oxyde aussi le TCE en poxyde, qu'il transforme nouveau en dichloro-actate [36]. Les vertus des mthanotrophes ont rapidement fait germer l'ide d'une utilisation pratique. Il s'agissait de favoriser le dveloppement des bactries dans des conditions o la mthane oxygnase soluble tait fonctionnelle. Pour aboutir ce rsultat, il fallait bien sr leur fournir du mthane, ainsi que des sources d'azote et de phosphore. Les polluants taient destins tre oxyds en mme temps que la source carbone principale par comtabolisme. Un procd a t dvelopp par une firme amricaine 4, consistant injecter horizontalement au-dessous de la nappe phratique un mlange d'air et de mthane faible concentration (moins de 5%) afin d'viter tout risque d'explosion. Les gaz diffuss taient recueillis au-dessus de la nappe aquifre. Une dcontamination efficace tait obtenue en quelques semaines avec un cot rduit 5. Quelques difficults peuvent surgir dans cette opration. Le mthane industriel doit tre dbarrass de toutes traces d'actylne car celui-ci inhibe l'oxygnase du mthane. Il faut veiller ensuite favoriser la multiplication des bactries. On doit donc ajouter une source de phosphore et d'azote. Si cela ne s'avre pas suffisant, on instille dans le sol des bactries comptentes. Les ingnieurs ont inject en mlange l'air du trithyl-phosphate (un compos volatil) 0,07% et de l'oxyde nitreux 0,007%. Afin d'viter l'effet de comptition par le mthane, celui-ci est inject raison de 4% de faon

4 - Westinghouse Savannah River Co. 5 - D'aprs un rapport d'expertise de T.C. HAZEN et coll. (1995); la socit est Aiken (North Carolina) et a fait breveter son procd en 1995. Voir : S.M. PFIFNER et coll.(1997) J. Ind. Microbiol. Biotechnol. 18 : 204-212.

3 OXYDATIONS MINRALES

155

discontinue : des injections de mthane pendant plusieurs heures alternent avec l'emploi d'un mlange gazeux sans mthane. La premire phase stimule la croissance des bactries, alors que la seconde favorise la destruction des matires polluantes. Une puration des produits indsirables a t ralise ainsi aprs une priode de quelques jours quelques semaines. L'utilisation des mthanotrophes des fins pratiques ne fait que reproduire certaines conditions naturelles o sont limins une foule de composs un seul atome de carbone ou portant des groupes mthyle : drivs de la choline, sulfure de mthyle, bromure de mthyle, Carbofuran (un pesticide) et beaucoup d'autres, sans oublier la destruction, comme nous l'avons vu, du trichlorothylne et de divers hydrocarbures halogns. En rsum, l'oxydation biologique du mthane est une proprit rpandue, caractrise par une biochimie particulire, pratique par des germes divers qui sont susceptibles de faire des biodgradations performantes comme la destruction du TCE et d'autres produits. Leur fonction cologique dans l'environnement semble considrable et donne lieu des applications pratiques intressantes. La section suivante est consacre plus particulirement aux halomthanes en gnral.

3.5 - HALOMTHANES
Les drivs mono-halogns du mthane sont en majorit des produits naturels prsents dans l'atmosphre. On les accuse de contribuer la destruction de la couche d'ozone. Le plus abondant est le chloromthane (CH3Cl), soit environ 0,0006 ppmv. Cela peut paratre bien peu, mais reprsente tout de mme 5 millions de tonnes dans l'atmosphre terrestre avec une demi-vie estime 1,2 anne. Beaucoup plus faibles sont les taux de CH3Br et CH3I, mais le premier est bien plus ractif par ses effets sur la couche d'ozone, qui sont presque aussi importants que ceux de son homologue chlor [37]. L'action sur la couche d'ozone est le rsultat d'une chimie radicalaire complexe. Par exemple CH3Cl subit en prsence de radicaux hydroxyle une photolyse qui gnre du monoxyde de chlore (ClO) et du chlore atomique (Cl) transports dans la stratosphre. Ces entits ragissent avec l'ozone qui fait retour O2. Le rsultat global est alors : 2 O3 3 O2. La plus grande partie est produite par les ocans, par la combustion du bois ou sa dcomposition par des champignons. Les plantes mettent un peu de chlorure de mthyle, par exemple les tubercules de pomme de terre [38]. On estime que les missions de CH3Cl et CH3Br d'origine humaine sont relativement faibles, peine quelques pour cent du total 6. Il existe donc une destruction naturelle de la couche d'ozone, dont le mcanisme et l'importance sont encore matire controverse. Mais l'intervention humaine s'est manifeste surtout par l'mission des chlorofluorocarbones ou CFC, qui ont donc renforc de faon alarmante un processus naturel. La couche d'ozone est surveille quasi quotidiennement par les

6 - Elle est plus importante, tout en restant minoritaire, dans le cas du bromure, utilis comme dsinfectant par fumigation. L'iodure de mthyle semble beaucoup moins important cause de son temps de sjour qui reste bref (quelques jours).

156

BIODGRADATIONS ET MTABOLISMES

stations scientifiques de l'Antarctique. L'importance de cette diminution d'ozone dans cette rgion du globe loin des principaux foyers d'activit humaine semble due au rgime climatique trs froid et ses variations pourraient tre naturelles. Le problme n'est toujours pas rsolu et dborde sur des controverses scientifiques, conomiques, politiques et mdiatiques. Revenons au chlorure de mthyle ou chloromthane. Quelles sont les sources naturelles des halomthanes ? Il semble que les principaux producteurs soient des organismes marins du plancton, des algues, et des plantes halophiles du littoral (Salicornia, Spartina). Des estimations quantitatives faites sur des marais salants californiens confirment l'intervention des vgtaux halophiles [39]. Les champignons et divers vgtaux terrestres font couramment des halocarbones. Par exemple les champignons des genres Fomes et Phellinus librent du CH3Cl, qui est peut-tre un agent de dfense. Cette production a t observe aussi chez Mesembryanthemum crystallinum ou Herbe Glace (une petite ficodace dcorative utilise dans les rocailles) et les tubercules de pomme de terre frachement rcolts [40]. Les halomthanes ont plusieurs origines. On en connat au moins deux. La premire est fonde sur l'action d'une peroxydase spcialise, ou haloperoxydase. Un ion halognure X est oxyd en X+ l'aide de H2O2, et l'halogne est insr sur un accepteur RH contenant plusieurs atomes de carbone (un intermdiaire du mtabolisme) selon la raction gnrale [41] : RH + X + H2O2 + H+ RX + 2 H2O (1)

Les plantes et les champignons ne sont pas les seuls gnrer des composs halogns. Cette proprit a t reconnue chez diverses bactries qui dtiennent une haloperoxydase spciale plus ou moins spcifique et contenant une flavine [42]. Le driv halogn (RX) se dcompose ensuite ici en librant CH3Cl ou CH3Br. De telles haloperoxydases sont communes chez les algues et champignons, qui utilisent aussi une autre voie fonde sur un donneur de mthyle trs classique dans le mtabolisme, la S-adnosylmthionine ou AdoMet*, selon : X + AdoMet CH3X + AdoHCys 7 (2)

La petite Herbe Glace possde ce systme [43], et l'enzyme est une mthyl-transfrase. Le chou (Brassica oleracea) renferme en abondance une enzyme du mme type. Le plus extraordinaire est que des bactries utilisent CH3Cl comme substrat de croissance malgr sa dilution dans l'atmosphre. Les mthylotrophes sont en premire ligne. Plusieurs organismes mthylotrophes capables de se dvelopper sur chloromthane comme seule source de carbone et d'nergie ont t isols. L'un d'eux est un homo-actogne strictement anarobie (Acetobacterium dehalogenans), d'autres sont des mthylotrophes arobies des genres Hyphomicrobium et Methylobacterium. On s'arrtera ici aux seuls arobies. cause de la dilution du substrat dans l'air ambiant, on imagine mal que les bactries puissent se nourrir autrement que par le chlorure de mthane produit in situ dans le sol par les champignons et les plantes, dans des environnements minuscules o le gaz est plus concentr.

7 - S-adnosylhomocystine.

3 OXYDATIONS MINRALES

157

L'assimilation de CH3Cl peut se faire avec ou sans comtabolisme par oxydations successives. En anarobiose, Acetobacterium dehalogenans rcupre le groupe mthyle pour en faire du mthyl-FH4 [44]. C'est un intermdiaire que nous connaissons aprs avoir examin le mtabolisme des actognes, et il nous fera faire un petit retour en arrire. Le mthyl-FH4 fait partie de la voie de l'actyl-CoA ou voie de WOOD, qu'on trouve aussi chez les mthanognes. Le Methylobacterium souche CM4, un mthylotrophe arobie tudi par VANNELLI et coll. [45] (chapitre 4), utilise le chlorure de mthyle comme seule source de carbone et d'nergie par un mcanisme qui ressemble curieusement celui des actognes et des mthanognes. Cependant le rsultat des transformations n'est pas l'actyl-CoA mais le formiate. Le rendement de croissance est lev, soit 2,8 g de protine cellulaire par mole de substrat carbon. Des oxydations du bromomthane et du fluoromthane par les mthanotrophes ont t galement observes. Pour Hyphomicrobium chloromethanicum, CH3Cl est galement utilisable comme seule source de carbone et d'nergie et donne lieu un mtabolisme similaire dont un dessin montre le principe [46].
CH3 Co(I) enz. CH3Cl CmuA Co(III) enz. FH4 Cl CmuB CH3 FH4 [2H] CH2 FH4 [2H] CH FH4 [2H] HC FH4 H2O FH4 HCOOH

Oxydation du chlorure de mthyle par Methylobacterium


Les deux premires tapes sont catalyses par les mthyl-transfrases CmuA et CmuB, utilisant un corrinode. On pourra comparer le mcanisme avec celui des actognes. Les oprations se droulent ici en sens inverse. Elles sont dduites des rsultats obtenus avec des extraits acellulaires. Le mthyle est greff sur le cobalt quand celui-ci passe de l'tat CoI CoIII, puis dcharg sur le ttrahydrofolate (FH4) pour produire le mthyl-FH4. Observons ici les diffrentes oxydorductions ralisables sur le FH4, avec la sortie le formyl-FH4 et le formiate. Les trois oxydations successives sont symbolises par [2H] 8. Cette voie conduisant au formiate est un mtabolisme nergtique. Comme les bactries ont galement besoin d'une source de carbone, elles prlvent celui-ci au niveau de mthylne-FH4, qui alimente le cycle de la srine dcrit antrieurement. L'intervention d'un corrinode est assez exceptionnelle chez des organismes ayant un mode de vie arobie. Chose intressante, la protine CmuA a des analogies reconnaissables avec la mthionine synthase du colibacille. Cette enzyme reprsente une tape cl du mtabolisme des lments monocarbons (voir mthionine*). Une ressemblance significative au niveau d'une portion de squence a t trouve avec une mthyl-transfrase appartenant un mthanogne (Methanosarcina barkeri). Il y a plus tonnant encore. Un autre Methylobacterium (M. extorquens AM1) utilise en

8 - On reconnat successivement les stades mthyl-FH4, mthylne-FH4, mthnyl-FH4 et formyl-FH4.

158

BIODGRADATIONS ET MTABOLISMES

plus du FH4 une ttrahydro-mthanoptrine trs proche de celle que les mthanognes mettent en jeu au cours de la rduction de CO2 en mthane [47]. On croyait antrieurement que ce cofacteur tait strictement rserv aux archaebactries mthanognes et rductrices de sulfate. Cette trouvaille laisserait supposer que les gnes impliqus dans la mthylotrophie et la mthanognse ont une origine commune trs ancienne, avec le mme schma directeur dans la gestion mtabolique des lments monocarbons entre bactries arobies et archaebactries strictement anarobies. Chose intressante, l'assimilation du CH3Cl par les mthylotrophes donne lieu une diminution du rapport 13C/12C de mme ordre de grandeur que celui de la mthanognse. Le dficit en carbone-13 est de l'ordre de 7% par rapport au rservoir carbon de dpart. On suppose videmment que le mcanisme de base mis en jeu est similaire [48]. Il existe donc un cycle des halognures de mthyle dans la nature, le principal tant celui du CH3Cl. Un quilibre dynamique, dont les paramtres ne sont pas entirement connus, s'tablit entre la production biologique de ces halognures et leur oxydation par les bactries mthylotrophes du sol. Le mtabolisme de celles-ci prsente une ressemblance troublante avec celui de certaines archaebactries. La mthyltransfrase corrinode retient particulirement l'attention. Sa spcificit est assez large. Elle peut catalyser un va-et-vient de mthyle entre un donneur et un accepteur, utilisant CH3Cl, CH3 Br ou CH3I pour mthyler toute une panoplie d'accepteurs: halognures, nitrite (NO2), cyanure (CN), thiocyanate (SCN) et hydrosulfure (HS) ! L'industrie humaine n'a fait que contaminer l'environnement par de nouveaux lments monocarbons sous la forme des chlorofluorocarbones proprement dits et des halons.
CH3Cl

CH3Br

CFC halons

HCFC

CH3CCl3 + CCl4

Le diagramme montre la rpartition en quivalents chlore des gaz halogns de la troposphre, d'aprs des mesures faites en 1999 et rapportes par BUTLER [49]. Sont reprsentes en blanc les parts attribues aux missions naturelles. Les autres, en gris, proviennent de l'activit humaine et reprsentent 77% du total (certaines abrviations sont redfinies en glossaire). On estime que les CFC ont un temps moyen de rmanence lev dans l'atmosphre, de l'ordre de 60 100 ans. Les plus connus sont le fron-11 (CCl3F) et le fron-12 (CCl2F2), utiliss dans les rfrigrateurs et les climatiseurs, et maintenant bannis. On a tent de les remplacer par les HCFC (hydrochloro-fluorocarbones). Leur temps de rsidence est calcul d'aprs la cintique de raction avec le radical hydroxyle. Il serait de 15 ans et on les suppose moins nocifs pour la couche d'ozone [50]. L'un d'eux est le HCFC-21

3 OXYDATIONS MINRALES

159

(CHCl2F). Ils seraient plus susceptibles une dgradation biologique. L'attaque arobie de plusieurs HCFC dans le sol l'tat de traces a t dtecte et les responsables probables sont l encore des mthanotrophes [51]. Par contre les CFC paraissent rfractaires toute attaque anarobie et ne sont dgrads la rigueur que par les mthanognes, sans doute par dshalognation rductrice. Cette transformation apparat clairement dans le cas du fron-11 par Methanosarcina barkeri [52]. La question semble progresser assez peu actuellement. Les halons regroupent un certain nombre de gaz utiliss dans les extincteurs. En font partie le perfluoro-propane (C3F8), le perfluoro-butane (C4 F10), le trifluoroiodo-mthane (CF3I), et un certain nombre de composs 1-4 atomes de carbone, contenant du chlore et du fluor, par exemple le chlorottrafluorothane (CHFClCF3). Il est vraisemblable que la fabrication de ces gaz sera totalement interrompue la suite des confrences internationales. On cherche les remplacer par des hydrocarbures chlors qui seraient sans danger sur la couche d'ozone. Sont galement catalogus abusivement comme halons des mlanges gazeux qui n'ont rien voir avec les organo-halogns, comme le dioxyde de carbone, l'argon et l'azote, utiliss aussi dans les extincteurs ou les bombes arosols.

3.6 - L'OXYDATION DE L'AMMONIAC


Cette question, dont on a dj fourni quelques lments, complte logiquement l'oxydation du mthane, car l'ammoniac, dgag en abondance par les dcompositions de matire organique animale ou vgtale, est oxyd par une oxygnase dont nous connaissons les analogies avec l'enzyme membranaire du mthane. L'oxydation de l'ammoniac dans l'environnement reste enveloppe d'incertitudes. Aussi est-ce un sujet difficile mais important. L'ammoniac est trs toxique pour les tres vivants et son caractre volatil faciliterait son vasion dans l'atmosphre, si ce n'est qu' pH neutre dans les sols et les eaux, il est essentiellement l'tat d'ion ammonium NH4+ (le pKa est 9,1 30C). Son oxydation arobie jusqu'au stade nitrate, la principale ressource azote des plantes vertes, s'appelle nitrification et se fait en deux tapes. La premire est la transformation de NH3 (ou NH4+) en nitrite (NO2) chez Nitrosomonas par l'ammoniac mono-oxygnase (1) et l'hydroxylamine oxydorductase (2 ) : NH3 + O2 + NADH + H+ NH2OH + NAD+ + H2O NH2OH + H2O NO2 + 4 e + 5 H+ La seconde tape transforme le nitrite en nitrate chez Nitrobacter : NO2 + O2 + NADH + H+ NO3 + H2O + NAD+ (3) (1) (2)

Les vgtaux disposent de l'azote minral sous forme ammoniacale ou nitrate, avec une prfrence de nombreuses espces pour la seconde. Beaucoup de plantes cultives peuvent utiliser indiffremment ces deux sources azotes. Il en est de mme pour les espces pionnires sur terrain difficile. Le taux d'assimilation de

160

BIODGRADATIONS ET MTABOLISMES

l'ammonium par rapport celui du nitrate est alors proche de l'unit [53]. La toxicit de NH4+ entrane la prfrence de nombreuses plantes pour le nitrate. Inversement le riz, les bruyres et les conifres se contentent de sols enrichis en ammonium et matires organiques, et rsistent bien la toxicit ammoniacale. Cette question a une grande importance en conomie forestire. Des arbres comme les picas croissent mieux sur ammonium que sur nitrate. Ils se contentent donc facilement de sols o la nitrification est faible. Par contre si celle-ci augmente la suite d'un changement des conditions, la monte des nitrates peut gner la rimplantation de ces arbres. Ce problme a fait l'objet d'tudes par des auteurs nordamricains [54]. Des facteurs supplmentaires sont considrer, comme le prlvement azot par la microflore du sol et les mycorhizes, dont la prfrence va vers l'ammonium. L'conomie azote du monde vgtal est donc sous la dpendance d'influences complexes dont la nitrification n'est que l'un des lments. La nitrification est un facteur de fertilisation des milieux naturels pour de nombreuses plantes, mais contribue rgler la rpartition des espces en fonction de l'apport azot et du rapport NH4+/NO3. Il y a trois stades considrer : l'oxydation de l'azote ammoniacal en hydroxylamine, le passage au nitrite, l'oxydation du nitrite en nitrate. Ces ractions sont arobies. Nitrosomonas europaea catalyse les deux premires tapes. C'est un Gram-ngatif appartenant au groupe des -protobactries, vivant en autotrophie avec une croissance trs lente, son temps de gnration tant d'au moins 7 heures dans les conditions optimales. La premire raction (1) est catalyse par l'ammoniac monooxygnase (AMO) code par trois gnes formant un l'opron amoAB. Elle utilise NADH et consomme de l'nergie. L'nergie est apporte par la raction (2), catalyse par l'hydroxylamine oxydorductase (HAO, EC 1.7.3.4) associe une chane de transporteurs d'lectrons. L'ammoniac mono-oxygnase (AMO), est construite sur le mme modle que la mthane mono-oxygnase membranaire des mthanotrophes, comme l'a suggr une comparaison entre leurs gnes [55]. Son substrat est NH3 et non pas l'ion ammonium. Elle oxyde aussi mais plus faiblement le mthane. Nous savons qu'elle oxyde aussi un peu l'ammoniac. L'AMO est inhibe slectivement par la nitrapyrine et oxyde une riche palette de substrats comme le fait l'enzyme du mthane. En somme il y a bien une sorte de cousinage entre les deux enzymes, qui dfaut d'une forte homologie de squence ont beaucoup de caractres communs et pourraient avoir volu partir de la mme solution ancestrale. Lorsque l'AMO attaque des substrats secondaires, comme des composs organiques halogns, elle ne peut le faire que paralllement l'oxydation de l'ammoniac, qui apporte l'nergie ncessaire. Toute chute du taux d'oxygnation de l'ammoniac entrane de fait une baisse de l'activit dpolluante de l'enzyme. Comme l'ammoniac mono-oxygnase est une enzyme cl du cycle de l'azote, toute inhibition de son action pourrait avoir des effets pervers dans l'environnement. Or l'enzyme est fragilise par l'tendue mme de ses potentialits. Loxydation du TCE par l'AMO engendre des intermdiaires nocifs qui ragissent avec plusieurs protines cellulaires dont l'AMO. Il y a plusieurs critres montrant que l'oxygnase est bloque par les produits de transformation du TCE. Tout d'abord l'inhibition dfinitive de l'AMO ne se produit qu'en prsence d'O2, ce qui montre que le cycle catalytique est ncessaire cette

3 OXYDATIONS MINRALES

161

inactivation qui est dfinitive. Elle est contrebalance dans les cellules entires par la synthse de novo de nouvelles molcules d'enzyme. Un deuxime critre est l'inhibition comptitive par l'allylthioure, qui retarde la destruction de l'enzyme en ralentissant l'oxydation du TCE. L'AMO s'empoisonne galement par l'oxydation de substrats autres que le TCE. L'un d'eux est l'actylne. La raction de l'actylne marqu au carbone-14 installe la radioactivit dans l'un des polypeptides de l'oxygnase, uniquement si l'oxygne est prsent, et l encore l'allylthioure protge l'enzyme contre son inactivation irrversible. Enfin un autre inhibiteur agissant la manire de l'actylne est le sulfure d'allyle. Son action puissante sur l'enzyme s'explique peut-tre par formation d'un poxyde ou d'un sulfoxyde ractif. La formation d'un produit de ce type parat plausible, car l'AMO transforme le dimthylsulfure en DMSO [56]. L'oxydation de l'ammoniac dans la biosphre est donc un mcanisme fragile relativement exigeant vis--vis de divers paramtres. Il est facilement empoisonn par des produits polluants. L'hydroxylamine oxydorductase est une enzyme tonnante et complexe. Elle a trois sous-units identiques contenant chacune 8 hmes C lis au polypeptide par le consensus courant CxxCH, le fer tant coordonn des deux cts par l'histidine. L'un de ces hmes est inhabituel par sa bande SORET* 460 nm en prsence de CO, ce qui le fait dsigner comme P460.
1re sousunit P460 4 6 5 2 1 3 5 6,7

8 1 sousunit
re

1 2

P460 Cter

Hydroxylamine oxydorductase (structure partielle)


Ce noyau hminique particulier est considr comme le site actif o le fer est haut spin et penta-coordonn, la sixime coordinence tant tablie avec le substrat. L'oxydorductase est donc dote d'une chane interne de transporteurs d'lectrons qui ressemble celle qu'on trouve chez les mthanotrophes [57]. Le dessin reprsente deux des trois sous-units de l'enzyme. Les cercles noirs sont les atomes de fer au centre des 8 porphyrines par sous-unit. Les hmes sont numrots de 1 8 en fonction de la position de leurs liens covalents avec la squence.

162

BIODGRADATIONS ET MTABOLISMES

Ils forment 4 groupes I, II, III et IV qui sont autant dunits fonctionnelles au sein de la chane de transferts : I (4 + 6 + 7), II (3 + 5), III (1 + 2) et IV (8). L'hme n4 est le P460 du site actif. Les potentiels s'chelonnent entre 400 et 100 mV, le plus bas tant celui de l'hme 8. Le P460 a une structure atypique. La porphyrine dj attache par deux liens covalents sur cystine en contracte un troisime avec un rsidu tyrosine de la sous-unit voisine travers la surface de contact. La protine n'a rien d'une fantaisie isole dans la nature. On retrouve un P460 chez Methylococcus capsulatus, un mthanotrophe capable d'oxyder l'ammoniac en hydroxylamine puis en nitrite. Les lectrons sont-ils achemins directement sur l'oxygne ou vers une oxydase terminale membranaire ? L encore existe une longue chane d'hmes C dans les cytochromes c554 et c552.
NH2OH + H2O hydroxylamine oxydorductase
+ NO2 +5H

O2 + 4 H+ 4 e 2 cyt.554 4 e 4 cyt.552 4 e oxydase terminale

4 e

2 H2O

Le c554 est un transporteur 4 hmes de potentiels allant de + 47 276 mV. Ils sont aligns dans un ordre qui rappelle le tronon de squence portant les hmes 3 6 dans l'oxydorductase [58], bien qu'il n'y ait pas d'homologie de squence entre les deux protines. Les lectrons entrent sous +47 mV sur deux hmes dont l'un est penta-coordonn et ressemble ainsi au P460 prcdent. Le c552 est un petit cytochrome un seul hme qui est bti comme celui des mitochondries animales. L'oxydase terminale rappelle celle de Paracoccus. Les bactries telles que Nitrosomonas ont un gnome relativement petit (2 200 kb) dont la squence complte est attendue avec intrt car il s'agit de cellules autotrophes. Chose curieuse, les gnes de l'oxygnase, de l'oxydorductase et des cytochromes fonctionnellement associs existent en plusieurs exemplaires de squences pratiquement identiques [59], ce qui n'est pas sans compliquer l'analyse gntique. En effet l'inactivation d'un site par mutation est facilement compense par un autre gne de la srie. La raison de cette pluralit est nigmatique. Deux gnes identiques peuvent amliorer la production de l'enzyme correspondante sur le plan quantitatif. Si la bactrie n'en tirait aucun avantage physiologique, le hasard des mutations aurait toute chance de faire disparatre le matriel gntique superflu. En ralit l'explication se situe probablement au niveau des rgulations, qui conduiraient exprimer l'un ou l'autre des gnes dans des circonstances diffrentes. Le pouvoir d'adaptation de la bactrie aux conditions du milieu s'en trouverait amlior. Nous arrivons maintenant l'oxydation du nitrite en nitrate. La nitrite-cytochrome c oxydorductase appartient aux bactries telles que Nitrobacter winogradskyi, qui est le principal matriel d'tude. La protine est hminique et contient des noyaux fer-soufre et du molybdne. Celui-ci est log dans un cofacteur organique spcial du

3 OXYDATIONS MINRALES

163

type de ceux qu'on trouve dans la majorit des molybdo-enzymes. Les chefs de file en sont la xanthine oxydase et les nitrate rductases [60]. Il y a une certaine ressemblance ici avec la sulfite oxydase, qui catalyse une raction assez similaire. Parce que l'oxydorductase contient des hmes A et C, on la dsigne habituellement comme cytochrome a1c1. Les lectrons sont achemins ensuite vers l'oxygne par un cytochrome c et une cytochrome c oxydase de type aa3 similaires ceux des mitochondries [61].
NO2, H2O nitrite oxydorductase cyt. a1c1 NO3, 2 H+ 2 e 2 e 1/2 O2 + 2 H+ cytochrome c oxydase cyt. aa3

2 cyt. c

H 2O

L'importance de la nitrification dans l'environnement se manifeste dans trois directions. La premire est une rcupration de l'azote ammoniacal et sa transformation finale en nitrate (ractions 1, 2 et 3 indiques antrieurement), crant la principale source azote des vgtaux verts et un maillon essentiel du cycle de l'azote. La deuxime apparat dans l'puration des eaux lourdement charges en ammoniac, notamment en aval des stations d'levage industriel. L'ammoniac est toxique pour la vie aquatique, le nitrate form est entran facilement et servira de support la dnitrification dont le terme ultime est N2. L'ensemble contribue ainsi liminer le trop-plein en azote. La troisime direction d'importance est celle des biodgradations amorces en grande partie par l'ammoniac mono-oxygnase : oxydation et dshalognation d'hydrocarbures chlors, du TCE L'attaque de ces diffrents polluants n'apporte aucun bnfice nergtique la cellule et ne peut se faire que conjointement celle de l'ammoniac. La plupart des tudes ont port initialement sur Nitrosomonas europaea pour la transformation de NH3 en nitrite, et sur Nitrobacter winogradskyi pour l'oxydation du nitrite en nitrate. Ces organismes ne sont pas les seuls conduire la nitrification dans la nature, mais ont l'avantage d'tre faciles obtenir partir des collections et leurs proprits sont bien tablies. Une recherche systmatique des organismes nitrifiants par l'analyse des squences d'ARN 16S et l'emploi de sondes nucliques rvle pourtant une certaine diversit [62]. Les Nitrosococcus sont des -protobactries, tandis que les Nitrosomonas et un groupe de germes apparents entre eux (Nitrosobolus et Nitrosovibrio) sont des -protobactries. Nitrospira forme un groupe part. L'oxydation des nitrites est ralise par des bactries appartenant 4 genres, Nitrobacter (de la sous-classe alpha), Nitrospina (delta), Nitrococcus (gamma) et Nitrospira. La biologie de ces espces est encore insuffisamment tudie par manque de donnes en culture pure. Certaines sont htrotrophes, la plupart entrent volontiers dans des biofilms o se crent des associations syntrophiques entre celles qui oxydent NH3 et celles qui oxydent le nitrite. L'importance de certaines formes dans les boues d'puration reste facilement inaperue cause de la lenteur de dveloppement des isolats.

164

BIODGRADATIONS ET MTABOLISMES

Des travaux rcents ont montr l'importance des Nitrospira (N. marina, N. moscoviensis) dans l'oxydation des nitrites en nitrates [63]. Ces bactries, qui occupent une place part dans la phylognse des procaryotes, sont prsentes dans une grande varit de milieux et se dveloppent sur des concentrations de nitrite de l'ordre de 200 mg . L1. Elles ont une forte affinit pour les nitrites mais une croissance assez lente. Les Nitrobacter ont des proprits inverses, se dveloppent sur forte concentration de nitrite (2 g . L1), ont une faible affinit pour celui-ci, et se multiplient rapidement. Les premires sont dites de type K (pour Km), les secondes de type r (pour rate ou vitesse) [64]. La juxtaposition dans l'environnement de comptiteurs K et r se dveloppant sur le mme substrat n'existe pas que pour les nitrites. Elle correspond un certain partage des tches et un moteur d'volution dans les populations 9. La nitrification reprsente petite chelle un facteur essentiel de la maintenance d'un aquarium, biotope naturel en miniature o les principaux lments sont recycls en vase clos. Hormis l'apport de nourriture aux poissons et les changes gazeux avec l'atmosphre, l'aquarium garni de plantes vertes fonctionne en autarcie complte. L'azote ammoniacal en provenance des poissons et des dbris vgtaux est roxyd en continu par les bactries nitrifiantes venues coloniser le filtre. Il est bien connu des aquariophiles que l'installation d'un nouveau bac ncessite une priode d'adaptation de plusieurs semaines, au cours de laquelle les nitrites sont produits plus rapidement qu'ils ne sont oxyds en nitrates. Leur teneur peut atteindre une valeur toxique pour les poissons. On acclre le processus par un ensemencement bactrien et une bonne oxygnation. Lorsque l'aquarium est "install", le taux de nitrite doit retomber une valeur faible. La monte des nitrates des valeurs situes autour de 10-20 mg . L1 tmoigne d'une bonne nitrification, mais elle doit se stabiliser grce au dveloppement des plantes. L'usage d'eau dminralise et purifie l'excs n'est pas forcment recommand puisqu'il risque de faire disparatre des oligo-lments ou d'autres composants (comme les phosphates) ncessaires l'conomie gnrale du bac. Les Nitrospira auraient un rle essentiel dans les aquariums pour faire disparatre les nitrites au fur et mesure, les Nitrobacter interviendraient davantage aprs une forte monte des nitrites. Un mauvais dveloppement de ces bactries est la source d'une monte dommageable des nitrites. Revenons l'oxydation de l'ammoniac. Sa transformation en nitrate repose sur un mcanisme fragile qui n'opre que dans une gamme de pH assez troite, avec un optimum plac vers 7,5-8,5 ; elle cesse avec le froid (au-dessous de 5-10C) et ds que l'oxygne tombe des valeurs faibles. La nitrification risque donc d'tre absente dans les sols forestiers acides ou peu ars, et reste sensible des actions inhibitrices varies. L'effet inhibiteur d'un pH au-dessous de la neutralit peut s'expliquer par l'quilibre entre NH3 et NH4+, dj fortement dplac en faveur de l'ammonium pH neutre. Or l'ammonium n'est pas le substrat de la nitrification, contrairement NH3. Le pH acide provoque donc une rarfaction accrue de

9 - Une question de dynamique des populations, applique la croissance cellulaire comme l'volution humaine, appele par certain auteurs thorie de RUSHTON.

3 OXYDATIONS MINRALES

165

l'ammoniac disponible. Il en rsulte aussi des effets complexes exercs par la nature du sol. Certains constituants agissent comme changeurs de cations et adsorbent l'ammonium, effectuant ainsi un dtournement global de l'azote qui sera moins disponible pour l'oxygnation. La nitrification conserve des aspects obscurs et les limites de son action ne sont pas encore bien cernes, ce qui est bien dommage vu l'intrt qu'elle prsente pour l'agriculture. C'est lors de l'oxydation de l'ammoniac en nitrite que son utilit dans les biodgradations apparat au mieux, puisque l'ammoniac mono-oxygnase possde, comme l'enzyme correspondante active sur le mthane, un pouvoir de transformer une gamme tendue de substrats parmi lesquels figurent des hydrocarbures halogns. La section suivante porte sur un aspect nouveau de l'oxydation de l'ammoniac, qui pourrait tre d'une grande utilit pour le traitement des eaux. Un aspect indit de l'oxydation de l'ammoniac n'est connu que depuis quelques annes. On pensait autrefois qu'elle tait, pour des raisons videntes, tributaire de l'oxygne. Des observations prouvant une oxydation de NH3 en anarobiose sont venues compliquer les choses. Elles ont t faites en bioracteur install pour une tude de dnitrification [65]. L'ammoniac est oxyd en absence complte d'O2, en passant probablement par des stades intermdiaires comme l'hydroxylamine et l'hydrazine (H2NNH2), le stade final tant l'azote diatomique (N2) ! Quel est l'oxydant ? Le nitrite ou peut-tre le nitrate. Ce nouveau mcanisme biologique a t dsign par anammox (anaerobic ammonium oxidation). Il intervient pH 7,5-8,5, se montre encore plus lent que la nitrification arobie. Quand l'ammoniac marqu l'azote-15 est mis en prsence de nitrite contenant l'azote-14, le N2 form est constitu d'un atome 14N et d'un atome 15N. La dtection de ce diazote "hybride" peut donc servir rvler le fonctionnement de l'anammox, qu'on pourrait symboliser par : NH4+ + NO2 N2 + 2 H2O Malheureusement les germes incrimins n'ont pas t clairement caractriss, et leur croissance est extrmement lente : une division toute les 2 3 semaines ! Les cellules sont autotrophes. Elles se dveloppent dans des biofilms au contact des eaux uses charges en ammoniac. C'est sans doute la difficult de les obtenir en culture qui fait que beaucoup de dtails sur cette question manquent encore. Une nouvelle oxydorductase a t caractrise partir d'une culture anarobie. Elle oxyde in vitro l'hydroxylamine et l'hydrazine en utilisant des accepteurs d'lectrons artificiels. L'enzyme contient de nombreux hmes. Son spectre inhabituel l'a faite dsigner comme cytochrome P468. Elle ne parat prsenter aucune ressemblance avec l'enzyme correspondante de Nitrosomonas europaea. Cette dernire espce, qui est en principe arobie, possde un mtabolisme qui ressemble l'anammox en taux faible d'oxygne. Elle fait du NO par oxydation de l'ammoniac avec le nitrite. Ce processus est trs lent, mais un tel chass-crois de ractions en milieu anarobie ne facilite videmment pas les analyses. En somme il y a deux voies d'oxydation diffrentes de l'ammoniac dans la nature. La premire et la plus importante est la nitrification, une oxydation par O2 dont le nitrate est le stade terminal

166

BIODGRADATIONS ET MTABOLISMES

nitrate. La seconde voie est appele anammox. Elle est anarobie et totalement indpendante de la premire. L'ammoniac est transform en azote molculaire, le nitrite servant d'oxydant. Les germes responsables de l'anammox sont des bactries atypiques du genre Candidatus dans le groupe spcial des planctomyctes dont la morphologie comporte une compartimentation inhabituelle. L'oxydation de l'ammoniac a lieu dans la membrane priphrique d'une particule interne entoure d'une double membrane et appele anammoxosome.
parahyphoplasme membrane externe membrane interne anammoxosome riboplasme nuclode

Les cellules sont entoures de deux membranes, interne et externe, et d'une zone cytoplasmique priphrique dpourvue de ribosomes, trouve chez tous les planctomyctes connus, et dsigne comme le parahyphoplasme. Une rgion plus interne entoure d'une membrane simple ou riboplasme 10 renferme des ribosomes, un ou plusieurs nuclodes rendus fluorescents par le DAPI et l'anammoxosome [66]. Le mtabolisme de l'ammoniac s'effectue cycliquement par une nitrite rductase, une hydrazine hydrolase et une enzyme d'oxydation de l'hydrazine productrice de N2 et non entirement caractrise. Ces facteurs catalysent respectivement les ractions (1), (2) et (3). NO2 + 4 e + 5 H+ NH2OH + H2O NH2OH + NH3 H2NNH2 + H2O H2NNH2 N2 + 4 H+ + 4 e (1) (2) (3)

Sur le schma a du cycle des oxydorductions, on peut voir que des protons sont prlevs du ct cytoplasmique, d'autres sont expulss l'intrieur de l'anammoxosome. Il est donc possible qu'un gradient lectrochimique s'tablisse de part et d'autre de cette membrane, mais on ignore comment l'nergie est rcupre. La composition biochimique de la membrane des anammoxosomes rvle des caractres extraordinaires sans quivalent connu ailleurs dans le monde vivant. On y rencontre des lipides exceptionnels appels ladderanes, du mot anglais voulant dire chelle. Les chanes hydrocarbones sont greffes sur le glycrol par des liaisons ther ou ester, mais le dtail le plus curieux est la succession de cycles 4 et 6 atomes de carbone (cyclobutane, cyclohexane) relis en cis selon les conventions chimiques usuelles. Deux exemples ont t figurs en b. 10 - Appel pirellulosome dans une autre espce, Pirellula marina.

3 OXYDATIONS MINRALES
NO2 cytoplasme NH2OH nitrite rductase 4 e hydrazine hydroxylase hydrazine oxydorductase 4 H+ OH O O O 5 H+ OH O O

167

N2H4 NH3 anammoxosome

N2

a - Cycle des oxydorductions

b - Exemples de ladderanes

Certains lipides sont des esters mthyliques d'acides gras ayant la mme structure bizarre. La rpartition des chanes et leur composition n'est pas quelconque. Elle a t dtermine par des auteurs nerlandais en s'aidant de la technique d'extraction et de purification partielle, marquage par anticorps, examen par fluorescence et spectromtrie de masse [67]. La physiologie de ces cellules particulires reste donc nigmatique. Les anammoxosomes ont t obtenus l'tat isol. Les ladderanes confrent la membrane spciale qui les entoure une rigidit accrue par rapport aux biomembranes habituelles. Ces lipides exceptionnels ont t prpars par synthse, s'organisent en bicouche, mais confrent une plus grande densit la membrane ainsi qu'une permabilit moindre. Il est suppos que cette organisation spciale est une adaptation contre la diffusion de l'hydrazine, qui entranerait des pertes importantes dans le mtabolisme nergtique. Il s'agit d'une adaptation de ces germes non-conformistes qui reste dcouvrir. La compartimentation interne des cellules n'a encore reu aucune explication.

3.7 - MONOXYDE DE CARBONE ET CARBOXYDOTROPHES


De grandes quantits de monoxyde de carbone, de l'ordre de 600 800 millions de tonnes par an sont dverss dans l'environnement. La combustion des carburants dans les moteurs et les installations thermiques a pris une part prpondrante dans les missions de CO dans l'atmosphre. Le cinquime environ de ce gaz est oxyd assez rapidement dans les couches superficielles du sol par des bactries arobies. Quant au monoxyde de carbone atmosphrique, il est soumis une oxydation photochimique et ragit avec les radicaux hydroxyles qu'il contribue ponger. La prsence de ces radicaux dans l'atmosphre a une grande importance pour empcher l'accumulation de CO, d'hydrocarbures, de terpnes et autres produits volatils. L'ozone en est une source principale. En conditions arobies, le CO est utilis comme seule source de carbone et d'nergie par les bactries dites carboxydotrophes disperses dans des groupes

168

BIODGRADATIONS ET MTABOLISMES

taxonomiques divers. Ce sont la plupart du temps des chimio-lithotrophes, l'nergie tant produite par l'oxydation de CO en CO2. L'utilisation du second fait de ces bactries des autotrophes . En somme, lorsqu'elles se dveloppent sur CO, elles jouent sur deux tableaux : production d'nergie et fabrication du gaz carbonique comme source de carbone. En anarobiose, le CO est utilis par divers organismes mthanognes, actognes, sulfato-rducteurs et phototrophes. Le mcanisme utilis est trs diffrent dans les deux cas. Chez les arobies, le CO est oxyd par une CO dshydrognase, qui est une flavoprotine contenant du molybdne, du slnium et des noyaux fer-soufre. La CO dshydrognase des anarobies est trs diffrente. Elle contient du nickel et fonctionne comme actyl-CoA synthase. C'est l'enzyme dj rencontre chez les actognes et les mthanognes. On s'attardera ici l'oxydation arobie du monoxyde de carbone. Le carboxydotrophe servant de modle est Oligotropha carboxydovorans. L'oxydation suivante est catalyse par une molybdo-enzyme flavinique : CO + H2O CO2 + 2 e + 2 H+ La dshydrognase travaille en contact troit avec la face interne de la membrane o le monoxyde de carbone est oxyd, contrairement au mthane qui l'tait sur la face externe. Les protons sont expulss vers l'extrieur, et l'nergie est donc en partie rcupre sous forme d'un potentiel de membrane. Il existe d'ailleurs une autre diffrence avec l'oxydation du mthane. La spcificit de la CO dshydrognase est assez troite pour n'accepter que CO. dfaut de la prsence de monoxyde de carbone, les bactries peuvent continuer vivre comme des chimiolithotrophes en oxydant de l'hydrogne par une hydrognase. Le potentiel du couple CO2/CO est trs ngatif , soit E' = 540 mV, plus bas que celui de l'hydrogne ( 414 mV). C'est pourquoi la rduction de CO2 en CO des espces anarobies est une opration thermodynamiquement difficile exigeant une source d'lectrons trs rductrice. Inversement l'oxydation devrait pouvoir s'effectuer facilement avec des effecteurs varis, et comme le saut nergtique jusqu' O2 est important, le monoxyde de carbone apparat comme un trs bon carburant. Divers colorants font l'affaire comme accepteurs artificiels (bleu de mthylne, thionine, phnazine mthosulfate), alors que la dshydrognase ne rduit pas les accepteurs bas potentiel comme les violognes. L'accepteur physiologique de la CO dshydrognase de O. carboxydovorans est un cytochrome b561, vers lequel convergeraient aussi les lectrons en provenance de l'hydrogne. Comme la plupart des carboxydotrophes, cette espce a deux voies respiratoires fonctionnant avec O2, l'une tant rsistante l'inhibition par CO ou le cyanure (1 M), l'autre tant de type standard avec un cytochrome c et un cytochrome c oxydase [68]. On sait que les bactries ont couramment plusieurs chanes respiratoires pour faire face des conditions changeantes. Les bactries ont la possibilit ici de vivre en htrotrophie ou en autotrophie. Le premier cas est celui de la voie ordinaire o interviennent des dshydrognases NAD+/NADH, des cytochromes b et c, une cytochrome c oxydase terminale de type aa3. Cette voie est bloque par la rotnone et l'antimycine A. Le NADH est en mme temps une source d'lectrons pour l'assimilation de CO2 en autotrophie. Une seconde voie est insensible au CO et au

3 OXYDATIONS MINRALES

169

cyanure. Son oxydase terminale est de type o et l'inhibiteur est le HQNO. Les deux voies sont indiques par un plan.
E' (mV)
400

CO

H2

NADH rotnone

cycle de CALVIN

200

cyt. b563
0

quinone cyt. b561 cyt. o

quinone cyt. b558 antimycine A cyt. c cyt. aa3


(voie ordinaire)

200

400

(voie insensible CO)


600

800

O2

O2

Voies respiratoires de O. carboxydovorans


L'oxydation de CO ou de H2 fait passer les lectrons prfrentiellement vers la voie insensible CO, ce qui semble logique. Un caractre intressant de cette physiologie est la possibilit d'engendrer le NADH ncessaire la vie en autotrophie, puisque le cycle de CALVIN exige la fois un rducteur et de l'ATP. Des expriences ont t faites pour dterminer comment les lectrons parviennent au NAD+ pour sa rduction en NADH [69]. On voit d'aprs le diagramme que les lectrons produits par l'oxydation de CO ou de H2 ne peuvent aboutir NADH qu'en remontant l'chelle des potentiels vers les valeurs ngatives. Le problme est le mme que celui des phototrophes. Un courant d'lectrons inverse actionn par le potentiel de membrane est l'origine du NADH. Les faits exprimentaux militent en faveur de cette conclusion. Un apport soudain de CO et d'oxygne des cellules de O. carboxydovorans dclenche une formation immdiate de NADH qui est inhibe par la rotnone. Les agents dcouplants suppriment la rduction en NADH, ainsi que les inhibiteurs de l'ATPase, tandis que l'antimycine A n'a pas d'effet 11. Aucune rduction directe de NAD+ par le flux d'lectrons en provenance de CO n'est observe, mais les intermdiaires obligs sont les cytochromes b561 et b558. L'inhibition exerce par les agents dcouplants sur le courant d'lectrons inverse montre bien que le potentiel de membrane est indispensable l'opration. Le courant d'lectrons inverse nest plus ncessaire au cours de la croissance htrotrophe, par exemple sur pyruvate. Des mesures ont montr que le flot des lectrons emprunte de prfrence la voie respiratoire sensible CO quand la croissance s'effectue sur CO2 + H2 ou sur pyruvate. Le rapport H+ /O, qui mesure la translocation de protons par atome d'oxygne, est de l'ordre de 6 dans les deux

11 - Rappels : la rotnone inhibe le complexe respiratoire de la NADH dshydrognase, alors que l'antimycine A agit sur l'tape bc1.

170

BIODGRADATIONS ET MTABOLISMES

cas. La croissance sur le seul CO est moins rapide avec un rapport H+/O qui tombe 4. Comme elle met contribution la voie respiratoire insensible CO, on peut supposer que celle-ci recharge galement le potentiel de membrane, mais qu'elle le fait moins efficacement. On constate une fois de plus la multiplicit des circuits nergtiques chez les bactries, leur offrant d'optimiser les oxydations, la production d'ATP et l'tablissement du potentiel membranaire au gr des conditions. Quelles sont les proprits de la CO dshydrognase des carboxydotrophes ? Chez Oligotropha carboxydovorans, l'enzyme a la structure (LMS)2, donc un dimre de trimres. Les trois gnes correspondants, cobx, cobs et col sont groups dans cet ordre sur un grand plasmide de 128 kb (pHCG3). Ils sont placs sur un segment de 30 kb prs des gnes du cycle de CALVIN et de ceux de l'hydrognase (hox). Un fort conservatisme de squence a t trouv avec d'autres espces [70]. Aprs limination du plasmide, O. carboxydovorans perd en mme temps la capacit d'oxyder CO et H2, et n'assimile plus CO2. Les sous-units L (88,7 kDa), M (30,2 kDa) et S (17,8 kDa) forment un complexe contenant une chane de transporteurs d'oxydorduction. Sur la base des squences, l'enzyme fait partie d'une famille d'hydroxylases molybdne [71].
chane M

FAD Fe/S MCD

chane S

chane L

CO dshydrognase de O. carboxidovorans
L'attaque du substrat se fait dans les sous-units M au niveau d'un cofacteur contenant le molybdne (molybdoptrine-cytosine dinuclotide ou MCD) de mme nature que celui que nous retrouverons bientt dans la rduction des nitrates. Les intermdiaires suivants sont deux noyaux [2Fe-2S] dsigns comme I et II (ils sont dans des environnements diffrents). Enfin une flavine, qui est le FAD, reoit les lectrons avant de les expdier aux transporteurs respiratoires. Le dispositif n'est pas sans analogie avec celui d'une autre molybdo-enzyme classique, la xanthine oxydase. Une particularit importante ici est la prsence du slnium dans le site actif. Celui-ci se trouve enfoui assez profondment dans la sous-unit L en mme temps que le cofacteur molybdne. La position exacte de Se dans la protine a t dtermine dans la structure obtenue par cristallographie [72]. Son rle catalytique dans l'oxydation de CO semble essentiel. Le slnium est port sur le soufre d'un rsidu de cystine modifie, la S-slanylcystine qu'il ne faut pas confondre avec la slnocystine, acide amin o le slnium remplace le soufre. Ici le slnium est surajout au soufre.

3 OXYDATIONS MINRALES
O VI Mo OH S O S

171
Se C S O
IV

= =

= =

MCD

S Mo OH O S

VI

O S Mo O C S O Se Se C O S H S

Mcanisme hypothtique de la CO dshydrognase


Le mcanisme est encore hypothtique. Il ferait passer Mo(VI) penta-coordonn Mo(IV) ttra-coordonn, avec participation du slnium sous forme de slnure de carbonyle SeCO. Nous retrouvons le slnium dans une oxydorduction concernant CO2 ou un carbonyle. D'autres exemples sont cits en glossaire. Grce cette chimie particulire, le monoxyde de carbone produit en quantit par nos moteurs ne s'accumule pas sur la plante, et l'on ne peut que s'en rjouir !

3.8 - DU SULFURE AU SULFATE


L'activit volcanique mondiale dverse sans cesse de grandes quantits de composs soufrs dans la biosphre, soit au cours des ruptions, soit par les fumerolles. Il y a dans le monde un peu plus d'une cinquantaine de volcans qui ont une ou plusieurs ruptions par an ou mme par jour (Stromboli). La majeure partie du soufre mis est sous forme de dioxyde de soufre (SO2), accompagn de H2S, de soufre lmentaire 12, de sulfure de carbonyle (COS), de disulfure de carbone (CS2) et de petites quantits de produits secondaires tels que AsS. L'estimation des quantits de SO2 annuelles mises est trs difficile mais serait au minimum de 9 11 millions de tonnes. Or l'activit industrielle humaine en rpandrait bien davantage, de l'ordre de 80 millions de tonnes par an. Une partie se retrouve l'tat d'acide sulfurique et peut atteindre la haute atmosphre ou participer aux pluies acides. Le soufre est prsent dans les constituants de la vie son niveau d'oxydorduction le plus bas, qui est celui de l'ion sulfure (S2), de l'hydrosulfure (HS) et de l'hydrogne sulfur (H2S). Les sulfures sont galement produits par l'activit des sulfatorducteurs, et sont dverss en abondance par la dcomposition de la matire vivante, animale ou vgtale. Ils sont pris en charge par des bactries qui les oxydent, soit en soufre lmentaire (S0), soit en produits plus oxyds jusqu' l'ion sulfate. Cette fonction est bnfique pour l'environnement, car les composs rduits du soufre sont toxiques faible dose pour les cellules vivantes, et leur accumulation finirait par dvaster toute la biosphre !

12 - Certains volcans mettent de la vapeur de S qui se condense en dpts importants. Le Kawah Ijen, l'Est de Java, prsente une fontaine de soufre liquide mise 225C, se solidifiant en masses compactes qui sont exploites. Le volcan porte 2280 m d'altitude un vaste lac de cratre contenant de l'acide chlorhydrique et sulfurique un pH de 0,3 ! Parmi d'autres volcans connus pour leur soufre est le Chicn au Mexique.

= =

172
S2 sulfure 2 e S soufre 2 e SSO32 thiosulfate 4 e 2 e 2 e

BIODGRADATIONS ET MTABOLISMES
SO32 sulfite 2 e SO42 sulfate

[O3SS2SO3]2
ttrathionate

Il faut un dpart de 8 lectrons pour passer du sulfure au sulfate, et ces oxydations se font le plus souvent en arobiose, notamment par les bactries du genre Thiobacillus. Les bactries phototrophes oprent un cheminement similaire en anarobiose. Le passage inverse du sulfate au sulfure est pratiqu par les organismes sulfato-rducteurs anarobies examins dans un chapitre ultrieur. Ces conversions dans un sens ou dans l'autre fonctionnent dans le cycle naturel du soufre, o des tapes effectues en prsence d'oxygne alternent avec des phases ralises en son absence, comme dans le cycle du carbone mettant en jeu le mthane et le gaz carbonique. Le pouvoir d'oxyder le soufre et ses drivs n'est pas l'apanage d'un groupe taxonomique particulier. On peut distinguer au moins trois ensembles de bactries capables de pratiquer ces oxydations. Les phototrophes anarobies forment un premier groupe. Ces bactries pourpres ou vertes se servent de soufre rduit comme source d'lectrons pour faire marcher leur photosynthse, mais nous les laisserons de ct ici. Par contre les chimio-autotrophes (ou chimio-litho-autotrophes) sont parmi les plus importants. Ils assimilent le gaz carbonique en utilisant l'nergie de l'oxydation des sulfures, du soufre ou du thiosulfate par O2. Le terme ultime de ces oxydations est gnralement l'ion sulfate. Le genre Thiobacillus occupe une place minente dans ce deuxime groupe de bactries. Un troisime groupe rassemble les chimio-htrotrophes qui pratiquent les mmes oxydations, mais ont besoin d'une source de carbone organique. Le genre Thiobacillus renferme toute une gamme d'espces exclusivement autotrophes, mais qui se distinguent par leurs caractres physiologiques. Thiobacillus thioparus, T. neapolitanus et T. denitrificans se dveloppent de prfrence un pH proche de la neutralit. Le dernier a en outre la facult de rduire le nitrate en nitrite et N2, processus appel dnitrification et fonctionnant en absence d'O2. C'est, en somme, une espce pouvant passer de la respiration classique sur O2 une respiration anarobie sur nitrate, le substrat oxyd tant du sulfure, du soufre, du thiosulfate Ces germes remarquables sont en mme temps des autotrophes. Cette proprit, qui consiste assimiler CO2 par le cycle de CALVIN, s'accompagne d'inclusions caractristiques appeles carboxysomes*. Une autre srie du genre Thiobacillus rassemble des espces se dveloppant pH acide (optimum de 2 4 : T. acidophilus, T. thiooxidans, T. ferrooxidans) ou mme trs acide (jusqu' 1, T. prosperus). T. ferrooxidans peut se dvelopper en tirant son nergie de l'oxydation du fer ferreux. Parmi les chimio-htrotrophes figurent des espces trs diffrentes par leurs caractres morphologiques et physiologiques. Ces bactries gnralement aquatiques sont moins acidophiles que les prcdentes. Les Beggiatoa et Cytophaga

3 OXYDATIONS MINRALES

173

sont mobiles par glissement. Les premiers se dveloppent dans les eaux sulfureuses, les eaux douces avec des plantes en dcomposition, les rizires et les sdiments marins. Les Cytophaga sont importants dans l'puration des eaux uses, attaquent la cellulose, la chitine et autres polymres, corrodent le bois. Les bactries du genre Thiothrix forment des colonies de filaments. La physiologie de ces espces est imparfaitement connue et prsente de grandes variations en fonction des conditions, mais ce sont des espces "tout-terrain". Celles qui attaquent les sulfures accumulent des granules de soufre intracellulaires qui leur servent de rserve de substance oxyder en fonction d'un changement du milieu. Cette proprit adaptative est commune dans le genre Thiobacillus. La diversit des aptitudes physiologiques rgle la rpartition des espces dans le temps et dans l'espace. Elles se succdent en fonction de l'puisement du substrat, de l'acidit du milieu lie la production de H2SO4, des changements de temprature, de l'vaporation Il en rsulte une certaine stratification des espces dans les sdiments et dans le sol. Dans les conditions physiologiques habituelles, le sulfure est surtout prsent comme hydrosulfure (HS), le sulfite comme hydrosulfite (HSO3). Voici un tableau donnant les potentiels redox des diffrents couples l'tat standard et pH neutre [73] : Couple Sulfate/Hydrosulfite Thiosulfate/Hydrosulfure + Hydrosulfite Soufre lmentaire/Persulfure d'hydrogne Soufre lmentaire/Hydrosulfure Persulfure d'hydrogne/sulfure d'hydrogne Hydrosulfite/Hydrosulfure Hydrosulfite/Soufre lmentaire Ttrathionate/Thiosulfate Forme physiologique SO42/HSO3 S2O32/HS + HSO3 2 S /H2S2 S /HS
0 0

E' (mV) 516 402 340 270 200 116 38 + 24

H2S2/2 H2S HSO3/HS HSO3/S0 S4O6 /S2O3


2 2

Ces potentiels standards sont comparer avec celui du couple form par l'oxygne et l'eau (+ 820 mV), mais ils ne sont que des points de repre, puisque les valeurs relles dpendent du rapport entre formes oxyde et rduite, et sont gnralement trs diffrentes ! Du sulfure ou de l'hydrosulfure au sulfate, il y a donc deux sauts nergtiques majeurs, le plus important tant celui de l'oxydation de l'hydrosulfite au sulfate puisque le potentiel du couple correspondant est trs bas, soit 516 mV. Les lectrons sont canaliss jusqu' O2 par la chane respiratoire qui comporte ici une quinone et au moins un cytochrome c. La rduction de l'oxygne se fait par une cytochrome c oxydase cbb3, l'homologue du cytochrome aa3 des mitochondries [74]. Les oxydases terminales de ce type sont des pompes protons, et aident l'tablissement du potentiel membranaire (p) [75].

174
HS 2 e S 4 e cytochromes respiratoires SO32 2 e

BIODGRADATIONS ET MTABOLISMES
SO42

2 O2 + 8 H+

cbb3

4 H2O

Parmi les interconversions entre produits soufrs se placent des intermdiaires qui sont des oxydes complexes du type thiosulfate, trithionate, ttrathionate et polythionates. Ces produits sont placs comme des voies de garage ou des variantes sur le chemin qui va du sulfure au sulfate. Certaines sont des oxydorductions, d'autres des hydrolyses. Prs de la moiti des espces bactriennes vivant de l'oxydation des sulfures et du soufre peuvent se dvelopper sur ttrathionate, un substrat d'emploi commode au laboratoire. L'interconversion entre thiosulfate (S2O32) et ttrathionate (S4O62) se fait par la thiosulfate dshydrognase priplasmique utilisant le cytochrome c comme donneur ou accepteur chez Thiobacillus W5 [76], selon : 2 S2O32 + 2 cytochrome c (Fe3+) S4O62 + 2 cytochrome c (Fe2+) (1)

Chez Thiobacillus acidophilus, des hydrolases permettent de mtaboliser le ttrathionate et le trithionate selon les modles suivants [77] : Pour le ttrathionate : S4O62 + H2O S2O32 + S0 + SO42 + 2 H+ Pour le trithionate : S3O6
2

(2) (3)

+ H2O S2O

2 3

+ SO4 + 2 H

Les bactries responsables sont tenues de s'adapter des conditions trs changeantes et modifient leurs proprits en consquence. L'limination rapide des sulfures excdentaires est un facteur essentiel dans l'environnement. Les sulfures sont toxiques pour de nombreux micro-organismes, et leur accumulation dans les sdiments freine les biodgradations. En les oxydant trs activement, un Thiobacillus peut engorger son mtabolisme respiratoire et y fait face en stockant provisoirement du soufre lmentaire [78] ou en dirigeant une partie du soufre vers le thiosulfate et le ttrathionate, qui jouent en quelque sorte le rle de rservoir tampon. Cette activit bactrienne est un facteur important d'acidification du milieu. Elle entrane des phnomnes de corrosion dans les canalisations et distributions industrielles partout o il y a apport de soufre ou de sulfures. Thiobacillus caldus se dveloppe en culture 45C et pH trs acide (2,5), sur ttrathionate 5 mM comme source d'nergie. La source carbone est apporte par barbotage d'air enrichi en gaz carbonique [79]. L'oxydation des composs soufrs en sulfate est ralise en grande partie ou en totalit par des enzymes cytoplasmiques, l'exception du passage thiosulfate (S2O32) vers le ttrathionate (S4O62) qui a lieu dans le priplasme. Comme le milieu extrieur est trs acide relativement au cytoplasme, les cellules doivent pomper les substrats soufrs vers l'intrieur et y consacrer de l'nergie. Des diffrences importantes de localisation

3 OXYDATIONS MINRALES

175

et de fonctionnement des enzymes semblent exister d'une espce l'autre et la question devient vite ardue. L'oxydation du sulfure ou de l'hydrosulfure en S0 se fait typiquement par un flavocytochrome , constitu de deux sous-units ingales contenant le FAD et l'hme C. La sulfure dshydrognase chez Thiobacillus W5 fonctionne un pH optimum de 8,6 alors que le pH extrieur est acide [80] ! L'archtype de ces flavocytochromes fut l'origine celui de Chromatium vinosum, un phototrophe anarobie qui utilise prfrentiellement le sulfure comme source d'lectrons pour faire marcher sa photosynthse. L'enzyme de Pyrococcus furiosus, un hyperthermophile, contient 2 FAD et plusieurs noyaux fer-soufre de nature diffrente [81]. D'autres espces oxydent le sulfure sans se servir d'un flavocytochrome. Cependant la plupart des formes qui se dveloppent sur thiosulfate en possdent un qui pourrait avoir d'autres fonctions selon une hypothse avance par FRIEDRICH [82]. L'oxydation du sulfite (ou d'hydrosulfite) en sulfate se fait par deux mthodes. La premire est une oxydation directe catalyse par la sulfite oxydase, ou sulfite : cytochrome c oxydorductase (EC 1.8.2.1), ou encore SOR. La seconde se fait en deux tapes par l'APS rductase (1.8.99.2) suivie de l'ADP sulfurylase. Ces terminologies un peu compliques cachent des oprations simples. La premire (l'oxydation directe) est la plus rpandue et correspond la raction : HSO3 + 1/2 O2 SO42 + H+ (4)

L'enzyme est priplasmique. Elle n'est pas propre aux bactries. Elle figure dans l'espace inter-membranaire des mitochondries animales o elle a t trs tudie. On continue l'appeler sulfite oxydase bien que le vritable accepteur dans tous les cas examins ne soit pas l'oxygne mais un cytochrome c (l'oxygne n'intervient donc qu'en aval). L'enzyme contient du molybdne au sein d'une molybdoptrine (MPT), et fait donc partie de la famille des molybdo-enzymes. Le molybdne passe par plusieurs niveaux d'oxydorduction, Mo(IV), Mo(V) et Mo(VI), identifiables en RPE. La sulfite oxydase a t purifie rcemment partir de Thiobacillus novellus cultiv pH 8,5 sur carbonate de sodium et thiosulfate [83]. L'enzyme possde deux sous-units ingales de 40 et 8 kDa. La premire renferme la molybdoptrine, la seconde est un cytochrome c552. L'ensemble fonctionne comme une seule et mme molcule pouvant stocker 3 lectrons, deux sur le mtal, un seul sur le cytochrome.
HSO3 + H2O SO42 + H+

Mo(VI) Fe(III)

Mo(IV) Fe(III)

Mo(V) Fe(II) cyt. c Fe(III)

Mo(V) Fe(III) cyt. c Fe(II)

Mo(VI) Fe(II) cyt. c Fe(III) e

Mo(VI) Fe(III) cyt. c Fe(II) e

Oxydation du sulfite

176

BIODGRADATIONS ET MTABOLISMES

L'oxydation d'une molcule de sulfite n'apporte que 2 lectrons, dchargs un par un la sortie comme l'indique le dessin. Un cytochrome c550 indpendant du prcdent est laccepteur, et se roxyde sur la chane respiratoire. Observons un petit dtail significatif : l'oxydation de l'hydrosulfite, qui est proton Ph neutre, libre un proton avec le sulfate dans le priplasme, opration qui facilite l'acidification de la surface externe de la membrane cytoplasmique et contribue son potentiel lectrochimique. La deuxime mthode d'oxydation du sulfite passe par l'APS avec conservation de l'nergie sous forme d'ADP ou d'ATP. Elle se fait en deux tapes.
APS adnosine-5'-phosphosulfate O O O O OH O N N NH2 N N APS rductase HSO3 + AMP ADP sulfurylase APS + phosphate

O=S O P O CH2

APS + 2e

OH

ADP + SO42

La premire est une oxydation par l'APS rductase (EC 1.8.99.2), mieux connue chez les bactries assimilatrices du sulfate (qui font la raction inverse). L'examen des squences laisse supposer que la rductase conserve des similitudes chez toutes les bactries qui catalysent une oxydorduction entre sulfate et APS, que ce soit dans un sens ou dans l'autre [84]. La structure est celle d'un htrodimre comportant une flavine (FAD) et deux noyaux [4Fe-4S]. Quand la biosphre s'est enrichie en O2 dans un pass lointain, les arobies auraient rcupr un modle ancien dj en service chez les anarobies. L'norme accumulation du sulfate dans l'eau de mer, o il atteint une concentration de 28 mM, a t favorise au cours de l'histoire de la terre par l'activit des organismes photosynthtiques utilisant les sulfures comme sources d'lectrons. Les oxydations arobies voques ici seraient donc apparues ultrieurement. La deuxime conversion est catalyse par l'ADP sulfurylase (EC 2.7.7.4), elle libre le sulfate et de l'nergie sous forme d'ADP (par sa liaison pyrophosphate haut potentiel). La raction correspond en somme la mobilisation de l'nergie produite au cours de la formation de l'APS. Deux molcules d'ADP (des sous-ATP !) sont facilement traites par une raction classique dite de l'adnylate kinase ou myokinase : 2 ADP ATP + AMP. Un mcanisme analogue se retrouvera chez les sulfato-rducteurs mais fonctionnera en sens inverse. L'ADP sulfurylase de Thiobacillus denitrificans a t tudie en dtail.
AMP-S E + AMP-S (= APS) E E AMP E ADP E + ADP

SO42

phosphate

"ADP sulfurylase"

3 OXYDATIONS MINRALES

177

Son fonctionnement comporte la formation d'une liaison covalente transitoire entre l'enzyme (E) et l'APS [85]. Diffrents arguments tirs de l'emploi des inhibiteurs comme l'arsniate montrent que les tapes dsignes par les flches noires sont irrversibles. L'enzyme ne peut donc pas revenir en arrire et faire de l'APS avec du sulfate et de l'ADP. Le schma ci-dessus reste pourtant valable en remplaant le phosphate par du pyrophosphate et le produit de la raction est alors l'ATP ! C'est pourquoi BRSER et coll. ont propos d'appeler cette enzyme, non pas ADP sulfurylase, mais ATP sulfurylase. Ce n'est pas une simple subtilit de nomenclature, parce que la sulfurylase ressemble d'autres enzymes qui fonctionnent aussi avec l'ATP ou un triphosphate, et il est possible et mme probable que ce soit la vritable raction physiologique. L'enzyme est inhibe exprimentalement par le molybdate (Mo42) qui intervient comme analogue du sulfate. C'est un inhibiteur caractristique de cette tape du cycle du soufre. Il agit aussi bien chez Thiobacillus et les phototrophes, qui oxydent le soufre, que chez les sulfato-rducteurs oprant en sens inverse. La rcupration de l'nergie ATP par l'intermdiaire de l'APS apporte donc aux bactries un bnfice essentiel au cours de l'oxydation du sulfite en sulfate. En rsum l'oxydation du sulfite en sulfate est productrice d'nergie de deux faons diffrentes. La premire utilise la sulfite oxydase et repose sur une translocation de protons contribuant la formation d'un potentiel membranaire. La seconde privilgie l'apparition d'ADP ou d'ATP, et se fait en deux tapes, celles de l'APS rductase et de l'ADP(ATP) sulfurylase.

3.9 - LIMINATION DE COMPOSS SOUFRS SIMPLES


Il y a d'normes quantits de produits soufrs dans l'atmosphre, mais pour une fois l'homme n'est pas le principal responsable de cette pollution. Il s'agit pour prs de la moiti du dimthyl-sulfure (DMS), accompagn de H2S, de sulfure de mthyle (ou mthanethiol) et du dimthyl-disulfure (DMDS). Ces produits tirent leur origine de deux sources principales, la mthionine (l'acide amin entrant dans la composition des protines) et le dimthylsulfonium-propionate ou DMSP. L'environnement renferme galement une foule de composs secondaires, comme le thiocyanate (S=C=N), les isothiocyanates (RN=C=S), et des glucosinolates forms par les plantes.
H3CSH H3C CH3 H3C CH3 H3C H3C S+(CH2)2COO

SS

Mthanethiol

DMS

DMDS

DMSP

Le DMSP est produit par le phytoplancton marin, les algues de la zone des mares et les gramines littorales du genre Spartina. Ce produit agirait comme rgulateur physiologique de la pression osmotique en milieu salin et comme cryoprotecteur

178

BIODGRADATIONS ET MTABOLISMES

quand l'azote est limitant. Il aurait aussi le rle d'un agent anti-oxydant [86] ou de dfense contre les prdateurs (crustacs, protozoaires). Le prcurseur du DMSP chez l'algue verte Enteromorpha intestinalis est la mthionine [87]. L'attaque prpondrante du DMSP se fait par une lyase qui libre de l'acrylate et du dimthylsulfure (DMS). L'oxydation du DMSP produit aussi du dimthylsulfoxyde (DMSO).
COS H2SO4 SO2 CH3SO3H oxydations H3C CH3 oxydation photosynthsique rduction H 3C CH3 S DMS mthylation oxygnation rduction

CH3SH

DMDS

O DMSO

DMSP

H2C=CHCO acrylate

CH4

H2S

CO2

Les voies du dimthyl-sulfure


Le petit tableau montre quelques conversions du dimthyl-sulfure (DMS). Le DMSP est la source principale de DMS, qui nat galement de la rduction du DMSO par des sulfato-rducteurs. La quantit de DMS mise annuellement dans l'atmosphre est estime 45 millions de tonnes de soufre [88]. La concentration en DMSP et DMS peut atteindre 1 M et davantage dans les tapis de cyanobactries et les marais sals. Ils sont abondants dans les coraux, les algues, les diatomes et certaines plantes. La surface de la mer, l o elle est riche en phytoplancton, est sature en DMS car celui-ci est trs peu soluble et volatil comme l'ther (il bout 36C). Sa prsence confre l'eau de mer une odeur perceptible et son origine est surtout biologique. Par oxydation photochimique dans l'atmosphre, il engendre du sulfure de carbonyle, du dioxyde de soufre, de l'acide sulfurique et de l'acide mthane-sulfonique, ainsi que des produits mineurs. Toute augmentation des produits oxyds du soufre comme l'acide sulfurique, soit la suite d'une pollution d'origine humaine, soit au cours d'ruptions volcaniques, est responsable de pluies acides. L'introduction d'arosols d'acide sulfurique dans la haute atmosphre a aussi pour consquence d'intercepter une part de rayonnement solaire et d'avoir des rpercussions climatiques, car il se forme des noyaux de condensation l'origine d'une nbulosit. L'quilibre radiatif gnral de la biosphre est donc concern. L'mission de DMS et la production d'acide sulfurique suggre une relation inattendue entre l'activit du plancton ocanique et le climat ! Le Thiobacillus thioparus et bactries de la mme srie sont capables d'oxyder divers substrats soufrs, DMS, DMDS, mthanethiol, en tirant leur nergie la fois de l'oxydation de la partie carbone et de celle de la partie soufre [89]. Il y a plusieurs voies d'oxydation par O2. La premire, qui est l'oxydation en dimthylsulfoxyde (DMSO) est intressante sur le plan biologique, car le DMSO est un accepteur d'lectrons dans des respirations dites anarobies, o l'oxygne est remplac par le nitrate, le sulfate et d'autres composs. L 'oxydation du DMS en DMSO

3 OXYDATIONS MINRALES

179

est pratique aussi en anarobiose par les bactries phototrophes non oxygniques qui s'en servent comme source d'lectrons. La deuxime voie d'oxydation utilise successivement la dimthyl-sulfure mono-oxygnase et la mthanethiol oxydase. Ces enzymes catalysent respectivement les ractions : Dimthyl-sulfure + O2 + NADH mthanethiol + formaldhyde + NAD+ + OH Mthanethiol + O2 + H2O H2S + formaldhyde + H2O2 (1) (2)

Ces ractions ont t observes chez les bactries appartenant aux genres Thiobacillus et Hyphomicrobium [90]. Le formaldhyde est pris en charge par le mtabolisme monocarbon utilisant le FH4*, et l'eau oxygne est dtruite par la catalase. Une variante de la raction (2) repose sur une mthyltransfrase et la formation de mthyl-FH4. Ces oxydations biologiques du DMS sont compltes par l'action photochimique faisant natre dans l'atmosphre un produit stable, l'acide mthanesulfonique (CH3SO3H), qui est entran par la pluie et la neige ou qui se dpose avec la poussire. Des bactries mthylotrophes spcialises peuvent le rcuprer comme source de carbone et d'nergie l'aide d'une mthanesulfonate mono-oxygnase [91]. Le DMS est galement mtabolis en H2S par anarobiose, et les mthanognes le transforment en mthane. Le sulfure d'hydrogne est nouveau mthylable en DMS, et il existe donc un cycle faisant alterner le DMS, le mthanethiol et le H2S. Nous le retrouverons au Chapitre 7. Et l'activit humaine l-dedans ? La contamination biologique de l'atmosphre en disulfure de carbone (CS2) par le sol et les plantes a t estime 5 millions de tonnes de soufre, et l'activit industrielle, principalement la fabrication de viscose et de cellophane, introduirait un million de tonnes supplmentaires. La plus grande partie de la pollution soufre vient du raffinage du ptrole, de la combustion des carburants utiliss pour le transport (malgr les progrs raliss pour dsulfurer l'essence et le gazole), de l'industrie minire et mtallurgique et des appareils de chauffage. Cette pollution est surtout sous forme de SO2 et contribue l'apparition du smog au-dessus des grandes mtropoles humaines (Los Angeles, Pekin, Mexico) En rsum, on a pu constater que le cycle du soufre a des ramifications complexes dans la biosphre. Nous n'avons abord ici que la partie des oxydations. Les plus importantes traitent des produits simples comme l'hydrosulfure et accumulent des ions sulfate ou de l'acide sulfurique. Le dimthyl-sulfure est pour l'essentiel d'origine biologique et donne lieu un chass-crois de ractions d'une varit surprenante. Les organismes responsables n'ont pas tous t rpertoris et il reste beaucoup dcouvrir sur la varit des enzymes impliques.

3.10 - L'OXYDATION DU FER ET DU MANGANSE


De nombreuses espces bactriennes tirent leur nergie de l'oxydation l'air du fer et du manganse. Les "bactries du fer" oxydent le fer ferreux en fer ferrique.

180

BIODGRADATIONS ET MTABOLISMES

Certaines espces oxydent aussi les sulfures et le soufre. Les ractions sont reprsentes par : 4 Fe2+ + O2 + 4 H+ 4 Fe3+ + 2 H2O S2 + 2 O2 SO42 2 S + 3 O2 + 2 H2O 2 SO4
0 2

(1) (2)

+ 4H

(3)

Parmi celles-ci, Gallionella ferruginea et Leptothrix ochracea sont des habitants communs des sources ferrugineuses et font d'importants dpts d'hydroxyde de fer grce la raction (1). Les Gallionella ont une morphologie curieuse : leurs cellules en forme de haricot excrtent une matrice organique dans laquelle les hydroxydes de fer prcipitent, formant des filaments torsads de 50 nm de diamtre. Les Leptothrix et Sphaerotilus s'entourent de gaines tubulaires dans lesquelles s'accumulent des oxydes de fer et de manganse. Les sources thermales renferment des espces voisines.

Gallionella ferruginea

Sphaerotilus

Ces organismes sont souvent adapts des eaux trs pauvres en lments nutritifs. Les Gallionella ont une Rubisco indicatrice d'un cycle de CALVIN assurant l'autotrophie. Ils sont en fait mixotrophes, car ils peuvent se fournir la fois en CO2 et en sources carbones organiques (glucose, fructose, saccharose). Ce sont des espces difficiles cultiver. En culture are contenant du sulfure, les bactries peuvent tirer tout leur carbone de CO2. Les premires cultures de G. ferruginea ont t obtenues 20-25C par une technique dite de KUCERA et WOLFE [92]. Leur dveloppement est trs lent au-dessous de 12 et leur croissance est arrte au-dessus de 30 (comme il arrive souvent pour les bactries du sol). Ces bactries sont micro-arophiles et croissent un pH optimum de 6,5. Contrairement Gallionella, les Leptothrix et Sphaerotilus n'assimilent pas CO2 et vivent en stricte htrotrophie. Nous savons que les bactries du genre Thiobacillus ont une importance conomique considrable, car elles interviennent dans la dsulfuration des rejets et des hydrocarbures, ainsi que dans les oprations minires. La vedette revient Thiobacillus ferrooxidans. Cette espce fortement acidophile est autotrophe et peut vivre dans des conditions extrmes, soit pH 2-3 et en prsence de concentrations mtalliques trs fortes. Sa tolrance pour le cadmium, le zinc et le cuivre atteint des concentrations proches de la molarit. Elle rsiste au cobalt (0,15 M), au chrome (75 mM), au plomb (1mM) et aux sels mercuriques (10 M). Elle rsiste

3 OXYDATIONS MINRALES

181

aussi un niveau lev d'ions sulfate (0,15 M). Ce germe extraordinaire assimile donc CO2 et tire son nergie de l'oxydation du fer et des sulfures par le dioxygne laide des ractions (2) et (3). Le fer sous forme ferrique se comporte lui-mme comme oxydant du sulfure et de quelques oxydes mtalliques. Le sulfure de fer le plus abondant dans la nature tant la pyrite (FeS2), la raction thorique peut s'crire : 14 Fe3+ + FeS2 + 8 H2O 15 Fe2+ + 2 SO42 + 16 H+ (4) L'oxydation du fer de la pyrite libre sur ce principe donc de grandes quantits d'acide raison de 16 protons par mole. La teneur leve de la pyrite en soufre fait qu'elle n'est pas un bon minerai de fer. La pyrite cde gnralement la place d'autres formes minralogiques (voir Fer*). En principe, l'oxydation du fer ferreux en fer ferrique correspond un potentiel redox standard Ph 7 de + 770 mV. Cette valeur leve est proche de celle du couple O2/H2O (+ 820 mV), laissant supposer que le saut nergtique utilisable par Thiobacillus pour sa croissance sur le fer est faible. Cependant l'ion Fe3+ forme des hydroxydes insolubles par raction sur l'eau : Fe(OH)2+, Fe(OH)3, ou Fe(OH)4. Cette proprit et l'apport d'acide dplacent l'quilibre d'oxydorduction correspondant la raction (1) vers la droite, favorisent l'oxydation du fer ferreux et abaissant le potentiel correspondant. Donc en l'absence de sulfure oxyder, la raction (1) est plus mme de fournir l'nergie aux bactries, en particulier si le milieu s'acidifie. La prsence de pyrite ou de sulfure produit normment d'acide (raction 2). La chute du pH des valeurs proches de 2 ou au-dessous dissocie en partie les hydroxydes de fer, mais favorise la raction (4) vers la droite, produisant davantage d'acidit et rgnrant galement du fer ferreux disponible pour la raction (1). Il y a donc un cycle d'une partie du fer entre les deux ractions (1) et (4). En les combinant ainsi (par multiplication des coefficients) : 28 Fe2+ + 7 O2 + 28 H+ Le bilan rsultant est : 2 FeS2 + 7 O2 + 2 H2O 2 Fe2+ + 4 SO42 + 4 H+ (5) 28 Fe3+ + 14 H2O (1') (4') 28 Fe3+ + 2 FeS2 + 16 H2O 30 Fe2+ + 4 SO42 + 32 H+

La raction (5) nous claire sur l'activit de Thiobacillus ferrooxidans comme espce minire. Le pH acide lui permet d'amorcer une oxydation du fer. Celui-ci va lui servir mobiliser la pyrite, avec production d'acide sulfurique et de fer ferreux, entrans l'un et l'autre par lessivage. En fait la bactrie utilise ici surtout l'nergie de l'oxydation l'air du sulfure, une source d'nergie relativement confortable ! Comme l'ion ferreux est facilement roxyd par les bactries ou mme spontanment par O2, il y aura toujours assez de fer pour ramorcer l'oxydation de la pyrite en cas de besoin. Une partie du fer ainsi mobilis tend former des oxydes et hydroxydes insolubles ds que l'acide est limin, et il en rsulte des dpts ferrugineux importants appels jarosite, alors que l'acide form rend corrosives et polluantes les eaux de lessivage.

182

BIODGRADATIONS ET MTABOLISMES

Sur le plan enzymatique, on dispose de quelques renseignements sur la S-Fe(III) oxydorductase de T. ferrooxidans. L'enzyme a t purifie [93] et parat attache la membrane du ct du priplasme. Les renseignements sur son fonctionnement restent trs fragmentaires. Les ions ferriques sont capables d'oxyder divers ions et oxydes mtalliques. Par exemple l'oxyde d'uranium(IV) de l'uraninite ou pechblende (UO2) est solubilis en uranium(VI) : UO2 + 2 Fe3+ UO22+ + 2 Fe2+ (6)

Les bactries roxydent le fer par un va-et-vient qui favorise ainsi la solubilisation de l'oxyde d'uranium. Le mme principe peut tre appliqu d'autres minerais, grce l'alternance entre l'tat oxyd et l'tat rduit du fer et l'entranement des mtaux par l'acide form. Ces ractions ont conduit au dveloppement de ce qu'on appelle la biolixiviation. Avec Thiobacillus et bactries apparentes, il est ainsi possible de rcuprer du cuivre partir de minerais faible teneur ou de dchets miniers. Le cuivre est tir de plusieurs minraux dont la chalcopyrite (CuFeS2) et la chalcosine (Cu2S). Un procd du mme type a t utilis pour l'extraction d'autres mtaux comme l'or. Voici un schma de principe de l'extraction du cuivre par lixiviation 13 :
minerai sulfate ferrique

I. raction entre sulfate de fer et chalcopyrite, formant du sulfate de cuivre

air II. le fer rduit le sulfate de cuivre minerai lessiv fer prcipit de cuivre III

fermenteur Thiobacillus

L'opration reprsente comporte trois phases. En (I), la chalchopyrite est traite en prsence de sulfate ferrique, qui est rduit en sulfate ferreux avec solubilisation du cuivre en sulfate : 2 Fe2(SO4)3 + CuFeS2 + 2 H2O + 3 O2 CuSO4 + 5 FeSO4 + 2 H2SO4 (7)

13 - Schma imit de Microbiologie par PRESCOTT, HARLEY et KLEIN (DEBOECK)

3 OXYDATIONS MINRALES

183

En (II), le mlange acide soluble, contenant CuSO4 et FeSO4, est pass sur un lit de fer mtallique qui procde la rduction du sulfate de cuivre et la prcipitation du mtal : CuSO4 + Fe FeSO4 + Cu (8)

En (III), les bactries sont l'uvre dans un fermenteur contenant un milieu nutritif acide et ar, aliment par le sulfate de fer. Celui-ci est oxyd en Fe2(SO4)3 par les bactries. Il est rcupr et recycl. Le pilotage de ce type d'extraction reste dlicat dans la pratique en fonction de la nature du minerai. Thiobacillus commence gnralement par oxyder prfrentiellement le sulfure avant le fer, ce qui retarde la biolixivation. Des auteurs japonais ont prconis un procd par flottation o les bactries qui adhrent aux particules de pyrite l'tat divis tendent couler au fond de la suspension et facilitent l'limination des impurets par flottation [94]. Et le manganse ? Cet lment est abondant et se rencontre principalement l'tat de Mn(II) soluble ou de formes oxydes insolubles Mn(II) et Mn(III). Le dioxyde de manganse MnO2 est un solide brun et la forme la plus stable dans l'environnement. Le cycle d'oxydorduction du manganse dans la nature est en partie parallle celui du fer. Nous en aurons une indication dans un chapitre ultrieur, o les deux mtaux apparatront comme des accepteurs respiratoires. Une particularit des oxydes de manganse est leur pouvoir oxydant sur divers lments minraux et organiques. En outre MnO2 peut vhiculer d'autres mtaux : Cd, Cu, Co, Zn. Le Mn(II) engendr par rduction est roxyd par de nombreuses espces bactriennes, par exemple par les Leptothrix dj mentionns. L. discophora se caractrise par la double prcipitation d'oxyde de Fe et de Mn dans la gaine qui l'entoure. Le manganse s'oxyde de deux faons dans la nature, soit par une raction spontane acclre en milieu alcalin, soit par action enzymatique. La prcipitation des oxydes par Leptothrix rsulte de l'action d'une protine de 110 kDa excrte par les cellules. Cette enzyme a t caractrise ds 1987 et prsente des similitudes avec les oxydases renfermant plusieurs ions cuivre [95]. L'oxydation du manganse parat gnralement ralise par une cuproprotine, tudie chez Pseudomonas putida, une espce commune qui a l'avantage d'tre plus facile manipuler exprimentalement. Chose curieuse, certains Bacillus marins font des spores qui oxydent les ions Mn2+ et s'entourent d'un prcipit de dioxyde, mais l'isolement de l'enzyme partir des spores s'est avr difficile. L'oxydation du manganse parat jusqu' prsent toujours sous la dpendance d'oxydases contenant du cuivre et inhibes par l'azoture (ou azide) qui est un inhibiteur classique des cuproprotines. Ce problme a t revu assez rcemment par FRANCIS et TEBO [96]. Il a des prolongements vers la circulation d'autres mtaux dans l'environnement, puisque MnO2 peut les oxyder son tour, ou adsorber sa surface diffrents radionuclides et mtaux toxiques, facilitant leur limination dans le traitement des eaux ou autres oprations de dpollution. La circulation des mtaux dans l'environnement est une question importante qui claire certains cycles naturels, et cette question trouvera son prolongement au Chapitre 14.

184

BIODGRADATIONS ET MTABOLISMES

3.11 - CYANURE - CYANATE - THIOCYANATE


Le cyanure a la rputation d'tre un poison violent et figure habituellement sous forme d'anion CN. L'acide correspondant qui est le cyanure d'hydrogne (HCN) a un pKa de 9,3, et l'anion domine largement pH physiologique. La solution de cyanure de potassium pH 7 est instable cause de sa dissociation et de la perte de HCN. Celui-ci est volatil et moins dense que l'air, il s'limine rapidement dans l'atmosphre o sa concentration devient trs dangereuse 300 ppm. Mais l'quilibre entre HCN et l'anion est facilement dplac en faveur du second qui est fortement nuclophile. Il agit comme complexant des mtaux (Ni, Fe, Cu, Zn, Au) et donne des cyanohydrines avec les groupes carbonyles. On sait que le cyanure se fixe facilement sur les ferriporphyrines des cytochromes, notamment dans la cytochrome oxydase, ce qui en fait un poison mtabolique 14. Le cyanure est la fois un produit naturel et un polluant industriel. La production de cyanolipides ou de drivs glycosidiques des alpha-hydroxynitriles est trs rpandue dans le rgne vgtal. La production de ces drivs emprunte plusieurs voies partir d'acides amins par dcarboxylation et transformation de l'amine en nitrile. Leur hydrolyse par la -glucosidase provenant de champignons et de diverses espces bactriennes, dont Lactobacillus plantarum [97], libre le cyanure. Une raction intressante est la production de HCN par certaines bactries. Pseudomonas aeruginosa et P. fluorescens en font comme produit secondaire n'intervenant pas dans le mtabolisme central de la cellule [98]. L'enzyme responsable est une oxydase flavinique membranaire qui oxyde la glycine en CO2 et HCN. Ce systme est induit quand les bactries sont limites en oxygne et entrent en phase stationnaire. Quelle est la fonction de ce curieux dispositif ? Les produits du mtabolisme secondaire uvrent souvent comme armes de dfense ou de contrle de la concurrence. Quand il est produit par des Pseudomonas logs sur les racines des plantes, le cyanure est peut-tre un agent de lutte contre la multiplication des champignons. Cette fonction cologique possible reste vrifier. Les cyanures sont donc produits en continu et petite dose dans l'environnement. L'industrie en libre ventuellement des quantits considrables par les activits minires, le traitement des mtaux et la production de fibres synthtiques. Le cyanure ne s'accumule pas dans l'environnement, mais le danger des pollutions vient surtout des dversements brusques et abondants dans les rivires, avec leurs consquences catastrophiques pour la faune piscicole. L'organisme des mammifres est arm pour se dfendre contre les petites quantits de cyanure provenant de l'alimentation. L'enzyme de dfense est la rhodanse, qui est galement rpandue chez les micro-organismes, notamment les bactries de la photosynthse : Chromatiuvinosum, Rhodospirillum rubrum, Rhodobacter sphaeroides, Chlorobium limicola et d'autres. L'enzyme est une transfrase, prenant sur le

14 - L'action du cyanure sur la cytochrome oxydase mitochondriale a t dmontre pour la premire fois avant 1930 par WARBURG et KEILIN. Toxicit mortelle chez l'homme 1 mg par kg.

3 OXYDATIONS MINRALES

185

thiosulfate un atome de soufre (appel sulfane) pour le placer sur un accepteur. Si celui-ci est un cyanure, il est transform en thiocyanate : S2O32 + KCN SO32 + KSCN La dtoxication du cyanure est donc une des fonctions de la rhodanse. L'enzyme intervient aussi dans le mtabolisme des thiols, et ne serait pas tranger la formation des noyaux fer-soufre. La transformation du cyanure dans la nature est intressante et peut suivre plusieurs voies rsumes par ce schma [99] :
SCN thiocyanate

sulfite 1 2 H2O H+ HCOO + NH4+ 2 2 H2O 1. rhodanse 2. nitrilase 3. oxygnase 4. hydratase CN 4 HCONH2 formamide thiosulfate 3 NH4+ + CO2

O2 NADH 3H+

NAD+

Devenir du cyanure
Les ractions 2 et 3 permettent aux bactries de rcuprer l'azote sous forme ammoniacale. Le cyanure est alors utilis comme seule source d'azote pour une croissance assez lente. La raction 2 est catalyse par une nitrilase particulire (EC 3.5.5.1) dcrite chez Bacillus pumilus [100], Alcaligenes xylooxidans et un Pseudomonas [101]. Une formiate dshydrognase est induite en mme temps que la nitrilase et permet probablement de restaurer le NADH ncessaire la raction 3. La voie 4 est peut-tre une voie secondaire. La raction 3 de la cyanure oxygnase a t dcrite chez un Pseudomonas fluorescens et serait la plus importante [102]. Cette enzyme ressemble une dioxygnase, coupant O2 et incorporant les deux atomes dans le gaz carbonique. Elle fonctionne en fait comme une mono-oxygnase faisant parvenir seulement l'un des atomes d'oxygne au gaz carbonique, l'autre tant apport indirectement par l'eau. Le cheminement serait le suivant : CN + O2 + NADH + 2 H+ [XOH] + H2O + NAD+

(XOH tant un produit carbon et azot, qui pourrait tre HOCN). Cette monooxygnation obissant au modle standard serait suivie d'une hydrolyse : [XOH] + H2O CO2 + NH3 Une variante de l'oxygnation du cyanure (raction 3 du schma mtabolique) conduit HOCN ou cyanate, attaqu par la cyanase. Nous y reviendrons un peu plus loin. KUNZ et coll. ont dcouvert un phnomne curieux [103]. Ils ont cultiv les

186

BIODGRADATIONS ET MTABOLISMES

bactries sur cyanure avec une limitation en azote. La prsence du cyanure induit la mono-oxygnase. En observant la monte de celle-ci et la disparition du cyanure dans le milieu de culture de Ps. fluorescens, ils se sont aperus qu'il n'y avait pas de concordance dans le temps. Une partie du cyanure disparaissait indpendamment de l'activit enzymatique induite. Ils ont constat en outre que les bactries excrtaient des oxoacides (pyruvate et 2-oxoglutarate), lesquels formaient avec le cyanure des cyanohydrines. Le cyanure se retrouvait alors pig non enzymatiquement par ces oxoacides l'extrieur de la cellule. On a pu voir que les cyanohydrines pouvaient servir de substrats azots, mais que leur utilisation tait soumise la prsence de l'oxygnase. Ce phnomne fait sans doute office de protection. La toxicit du cyanure dans le milieu est contrecarre par l'action des oxoacides. Les cyanohydrines sont prises l'intrieur de la cellule, mtaboliss avec rcupration du carbone et de l'azote tout la fois. Il y a sans doute hydrolyse de ces cyanohydrines et libration de cyanure qui est trait son tour par l'oxygnase. Cependant les modalits exactes restent dterminer, ainsi que le vaet-vient d'oxoacides d'un compartiment l'autre. La nature de l'oxygnase est inconnue, mais il s'agit peut-tre d'une mtallo-enzyme comme les autres oxygnases.
CN RCCOO OH mb

HCN + RCOCOO

RCCOO + CO2 + NH3 NADH O2 oxygnase

assimilation

Revenons maintenant au cyanate (HOCN) 15. Ce produit peut rsulter d'une monooxygnation du cyanure (1), prcdant une raction sur bicarbonate (2) ou d'hydrolyse (3) par la cyanase (EC 4.2.1.104). CN + O2 + NADH + H+ N=C=O + H2O + NAD+ N=C=O + HCO3 + 2 H+ 2 CO2 + NH3 N=C=O + H2O + H
+

(1) (2) (3)

CO2 + NH3

On pense gnralement que la transformation de HCN en cyanate n'est pas une raction mtabolique importante, alors que la cyanase est une enzyme trs rpandue. Pourquoi ? La formation de N=C=O rsulterait surtout de la dcomposition spontane de l'ure et du carbamyl-phosphate*, et n'aurait la plupart du temps rien voir avec le cyanure. Le rle de la cyanase serait donc de maintenir dans la cellule un niveau suffisamment faible de cyanate pour tre tolr. La cyanase peut aussi mieux faire. E. coli K12 est muni d'une cyanase catalysant la raction (2). Elle est produite par l'opron cynTSX et inductible par l'azoture (ou azide, N3) [104]. Cette enzyme CynS lui permet de se multiplier sur cyanate comme seule source azote ! La protine CynT code par le mme opron est une

15 - Les questions de terminologie sont rappeles en glossaire cyanate*.

3 OXYDATIONS MINRALES

187

anhydrase carbonique dont le rle est peut-tre de rhydrater le gaz carbonique en bicarbonate pour approvisionner la cyanase. Le thiocyanate donne lieu un problme similaire. N de la raction du soufre sur le cyanure, il est moins toxique que celui-ci, tout en tant un polluant de l'industrie chimique. Le thiocyanate a aussi une origine botanique. De nombreuses plantes fabriquent des glucosinolates (thioglucosides) qui sont trs rpandus chez les Crucifres. Par exemple la consommation de chou fait apparatre du thiocyanate dans le sang et dans la salive. L'hydrolyse de ces produits libre du thiocyanate en mme temps par la rhodanse. La dgradation du thiocyanate emprunte plusieurs voies. L'une d'elles a t analyse chez Thiobacillus thioparus, un chimio-lithotrophe capable de tirer son nergie du thiocyanate. Des auteurs japonais [105] ont mis en vidence une thiocyanate hydrolase transformant le substrat en sulfure de carbonyle (SCO) et ammoniac, selon un schma impliquant deux intermdiaires. La premire tape a des analogies avec l'hydratation d'un nitrile (RCN) et l'enzyme possde effectivement une homologie avec la famille des nitrilases. De faon gnrale les nitriles sont transforms en acide carboxylique par deux hydratations successives, la premire par la nitrilase formant l'amide, grce laquelle une amidase libre l'ammoniac.
H 2O
SC=N SCNH

H2O

NH3
SCOH

OH S=C=O sulfure de carbonyle

thiocyanate

Thiocyanate hydrolase
Une deuxime voie d'attaque du thiocyanate a t dcrite chez un Gram-ngatif non clairement identifi et dsign comme souche 26B. Elle est fonde sur une premire hydrolyse librant du sulfure et du cyanate [106]. Le soufre est oxyd en thiosulfate puis en ttrathionate, qui est souvent le produit terminal de cette voie. Le thiocyanate est un substrat tonnant en ce qu'il peut servir la fois de source d'nergie, de carbone, de soufre ou d'azote. Voil bien des possibilits pour une molcule aussi simple ! L'oxydation du thiocyanate en sulfate, CO2 et NH3 libre au total 8 lectrons. Les bactries capables de se dvelopper en autotrophie avec le thiocyanate comme donneur d'lectrons sont gnralement des Thiobacillus, notamment T. thioparus. Diffrentes catgories de bactries htrotrophes (Arthrobacter, Pseudomonas, Methylobacterium thiocyanatum) peuvent tirer leur azote du thiocyanate. Son attaque au cours de l'puration d'eaux lourdement contamines est faite par des associations bactriennes o dominent des germes tels que T. thioparus. L'utilisation du thiocyanate par des bactries capables de se dvelopper dans des milieux carbonats fortement alcalins contenants de l'actate (pH 10) a t dmontre rcemment [107] Ces bactries sont des associations d'autotrophes et d'htrotrophes qui accumulent du cyanate, apparemment la suite de l'hydrolyse du thiocyanate par la raction (3) indique prcdemment. Voici bien des possibilits et des transformations naturelles multiples qui auraient pu rester insouponnes !

188

BIODGRADATIONS ET MTABOLISMES

Que devient le SCO form ? Nous l'avons vu engendrer sous l'action de la thiocyanate hydrolase de Thiobacillus thioparus. Il se forme galement partir du disulfure de carbone (S=C=S). Ce compos mrite un bref dtour. Liquide dense non-miscible l'eau, inflammable et volatil, il est utilis dans l'industrie de la viscose 16 et comme solvant des rsines, caoutchoucs et graisses. Un Paracoccus denitrificans se dveloppe en autotrophie en utilisant comme source d'nergie du succinate, du thiosulfate ou du disulfure de carbone. Celui-ci est transform en sulfure de carbonyle par une oxygnase [108] Le devenir du SCO est en principe trs simple. T. thioparus l'hydrolyse en CO2 + H2S. Mais le plus tonnant est sa rduction par la nitrognase d'Azotobacter vinelandii, l'enzyme charge en principe d'assimiler en ammoniac le diazote atmosphrique. SCO + 2 e + 2 H+ H2S + CO L'un des produits de la raction est du monoxyde de carbone, dont la formation a t mise en vidence par spectroscopie ou en le pigeant avec l'hmoglobine [109]. La nitrognase est trs sensible la prsence d'O2 mais elle en est protge l'intrieur de la cellule par la grande activit des oxydations qui s'y droulent. La nitrognase fonctionne avec une ferrdoxine rduite comme source d'lectrons, et de l'ATP comme source d'nergie. La nitrognase peut rduire de toute faon les liaisons NN, NO, NC ou CC doubles ou triples. Elle accepte donc SCO comme substrat, mais le disulfure de carbone est un inhibiteur. Aprs rduction de SCO en CO, celui-ci est gnralement oxyd en CO2. Il est galement substrat de la mthane mono-oxygnase ! La liste des possibilits n'est pas close pour autant. On en veut pour preuve la dcouverte d'un mthylotrophe facultatif, Methylobacterium thiocyanatum, capable d'utiliser le cyanate comme seule source d'azote, et le thiocyanate comme seule source la fois d'azote et de soufre [110]. Ces bactries cultives sur mthanol possdent un taux lev d'hydroxypyruvate rductase et sont donc prsumes utiliser le cycle de la srine. Le thiocyanate serait transform en cyanate, qui est attaqu son tour par une cyanase trs active fonctionnant avec du bicarbonate comme substrat selon la raction (2) donne antrieurement. Cette discussion montre la fois la varit, la complexit des transformations affectant ces drivs, et l'intervention d'enzymes particulirement polyvalentes. Du cyanure au thiocyanate, isothiocyanate, nitriles, cyanohydrines, sulfure de carbonyle et disulfure de carbone, on ne se serait pas attendu une telle diversit d'interactions au sein de l'environnement.

16 - Raction de la cellulose traite par la soude avec le sulfure de carbone, donnant des acides xanthogniques de la cellulose (S=C(SH)OR, o R est un alcoyle), servant rgnrer la cellulose par traitement acide. CS2 se forme par raction trs endothermique du soufre sur le charbon 900C

3 OXYDATIONS MINRALES

189

CONCLUSION BRVE
Ce chapitre nous a fait passer en revue rapidement l'incroyable varit des oxydations biologiques par l'air touchant des molcules carbones, azotes, soufres et des lments mtalliques. Des transformations cycliques s'entrecroisent et brassent d'une manire essentielle la circulation des lments dans la biosphre sans laquelle les biodgradations, l'puration biologique, seraient impossibles. Les deux chapitres suivants viendront complter ce constat.

RFRENCES
[1] O W E N T (1982) J. Mol. Evol. 18 : 150-156. [2] S C H L E S S I N G E R G & Miller SL (1983) J. Mol. Evol. 19 : 376-382. [3] K A S T I N G JF (1993) Science 259 : 920-926. [4] B A T T L E M & coll. (1996) Nature 383 : 231-235. [5] B O E T I U S A, R A V E N S C H L A G K, S C H U B E R T C J, R I C K E R T D , W I D D E L F, G I E S E K E A, A M A N N R, J R G E N S E N BB, W I T T E U & P F A N N K U C H E O (2000) Nature 407 : 623-626. [6] H A N S O N RS & H A N S O N TE (1996) Microbiol. Reviews 60 : 430-471. [7] B E R G M A N N D J, Z A H N JA & D I S P I R I T O AA (1999) J. Bacteriol. 181 : 991-997. [8] N G U Y E N H H T & coll. (1994) J. Biol. Chem. 269 : 14995-15005. [9] Z A H N JA & D I S P I R I T O AA (1996) J. Bacteriol. 178 : 1018-1029. [10] L I U Y , N E I S H E I M JC , L E E S K & L I P S C O M B JD (1995) J. Biol. Chem. 270 : 24662-24665. [11] R O S E N Z W E I G AC , F R E D E R I C K C A, L I P P A R D S J & N O R D L U N G P (1993) Nature 366 : 537-543. [12] F O X BG & coll. (1989) J. Biol. Chem. 266 : 240-250 ; F O X BG , Y . L I U , D E G E JE & L I P S C O M B JD (1991) J. Biol. Chem. 266 : 540-550. [13] O L D E N H U I S R & coll. (1991) Appl. Environ. Microbiol. 55 : 3155-3161. [14] L E E S K & coll. (1993) J. Biol. Chem. 268 : 21569-21577; L I U Y , N E S H E I M JC , L E E S K & L I P S C O M B JD (1995) J. Biol. Chem. 270 : 24662-24665. [15] W I L K I N S PC , D A L T O N H , S A M U E L C J & G R E E N J (1994) Eur. J. Biochem. 226 : 555-560. [16] J A H N G D & W O O D TK (1994) Appl. Environ. Microbiol. 60 : 2473-2482. [17] H O L M E S AJ, C O S T E L L O A, L I D S T R O M ME, M U R R E L L JC & coll. (1995) FEMS Microbiol. Lett. 132 : 203-208. [18] M C T A V I S H H , F U C H S JA & H O O P E R AB(1993) J. Bacteriol. 175 : 2436-2444; B E R G M A N N D J & H O O P E R AB (1994) Biochem. Biophys. Res. Comm. 204 : 759-762. [19] S C H I E M K E AK & coll. (1995) Arch. Biochem. Biophys. 321 : 421-428. [20] V A N N E L L I T, L O G A N M, A R C I E R O D M & H O O P E R AB (1990) Appl. Environ. Microbiol. 56 : 1169-1171. [21] M E G R A W S R & K N O W L E S R (1989) Soil Biol. Biochem. 89 : 11-20.

190 [22] W O L F H J & H A N S O N RS (1980) J. Gen. Microbiol. 114 : 187-194; S A H A Y & C H E N M (1989) Natl. Acad. Sci. Lett. 12 : 373-376.

BIODGRADATIONS ET MTABOLISMES

[23] S C N E L L S & K I N G G M (1995) FEMS Microbiol. Ecol. Lett. 4 : 285-294; B E N D E R M & C O N R A D R (1995) Soil Biol. Biochem. 27 : 1517-1527. [24] G O O D W I N PM & A N T H O N Y C (1998) Adv. Microb. Physiol. 40 : 1-80. [25] D E V R I E S G E, A R F M A N N, T E R P S T R A P & D I J K H U I Z E N L (1992) J. Bacteriol. 174 : 5346-5353 ; H E K T O R H J, K L O O S T E R M A N H & D I J K H U I Z E N L (2002) J. Biol. Chem. 277 : 46966-46973. [26] B Y S T R Y K H LV, G O V O R U K H I N A NI, D I J K H U I Z E N L & D U I N E JA (1997) Eur. J. Biochem. 247 : 280-287. [27] K E M P MB & Q U A Y L E JR (1967) Biochem. J. 102 : 94-102; S T R O M T, F E R E N C I & Q U A Y L E JR (1974) Biochem. J. 144 : 465-476. [28] N E W M A N LP & W A C K E T T LM (1995) Biochemistry 34 : 14066-14076 ; S H I E L D S MS , R E A G I N MJ, G E R G E R RR, C A M P B E L L R & S O M E R V I L L E C (1995) Appl. Environ. Microbiol. 61 : 1352-1356 ; D I J K H U I Z E N L & coll. (1992) In "Methane and methanol oxidizers", M U R R E E L JC & D A L T O N H eds, Plenum Press, N.Y. [29] B O W M A N JP, S L Y LI & S T A C K E B R A N D T E (1995) Int. J. Syst. Bacteriol. 45 : 182-185. [30] D I S T E L D L & C A V A N A U G H C M (1994) J. Bacteriol. 176 : 1932-1938 ; D I S T E L D L & C A V A N A U G H C M (1995) Proc. Natl. Acad. Sci. 92 : 9598-9602. [31] W A C K E T T LP, B R U S S E A U G A, H O U S E H O L D E R S R & H A N S O N RS (1989) Appl. Environ. Microbiol. 55 : 2960-2964 ; E N S L E Y BS (1991) Annu. Rev. Microbiol. 45 : 283-299. [32] W I L K I N S PC , D A L T O N H & S A M U E L C J & G R E E N J (1994) Eur. J. Biochem. 226 : 555-560. [33] M O T O S U G I K, E S A K I N & S O D A K. (1982) J. Bacteriol. 150 : 522-527. [34] F I C H MW , G R A H A M D W , A R N O L D RG , A G A R W A L S K, P H L E P S P, S P E I T E L G E & G E O R G I O U G (1993) Appl. Environ. Microbiol. 59 : 2771-2776. [35] J A H N G D & W O O D TK (1994) Appl. Env. Microbiol. 60 : 2473-2482. [36] S H I E L D S M.S . & coll. (1991) Appl. Environ. Microbiol 57 : 1935-1941; S H I E L D S MS , R E A G I N MJ, G E R G E R RR, C A M P B E L L R & S O M E R V I L L E C (1995) Appl. Environ. Microbiol. 61 : 1352-1356. [37] J E F F E R S PM, W O L F E NL, N Z E N G U N G V (1998) Geophys. Res. Lett. 25 : 43-46. [38] H A R P E R D B, H A R V E Y BMR , J E F F E R S MR & K E N N E D Y JT (1999) New Phytol. 142 : 5-17. [39] R H E W RC , M I L L E R BJ & W E I S S RF (2000) Nature 403 : 292-294. [40] H A R P E R D B, H A R V E Y BMR , J E F F E R S MR & K E N N E D Y JT (1999) New Phytol. 142 : 5-17. [41] H A R P E R D B (1993) Biogenesis and metabolic role of halomethanes in fungi and plants. In Metal Ions in Biological Systems, S I G E L H & S I G E L A eds, Marcel Dekker, New York : 345-388 ; H A R P E R D B & H A M I L T O N JTG (1988) J. Gen. Microbiol. 134 : 2831-2839. [42] V A N P E E KH (2001) Arch. Microbiol. 175 : 250-258. [43] W U O S M A A AM & H A G E R LP (1990) Science 249 : 160-162. [44] W O L F A R T H G & D I E K E R T G (1997) Curr. Opin. Biotecnol. 8 : 290-295.

3 OXYDATIONS MINRALES [45] V A N N E L L E T, S T U D E R A, K E R T E S Z M & L E I S I N G E R T (1998) Appl. Environ. Microbiol. 64 : 1933-1936 ; V A N N E L L E T,M E S S M E R M, S T U D E R A, V U I L L E U M I E R S & L E I S I N G E R T (1998) Proc. Natl. Acad. Sci. 96 : 4615-4620. [46] M C A N U L L A C , W O O D A L L C A, M C D O N A L D IR, S T U D E R A, V U I L L E U M I E R S , L E I S I N G E R T & M U R R E L L JC (2001) Appl. Environ. Microbiol. 67 : 307-316. [47] C H I S T O S E R D O V A L, V O R H O L T JA, T H A U E R RK & L I D S T R O M ME (1998) Science 281 : 99-102. [48] M I L L E R L G , K A L I N RM, M C C A U L E Y S E, H A M I L T O N JT, H A R P E R D B, M I L L E T D B, O R E M L A N D RS & G O L D S T E I N AH (2001) Proc. Natl. Acad. Sci. 98 : 5833-5837. [49] B U T L E R JH (2000) Nature 403 : 260-261. [50] M A C F A R L A N D (1992) Proc. Natl. Acad. Sci. 89 : 807-811. [51] O R E M L A N D RS , L O N E R G A N D J & C U L B E R T S O N C W , L O V L E Y D R (1996) Appl. Environ. Microbiol. 62 : 1818-1821. [52] K R O N E UE & T H A U E R RK (1992) FEMS Microbiol.Lett. 90 : 201-204. [53] L E E RB, P U R V E S JV, R A T T C L I F F E RG , S A K E R LR (1992) J. Exp. Bot. 43 : 1385-1396 ; F E N T E M PA, L E A PL & S T E W A R T G R (1983) Plant Physiol. 71 : 502-506. [54] K R O N Z U C K E R H J, S I D D I Q I Y & G L A S S AD M (1997) Nature 385 : 59-61 ; S T A R K JM & H A R T S C (1997) Nature 385 : 61-64. [55] H O L M E S AJ, C O S T E L L O A, L I D S T R O M ME & M U R R E L L JC (1995) FEMS Microbiol. Lett. 132 : 203-208. [56] J U L I E T T E LA, H Y M A N MR & A R P D J (1993) Appl. Environ. Microbiol. 59 : 3718-3727 et 3728-3735. [57] I G A R A S H I N, M O R I Y A M A N, F U J I W A R A H , F U K U M O R I T & T A N A K A Y , (1997) Nature Struct. Biol. 4 : 276-284. [58] I V E R S O N TM, A R C I E R O D M H S U BT, L O G A N MS P , H O O P E R AB & R E E S D C (1998) Nature Struct. Biol. 5 : 1005-1012. [59] H O M M E S NG , S A Y A V E D R A - S O T O LA & A R P D J (2001) J. Bacteriol. 183 : 1096-1100. [60] F U K U O K A M, F U K U M O R I Y & Y A M A N A K A T (1987) J. Biochem. (Tokyo) 102 : 525-530. [61] Y A M A N A K A T & F U K U M O R I Y (1988) FEMS Microbiol. Rev. 4 : 259-270.

191

[62] J U R E T S C H K O S , T I M M E R M A N N G , S C H M I D M, S C H L E I F E R K- H , P O M M E R E N I N G - R S E R A, K O O P S H P & W A G N E R M (1998) Appl. Environ. Microbiol. 64 : 3042-3051. [63] B A R T O S C H S , H A R T W I G C , S P I E C K E & B O C K E (2002) Microbial Ecol. 43 : 26-33. [64] A N D R E W S JH & H A R R I S RF (1986) Adv. Microbiol. Ecol. 9 : 99-147. [65] V A N D E G R A A F AA, M U L D E R A, D E B R U I J N P, J E T T E N MS N , R O B E R T S O N LA & K U E N E N JG (1995) Appl. Environ. Microbiol. 61 : 1246-1251 ; S T R O U S M, K U E N E N JG & J E T T E N MS N (1999) Appl. Environ. Microbiol. 65 : 3248-3250. [66] L I N D S A Y MR, W E B B RI, S T R O U S M, J E T T E N MS , B U T L E R MK, F O R D E RJ & F U E R S T JA (2001) Arch. Microbiol. 174 : 413-429. [67] D A M S T JS S , S T R O U S M, R I J P S T R A W IC , H O P M A N S EC , G E E N E V A S E N JAJ , V A N D U I N AC T , V A N N I F T R I K LA & J E T T E N MS M (2002) Nature 419 : 708-712. [68] C Y P I O N K A H & M E Y E R O (1983) J. Biol. Chem. 156 : 1178-1187.

192 [69] J A C O B I T Z S & M E Y E R O (1986) Arch. Microbiol. 145 : 372-377. [70] M. K R A U T & coll. (1989) Arch. Microbiol. 152 : 335-341. [71] H I L L E R (1996) Chem. Rev. 96 : 2757-2816.

BIODGRADATIONS ET MTABOLISMES

[72] D O B B E K H , G R E M E R L, M E Y E R O & H U B E R R (1999) Proc. Natl. Acad. Sci. 96 : 8884-8889. [73] T H A U E R RK, J U N G E R M A N N K & D E C K E R K (1977) Bacteriol. Rev. 41 : 100-181 ; B I T T E R E R H , cit par B R U N E D C (1989) Biochim. Biophys. Acta 975 : 189-221. [74] O H JI & K A P L A N S (1999) Biochemistry 38 :2688-2696. [75] D E G I E R JW , S C H E P P E R M, R E I J N D E R S W N, V A N D Y C K S J, S L O T B O O M D J, W A R N E A, S A R A S T E M, K R A B K, F I N E L M, S T O U T H A M E R AH , V A N S P A N N I N G RJ & V A N D E R O O S T J (1996) Mol. Microbiol. 20 : 1247-1260. [76] V I S S E R JM, D E J O N G G AH , R O B E R T S O N LA & K U E N E N JG (1996) Arch. Microbiol. 166 : 372-378. [77] M E U L E N B E R G R, P R O N K JT, F R A N K J, H A Z E U W , B O S P & K U E N E N JG (1992) Eur. J. Biochem. 209 : 367-374. [78] V I S S E R JM, R O B E R T S O N LA, V A N V E R S E V E L D H K & K U E N E N JG (1997) Appl. Environ. Microbiol. 63 : 2300-2305. [79] H A L L B E R G KB, D O P S O N M, L I N D S T R M B (1996) J. Bacteriol. 178 : 6-11. [80] V I S S E R JM, D E J O N G G AH , R O B E R T S O N LA & K U E N E N JG (1997) Arch.Microbiol. 167 : 295-301. [81] H A G E N W R, S I L V A PJ, A M O R I M MA, H A G E D O O R N PL, W A S S I N K H , H A A K E R H & R O B B FT (2000) J. Biol. Inorg. Chem. 5 : 527-534. [82] F R I E D R I C H C G (1998) Adv. Microbiol. Physiol. 39 :235-289. [83] K A P P L E R U, B E N N E T T B, R E T H M E I E R J, S C H W A R T Z G , D E U T Z M A N N R, M C E W A N AG & D A H L C (2000) J. Biol. Chem. 275 : 13202-13212. [84] F R I T Z G , B U C H E R T T, H U B E R H , S T E T T E R KO & K R O N E C K PM (2000) FEBS Lett. 473 : 63-66. [85] B R S E R T, S E L M E R T & D A H L C (2000) J. Biol. Chem. 275 : 1691-1698. [86] S U N D A W , K I E B E R D J, K I E N E RP & H U N T S M A N S (2002) Nature 418 : 317-320. [87] G A G E D A, R H O D E S D , N O L T E KD , H I C K S W A, L E U S T E K T, C O O P E R AJL & H A N S O N AD (1997) Nature 387 : 891-894. [88] K E L L Y D P & S M I T H NA (1989) Adv. Microbiol. Ecol. 11 : 345-385. [89] S M I T H NA & K E L L Y D P (1988) J. Gen. Microbiol. 134 : 3031-3039. [90] D E B O N T JAM , V A N D I J K E N JP & H A R D E R W (1981) J. Gen. Microbiol. 127 : 315-323 ; S U Y L E N G MH , L A N G E PJ, V A N D I J K E N JP & K U E N E N JG (1987) J. Gen. Microbiol. 133 : 2989-2994 ; V I S S C H E R PT & T A Y L O R BF (1993) Appl. Environ. Microbiol. 59 : 3784-3789. [91] K E L L Y D P & M U R R E L L JC (1999) Arch. Microbiol. 172 : 341-348. [92] K U C E R A S & W O L F E RS (1957) J. Bacteriol. 74 : 344 ; H A L L B E C K L, S T A H L T & P E D E R S E N K (1993) J. Gen. Microbiol. 139 : 1531-1535. [93] S U G I O T, M I Z U N A S H I W , I N A G A K I K & T A N O T (1987) J. Bacteriol. 169 : 4916-4922. [94] N A G A O K A T, O H M U R A N & S A I K I H (1999) Appl. Environ. Microbiol. 65 : 3588-3593. [95] A D A M S LF & G H I O R S E W C (1987) J. Bacteriol. 169 : 1279-1285 ; B O O G E R D RC & D E V R I N D JPM (1987) J. Bacteriol. 169 : 489-494 ;

3 OXYDATIONS MINRALES C O R S T J E N S PLA M, D E V R I N D JPM , G O O S E N T & D E V R I D - D E J O N G EW (1997) Geomicrobiol. J. 14 : 91-108. [96] F R A N C I S C A & T E B O BM (1999) J. Mol. Biotechnol. 1 : 71-78. [97] L E I V, A M O A - A W U A W K & B R I M E R L (1999) Int. J. Food Microbiol. 53 : 169-184. [98] B L U M E R C & H A A S D (2000) Arch. Microbiol. 173 : 170-177. [99] K U N Z D A, N A G A P P A N O , S I L V A - A V A L O S J & D E L O N G G T (1992) Microbiology 140 : 1705-1712. [100] M E Y E R S PR, R A W L I N G S D E, W O O D S D R & L I N D S E Y G G (1993) J. Bacteriol. 175 : 6105-6112. [101] W H I T E JM, J O N E S D D , H U A N G D & G A U T H I E R JJ (1988) J. Ind. Microbiol. 3 : 263-272. [102] H A R R I S RE & K N O W L E S C J (1983) J. Gen. Microbiol. 129 : 1005-1011 ; W A N G C S , K U N Z D A & V E N A B L E S BJ (1996) Appl. Environ. Microbiol. 62 : 2195-2197. [103] K U N Z D A, C H E N JL & G U A N G L I A N G P (1998) Appl. Environ. Microbiol. 64 : 4452-4459. [104] L A M B L I N AF & F U C H S JA (1994) J. Bacteriol. 176 : 6613-6622. [105] K A T A Y A M A Y , M A T S U S H I T A Y , K A N E K O M, K O N D O M, M I Z U N O T & N Y U N O Y A H (1998) J. Bacteriol. 180 : 2583-2589. [106] S T R A T F O R D J, D I A S AE, K N O W L E S C J (1994) Microbiology 140(Pt 10) : 2657-2662. [107] S O R O K I N D Y , T O U R O V A TP, L Y S E N K O AM & K U E N E N JG (2001) Appl. Environ. Microbiol. 67 : 528-538. [108] J O R D A N S L, M C D O N A L D IR, K R A C Z K I E W I C Z - D O W J A T AJ, K E L L Y D P, R A I N E Y FA, M U R R E L L JC & W O O D AP (1997) Arch. 168 : 225-236. [109] S E E F E L D T LC , R A S C H E ME & Ensign SA (1995) Biochemistry 34 : 5382-5389. [110] W O O D AP, K E L L Y D P, M C D O N A L D IR, J O R D A N S L, M O R G A N TD , K H A N S , M U R R E L L JC & B O R O D I N A E (1998) Arch. Microbiol. 169 : 148-158.

193

CHAPITRE 4 HYDROGNE - ACTATE - MTHANE


Ce chapitre concerne des transformations qui se droulent pour l'essentiel l'abri de l'air. L'hydrogne, l'acide actique et le mthane reprsentent un important courant de matire dans la biosphre, et sont des intermdiaires incontournables de la chimie de l'environnement. Des mcanismes biochimiques indits sont mis en jeu. Une part importante de ce chapitre sera consacr la synthse du mthane, gaz effet de serre, dont le mcanisme dtaill a t dmont rcemment. Les organismes responsables sont probablement parmi les plus anciens dans l'histoire de la vie, bien avant la monte de l'oxygne atmosphrique et le dveloppement des oxydations arobies. 4.1 - Hydrogne et hydrognases 4.2 - Les hydrognases sont rgules 4.3 - Bactries actognes 4.4 - La gense du mthane 4.5 - Les tapes de la mthanognse 4.6 - Lnergie de lhtrodisulfure rductase 4.7 - De lacide actique au mthane 4.8 - Mthanognes et biodgradations 4.9 - Hydrognosomes 197 201 205 213 218 227 229 232 235

4 HYDROGNE - ACTATE - MTHANE


Ce chapitre concerne des transformations qui se droulent pour l'essentiel l'abri de l'air. L'hydrogne, l'acide actique et le mthane reprsentent un important courant de matire dans la biosphre, et sont des intermdiaires incontournables de la chimie de l'environnement. Ce ne sont pas les seuls, mais nous commenons par ceux qui sont probablement parmi les plus anciens dans l'histoire de la vie, bien avant la monte de l'oxygne atmosphrique et le dveloppement des oxydations arobies.

4.1 - HYDROGNE ET HYDROGNASES


Les hydrognases mtabolisent l'hydrogne molculaire selon l'quilibre rversible thorique : H2 2H+ + 2e selon le potentiel standard E' = 430 mV ( pH 7).

Les lectrons sont fournis ou capts par un donneur ou un accepteur selon le sens dans lequel fonctionne la raction. Dans la raction de gauche droite, l'hydrogne diatomique est scind sur un mtal de faon htrolytique en ion hydrure et proton (H2 H + H+). L'oxydation porte sur l'hydrure, qui met le deuxime proton et deux lectrons. En tant rversible, ce mcanisme provoque un change de deutrium entre H2 et D2 et entrane la formation de HD. L'oxydation de l'hydrogne s'effectue selon trois modes privilgis. Le premier utilise typiquement O2 comme accepteur par l'intermdiaire d'une chane respiratoire. De nombreuses espces bactriennes chimio-lithotrophes en tirent de l'nergie, et sont d'ailleurs souvent des autotrophes, c'est--dire utilisatrices de CO2 comme seule source de carbone. Le second mode est celui des bactries phototrophes anarobies utilisatrices de H2 comme source d'lectrons pour l'assimilation de CO2, la source d'nergie principale tant videmment la lumire. Enfin le troisime mode s'observe chez les bactries mthanognes qui peuvent employer H2 comme source d'lectrons dans la rduction de CO2 en mthane. La raction inverse aboutit la formation d'hydrogne. Elle s'observe dans diverses ractions de fermentation o H2 apparat comme produit conjointement d'autres entits qui sont des composs organiques et CO2. Comme nous l'avons constat, la production d'hydrogne correspond l'vacuation d'un excdent de pouvoir rducteur. C'est pourquoi elle peut s'observer galement chez les phototrophes, quand labondance d'nergie lumineuse engendre un excs de pouvoir rducteur par rapport aux cibles assimiler, comme CO2 ou N2. Il y a

198

BIODGRADATIONS ET MTABOLISMES

donc un vritable cycle de l'hydrogne dans la nature faisant alterner consommation et production. Ces deux volets mettent en lice des enzymes distinctes, qui sont presque toutes des protines fer-soufre. Celles qui consomment H2 sont des hydrognases [NiFe] renfermant du nickel, parmi lesquelles certaines ont aussi du slnium, les hydrognases [NiFeSe]. Les secondes produisent de l'hydrogne, n'ont ni slnium ni nickel, et sont les hydrognases [Fe]. Une revue rcente sur ce sujet a t publie par P.M. VIGNAIS et A. COLBEAU [1]. Les hydrognases sont donc des enzymes essentiellement procaryotiques. Elles n'appartiennent pas qu'aux bactries effectuant des fermentations car elles s'observent chez les phototrophes, les actognes, les rducteurs des composs soufrs, du nitrate et du fumarate, ainsi que chez les archaebactries mthanognes. De faon gnrale les hydrognases occupent une position centrale dans le mtabolisme anarobie, probablement depuis les temps les plus anciens de l'volution biologique. Malgr sa participation essentielle la chimie de l'environnement, l'hydrogne molculaire ne s'accumule jamais forte concentration. On peut y voir plusieurs explications. La premire est la proprit du gaz H2 de diffuser trs rapidement et de s'chapper dans l'atmosphre. Ensuite l'hydrogne est un excellent carburant pour les oxydations biologiques, et se voit trs avidement consomm au fur et mesure de sa production. Enfin l'hydrogne est lui-mme toxique ds que sa concentration s'lve, en abaissant exagrment le potentiel redox du milieu et en freinant les fermentations. La production biologique de H2 est nanmoins une perspective bien tentante pour l'obtention d'un carburant nrgtique propre, dont la combustion ne produit que de l'eau. Des recherches ont t entreprises dans ce sens depuis la crise ptrolire des annes 70. La difficult d'obtenir de l'hydrogne en grande quantit et bas prix l'aide de cultures biologiques est un obstacle important. Il n'a pas t renonc cet objectif pour autant. En particulier des micro-algues telles que les Chlamydomonas pourraient devenir des outils intressants pour cela [2]. Les hydrognases [NiFe] sont communment priplasmiques ou membranaires. Les premires analyses structurales [3] ont port sur les bactries appartenant au genre Desulfovibrio, o la rduction des ions sulfate peut s'effectuer partir de l'hydrogne comme source d'lectrons. La complexit de ces enzymes contraste avec la simplicit de la raction catalyse. On y rencontre deux sous-units ingales, L et S (de 60 et 28 kDa respectivement), plusieurs centres fer-soufre et des ligands inattendus [4] comme CO, et CN. Le nickel est li quatre rsidus de cystine par les atomes de soufre et fait partie avec le fer dun centre bi-mtallique. Une tude phylogntique dtaille sur la base des squences et des fonctions permis de distinguer au moins 4 groupes diffrents dans ces enzymes [5]. La figure montre larchitecture des deux parties de l'hydrognase de Desulfovibrio vulgaris. La petite sous-unit S contient trois centres fer-soufre (dont deux [4Fe-4S] de part et d'autre d'un [3Fe-4S]), formant comme un fil conducteur partir du domaine N-terminal jusqu'au site catalytique de la sous-unit partenaire. La structure de S ressemble celle d'une flavodoxine*, et l'on pense que les lectrons partent de ce ct sur un accepteur qui serait une ferrdoxine.

4 - HYDROGNE - ACTATE - MTHANE

199

fer nickel

chane S

noyaux Fe/S

site catalytique

chane L domaine N-terminal

Hydrognase NiFe de Desulfovibrio vulgaris


Du volume important de travaux dj consacrs aux hydrognases [NiFe] par les mthodes gntiques, cintiques et physiques, le plus tonnant est sans doute la structure du site catalytique contenant du nickel et du fer. L'enzyme contient galement un ion magnsium dont la fonction est inconnue. La rupture de la molcule de H2 par oxydation se fait probablement au niveau du fer et des ligands trs spciaux qu'il porte figurs sur le dessin. La structure hypothtique est celle de l'enzyme oxyde, les mtaux tant ponts par le soufre appartenant deux rsidus de cystine. Des remaniements dans la coordination des deux mtaux et les ponts soufrs auraient lieu au cours de loxydorduction. Dans l'enzyme oxyde de D. gigas, un atome d'oxygne occuperait la position X entre le fer et le nickel.
O Fe S x S Ni S S C C C Cys Cys

O Cys

Cys

La grande sous-unit renferme un ion magnsium li spcifiquement la chane polypeptidique. Dans l'enzyme au repos, les deux mtaux sont l'tat Fe(II) et Ni(II) [6] et passent l'tat Fe(II) et Ni(III) au cours du cycle. En bref, l'hydrogne subirait une coupure htrolytique en H et H+ sur le fer. Celui-ci retiendrait l'hydrure (H) en laissant partir le proton capt par l'un des thiolates Cys-S qui entourent le nickel. Comme le cycle ractionnel nest pas encore totalement tabli, nous le laisserons de ct, mais il est certain que les deux mtaux collaborent pour oxyder l'hydrure en H+ + 2e. La structure dtaille de l'enzyme a montr la prsence d'un chemin pour l'arrive de H2, l'expulsion des deux protons successifs, la canalisation des lectrons vers la petite sous-unit. Les centres [4Fe-4S] fonctionnent bas potentiel (vers 350 mV), alors que le [3Fe-4S] qui les spare a un potentiel plus lev ( 35 mV). C'est une nigme de plus dans cette mcanique sophistique. Le

200

BIODGRADATIONS ET MTABOLISMES

noyau [3Fe-4S] n'existe pas dans toutes les hydrognases homologues, et certains auteurs pensent mme qu'il n'a aucune fonction essentielle. Une nouvelle hydrognase appartenant un type particulier (HupUV) [7] a t mise en vidence dans le cytoplasme de Rhodobacter capsulatus. Elle sert de systme de dtection et de rgulation command par l'hydrogne gazeux. noter que les enzymes [NiFe] appartiennent plusieurs classes et participent une varit de fonctions physiologiques. Certaines dshydrognases sont associes dautres protines lies la membrane pour former un complexe avec des dshydrognases liant NAD(P)+ ou du F420 (mthanognes, Section 5). Cest un sujet vaste et complexe qui soulve une grand intrt 1. Le slnium des hydrognases [NiFeSe] fait partie de la slnocystine*, une cystine dguise o le slnium remplace le soufre. La slnocystine prend la place d'un rsidu de cystine li au nickel, dont la ractivit se verrait renforce par le voisinage du slnium. Ces hydrognases qui ont une structure trs voisine de celle des [NiFe], sont rpandues chez les bactries sulfato-rductrices et les archaebactries. part la prsence de cette slnocystine, il y a quelques diffrences avec les [NiFe]. Le fer remplace le magnsium aperu dans la sous-unit L de l'enzyme prcdente, et le noyau [3Fe-4S] de la petite sous-unit est remplac par un [4Fe-4S]. La structure de l'hydrognase [Ni/Fe/Se] chez Desulfomicrobium baculatum a t dtermine [8]. La comparaison avec l'hydrognase nickel et fer mais sans slnium montre que l'organisation reste sensiblement la mme. On y retrouve des ligands exotiques comme CO et CN fermement lis au mtal et identifis par des mthodes chimiques et spectroscopiques [9]. Avec ou sans slnium, les deux dshydrognases appartiennent visiblement la mme famille structurale. Les hydrognases [Fe], dites fer seul, diffrent totalement des prcdentes, malgr des analogies qui rsultent d'une volution convergente. Ces enzymes ont t analyses plus tardivement, car elles sont plus sensibles O2 et moins commodes manipuler. Elles sont fortement inhibes par le monoxyde de carbone et le nitrite. Ces hydrognases sont plus souvent productrices d'hydrogne molculaire que consommatrices. Les mieux connues sont maintenant celles de Clostridium pasteurianum et de Desulfovibrio desulfuricans 2. Les hydrognases [Fe] sont trs performantes dans les conditions optimales, et peuvent produire de 6000 9000 molcules de H2 par seconde 30C. C'est pourtant une machinerie complique, dont on connat maintenant la structure chez Clostridium [10]. Son hydrognase est cytoplasmique, n'a qu'une seule chane de 438 rsidus et contient 5 groupes fer-soufre, soit un [2Fe-2S], trois [4Fe-4S] et un "centre H" plus complexe contenant deux atomes de fer portant chacun des ligands CO et CN. Ces deux Fe sont lis la protine par des rsidus de cystine, et lun deux est li par cystine un centre [4Fe-4S]. Le lobe N-terminal, gauche du dessin, est la partie qui reoit les lectrons ncessaires la production de H2. L'enzyme de Desulfovibrio est

1 - Sur le plan fondamental bien sr, mais aussi dans les perspectives appliques pour produire lhydrogne ! 2 - Ces bactries ont donc la fois des hydrognases qui consomment de l'hydrogne, et d'autres qui en produisent. La localisation de ces enzymes dans la cellule n'est pas la mme et elles participent un cycle interne de l'hydrogne.

4 - HYDROGNE - ACTATE - MTHANE

201

localise dans son priplasme. Le centre H qui sy trouve est un peu diffrent du prcdent et les groupes [2Fe-2S] et [4Fe-4S] voisins manquent. Par contre l'enzyme a une sous-unit supplmentaire qui serait ncessaire son exportation dans le priplasme.
[4Fe-4S] S Fe Fe S S S Fe CO S Cys centre H [4Fe-4S] [2Fe-2S] CN Fe CO S Fe S CO Fe

2H+

CN

Nterm. Cterm.

H2

Hydrognase [Fe] de Clostridium pasteurianum


Imiter les performances des hydrognases [Fe], tel est le challenge pour le futur, et donne lieu des recherches de modlisation [11]. En somme les bactries nous montrent la voie pour fabriquer peut-tre des quantits inpuisables du carburant hydrogne. Ce rve deviendra-t-il ralit ?

4.2 - LES HYDROGNASES SONT RGULES


Le mtabolisme de l'hydrogne fait le lien entre divers secteurs de l'conomie cellulaire en conditions anarobies ou micro-arobies lorsque le potentiel redox est suffisamment bas. Les hydrognases rpondent des problmes prcis et ne sont synthtises que lorsque les conditions garantissent leur utilit. Les microorganismes ont souvent plusieurs hydrognases appartenant diffrents types, chacune d'elles tant adapte une situation particulire. L'oxydation de H2 peut alimenter en lectrons l'assimilation de CO2 en autotrophie, la rduction de l'azote en ammoniac, la rduction du nitrate, du fumarate, ou une gamme assez tendue d'accepteurs susceptibles d'intervenir en anarobiose.

202

BIODGRADATIONS ET MTABOLISMES

L'assemblage des hydrognases est sous la dpendance de nombreux gnes qui commandent la synthse des sous-units, leur maturation et leur transport (notamment pour les enzymes priplasmiques), l'acquisition et le transport des mtaux ainsi que l'insertion des groupes annexes tels que CO et CN. Voici par exemple la rgion gnomique dont dpend l'hydrognase [NiFe] de Rhodobacter capsulatus par les gnes hup (pour hydrogen uptake) :
hup W X hypF T U V S hup L C hup D FG H J K hyp AB R systme deux composants hydrognase HupR hyp C D E

Les loci hup et hyp de R. capsulatus


Les deux sous-units de hydrognase proprement dite sont codes par hupS et hupL. Le gne hupC code pour un cytochrome b, un accepteur d'lectrons associ hydrognase. Les trois gnes sont transcrits d'une seule pice partir d'un promoteur (petite flche), de telle sorte que les polypeptides correspondants sont synthtiss de faon concerte. Tous les autres gnes concernent des oprations de service ou de contrle. Les gnes hypF, hypAB, hypCDE sont concerns par le transport et l'introduction dans l'enzyme du nickel et du fer associs leurs ligands CO et CN. La protine HypB lie ce mtal et fonctionne comme une GTPase, tandis que HypC interviendrait dans la maturation de la sous-unit catalytique HupL de l'enzyme. HypF est apparemment responsable de l'introduction des groupes CO et CN dans le site catalytique de hydrognase. L'exportation des deux sous-units de l'hydrognase aprs assemblage et maturation se fait l'aide du systme Tat rcemment dcouvert. Il fait partie des mcanismes de transport chargs d'insrer diverses protines dans la membrane ou de les amener dans le priplasme [12]. Ces indications sommaires sont donnes titre d'exemple, les solutions pouvant varier d'une espce l'autre, mais elles permettent de raliser combien la mise en place d'une hydrognase fonctionnelle ncessite un vritable arsenal de moyens molculaires ! Le plus intressant revient aux gnes hupR, hupTUV. Ils dterminent des facteurs rgulateurs. L'activit hydrognase de R. capsulatus est forte en prsence de H2, grce la transcription des gnes hupSLC. C'est l'inverse quand H2 disparat du milieu. Il y a donc un mcanisme de dtection relatif la prsence ou non de H2. Cette fonction appartient HupU et HupV. Les deux polypeptides forment un complexe qui ressemble hydrognase HupSL par sa structure et ses proprits. Cest une deuxime hydrognase [13]. Les mutants dpourvus de HupUV conservent une forte activit hydrognase, mme quand il n'y a plus d'hydrogne dans le milieu. Que fait cette hydrognase rgulatrice ? Elle sert de capteur, un peu la manire d'une lectrode hydrogne. En prsence de H2, elle subit un changement de conformation qui est peru et transmis vers HupR, la protine qui va dcider si les gnes hupSLC seront transcrits ou non. Ce systme est un cas de rgulation deux composants, dont le principe est trs rpandu chez les bactries. On y voit une kinase et un rgulateur. La kinase est une protine qui se phosphoryle

4 - HYDROGNE - ACTATE - MTHANE

203

elle-mme sur histidine la suite de la rception d'un signal. Elle rejette alors son phosphate sur la deuxime protine, le rgulateur, qui s'associe l'ADN au voisinage des gnes dont il rgule la transcription. Toutes ces paires de protines prsentent des domaines conservs reconnaissables par des homologies de squence et des ressemblances structurales. La rgulation deux composants se fait donc ici par HupT (la kinase) et HupR (le rgulateur) [14]. Un dessin nous aidera comprendre le mcanisme [15]. Le complexe HupUV reconnat donc l'hydrogne. Il interagit avec la kinase HupT et lempche de sautophosphoryler en prsence de H2. En A, il n'y a pas d'hydrogne. Le facteur HupT est alors libre de sautophosphoryler sur histidine. Il phosphoryle son tour HupR et bloque ainsi son action comme activateur. En B, lautophosphorylation de HupT est empche. Comme la protine HupR n'est pas modifie, elle active la transcription des gnes hupSLC de l'hydrognase [16]. Cette opration est rversible parce que HupR non phosphoryle est une phosphatase qui hydrolyse la liaison du phosphate sur HupT, et cette action antagoniste de la phosphorylation autorise un rglage fin entre les deux actions contraires. Le systme de rgulation deux composants HupT/HupR se comporte de manire exceptionnelle, car dans les rgulations de ce type, cest gnralement la forme phosphoryle du rgulateur qui active la transcription, alors quici HupR-P fait linverse.
ADP ATP P P R hupSLC ARNm

T a
H2

T
R

U T

V U

T b V U V U

R transcription hupSLC

Rgulation de hup SLC


Cette cascade d'effets est donc place sous la dpendance de l'hydrogne et participe au contrle du potentiel redox de la cellule. R. capsulatus est une espce photo-autotrophe capable d'assimiler le dioxyde de carbone, de rduire l'azote atmosphrique et de faire une respiration sur O2. Cette dernire met contribution lhydrognase HupSL pour lancer des lectrons dans la chane respiratoire, et fournir ainsi de lnergie plusieurs chanes mtaboliques grce larobiose. Dans le mme temps les diffrentes activits sensibles loxygne comme lassimilation de lazote et la photosynthse sont freines. Cette situation est renverse au cours de lanarobiose. D'o la ncessit d'un contrle gnral qui permet de coordonner tout cela. L'opron hupSLC est contrl par HupR, mais dpend aussi chez Rhodobacter dun second rgulateur d'action plus gnrale qui est ici la protine RegA. Celle-ci contrle non seulement hupSLC mais des gnes de la photosynthse, de lassimilation de CO2, de la respiration et de la nitrognase, une rgulation globale !

204

BIODGRADATIONS ET MTABOLISMES

Pour que l'action de l'ARN-polymrase puisse commencer transcrire en amont d'un groupe de gnes, il faut qu'elle reconnaisse la squence d'un promoteur par l'intermdiaire d'un facteur sigma* ou facteur d'amorage*. Dans bien des cas, elle a le feu vert pour dclencher seule le processus. Dans d'autres cas, il lui faut un rgulateur, soit pour activer la transcription, soit au contraire pour linterdire (contrle ngatif). RegA est un rgulateur ngatif pour hupSLC et pour son propre gne. Les diffrentes protines rgulatrices interagissent avec la polymrase et s'installent sur l'ADN en des zones spcifiques, le plus souvent sous forme de dimres. Le site dattachement de HupR sur lADN est relativement distant du promoteur, mais le schma explique comment les protines HupR et RegA peuvent se regrouper pour interagir avec lARN-polymrase :
ARN-pol RegA HupR ADN site HupR site IHF IHF sigma-70 IHF promoteur hupSLC RegA ARN-pol hupSLC HupR ADN

La solution est fonde sur la courbure de la double hlice d'ADN avec l'aide de IHF*, permettant HupR dentrer en contact avec la polymrase. Le site dattachement de RegA chevauche en partie le promoteur la faon dun rpresseur, mais dborde aussi sur le site de liaison de IHF. Or RegA est elle-mme soumise rgulation. Elle fait partie son tour d'un systme deux composants, RegB/RegA. Le composant RegB est une kinase membranaire, tandis que RegA est cytoplasmique. Daprs un schma publi par ELSEN et coll. [17], RegA phosphoryle active la synthse des photorcepteurs, des enzymes du cycle de CALVIN, de la nitrognase et des cytochromes respiratoires. Mais sa phosphorylation renforce son attachement lADN devant lopron hupSLC, dont elle entraverait lexpression. Il a t montr rcemment par SWEM et coll. que RegB est sensible des conditions oxydantes causes par O2, sautophosphoryle et cde son phosphate RegA. Ces auteurs ont propos un mcanisme pour expliquer la transduction du signal qui conserve encore des points obscurs [18]. Cette description succincte ne rend compte que de la situation chez Rhodobacter, qui est un phototrophe non oxygnique. Labsence de O2 rend moins utile lhydrognase HupSL mais stimule la machinerie assimilatrice de carbone et dazote. Des solutions diffrentes existent chez dautres espces. Chez certaines bactries, la synthse de l'hydrognase n'est pas rgule par H2 mais par O2, et ne se fait qu'en arobiose ou micro-anarobiose. Les protines sensibles O2 sont galement des rgulateurs globaux dont nous retrouverons ultrieurement plusieurs exemples. Le contrle des hydrognases fait partie des mesures physiologiques prises par les cellules quand elles passent de larobiose lanarobiose ou vice versa. Mais rappelons-nous que l'hydrogne a un rle cl dans l'environnement. La suite nous en persuadera aisment.

4 - HYDROGNE - ACTATE - MTHANE

205

4.3 - BACTRIES ACTOGNES


L'acide actique est une entit chimique particulirement rpandue dans l'environnement. Certains organismes en font un sous-produit de leur mtabolisme nergtique, d'autres l'utilisent comme substrat de croissance. En milieu priv d'oxygne, les bactries actognes font partie de la premire catgorie, les mthanognes de la seconde. Les actognes ont t dcrits pour la premire fois par WIERENGA en 1940 et les premires tudes ont t faites sur Clostridium thermoaceticum. L'acide actique est le rsultat de transformations qui ont pour but de fournir de l'nergie la cellule. Il fait le lien entre les produits d'hydrolyse et de fermentation ns des matires animales et vgtales d'une part, et la transformation ultime en mthane de l'autre. Les actognes s'accommodent frquemment de conditions trs frustes, mais ont l'intrt de raliser des biodgradations anarobies complmentaires de celles qui sont faites sous oxygne. En somme ils occupent une niche importante, voire essentielle, dans le cycle naturel des lments carbons. Les actognes sont presque tous strictement anarobies 3, typiquement prsents dans les vases des lacs, les boues d'puration, les rejets de distillerie et les effluents domestiques. On distingue les formes homo-actognes, qui ne font que de l'acide actique, par opposition aux htro-actognes, produisant en mme temps d'autres acides (butyrique, caproque et autres). Eubacterium limosum et Butyribacterium methylotrophicum en sont des exemples. Le caractre actogne n'appartient pas un groupe taxonomique particulier et se rattache aussi bien des espces Gram-positives sporulantes appartenant au genre Clostridium qu' des non sporulantes (Acetobacterium woodii). On rencontre des formes msophiles et des espces thermophiles comme Clostridium thermoaceticum, qui se dveloppe 55-60C. Certains actognes Gram-ngatifs sont en mme temps des sulfatorducteurs (Desulfovibrio barsii). Les actognes stricts vivent en autotrophie sur CO2 + H2 et font de l'acide actique avec ces seules ressources. L'emploi du dioxyde de carbone des fins nergtiques est une dissimilation, par opposition l'assimilation o le CO2 est pris comme source de carbone pour les synthses organiques. D'autres espces sont htrotrophes et font leur acide actique sur un substrat organique. Les mixotrophes utilisent les deux modes. C'est le cas de C. thermoaceticum : 2 CO2 + 4 H2 NADH CH3COO + H+ + 2 H2O NADH C6H12O6 (glucose) 3 CH3COO + 3 H+ (G' = 310 kJ mole1) (G' = 95 kJ mole1)

Ces deux voies sont productrices d'nergie, la premire tant beaucoup plus efficace que la seconde. On voit aisment que la croissance sur glucose, nergie gale, produit environ 10 fois plus d'acide actique que la croissance autotrophe symbolise par la premire ligne. L'acide actique est donc rejet en abondance pour un rendement nergtique assez mdiocre comme dans une fermentation

3 - Ces bactries n'ont donc rien voir avec Acetobacter et les germes qui contribuent transformer le vin en vinaigre, une oxydation arobie de l'thanol en acide actique.

206

BIODGRADATIONS ET MTABOLISMES

ordinaire. Une petite partie est nanmoins rutilise comme source de carbone sans laquelle la cellule ne pourrait effectuer ses synthses. Au cours de la croissance autotrophe, l'assimilation de CO2 conduit par consquent des synthses organiques ne passant pas par le mcanisme habituel du cycle de CALVIN utilis par les plantes vertes et maints organismes autotrophes. C'est l que se manifeste le caractre le plus extraordinaire du mtabolisme nergtique des actognes. Il est symbolis par ce petit diagramme indiquant les transformations du glucose.
glucose 4 H+ + 4 e 2 CH3CO-COOH 4 H+ + 4 e 2 CO2 2 CH3COOH actyl-CoA CH3COOH actyl-CoA cette branche revient former l'acide actique avec 2 CO2 + 4 H2

CO2 du milieu

Actognse sur glucose


Parmi les 3 molcules d'acide actique formes partir du glucose, 2 sont issues de l'acide pyruvique grce une voie qui n'est autre que la glycolyse bien connue (symbolise par le rectangle gauche). Elle produit deux fois 4 lectrons, soit 8 au total, et la dcarboxylation des 2 molcules d'acide pyruvique libre 2 CO2. La troisime molcule d'acide actique correspond la soudure des 2 CO2 par la raction : 2 CO2 + 8 e + 8 H+ CH3COOH + 2 H2O. L'acide actique est indiqu ici par souci de simplification, mais le vritable produit est l'actyl-coenzyme A, dont l'hydrolyse en actate et coenzyme A libre sera couple la formation d'une molcule d'ATP. Cette voie particulire s'appelle la voie de WOOD-LJUNGDAHL (voie WL). Elle permet aux bactries de cette classe de se dvelopper sur CO2 ou CO comme seule source de carbone. Les dtails de cette voie ont t rcolts depuis 1962 et ont donn lieu un volumineux travail d'analyse [19]. La voie WL n'est pas rserve l'actognse, car elle existe aussi chez les mthanognes. Elle fonctionne avec l'intervention d'une enzyme exceptionnelle dans la nature, appele alternativement CO dshydrognase ou actyl-coenzyme A synthase que nous retrouverons plus loin (page 211). Le glucose n'est pas ncessairement la source organique et certaines espces utilisent le mthanol, le formiate et mme le monoxyde de carbone. Par exemple Eubacterium limosum utilise le mthanol la fois pour faire son acide actique (dissimilation) et comme source de carbone (assimilation). C'est donc un mthylotrophe. L'hydrogne est une excellente source d'lectrons pour commuer le gaz carbonique en acide actique grce son bas potentiel standard ( 430 mV pH 7), mais n'est pas le donneur obligatoire de l'actognse sur CO2. D'autres sources d'lectrons sont employes pourvu que leur potentiel soit suffisamment bas. En outre presque tous les homoactognes transforment en acide actique

4 - HYDROGNE - ACTATE - MTHANE

207

des hexoses, des pentoses, des polyols, des acides uroniques, des acides amins, divers mtabolites comme le malate et le lactate. Les actognes occupent donc un crneau important dans les transformations de l'environnement. Ils s'emparent des produits dj dgrads par les hydrolyses et oxydations faites en amont partir des matires organiques animales ou vgtales et transforment tout cela en acide actique. Celui-ci sera repris son tour par les mthanognes pour faire du mthane. Le monoxyde de carbone rendu clbre par sa toxicit pour les humains est un produit biologique. Le degr d'oxydation du carbone y est quivalent celui de l'acide formique. Il y a deux faons d'utiliser le CO dans la nature. La premire est une oxydation arobie en dioxyde de carbone par les bactries dites carboxydotrophes. Elle est parallle la transformation du formiate en CO2 par la formiate dshydrognase. La seconde mthode est celle des actognes et se fait en anarobiose, par la raction globale : 4 CO + 2 H2O CH3COOH + 2 CO2 Ainsi Peptostreptococcus productus est capable de crotre sur monoxyde de carbone comme seule source de carbone et d'nergie [20]. Deux molcules de CO parmi les quatre sont oxydes en 2 CO2. Les 4 lectrons fournis servent rduire un troisime CO en radical mthyle, qui sera soud au quatrime pour donner l'acide actique (actyl-CoA). Ces bactries sont ubiquistes dans les milieux non marins privs d'oxyne. Leur isolement exige un milieu rendu suffisamment rducteur l'aide de citrate de titane(III). On a eu la surprise de constater que les actognes n'taient pas strictement anarobies car ils pouvaient tre isols d'environnements privs incompltement d'O2, soit dans des sols bien drains ou dans le tube digestif de certains insectes. Leur tolrance l'oxygne peut s'lever des concentrations atteignant 5% de celle de l'air ambiant. L'oxygne faible concentration provoque un retard de multiplication mais n'empche pas toute synthse d'actate. Il y a mieux. Certains actognes colonisent les racines de plantes marines, avec lesquelles ils contractent une association physiologique [21]. Or les racines mettent de l'oxygne, et les bactries y sont donc priodiquement exposes. Clostridium glycolicum est adapt cette situation et dvie son mtabolisme en fonction de la prsence d'O2. Ces germes ont les moyens de rsister ou de se dbarrasser de l'oxygne. Dpourvus de catalase et de superoxyde dismutase, ils ont une NADH oxydase et une peroxydase trs actives qui expliqueraient cette rsistance [22]. Les sdiments marins profonds hbergent une prolifration d'actognes. Des expriences de laboratoire suggrent que la chaleur gothermique grande profondeur dans les sdiments stimule l'actogense [23]. Les acides gras courte chane sont des intermdiaires de la dgradation de la matire organique qui aboutit l'actate, et ce dernier est consomm en partie par les mthanognes. Les actognes, comme les mthanognes que nous examinerons plus loin, font l'actyl-coenzyme A par un procd qui ne ressemble en rien ce que font la plupart des organismes. Le principe de base est fond sur l'tablissement d'une liaison carbone-carbone partir de deux molcules de CO2. L'une de ces molcules est rduite trois fois de suite jusqu'au stade mthyle (X tant un accepteur).

208

BIODGRADATIONS ET MTABOLISMES

La seconde n'est rduite qu'une seule fois en CO. La CO dshydrognase (CODH) est l'enzyme cl : elle rduit CO2 en monoxyde de carbone, et fait la soudure pour aboutir l'actyl-CoA selon les deux tapes indiques en trait paissi. C'est donc aussi une actyl-CoA synthase 4.
HS-CoA ATP CO2 CO2 2e 2e 2e 2e CH3-X [CO] CODH CODH synthses cellulaires CH3COSCoA actate

Les rductions successives du dioxyde de carbone sont indpendantes de la CODH et mettent en uvre un cofacteur trs important, l'acide ttrahydrofolique ou FH4, connu en biochimie classique comme transporteur d'units mono-carbones aux trois niveaux d'oxydation : formiate, formaldhyde, mthanol. Le passage d'un niveau l'autre s'effectue sur le cofacteur*.
2 CH3COCOOH HSCoA HSCoA 1 [2H] 8 2 e+2 H+ 9 H2 H FH4 FH4 CHO FH4 4 H2O CH FH4 [2H] 5 CH2 FH4 [2H] 6 CH3 FH4 H CH3COOH CO H 7 [CO] CH3CoIII corrinode CoI 1 CH3CO glucose HSCoA synthses carbones

SCoA CO2

CH3CO SCoA 8

CH3COOH~SCoA HO P 10 HSCoA

[2H]

ATP ADP + Pi

HCOOH 3

CH3CO~ P ADP ATP

N Terminologie 1 2 3 4 5 Pyruvate-ferrdoxine oxydorductase Formiate dshydrognase 10-Formyl-FH4 synthtase 5,10-Mthnyl-FH4 cyclohydrolase 5,10-Mthnyl-FH4 dshydrognase

N 6 7 8 9 10

Terminologie 5,10-Mthylne-FH4 rductase Mthyl-transfrase (CFeSP) Monoxyde de carbone dshydrognase (CODH) Hydrognase Actyl transfrase

Voie de WOOD
4 - Le symbole [CO] signifie que le monoxyde de carbone form reste associ l'enzyme.

4 - HYDROGNE - ACTATE - MTHANE

209

Pour simplifier, les diffrentes tapes n'ont t figures que dans un seul sens, bien qu'elles soient rversibles. Voici quelques indications sur les tapes numrotes : 1 - Le pyruvate provient du glucose par la voie glycolytique dite EMP. Sa dcarboxylation du pyruvate avec oxydation donne CO2 ou CO, et produit de l'actyl-coenzyme A. Dans le mtabolisme arobie classique, la dcarboxylation avec oxydation du pyruvate utilise comme accepteur de la paire d'lectrons une flavine (FAD). Chez les anarobies vivant bas potentiel redox comme les actognes, la dcarboxylase est une enzyme fer-soufre et l'accepteur est une ferrdoxine, qui dcharge les lectrons sur une hydrognase formant H2. La raction est exceptionnelle ici parce que l'enzyme peut librer elle-mme de l'hydrogne et fonctionner directement comme hydrognase sans suivre la procdure habituelle [24]. La voie figure en pointill est hypothtique. Une autre particularit est le fonctionnement rversible en pyruvate oxydorductase, pouvant oxyder H2 en protons et faire du pyruvate. La dcarboxylase est donc une pyruvate synthase, que Clostridium thermoaceticum utilise pour crotre sur CO2 ou CO [25]. Les bactries peuvent donc assimiler CO2 simultanment par deux voies, selon que l'enzyme utilise est une pyruvate synthase ou une CO dshydrognase. 2, 3 - Les formiate dshydrognases* sont des enzymes rpandues dans le monde bactrien. Elles fonctionnent ici dans le sens de la rduction de CO2 en formiate par NADPH. Le partenaire accepteur ou donneur d'lectrons est diffrent selon les cas. C. thermoaceticum. Les formiate dshydrognases sont typiquement des enzymes noyau fer-soufre et slnium. La soudure de l'lment mono-carbon sur le ttrahydrofolate (FH4) comme accepteur s'effectue sans oxydorduction mais avec un apport d'nergie ATP. La liaison est haut potentiel et facilite le transfert de l'lment mono-carbon sur d'autres accepteurs. 4, 5, 6 - La dshydratation et les deux rductions successives procdent d'un mtabolisme classique en biochimie. Le mthylne-FH4, qui est au niveau d'oxydation du formaldhyde, est un intermdiaire essentiel du mtabolisme, car il correspond une entre majeure des units mono-carbones dans les synthses cellulaires. 7 - Le groupe mthyle est transfr sur une protine porteuse d'un cofacteur corrinode ou CFeSP (corrinoid-iron-sulfur protein). On l'a appel parfois protine B12. Les corrinodes*, dont il existe une multiplicit (notamment chez les mthanognes), sont des outils biologiques tout fait remarquables, car ils tablissent une liaison directe entre un lment carbon et un mtal, qui est le cobalt. Des indications sommaires sont donnes en glossaire. Le mtal occupe trois niveaux d'oxydation : Co1+, Co2+ et Co3 + ou Co(I), Co(II) et Co(III). La mthylation du cobalt n'est possible qu'au niveau Co1+. Son oxydation au niveau Co3+ fragilise la liaison et facilite le transfert sur un accepteur. Il y a donc sur le cobalt un cycle d'oxydorduction interne avec canalisation des lectrons par noyau fer-soufre [26]. Le groupe mthyle est transmis du FH4 (en haut) la CODH ou actyl-CoA synthase (en bas), par le corrinode de la mthyl-transfrase (cadre central). Au cours du premier transfert, le cobalt passe de l'tat I l'tat III, puis revient de III I au cours du deuxime transfert.

210

BIODGRADATIONS ET MTABOLISMES

Une oxydation spontane de Co(I) Co(II) conduit l'inactivation du systme, mais le retour l'tat Co(I) actif est possible in vivo l'aide d'une ferrdoxine rduite, ou in vitro par des agents rducteurs puissants, car le potentiel redox du couple Co(II)/Co(I) est trs bas, soit E' = 502 mV. On a dcouvert que le site accepteur de mthyle sur la CODH contient du nickel.
CH3 H FH4 5-mthyl-FH4 CH3 CoI CoII inactif CH3 CoIII H FH4 H

Ni

Ni CODH

CODH CO HSCoA

CH3CO-SCoA

Selon cette interprtation [27], le passage Co(I)-Co(II) ne fait pas partie du cycle catalytique de l'enzyme. Le mcanisme de la transfrase ne comporterait que l'alternance entre les tats Co(I) et Co(III), en mettant contribution un noyau fer-soufre du type [4Fe-4S] servant alternativement de donneur et d'accepteur interne, en mme temps qu'un autre site non identifi. La structure de la mthyl-transfrase comporte deux sous-units de 33 et 55 kDa. La premire contient la cobalamine et lie le mthyl-FH4, tandis que la seconde renferme le noyau fer-soufre. La structure dtaille de la premire partie chez C. thermoaceticum a t dtermine 2,2 de rsolution [28] et montre une structure en tonneau o s'insrent cte cte FH4 et cobamide. Cette mthyl-transfrase joue avec une liaison directe entre un mtal et un atome de carbone, un processus trs rare en biologie. Le procd utilis par la protine s'interprte comme un renforcement de la ractivit du mthyle port par le FH4 quand celui-ci vient se fixer. Voici un petit schma hypothtique [29]. La protonation du donneur dclenche une raction de substitution avec changement de conformation de l'enzyme et concession d'un lectron par le noyau [4Fe-4S]. En mme temps le mthyle prend un caractre lectrophile et attaque le mtal comme le ferait un carbocation.
H+ FH4 H C H H CoI FH4 H H H H C CoIII

[4Fe-4S] ++ [4Fe-4S] +

Attaque lectrophile sur le cobalt

4 - HYDROGNE - ACTATE - MTHANE

211

Imaginons que cette opration soit entirement rversible. En remplaant le FH4 par un accepteur qui ne sera autre que la CODH, le mthyle quitterait un mtal pour aller vers un autre mtal qui serait le nickel, tandis que le noyau [4Fe-4S] restituerait l'lectron qu'il a reu. 8, 9 - L'tape fondamentale de la voie de WOOD-LJUNGDAHL consiste assembler le mthyle, le monoxyde de carbone et le coenzyme A (HSCoA). Quand CO2 remplace CO, une rduction fait intervenir l'hydrogne comme le donneur initial d'une paire d'lectrons, achemins par hydrognase et ferrdoxine. L'enzyme qui fait l'assemblage gnral est comme on le sait la fois une CO dshydrognase et une actyl-CoA synthase que nous continuerons dsigner en abrg CODH. Cette enzyme extraordinaire n'a pas d'autre quivalent dans le monde vivant et se retrouvera aussi comme pice matresse des mthanognes. L'tape 9, qui est la raction d'une hydrognase, serait catalyse par la CODH elle-mme 5. En somme l'enzyme serait capable de se passer d'une hydrognase spare et d'utiliser elle-mme H2, ce qui lui ferait catalyser trois ractions rversibles : l'oxydorduction CO2/CO, l'oxydorduction 2H+/H2, la synthse ou la rupture de l'actyl-CoA ! La consquence est un pouvoir d'adaptation remarquable. Clostridium thermoaceticum peut se dvelopper sur monoxyde de carbone, faire son CO2 et de l'hydrogne, fabriquer de l'actyl-CoA pour son mtabolisme et faire aussi du pyruvate ! La CODH a des caractres similaires chez les actognes et les mthanognes. Chez C. thermoaceticum, la CODH est un ttramre de structure 22. Il y a trois noyaux contenant du fer et du soufre, appels A, B et C. L'enzyme est code par un opron contenant les gnes acsA et acsB (les sous-units et ), acsC, acsD (la protine corrinode) et acsE (la mthyl-transfrase). Voici les caractres des sous-units de la CODH : Sous-unit - 81 kDa. Un noyau [4Fe-4S] ou centre A, associ du nickel et du cuivre. C'est l que se fait l'assemblage de l'actyl-CoA, le CO tant port par du cuivre et le mthyle accept par le nickel. Sous-unit - 72 kDa. Il y a deux noyaux fer-soufre, les centres B et C. Cette partie est consacre l'oxydorduction CO2/CO qui a lieu sur le site C, un [4Fe-4S] modifi de structure encore incertaine et li du nickel fermement li. Un [4Fe-4S] canalise les lectrons changs par B. Trs schmatiquement : la partie est l'actyl-CoA synthase, par l'apport de CO (provenant des sous-units ) et de groupes mthyle (provenant de la transmthylase cobalt). La partie est la CO dshydrognase proprement dite. C'est sans doute elle qui fonctionne aussi comme hydrognase. Elle figure seule dans la CO dshydrognase de certaines espces bactriennes, qui ne font pas l'actyl-CoA comme le phototrophe Rhodospirillum rubrum [30]. L'hypothse du groupe de RAGSDALE est fonde sur l'emploi des spectromtries RPE et RAMAN, ainsi que des isotopes du fer, du nickel et du carbone (54Fe, 64Ni, 13 C) [31]. Le dplacement des raies de rsonance des liaisons carbone-mtal permet de se faire une ide de l'entit qui reoit CO ou CO2. La rduction du CO2

5 - Montr par MENON et RAGSDALE (1996) cits plus haut, comme pour la pyruvate oxydorductase.

212

BIODGRADATIONS ET MTABOLISMES

s'effectue sur la partie de la CODH. Le CO form comme intermdiaire dans la synthse de l'actyl-CoA gagnerait alors un noyau fer-soufre-nickel. Celui-ci se trouve sur un site appel A dans la partie . Le passage se ferait par un "tunnel", une voie de communication interne entre les deux sous-units, empchant tout change avec l'extrieur. D'aprs un article rcent de SERAVALLI [32] , l'accepteur de CO sur le site A serait le cuivre, tandis que le groupe mthyle achemin par la transfrase serait dpos sur le nickel dans une tape considre comme limitante [33]. Le schma suivant est une interprtation encore provisoire montrant la synergie entre une partie synthtase () et une partie CO dshydrognase (). Le coenzyme A serait stock sur un site voisin du noyau fer-soufre-nickel.
Co(I)CH3 CO Cu CH3 CH3 CO Ni Cu CO Ni Cu

Ni

Cu

CO2

Ni

Cu

CO

Ni

Ni CO2

Cu

HSCoA CH3Co-SCoA

Synthse de l'actyl-CoA
Une structure dtaille de la CODH a t rcemment publie par DARNAULT et collaborateurs [34]. Le mcanisme ractionnel a t propos par SERAVALLI et le groupe de RAGSDALE. Il est montr ici titre indicatif car le rle du cuivre reste controvers.
O S [4Fe-4S] S [4Fe-4S]
+ +

C Cu+ Cys S S Cys Ni+

CFeSP CH3Co(III) N N

CO Cu
+

Cys S S Cys Ni+ N N

O S [4Fe-4S]
2+

CFeSP Co(I) Cys S

O CH3CSCoA CH3 C Cu+ Cys S S Cys Ni2+ N N H+ CoA-SH SCoA S [4Fe-4S]2+

C Cu+ CH3 Ni2+ N N

O S [4Fe-4S]2+

S Cys O C Cu+ CH3 Cys S S Cys Ni2+ N N

Synthse de l'actyl Co-A

4 - HYDROGNE - ACTATE - MTHANE

213

Dans la structure cristallographique publie par DARGAULT et collaborateurs, deux compositions diffrentes des sites actifs ont t identifies : zinc-nickel-fer pour une des sous-units en conformation ferme, et nickel-nickel-fer pour l'autre sousunit en conformation ouverte. Ces auteurs pensent que l'htrognit vient des conditions exprimentales. Les mtaux cits sont exposs au solvant et sont probablement facilement changeables. Il est possible que la paire Ni-Ni soit le ple essentiel, l'un des nickel tant plus labile et remplac par du cuivre et mme du zinc. Tous les rsultats exprimentaux convergent vers le caractre indispensable du nickel, alors que le rle du cuivre reste problmatique. Il a t possible rcemment de faire exprimer par Escherichia coli la CODH complte de C. thermoaceticum . Ces bactries se sont montres assez complaisantes pour faire une CODH active aprs insertion du nickel [35]. 10 - La dernire tape est classique chez les bactries de la fermentation. L'actyl-phosphate a un potentiel nergtique comparable celui de l'actyl-CoA. Il y a formation d'ATP. Le principe de la voie de WOOD-LJUNGDAHL, dcrite ici chez les actognes, est adopt aussi par les mthanognes, mais nous trouverons d'importantes diffrences au niveau des cofacteurs et une physiologie particulire.

4.4 - LA GENSE DU MTHANE


Nous savons qu'il existe un cycle du mthane dans l'environnement. Il est temps maintenant de prciser comment se forme le mthane dont nous savons qu'il peut tre un maillon important des biotransformations. Le mthane d'origine biologique prsente un dficit caractristique en carbone-13. La mesure du rapport 13C/12C dans le gaz naturel, qui est riche en mthane, a permis de montrer quil est en grande partie d'origine biologique fossile. La mthanisation peut-elle intervenir dans le nettoyage de notre environnement ? La rponse est affirmative pour deux raisons. La premire se rapporte l'activit rductrice des mthanognes eux-mmes. Divers substrats peuvent y tre rduits au mme titre que le CO2. C'est pourquoi la mthanognse peut s'accompagner de la transformation d'une varit de substances. La deuxime raison dcoule de l'association des mthanognes dans les populations mixtes qu'ils contribuent stabiliser. En effet ils dbarrassent leurs partenaires de certains produits ns de leur activit, comme le gaz carbonique, l'hydrogne, les acides formique et actique. Sans la mthanognse, l'accumulation de ces produits entraverait rapidement le dveloppement de la microflore. Les mthanognes sont en somme les boueurs de ces populations anarobies. Le mthane en est le principal dchet non rutilisable sur place, car son mtabolisme ncessite de l'oxygne. La mthanisation enlve les dchets. Une biodgradation totale ou partielle de polluants organo-halogns, par exemple, peut s'tablir ainsi en anarobiose au sein de ces associations. Elle limine alors l'halogne sous forme d'anions inoffensifs (chlorure, bromure ou iodure) tout en librant des molcules carbones plus facilement mtabolisables. Les mthanognes sont abondants dans tous les sdiments anoxiques, fonds de lacs, mangroves, marcages, fonds marins.

214

BIODGRADATIONS ET MTABOLISMES

La mthanognse n'existe que chez les archaebactries et correspond un processus gnrateur d'nergie qui s'empare des produits abondants engendrs par d'autres organismes. L'acide actique des fermentations ou des actognes est l'un d'eux. La mthanognse dite actoclastique utilise l'acide actique selon un bilan trs simple : CH3COOH CH4 + CO2 Il correspond une part importante du mthane produit dans la nature en recyclant cet acide actique qui sans cela s'accumulerait en abondance en milieu anarobie. Un autre mode de synthse du mthane est la rduction du gaz carbonique par l'hydrogne : CO2 + 4 H2 CH4 + 2 H2O De faon gnrale la production de CH4 est ralise dans un milieu trs rducteur o les mthanognes sont associs la plupart du temps d'autres micro-organismes au sein de populations mixtes souvent complexes. La mthanognse est le premier volet du cycle du mthane qui sera complt par les oxydations en dioxyde de carbone pratiques par les organismes arobies mthanotrophes. Une partie du CH4 chappe cette destruction en diffusant dans l'atmosphre. Cette "vaporation" est facilite par les plantes. On estime par exemple que les plants de riz canalisent plus de 90 pour cent du mthane produit leur pied, le reste tant en partie mis par la monte du gaz la surface de la rizire 6. Le mthane du sol est en partie capt par les racines avant d'tre vhicul vers le feuillage, qui en assure la dissmination dans l'air ambiant. On a dcouvert que le fond des mers recle des quantits normes de mthane sous forme dhydrate. Il se prsente sous forme dune glace gristre, instable et inflammable. Chimiquement, cest un clathrate o les molcules de mthane sont entoures dune cage rigide de molcules deau associes par des ponts hydrogne. La quantit de mthane ainsi immobilise dpend de la gomtrie du clathrate. Le rapport moyen CH4/H2O est 5,75. La fusion de lhydrate libre 164 fois son volume de mthane gazeux. O trouve-t-on cet hydrate ? Les conditions typiques ncessaires existent en bordure du plateau continental en eau trs froide (0C) et sous forte pression (plus de 3 MPa, soit 200-450 m de profondeur). Lhydrate est instable moins de 190 m, mais il se concentre sous la surface des sdiments jusqu une paisseur de 1000 m au moins. Sa prsence se traduit par un cho particulier au cours des prospections sismiques. On en a trouv un peu partout dans le monde 7. Le mthane est un gaz mobile, qui peut voyager dans les sdiments, diffuser dans des roches poreuses, rester bloqu par des couches sdimentaires impermables. La formation de l'hydrate est donc probablement ralise en conditions physiques favorables quand les teneurs en mthane et en eau sont suffisantes. Lhydrate de 6 - Des gaz autres que le mthane tels que le phosphure d'hydrogne sont spontanment inflammables, et engendrent les fameux feux follets. 7 - Peu le long de nos ctes mais surtout en zones arctiques et antarctiques, le long des ctes amricaines, au large du Japon, dans les zones continentales o il y a un permafrost (Sibrie). Ailleurs en Caspienne, Mer Noire, Golfe du Mexique, au large du Prou.

4 - HYDROGNE - ACTATE - MTHANE

215

mthane a t regard longtemps comme une curiosit, un phnomne parasite qui pouvait bloquer les gasoducs dans les rgions froides. La situation sest inverse. On le voit comme une source dnergie potentielle, particulirement au Japon o sont menes des recherches trs actives. Selon les estimations les plus pessimistes, le mthane mondial immobilis sous cette forme reprsenterait plus de mille milliards de tonnes. Encore faudrait-il pouvoir l'exploiter. Lhydrate de mthane, en se dcomposant brusquement, peut faire natre un grand volume de gaz et provoquer des accidents au moment des forages. Pour l'tudier, il a donc fallu le remonter avec prcaution sous pressurisation. Dautre part on craint que toute cause comme le rchauffement climatique puisse faciliter le dpart de ce mthane vers latmosphre et renforcer leffet de serre. Il y aurait alors un phnomne d'amplification, renforcement de l'effet de serre, rchauffement, libration de davantage de mthane, et ainsi de suite. Do vient tout ce mthane ? Il a t tent de rpondre cette question par des mesures isotopiques en IRMS*. L'tude d'un hydrate provenant de la cte nord de l'Alaska donne une rponse mitige. La mthanognse biologique serait responsable de 30 40% du gaz tudi, le reste tant considr comme d'origine thermogne, provenant des couches profondes de l'corce et accompagn de petites quantits d'thane et de propane. Le problme rejoint celui de l'origine du ptrole, dont le mthane est finalement le composant le plus simple. Deux thses s'affrontent. Soit les hydrocarbures sont considrs comme d'origine essentiellement tellurique, soit ils sont au contraire d'origine biologique. Les tenants de l'origine tellurique des hydrocarbures, comme Thomas GOLD [36], font remarquer que le carbone est le quatrime lment en abondance dans l'univers (aprs H, He et O), et que le mthane est abondant dans le systme solaire. L'appauvrissement du mthane en carbone-13 ne serait pas caus ncessairement par un effet biologique, mais par un fractionnement physique au cours de la migration du gaz. Pour les tenants de l'origine biologique au contraire, les tres vivants seraient la source principale. La question est encore loin d'tre tranche, mais une double origine pour le mthane et les hydrocarbures reste tout fait possible. Peut-on valuer l'importance des rejets par les bactries mthanognes ? Les estimations ne sont forcment que des ordres de grandeur. Les mesures faites en des endroits diffrents donnent souvent des rsultats contradictoires. La quantit totale de CH4 libr dans la biosphre dpasserait 550 millions de tonnes par an. Le mthane produit sans intervention humaine n'en reprsenterait qu'un tiers. Il s'agit du gaz des marais et des sols (50 150 millions de tonnes), des manations de gaz naturel et du mthane produit par les bactries intestinales de nombreuses espces animales : termites, coloptres varis et autres arthropodes, ainsi que des mammifres ruminants sauvages. Pour certains auteurs, les missions totales de mthane partir des insectes des pays chauds comme les termites apporteraient une contribution non ngligeable au mthane atmosphrique [37]. La part prpondrante depuis plusieurs dcennies serait anthropognique : industrie minire (charbon, ptrole, fuites des installations de gaz naturel), culture du riz, pandage de dchets, levage intensif des ruminants. Le tout pour au moins 200 350 millions de tonnes par an dont la plus grande part revient l'hmisphre nord. La seule culture du riz qui ne cesse de se dvelopper contribuerait pour plus de

216

BIODGRADATIONS ET MTABOLISMES

60 millions de tonnes par an. Si on admet que la plante comptera plus de 8 milliards d'tres humains en 2020, la production de riz devrait augmenter de 50 70%. Or le riz est la base de l'alimentation de plus de la moiti des habitants de la terre. En 1995, sa production tait dj suprieure celle du bl, raison de 550 millions de tonnes de riz non dcortiqu (ou paddy). Grce l'emploi de varits nouvelles, le rendement peut atteindre 150 quintaux l'hectare (davantage que pour le bl), et les efforts actuels tendent l'amliorer fortement. Malgr la slection de nouvelles varits, la culture du riz reste dpendante de ressources considrables en eau et cre des conditions trs favorables la mthanisation. Pourquoi ? Sans doute parce que les rizires comme tous les terrains inonds, au moins temporairement, sont riches en matires organiques et rapidement appauvris en oxygne. Les fermentations et la production de CO2, d'hydrogne et d'acide actique sont favorables la production du mthane. Les racines des plantes scrtent pourtant un peu d'oxygne utile aux organismes de la rhizosphre, et il ne devrait pas y avoir de mthanognse leur contact. Ce n'est pas le cas. Des auteurs ont montr que les racines du riz sont truffes de mthanognes, dont la survie semble pouvoir s'accommoder d'une exposition temporaire O2. La biologie des mthanognes dans les terrains anoxiques inonds met en vidence des espces nouvelles et une complexit imprvue [38]. La dtection des mthanognes dans un biotope donn, outre les mthodes d'isolement classique, fait appel la mise en vidence chromatographique des lipides di-thers caractristiques des archaebactries et la recherche d'ARN ribosomique spcifique. Une autre source de mthane est directement lie la population humaine, car elle correspond la dgradation des dchets industriels ou urbains dans les dcharges et terrains d'pandage. La lgislation franaise a prvu d'interdire toutes les dcharges depuis 2002 (avec des entorses ici et l !). L'idal est videmment d'obtenir l'limination des dchets en rcuprant le mthane produit, celui-ci tant brl ensuite comme source d'nergie. Cette opration est conduite ici ou l dans des usines spcialises ou dans des installations domestiques petite chelle (Biogaz). Malheureusement la mthanisation des dchets est souvent lente et ncessite sur le plan industriel des investissements trs importants, qui sont en concurrence avec les sources de gaz naturel. Plus de 50 millions de tonnes de CH4 par an seraient mis dans l'atmosphre partir de nos dchets, assez pour qu'on s'en proccupe ! Les ocans sont galement le sige d'une mthanognse, et un quilibre s'tablit entre le mthane dissous et celui de l'atmosphre. Certaines mers sont plus riches en mthane que d'autres. C'est le cas notamment de la Mer Noire. Elle contiendrait elle seule 96 millions de tonnes de CH4, lequel se concentrerait plus de 100 m de profondeur, o sa teneur atteindrait 11 mM. La Mer Noire est une mer quasi ferme dont le taux de pollution par les nombreux pays riverains devient particulirement alarmant. Le dveloppement excessif des strates profondes prives d'oxygne retarde la dpollution et provoque une disparition massive d'une partie de la faune aquatique [39]. Dans les lacs et tangs, la mthanognse est souvent trs active certaines priodes de l'anne, parce que les eaux de surface, rchauffes par le soleil et oxygnes au contact de l'atmosphre, forment une

4 - HYDROGNE - ACTATE - MTHANE

217

zone isolante au-dessus des eaux profondes plus froides et donc plus denses, spares par la zone de transition appele thermocline. Celle-ci peut se former 10-20 m de profondeur dans les lacs en t. Les eaux profondes perdent alors plus rapidement leur oxygne, reoivent des matires organiques coulant partir de la surface, et deviennent propices la formation et au stockage du mthane. La stratification des eaux favorise donc la cration de rservoirs anoxiques de gaz dissous. La production de mthane atteint son plus haut degr de sophistication dans le rumen, milieu complexe tabli dans la panse des ruminants (bovins, moutons, chvres, chameaux, girafes, cervids) avant que les vgtaux brouts et mastiqus parviennent l'estomac proprement dit. Le rumen est une formidable usine transformer la matire vgtale, o se dveloppent dans une ambiance anarobie et sous brassage temprature constante une grande quantit de micro-organismes varis. Les ruminants produisent une masse importante de salive (plus de 100 L par jour pour une vache adulte ), qui apporte de l'eau et du bicarbonate. Elle aide maintenir le pH du rumen. L'hydrolyse bactrienne de la cellulose libre du cellobiose et du glucose, d'excellents substrats soumis d'intenses fermentations productrices d'acides organiques, actique, butyrique et propionique, ou encore des acides gras. Ces acides fournissent de 40 70% des ressources nergtiques de l'animal. L'acide propionique est l'un des facteurs importants. Une microflore complexe comprend des eubactries, des protozoaires et des champignons. Les mthanognes tels que les Methanosarcina transforment en mthane divers composs issus de l'activit des autres espces. L'acide actique est l'un de ces produits. Tout ce peuplement risquerait de se trouver cours d'azote si l'animal ne fournissait de l'ure, qui diffuse travers la muqueuse digestive partir du sang et se transforme en CO2 et ammoniac par l'urase microbienne. Aprs avoir t profondment brasse et dgrade dans le rumen, la matire vgtale est transmise l'estomac proprement dit. Il s'y fabrique de grandes quantits de lysozyme. On sait que cette enzyme, qui existe communment dans les scrtions animales (larmes, salive, blanc d'uf) hydrolyse des composs particuliers de la paroi bactrienne, appels peptidoglycanes. Le lysozyme est donc une enzyme antibactrienne qui facilite ici la digestion de nombreuses bactries lorsque celles-ci ont fini leur travail 8. Chose intressante, les ruminants ont dvelopp au cours de l'volution des lysozymes modifis plus actifs en milieu acide et plus rsistants l'action de la pepsine que les lysozymes courants comme celui qu'on trouve chez l'homme dans les scrtions lacrymales. Moyennant quoi l'apport des animaux d'levage dans le cycle du mthane est donc loin d'tre ngligeable. La quantit de gaz mise par une vache adulte peut s'lever 30-50 litres par heure, contre 5 litres pour moutons et chvres dans le mme temps. Ce sont finalement 65 100 millions de tonnes de mthane qui sont mises dans l'atmosphre chaque anne par les fermentations digestives des animaux sauvages et domestiques. Comme les activits pastorales augmentent en mme temps que la

8 - C'est une simple approximation, parce que le lysozyme n'attaque pas la paroi de toutes les bactries ; les archaebactries et eubactries qui ont une paroi modifie ou une couche S rsistent.

218

BIODGRADATIONS ET MTABOLISMES

population mondiale, leur part dans le cycle du mthane ne devrait pas diminuer, bien au contraire. Cette intense activit mthanogne ne fait pas que participer un cycle biologique trs important, elle obit une biochimie trs particulire. Voici en rsum les caractristiques essentielles de la mthanognse. Le mthane est produit en conditions strictement anarobies par des archaebactries lexclusion de toute autre catgorie dorganismes. C'est le stade ultime dune chane de transformations des matires organiques, commences en prsence doxygne, poursuivie en anarobiose plus ou moins complte par les fermentations, la dnitrification ou d'autres respirations anarobies, et par lactognse. Le mthane produit par voie biologique se reconnat par son dficit en carbone-13 qui correspond un fractionnement isotopique*, l'un des plus importants parmi les processus biologiques. L'abondance naturelle de l'isotope 13 du carbone par rapport au carbone-12 peut diminuer de 5% et plus dans le mthane. Les comptiteurs naturels des mthanognes sont les bactries sulfatorductrices, car leur activit dtourne lhydrogne et tend freiner l'apparition du mthane l o le sulfate est abondant (notamment en milieu marin). En outre le sulfure dgag inhibe le dveloppement des mthanognes. Lnergie de la mthanognse est directement couple un transport de protons ou dions sodium vers lextrieur, c'est--dire ltablissement dun potentiel membranaire. Elle sapparente donc une respiration. Comme lnergie rcupre est relativement faible, les mthanognes sont contraints de transformer une grande quantit de source carbone et tendent sassocier avec dautres espces microbiennes complmentaires par leur lactivit. La mthanognse est donc souvent une affaire de syntrophisme dans des communauts cellulaires dotes dun mtabolisme global complexe. Ces associations sont actives en particulier dans le floc des stations dpuration et des formations particulires appeles granules. Il en rsulte des biodgradations performantes librant du mthane comme un des stades ultimes. La formation du mthane obit une mcanique particulire fonde sur lemploi de coenzymes indits. Les gnomes de Methanococcus jannaschii et Methanobacterium thermoaceticum [40] ont t entirement squencs et apportent une mine de donnes pour rpertorier et comparer tous les lments de la biochimie trs particulire de ces organismes.

4.5 - LES TAPES DE LA MTHANOGENSE


Plusieurs voies sont possibles pour engendrer le mthane. Le point de dpart est le dioxyde de carbone ou un produit organique simple. En rgle gnrale les matires premires utilises sont des sous-produits de fermentations au cours de la dcomposition de la matire vgtale : CO2, H2, formiate, actate, butyrate, mthanol,

4 - HYDROGNE - ACTATE - MTHANE

219

thanol Le dioxyde de carbone est rduit en mthane en quatre tapes successives avec lhydrogne comme donneur. La raction globale est : CO2 + 4 H2 CH4 + 2 H2O
2 H+ + 2 e CO2 2 H++ 2 e HCOOH acide formique 2 H+ + 2 e HCHO formaldhyde H 2O

(G' = 131 kJ . mol1)


2 H+ + 2 e

CH3OH mthanol H 2O

CH4

Les quatre rductions


Les trois intermdiaires du schma sont thoriques, car llment mono-carbon reste li un coenzyme au cours des tapes successives. On voit que lensemble du processus est exergonique ltat standard et pH 7. La valeur indique ( 131 kJ) est une valeur thorique puisque dans les conditions relles le gaz carbonique et lhydrogne sont loin de ltat standard. On sait que lhydrogne ne saccumule pas dans les milieux naturels, et une pression de 10 Pa seulement, cette valeur de G' est en ralit proche de 40 kJ. Le CO2 n'est pas obligatoirement la source du mthane. Le groupe des mthano-sarcinales contient des espces comme Methanosarcina mazei, qui sont capables dutiliser H2 et des sources de carbone diversifies : mthanol, mthylamine, actate. Leur action stend des composs tels que CCl4 et le chloroforme, ce qui est utile pour la dfense de lenvironnement. Ces organismes sont dsigns comme les mthanognes mthylotrophes par rapport aux autres qui sont des hydrognotrophes. Ltape la plus nergtique de la cascade de rductions est la dernire aprs le passage au niveau mthyle. On peut sen rendre compte par la transformation du mthanol en mthane, qui reprsente plus de 80% de lnergie obtenue partir de CO2 ltat standard : CH3OH + H2 CH4 + H2O(G' = 112 kJ . mol1) La mthanognse est galement possible partir du formiate issu des fermentations, et se fait par une dismutation produisant la fois CO2 et CH4 : 4 HCOO + 4 H+ CH4 + 3 CO2 + 2 H2O Les mthanognes sont seuls raliser ces transformations nergtiques qui rejettent le mthane comme sous-produit inutile. Comment les cellules rcuprent-elles cette nergie ? En couplant plusieurs tapes ltablissement dun potentiel de membrane, tabli par translocation de protons et dions sodium. La nature de cette opration a t rvle par les expriences de B LAUT et GOTTSCHALK [41]. Il sagit dun mtabolisme de type respiratoire anarobie, o le substrat oxyd est lhydrogne, et laccepteur final le CO2. La mthanisation peut se faire aussi partir de lacide actique. Cest la mthanognse actoclastique, une forme de mthylotrophie car le mthane est produit partir du groupe mthyle. Lacide actique est rcupr l encore partir de l'activit des fermentations et de l'actognse. CH3COOH CH4 + CO2(G' = kJ . mol1)

220

BIODGRADATIONS ET MTABOLISMES

L'nergie obtenue en partant de l'acide actique est relativement modeste. Pourtant une part trs importante de la mthanognse dans la nature se ralise ainsi, et lacide actique est parfois la source prdominante du mthane. On peut le comprendre aisment puisque lactate est un produit de fermentation abondant, alors que lhydrogne est un gaz volatil, rapidement oxyd par dautres voies et gnralement prsent taux trs faible. Le mcanisme biochimique de la conversion de CO2 en mthane nest connu que depuis une priode rcente, il est assez compliqu et met en jeu une batterie de cofacteurs qui nexistent nulle part en dehors des mthanognes (sauf rares exceptions). On en donnera un aperu condens. Des revues rcentes contiennent beaucoup de renseignements utiles et de longues bibliographies [42]. Un diagramme montre les diffrentes tapes. L'chelle symbolise les variations dnergie libre approximatives l'tat standard, et chaque raction avec son numro est une marche descalier. Le dioxyde de carbone est rduit en mme temps quil est dcharg sous forme de formyle (O=CH) sur un coenzyme spcial ressemblant au FH4. Llment mono-carbon qui lui est li va subir nouveau deux rductions. Nous avons dj rencontr le FH4 (ttrahydrofolate) chez les actognes. Le principe est ici le mme, le FH4 tant remplac par le MPTH4 (ttrahydromthanoptrine). La dernire partie (ractions 6 et 7) est la plus complique et la principale exclusivit des archaebactries. La plupart des tapes ont besoin dun bas potentiel doxydorduction, infrieur 300 mV, et sont catalyses par des enzymes sensibles loxygne. Les manipulations de laboratoire doivent donc se faire sous atmosphre inerte.
G' (kJ . mol1) 1
0

CO2

4 5

O=CH O=CH MF MPTH4

CH MPTH4 CH3 MPTH4

CH2 MPTH4

40

6 CH3SCoM

80

HS-CoB mthanophnazine F430

120

MF : mthanofurane MPTH4 : ttrahydromthanoptrine HS-CoM : coenzyme M HS-CoB : coenzyme B

CH4

Cheminement nergtique de l'lment monocarbon

4 - HYDROGNE - ACTATE - MTHANE

221

Il faut se rappeler que le FH4 ou le MPTH4 ne subissent pas doxydorduction, mais servent de supports pour les interconversions entre formiate et mthanol. Les ractions sont potentiellement rversibles, entre tapes formyl-, mthnyl- (aprs cyclisation catalyse par une cyclo-isomrase), mthylne-, mthyl-. Deux dshydrognases sont dans ce va-et-vient. Les ractions sont repres par numro. 1 - Le CO2 est rduit en acide formique qui dcharge son groupe formyle sur un accepteur appel mthanofurane (MF). Un coenzyme inhabituel, dont voici la structure :
COO
OOC

O N H

COO H N O
+ NH3

O N H O O

NH+ 3

COO

COO CO2

NH O O CHO

2 H++ 2 e

Lintermdiaire form est le formyl-mthanofurane (formylMF). Lenzyme de structure complexe est une dshydrognase qui a t purifie chez Methanosarcina barkeri [43]. Elle a cinq sous-units diffrentes, possde une ribambelle de noyaux fer-soufre et une molybdoptrine. Ce cofacteur est courant dans le nature et nous le retrouverons dans la rduction du nitrate ou du formiate. Il a ici la structure dun dinuclotide (MGD*), contient du molybdne ou du tungstne. On suppose que cette partie a le rle essentiel dans la catalyse, les lectrons tant fournis par une hydrognase et dirigs vers le site actif par la chane de noyaux fer-soufre de type [4Fe-4S]. La formation du formyl-mthanofurane est lgrement endergonique et correspond la marche nergtique montante en haut du diagramme. La rduction catalyse par une formiate dshydrognase s'accompagnerait d'un saut en nergie bien plus marqu, et l'intervention du mthanofurane semble une solution pour franchir facilement la petite colline nergtique par un effet de siphon, le formyl-MF tant absorb en aval au fur et mesure. 2 - Un transfert du formyle se fait sur le ttrahydromthanoptrine (MPTH4), pour donner le N5-formyl-MPTH4. Il ny a pas doxydorduction. Le formyle change simplement de vhicule. Le nouvel accepteur ressemble au ttrahydrofolate (FH4) aperu chez les actognes, et servira de support pour les deux rductions suivantes. Sa formule a t simplifie 9. Ont t symbolises les trois combinaisons de llment mono-carbon avec le MPTH4, en fonction de son niveau doxydorduction. Des archaebactries sulfato-rductrices [44] et quelques protobactries utilisatrices du mthanol [45] renferment aussi ce cofacteur. Ont t repres comme pour le FH4 les deux positions azotes essentielles 5 et 10. Lenzyme responsable de cette tape a t purifie [46] et sa structure dtaille est connue pour un hyperthermophile, Methanopyrus kandleri [47]. 9 - R dsigne une chane contenant du ribose, un groupe phosphate, un groupe glutaryle (en C5).

222
O HN H2N N H N
5

BIODGRADATIONS ET MTABOLISMES
H N

10

N H

CH3

CH2 I CHOH I CHOH I CHOH I CH2 R N CH3 N


5

N
5

CH
+

10

N
5

CH2

10

H N

10

5,10-mthnyl-MPTH4

5,10-mthylne-MPTH4

5,10-mthyl-MPTH4

Ttrahydromthanoprine (MPTH4)
3, 4 - Une cyclo-isomrase catalyse une cyclisation avec limination dune molcule deau. Le rsultat est le N5,N10-mthnyl-MPTH4. Celui-ci est rduit en N5,N10-mthylne-MPTH4 par la mthylne-MPTH4 dshydrognase avec un partenaire qui nest ni NAD+ ni FAD, mais un compos flavinique dsign comme F420 (avec un pic dabsorbance 420 nm). La raction est : N5,N10-mthnyl+-MPTH4 + F420-H2 N5,N10-mthylne-MPTH4 + F420 + H+. Le systme ne peut avancer que si le F420 est rduit nouveau. Une hydrognase [NiFe] particulire, contenant du nickel et spcifique du F420 utilise H2 comme source dlectrons. Le F420 est une dazaflavine, analogue une flavine classique comme le FAD mais dote d'un carbone la position 5 la place de l'azote. Cette diffrence est fondamentale, parce que le F420 est un accepteur de deux lectrons la fois pour devenir le F420H2, alors que la rduction d'une flavine est possible lectron par lectron et peut passer par un stade intermdiaire radicalaire. Le F420 se prte donc une utilisation plus rigide que celle des flavines 10. En outre son potentiel doxydorduction est plus bas, soit environ 350 mV.
F 420 O
5

F420-H2 H NH N
4

H O
5

2H +2e

NH N H
4

HO

N CH2

O CH3 NH O COO

H O N C00 CH CH2 CH2 C00

O O P O O OH OH

OH

La dazaflavine des mthanognes


10 - Une 5-dazaflavine est donc un accepteur dhydrure, la manire du NAD+. Exprimentalement, les dazaflavines peuvent remplacer parfois le FAD ou le FMN lorsque la raction supporte un change de deux lectrons. Si la raction passe par un stade intermdiaire radicalaire de type semiquinone, une azaflavine est inhibitrice et sert d'outil pour examiner le mcanisme des ractions flaviniques.

4 - HYDROGNE - ACTATE - MTHANE

223

Le recours au F420 n'est pas obligatoire. Deux catgories de dshydrognases peuvent coexister dans le mme organisme, celles qui dpendent de F420 (codes par gnes mtd) et celles qui en sont dpourvues et fonctionnent comme hydrognases (codes par hmd). Les dshydrognases F420 (Mtd) de plusieurs espces, dont Methanosarcina barkeri et Methanopyrus kandleri ont t purifies [48] et ont donn lieu des tudes de strochimie intressantes [49]. Le F420 intervient dans (1), et la deuxime enzyme (Hmd) catalyse (2). cela s'ajoute une troisime protine qui rduit directement F420 avec l'hydrogne. L'enzyme est une hydrognase Ni atypique et dpourvue de noyaux fer-soufre. Elle obit un mcanisme particulier [50] et catalyse (3) : F420 + N5,N10-mthnyl+-MPTH4 N5,N10-mthylne-MPTH4 + F420 rduit + H+ H2 + N5,N10-mthnyl+-MPTH4 N5,N10-mthylne-MPTH4 + H+
+

(1) (2) (3)

H2 + F420 F420 rduit + H

La raction (2) mrite une parenthse. Son caractre rversible lui permet de faire de lhydrogne partir du mthylne-MPTH4. Lenzyme Hmd est une dshydrognase fonctionnant comme une hydrognase particulire distincte par ses proprits des autres hydrognases, car elle na pas de noyau [NiFe], ne rduit pas les violognes et ne catalyse pas lchange H/D. Elle est inductible en conditions de carence en nickel [51]. On admet actuellement que cette hydrognase possde un cofacteur qui serait constitu par du fer. Pourquoi ce luxe de protines diffrentes dans cette tape de la mthanognse ? Une explication partielle consiste voir ce dispositif comme une parade aux conditions trs changeantes du ct de la fourniture en hydrogne. Quand celui-ci est rare, la dshydrognase F420 est synthtise en priorit par rapport lenzyme atypique Hmd.
CO2 CH H2 Hmd 2 H+ MPTH4 CH2 MPTH4 CH4 Mtd F420 F420-H2 hase Ni H2 2H+ autres ractions

Utiliser au mieux l'hydrogne


Cest linverse quand lhydrogne est abondant. Mais la forme rduite du F420, soit F420-H2, est prcieuse car elle sert faire marcher dautres tapes rductrices de la mthanognse, et c'est pourquoi sa formation en permanence par la raction (3) est rendue ncessaire. Sur un petit diagramme est figure une chane ractionnelle. Elle met contribution lenzyme Hmd, qui rduit le mthnyl-MPTH4. Lenzyme Mtd fait la mme chose mais utilise F420-H2 comme donneur la place de H2. Enfin lhydrognase nickel rduit directement F420 avec lhydrogne.

224

BIODGRADATIONS ET MTABOLISMES

Quand lhydrogne est abondant, le flux des lectrons venant de lhydrognase Hmd, permet linterconversion rapide entre mthnyle et mthylne sur le MPTH4. Le va-et-vient entre ces deux formes permet Mtd de maintenir un taux lev du F420 rduit (F420-H2) ncessaire dautres ractions de la mthanognse. Si lhydrogne est peu abondant, lhydrognase Ni, spcifique du F420, possde une plus forte affinit pour H2 et alimente le systme de droite gauche sur le diagramme. Il est probable que ce modle est trs simplifi par rapport la ralit, et que des mcanismes rgulateurs complexes permettent doptimiser les flux du carbone et des lectrons. 5 - Lenzyme dont le nom complet est N5,N10-mthylne-MPTH4 rductase opre la rduction du mthylne en mthyle. Elle a t purifie partir de plusieurs espces dont Methanosarcina barkeri [52], et fonctionne avec le F420 rduit comme donneur dlectrons. Partant du CO2, le carbone a donc subi trois rductions successives conduisant au stade mthyle qui quivaut au mthanol. Il faudra donc une rduction supplmentaire pour parvenir au mthane. 6 - Un transfert prcde lultime rduction. Elle fait passer le mthyle sur un coenzyme caractristique de la mthanognse ou coenzyme M (acide 2-mercaptothane-sulfonique). Ce facteur est un thiol et sera dsign en abrg par HS-CoM. Une transfrase tablit la liaison thio-ther sur le coenzyme M : CH3MPTH4 + HSCoM MPTH4 + CH3SCoM
O HS S O avant O H3C S et aprs O S O mthylation O

Le coenzyme M
Cette raction en apparence modeste est une des tapes nergtiques essentielles G' = 30 kJ . mol1 environ) et contribue btir le potentiel membranaire. La mthyltransfrase a trois caractres principaux. Elle est membranaire, contient un corrinode* et fonctionne en expulsant des ions sodium raison dun rapport molaire de 1,7 Na+ environ pour 1-mthyl-MPTH4 utilis [53]. On a pu cloner et squencer les gnes codant pour les 8 sous-units diffrentes de la transfrase 11 chez Methanosarcina mazei G1 [54]. Cette souche a offert un cadre favorable trs utile la recherche, car il est peu facile dobtenir des vsicules isoles (liposomes) montrant des couplages nergtiques in vitro partir des archaebactries 12. Cependant les mthanognes connus montrent une grande diversit de proprits physiologiques et de compositions enzymatiques. Il nest pas sr quon puisse extrapoler automatiquement les donnes acquises partir de G1. Il a t montr exprimentalement que les cellules de Methanosarcina barkeri mises en prsence 11 - Lenzyme est code par l'opron mtrEDCBAFGH. La sous-unit MtrA contient le corrinode. 12 - Cela est d aux contacts troits et interdigitations de la couche externe de glycoprotines avec la membrane cytoplasmique proprement dite, et on ne peut pas dcoller aussi facilement celle-ci du reste de lenveloppe ou faire des protoplastes comme on le fait par exemple avec un colibacille.

4 - HYDROGNE - ACTATE - MTHANE

225

des substrats H2 et HCHO expulsaient des ions sodium, et que cette proprit se retrouvait dans des liposomes contenant la transfrase. Le potentiel engendr par la translocation de Na+ atteint 60 mV environ et rsiste laction des ingrdients qui permabilisent les membranes aux protons. Le transfert fonctionnerait en deux temps. Le mthyle transport par le MPTH4 serait dcharg sur le cobalt(I) du corrinode dans la transfrase, formant une liaison transitoire CH3Co(III). Une oxydorduction rversible et interne lenzyme ferait passer le cobalt ltat Co(I), rompant la liaison et facilitant le transfert sur le coenzyme M. Chacune des deux tapes devrait engager une variation dnergie denviron 15 kJ . mol1. La premire nest pas stimule par les ions Na+, contrairement la seconde. On pense que la translocation du sodium est couple au passage du mthyle entre cobalt et coenzyme M.
Co(I)

CH3_MPTH4 G'0 = 15 kJ MPTH4 HS-CoM G'0 = 15 kJ CH3 S-Com cytoplasme


_

CH3_ Co(III) Na+ Co(I) membrane

Rle du corrinode dans le transfert de mthyle sur coenzyme M


Lintervention du corrinode ressemble la situation dcrite chez les actognes. On observe que le cobalt n'est oxyd que temporairement. Le potentiel membranaire form est converti en ATP par une ATP synthase qui est mue par un gradient de Na+ ou de H+ selon les espces.
F430 COO H H 3C H2NOC HS coenzyme B O H N CH3 CO O O P O O
OOC

O HN CH3 N Ni + N COO COO

H O COO

Coenzymes de la phase finale

226

BIODGRADATIONS ET MTABOLISMES

7 - La dernire tape de la mthanognse est la plus trange. Le passage au mthane implique une dernire rduction deux lectrons du groupe mthyle. Lenzyme est la mthyl-coenzyme M rductase. Elle a deux cofacteurs, le coenzyme B (son nom chimique est donn en glossaire) et le F430 ( ne pas confondre avec le F420) Le coenzyme B est un thiol comme le CoM, mais sa chane est plus longue. Le F430 est une porphyrine modifie renfermant du nickel.Le principe de la raction parat le suivant. La rduction du mthyle est compense par loxydation des deux thiols, les coenzymes M et B qui vont former ensemble ce quon appelle lhtrodisulfure. Le coenzyme M est occup par le mthyle, mais celui-ci est chass et rduit en CH4 tandis que se forme le disulfure. Le schma indique les trois phases essentielles.
CH4 S 1 CoM MPTH4 3 mthyl-MPTH4 S htrodisulfure 2 HS 2 H+ + 2 e HS

CoB HS

+
H3CS

Formation du mthane et de l'htrodisulfure


La raction 1 engendre le mthane et lhtrodisulfure par une raction doxydorduction. L'enzyme essentielle est appele mthyl-CoM rductase, pour laquelle on a des renseignements dtaills chez Methanobacterium thermoautrophicum [55]. Lenzyme de 300 kDa est code par de trois gnes B, G et A dans un opron mcrBDCGA, possde 3 sous-units diffrentes et une structure globale 2 2 2 avec deux molcules de F430. Le nickel semble tre un lment capital. Voici une interprtation. Le mtal formerait une liaison temporaire avec le mthyle arrach au coenzyme M. Ce serait la vraie phase rductrice, pendant que le mtal soxyderait de Ni(I) Ni(III) 13, comme l'indique un schma simplifi. On observe une ressemblance intressante du comportement du nickel avec celui du cobalt dans le corrinode.
HS S CH3 N N NiI N N N N CoB SO3
S

CoB SO3 CH4 N N

S S

CoB SO3

CoM F430

HS CH3 NiIII

N N

NiI

N N

Naissance du mthane

13 - Observez le parallle avec la liaison Co(III)-mthyle dans les corrinodes.

4 - HYDROGNE - ACTATE - MTHANE

227

La deuxime raction est donc celle qui rompt lhtrodisulfure et rgnre les deux thiols pour les rendre nouveau disponibles. Ce rle appartient lhtrodisulfure rductase. Il est dtaill dans la section suivante. Cette nouvelle rductase est compltement distincte de la prcdente. Elle est charge de clore le cycle des oprations de rgnration des deux thiols.

4.6 - LNERGIE DE LHTRODISULFURE RDUCTASE


La rduction de lhtrodisulfure form entre les coenzymes M et B est un deuxime site de couplage nergtique aprs celui de la mthyl-transfrase aperu antrieurement. Une tape essentielle. Quel est son principe de ce couplage ? Si on fait le point, on constate que la ralisation du mthane est maintenant termine. L'tape ultime consiste rendre nouveau disponibles le coenzyme M et l'autre thiol, le coenzyme B. C'est le rle de cette rductase. L'opration a lieu dans la membrane. Le donneur est soit H2, soit la dazaflavine rduite (F420H2). Examinons le cas o le donneur est H2. Son utilisation ncessite une hydrognase, mais celle-ci ne sait pas transmettre les lectrons directement la rductase. Il faut un transporteur intermdiaire au sein de la membrane, un produit qui ressemble une quinone respiratoire et lipophile comme elle. Il s'agit de la mthanophnazine (MP) [56]. Elle na t mise en vidence ailleurs que chez les espces mthylotrophes, qui oxydent du mthanol. En dpit de cette exception qui est peuttre une survivance volutive ancienne ou une convergence, ce cofacteur reste particulier la mthanognse.
N N
forme oxyde

O H N N H

forme rduite

Mthanophnazine
Une mini-chane de transporteurs entre l'hydrogne et l'htrodisulfure est symbolise par une figure. Des protons sont mis sur la face extrieure. Les principaux rsultats exprimentaux ont t acquis avec Methanosarcina mazei [57]. Lhydrognase est dsigne par son sigle gntique VhoAG. Elle ne fonctionne pas avec le F420 rduit. Le transport des lectrons fait appel des cytochromes et la mthanophnazine figure par MP. La membrane est symbolise la page suivante comme vue par sa tranche, face extrieure en haut, cytoplasmique en bas. Lhydrognase gauche forme un complexe de trois sous-units, VhoA, VhoG et VhoC. Cette dernire est un cytochrome b1. Par les homologies de squence, il a t dmontr que VhoAG ressemble aux hydrognases [Fe-Ni] des eubactries.

228
H2 2 H+

BIODGRADATIONS ET MTABOLISMES
2 H+ htrodisulfure rductase cyt. b1 VhoC 2 e MPred MPox 2 e cyt. b2 HdrE HdrD 2 e

extrieur membrane cytoplasme

VhoAG 2 e

hydrognase 2 H+ 2 H+ + CoM-S-S-CoB HS-CoM HS-CoB

La rductase HdrDE
Cest donc un systme dot dune structure courante, la partie cytochrome tant surajoute.Lhtrodisulfure rductase forme un complexe de deux sous-units, HdrD o se trouve le site actif ainsi que deux noyaux [4Fe-4S] [58]. HdrE est un cytochrome b2. Enfin la mthanophnazine (MP) fait un va-et-vient entre les deux systmes. Elle peut tre remplace exprimentalement par un analogue soluble plus facile utiliser, la 2-hydroxyphnazine, et son cycle rappelle celui dune quinone dans une chane respiratoire classique. En comptabilisant les protons changs par lensemble, on voit que quatre protons sont prlevs dans le cytoplasme, et quatre autres sont mis au-dehors. Pour chaque paire d'lectrons transfrs partir d'une molcule d'hydrogne, il y a donc un pompage thorique de quatre protons. L'exprience en indique 3,6. Le saut nergtique total est de lordre de 42 kJ . mol1, suffisant pour la formation dune molcule dATP ( 32 kJ . mol1 ltat standard). On estime que dans les conditions relles o le taux dhtrodisulfure prdomine sur celui des thiols ltat spar, lnergie disponible est nettement suprieure. Lhydrognase VhoAGC nest pas seule pourvoir un pouvoir rducteur pour ce systme. Une autre hydrognase peut la remplacer en catalysant : F420-H2 + mthanophnazineox F420 + H2 + mthanophnazinered.

L'nergie serait libre en deux temps. On sait que le F420-H2 est produit par dautres ractions en amont. Cette hydrognase, quon appelle aussi la F420-H2 dshydrognase, pourrait aussi faire une translocation de protons la manire de la NADH dshydrognase mitochondriale. L'tude exprimentale faite avec des membranes isoles de Methanosarcina mazei semble confirmer cette analogie. Elle montre qu'il y a bien tablissement d'un gradient transmembranaire de H+ au cours de l'oxydation de la F420-H2. La mthanophnazine est reprsente par son analogue soluble, la 2-hydroxyphnazine (2OH-P) [59], et les membranes isoles catalysent les deux ractions successives : H2 + 2OH-P dihydro-2-OH-phnazine (2OH-PH2) 2OH-PH2 + CoM-S-S-CoB 2OH-P + HS-CoM + HS-CoB (G' = 31,8 kJ . mol1) (G' = 10,6 kJ . mol1)

4 - HYDROGNE - ACTATE - MTHANE

229

Ces ractions sont donc exothermiques l'une et l'autre. La seconde n'est autre que celle de l'htrodisulfure rductase. L'exprience montre que les membranes sont le sige la fois d'un gradient de protons et d'une synthse d'ATP partir d'ADP et de phosphate. Chaque raction s'accompagne d'une translocation de protons dans un rapport H+/2e dont la valeur mesure est au plus de 0,9 pour chacune. La p qui en rsulte est suffisante pour une synthse d'ATP. Les mesures indiquent 0,25 ATP par paire d'lectrons. L'action de dcouplants confirme que l'une et l'autre de ces tapes sont productrices d'nergie utilisable par la cellule. Si on fait le bilan des aspects nergtiques de la mthanognse partir de CO2 + H2, on voit quelle entrane la formation dun potentiel ionique fond sur un gradient de protons ou d'ions Na+. Nous avons vu en effet que le sodium intervient aussi dans certaines tapes nergtiques. LATP peut-il tre form la fois partir de Na+ et H+ ? La question reste controverse, mais la tendance est de l'expliquer par la prsence de deux facteurs, un antiporteur Na+/H+ (un ion Na+ rentre pour un proton qui sort), et une ATP synthase de type F couplant la synthse dATP avec le retour des protons vers l'intrieur [60]. Il est nanmoins possible que certains mthanognes possdent une ATP synthase capable d'effectuer ce couplage directement avec les ions sodium. Un tel dispositif est connu en dtail dans une eubactrie, Propionigenium modestum. En conclusion de ces deux dernires sections, nous assistons une biochimie tonnante qui s'carte des circuits classiques prsents dans la majorit des espces vivantes, et loin de faire figure d'organismes frustes et primitifs, les mthanognes rvlent en fait une physiologie trs sophistique. L'nergie dgage par la fabrication du mthane est rcupre en grande partie par un potentiel membranaire. La mthanognse est une oxydation d'hydrogne par le CO2 comme accepteur et apparat en principe comme une respiration anarobie sur CO2. En somme le mthane n'est pas un produit de fermentation au sens biochimique du terme, contrairement ce que l'on croit souvent.

4.7 - DE LACIDE ACTIQUE AU MTHANE


Une part importante du mthane de la biosphre tire son origine de lacide actique produit par les fermentations et les actognes. Cest lactotrophie, tudie en particulier avec Methanosarcina thermophila. La synthse de mthane partir de l'acide actique est dite actoclastique. Le MPTH4 y est remplac par un cofacteur trs voisin appel ttrahydrosarcinaptrine (SPTH4) [61], une particularit relativement peu importante car le fonctionnement reste exactement le mme 14. Pour faciliter la comprhension, la notation MPTH4 a t conserve ici tout en gardant en mmoire cette petite diffrence.

14 - La chane latrale hydroxyglytaryle est allonge par une liaison amidique avec lacide glutamique.

230 Lacide actique est trait de la faon suivante :

BIODGRADATIONS ET MTABOLISMES

Actate + ATP Actyl-phosphate + ADP Actyl-phosphate + HS-CoA CH3CO-S-CoA + phosphate CH3CO-S-CoA + MPTH4 + H2O CH3-MPTH4 + HS-CoA + CO2 + 2H + 2e
+

(1) (2) (3)

La raction (3) portant sur lactyl-coenzyme A est la plus importante, car elle revient scinder rversiblement lactyle en mthyle et CO2 avec libration dun pouvoir rducteur emport par une ferrdoxine rduite. Ce mcanisme est indirectement gnrateur de mthane, car le CH3-MPTH4 peut dcharger son mthyle sur le coenzyme M. Ce dernier participera son tour la formation de lhtrodisulfure comme dcrit antrieurement. La raction (3) a une trs grande importance car elle peut marcher dans les deux sens. En fonctionnant de droite gauche, elle fait de l'actyl-CoA susceptible dentrer dans le mtabolisme cellulaire comme point de dpart de multiples synthses, l'indispensable source de carbone sans laquelle les mthanognes ne sauraient se dvelopper. Mais le dioxyde de carbone est utilis par la raction (3) dans la direction inverse. Il sagit dune vritable assimilation de CO2, lactyl-CoA tant le maillon initial qui permettra la synthse de tous les autres constituants cellulaires. La mme raction ncessaire la mthanognse partir de lactate est donc aussi la base dune autotrophie, puisque le CO2 est utilisable comme seule source de carbone. Par sa rversibilit, la raction (3) fait se superposer deux protocoles distincts, la mthanognse actoclastique, qui est productrice d'nergie, et l'assimilation du CO2. Lorsque la mthanognse fonctionne, celui-ci n'est pas totalement rcupr. La mthanognse sur actate laisse chapper un peu de dioxyde de carbone dont l'origine est prouve par les expriences de marquage. Pour synthtiser l'actyl-coenzyme A, le mthyl-MPTH4 fournira le groupe mthyle tandis que le carbonyle sera produit par la rduction de CO2 en CO [62]. Cette opration est catalyse par la CO dshydrognase. Cette enzyme dj rencontre chez les actognes fonctionne ici selon un principe similaire, soit pour la scission de la liaison C-C dans lactyl-CoA, soit comme actyl-CoA synthase. Nous la dsignerons en abrg par CODH/ACS. La raction (3) n'allant pas jusqu'au bout s'arrte au monoxyde de carbone en devenant : CH3CO-S-CoA + MPTH4 CH3-MPTH4 + HS-CoA + CO (4)

Le CH3-MPTH4 est alors la source du mthane par le mme cheminement que vu antrieurement. Lactate pourrait avoir exist aux temps les plus anciens de lvolution. Cette raction reprsenterait un modle primitif dautotrophie dans une atmosphre primitive, et les fortes homologies de squence releves en comparant les enzymes cls dans les bactries et les archaebactries semblent indiquer qu'il a t repris dans des directions parallles, mais avec des diffrences dans la stratgie utilise [63]. Ainsi chez les bactries actognes, le gaz carbonique tait rduit et activ en phase soluble grand renfort dATP avant d'tre transform en formyl-FH4 par le canal de la formiate dshydrognase et de la formyl-FH4 synthtase. Le potentiel du couple CO2 + mthanofurane/formyl-mthanofurane est vers 500 mV. Il est compens par un courant dlectrons inverse actionn par le potentiel membranaire (H+ ou Na+).

4 - HYDROGNE - ACTATE - MTHANE

231

La CO dshydrognase dite CODH/ACS est donc la fois au cur de la mthanogense actoclastique et de lautotrophie des archaebactries du type Methanosarcina. On admet provisoirement que lenzyme fonctionne par un mcanisme inverse de celui qui a t dcrit chez les actognes du genre Clostridium [64]. Rappelons que la CODH/ACS a la particularit de renfermer du nickel. La CODH/ACS de Methanosarcina barkeri et de M. thermophila est un complexe de masse molculaire trs leve (1600 kDa environ) de formule 6 6 6 6 6. On y distingue plusieurs parties [65], dont lactyl-CoA synthase proprement dite par les sous-units, dsignes ici , et , avec un site actif port par les sous-units appeles ici et rappelant celui de la CODH des actognes. On y trouve du nickel et des noyaux [4Fe-4S]. Tous les auteurs s'accordent pour reconnatre le caractre essentiel du nickel. La prsence du cuivre reste confirmer, mais elle semble probable car Cu a t dtect depuis longtemps dans la CODH/ACS de M. barkeri [66]. C'est un point qui reste obscur. Le lieu o se fait ou se dfait la liaison CC de lactyle est un noyau bi-mtallique spcial de type Ni-x-[4Fe-4S]. Les sous-units et correspondent la mthyl-transfrase et renferment le corrinode. Le mcanisme enzymatique regard ici dans le sens actyl-CoA mthyle + CO est encore imparfaitement connu et sujet controverses. Lintervention du fer et du nickel a t prouve par RPE, et apparat comme certaine. Le groupe mthyle n de la rupture de l'actyle est inject sur le corrinode dune sous-unit voisine, moyennant un changement de valence du cobalt sur le principe expliqu antrieurement. Le mthyle sera transmis par la suite au coenzyme M en vue de la prparation du mthane. Le carbonyle quitte le site actif sous forme de monoxyde de carbone. Celui-ci reste attach au complexe o il migre sur un site (appel site C) contenant aussi, croit-on, un noyau bi-mtallique renfermant du nickel et un noyau [4Fe-4S] qui serait le support de lactivit CO dshydrognase. Les ions cyanure inhibent fortement cette phase. Le monoxyde de carbone reste li l'enzyme tant qu''il n'a pas t oxyd. Les lectrons librs par cette oxydation lectrons sont changs avec l'extrieur par lintermdiaire dune ferrdoxine, et ils seront utiliss dans la conversion du mthyl-coenzyme M en mthane. [CO] + Ferrdoxine oxyde + H2O CO2 + Ferrdoxine rduite + 2 H+

La ferrdoxine rduite cde les lectrons une oxydorductase membranaire qui fait office dhydrognase comme dans le systme rencontr antrieurement, avec la chane : cytochrome b1 mthanophnazine cytochrome b2 htrodisulfure rductase. Le fonctionnement de la CODH/ACS rejoint donc le mcanisme dj rencontr. On s'attend trouver de grandes similitudes de mcanisme entre l'actyl-CoA synthase des mthanognes et celle des actognes, la premire pratiquant la mthanognse actoclastique. On constate cependant des divergences d'une espce l'autre et la prudence s'impose. Il n'y a qu'une homologie de squence insignifiante entre ces enzymes des actognes au mthanognes. Il apparat qu'elles ont diverg dans des temps trs anciens de l'volution sans qu'on puisse dire si le mcanisme de la catalyse a t exactement conserv. Tout le monde

232

BIODGRADATIONS ET MTABOLISMES

s'accorde penser qu'il s'agit bien d'un modle d'autotrophie trs primitif, dont il existe des vestiges chez des bactries phototrophes . la mthanognse sur acide actique se trouve associe une anhydrase carbonique. Cette enzyme catalyse la raction : CO2 + H2O HCO3 + H+. La raction n'a pas besoin de catalyseur pour fonctionner dans un sens ou dans l'autre, mais elle est acclre dun facteur norme par les anhydrases carboniques isoles un peu partout dans le monde vivant, chez les animaux, plantes, cyanobactries et bactries. Celles des archaebactries appartiennent un type spcial mais fonctionnent comme les autres avec du zinc. On dispose dune structure dtaille de cette enzyme dans le cas de Methanosarcina thermophila [67]. Quelle peut tre lutilit de lanhydrase carbonique au cours de la mthanognse, puisqu'elle ne fait qu'acclrer une raction qui se produirait de toute faon sans elle ? Si on se reporte lnergie produite par la mthanognse actoclastique ( 36 kJ . mol1 dans les conditions standard), il est clair quelle est assez faible, car elle nat principalement de la rduction du mthyl-CoM. Le rsultat devrait tre amlior si le gaz carbonique engendr aprs rupture de l'actyl-CoA tait rapidement soustrait de lquilibre ds son apparition, dplaant celui-ci dans un sens favorable et renforant la production d'nergie. C'est peut-tre le rle de lanhydrase de soutirer le plus rapidement possible le CO2 form afin d'amliorer le gain nergtique.

4.8 - MTHANOGNES ET BIODGRADATIONS


Les archaebactries mthanognes se dveloppent dans des milieux strictement anarobies, localiss en principe dans les couches les plus profondes d'une stratification o se succdent partir de la surface les arobies, les dnitrifiants, les bactries rductrices du fer et du manganse, les sulfato-rducteurs, les actognes, et finalement les mthanognes. Les biodgradations de substances naturelles ou xnobiotiques peuvent avoir lieu tous les niveaux, mais les plus actives sont gnralement dans les milieux arobies. C'est une constatation facile faire par la pratique du compostage. On pourrait supposer que certains polluants transports profondment l'abri de toute trace d'oxygne deviennent rcalcitrants une biotransformation et conduire des accumulations nuisibles. Compares aux arobies tels que les Pseudomonas, ou encore les bactries qui oxydent le mthane, les mthanognes peuvent apparatre comme des organismes trs spcialiss disposant de potentialits limites en dehors de leur mtabolisme trs particulier et inimitable. Les mthanognes sont tributaires de produits simples qui sont gnrs par les autres, comme l'hydrogne, le gaz carbonique, l'acide actique et quelques produits carbons faible masse molculaire. Ils sont nanmoins capables de transformer en mthane des substrats plus labors tels que des glucides. On peut donc supposer que la mthanognse peut s'accomplir sur une varit de composs plus grande qu'initialement escompt. La difficult des recherches est d'ordre technique. Le dveloppement des mthanognes est

4 - HYDROGNE - ACTATE - MTHANE

233

relativement lent, et ncessite des contraintes qui n'ont rien voir avec celles des organismes versatiles dveloppement trs rapide comme la plupart des bactries leves au laboratoire. L'isolement de mthanognes pour les tudes de biodgradation se fait gnralement partir de vases et sdiments o le dgagement de CH4 est constat. L'oxygne, le nitrate, le fer et le sulfate doivent avoir pratiquement disparu, mettant hors course les comptiteurs. De trs nombreuses recherches ont eu lieu pour tenter de comprendre comment des contaminants peuvent tre pongs par l'action des mthanognes, qui reprsentent en fait le dernier recours quand les autres possibilits sont puises. Un exemple reprsentatif est le travail de ZENGLER et coll [68]. Un enrichissement progressif a t fait partir d'un chantillon de sdiment, dans un milieu minral sans sulfate et priv d'oxygne, contenant un tampon bicarbonate pH 7 et du sulfure comme source de soufre. Le substrat carbon tait un hydrocarbure (hexadcane). L'exprience a dur de un deux ans. Le gaz form tait principalement du mthane, qui apparaissait seulement lorsque l'hydrocarbure tait prsent. Cette lente transformation s'expliquait par l'association de plusieurs groupes de micro-organismes actognes et archaebactriens. Leur relation tait celle du syntrophisme. Des actognes dgradaient l'alcane. L'hydrogne, le gaz carbonique et l'acide actique taient rcuprs par les mthanognes pour faire du mthane. 4 C16H34 + 64 H2O 32 CH3COO + 32 H+ + 68 H2 (G = 929 kJ) 32 CH3COO + 32 H+ 32 CH4 + 32 CO2 (G = 385 kJ) 68 H2 + 17 CO2 17 CH4 + 34 H2O (G = 282 kJ) Le bilan total est : 4 C16H34 + 30 H2O 49 CH4 + 15 CO2 (G = 1596 kJ) (4) (1) (2) (3)

Les ractions (2) et (3) sont celles des mthanognes. Les variations d'nergie libre ne sont pas l'tat standard, mais sont des valeurs moyennes estimes partir des concentrations relles. La consommation de l'hydrogne au fur et mesure de sa production est un point important, sinon la raction (1) des actognes ne produiraient aucune nergie. La quantit relle de mthane enregistre au cours de la consommation d'hexadcane tait un peu infrieure la quantit thorique, probablement cause des pertes de gaz et du dtournement du carbone pour les synthses cellulaires. L'emploi d'hexadcane enrichi en carbone-13 a rvl que le mthane form tait bien produit partir de l'hydrocarbure, malgr le risque d'artefact introduit par l'usage du bicarbonate comme tampon. Quelle est la nature de l'association microbienne ? Les analyses d'ARN 16S ont indiqu par comparaison avec les squences connues la prsence de protobactries de la classe delta, de mthanognes actoclastiques (proches de Methanosaeta) et de mthanognes utilisateurs de CO2 et de H2. Les mthanognes peuvent raliser par eux-mmes une dchloration de substrats carbons chlors un ou deux atomes de carbone. Cette proprit est partage par d'autres espces anarobies qui ont toutes en commun l'utilisation de la voie de WOOD-LJUNGDAHL o intervient l'actyl-CoA synthase. Le ttrachloromthane (CCl4) est transform en produits partiellement dchlors ou en CO2 par des mthanognes,

234

BIODGRADATIONS ET MTABOLISMES

des actognes (Acetobacterium woodii) et des sulfato-rducteurs (Desulfobacterium autotrophicum). Cette transformation est observable avec des suspensions cellulaires ou des extraits autoclavs, ce qui souligne le pouvoir catalytique d'au moins un des cofacteurs de la voie de WOOD-LJUNGDAHL, savoir un corrinode. Cette hypothse est clairement vrifie dans le cas de Methanosarcina barkeri. Ce mthanogne transforme le 1,2-dichlorothane en chlorothane ou en thylne. Or cette intressante dshalognation appartient aussi la cobalamine ou au F430, condition de placer dans le milieu du citrate de titane, Ti(III), afin de maintenir un bas potentiel rducteur (voir Titane*). Le premier cofacteur a du cobalt, le couple Co(II)/Co(I) a un potentiel de 610 mV. Le second a du nickel, avec un couple Ni(II)/Ni(I) dont le potentiel est comparable au prcdent. Ces deux cofacteurs ont donc par eux-mme un puissant pouvoir catalytique qui explique facilement l'action des cellules mthanognes. Le cycle catalytique pour la cobalamine serait le suivant. Le citrate de Ti(III) servirait de source d'lectrons. Le cobalt(I) ragirait avec le substrat par oxydation en Co(III) avec le dpart du chlorure et la formation d'une liaison CoC. Nous retrouvons les changements structuraux des liens autour du cobalt* en fonction de l'tat d'oxydorduction, rencontrs prcdemment et expliqus en glossaire. La lettre L symbolise une liaison interne forme sur la cobalamine au cours de ces changements.
Cl H CoI N: Ti(IV) Ti(IV) Ti(III) CoII N Ti(III) L CoIII N H H H H2O H Cl H H H CI H H CI Cl H H H H

CoIII N + CI H H H

1,2-dichlorothane
Le F430 catalyserait un cycle similaire, selon un mode en partie radicalaire et un passage altern du nickel entre Ni(I) et Ni(II). L'attaque du substrat se ferait par Ni(I), le citrate de titane tant utilis comme source d'lectrons. Cette remarquable chimie non enzymatique a t tudie par HOLLIGER et coll. [69] et s'est trouve facilite par les modifications spectrales des catalyseurs. Elle permet de comprendre le mode d'action des mthanognes dans ces dshalognations. Des tudes ont lieu en vue d'applications pour l'assainissement des eaux contamines par des hydrocarbures halogns, notamment au Canada. Une opinion gnralement admise veut que les mthanognes puissent participer des biodgradations dans les sdiments profonds la faveur d'un syntrophisme

4 - HYDROGNE - ACTATE - MTHANE

235

avec d'autres espces. Ils seraient les boueurs terminaux utilisateurs des sousproduits de l'activit de leurs partenaires. C'est peut-tre leur fonction dominante dans les quilibres naturels. On peut les voir en particulier comme des organismes qui contribuent dtoxifier l'acide actique et l'hydrogne. Dans la section suivante, nous rencontrerons des mthanognes dans une symbiose de type original.

4.9 - HYDROGNOSOMES
la fin de ce chapitre o nous avons examin la gense de l'hydrogne, de l'actate et du mthane, il convient de citer une bizarrerie de la nature : les hydrognosomes. Ce sont particules subcellulaires, d'une taille comparable celle des mitochondries (0,5-2 m), observes pour la premire fois dans un eucaryote parasite unicellulaire responsable d'infections vnriennes, Trichomonas vaginalis. On a pu les obtenir l'tat isol et dterminer leur biochimie. Leur proprit essentielle est de produire, en anarobiose, de l'actate partir du pyruvate, ainsi que H2 et CO2 en quantits comparables. En prsence d'oxygne, les particules effectuent une respiration sans faire d'hydrogne, mais dgnrent rapidement sans doute cause de l'apparition de peroxyde et de superoxyde. Le terme d'hydrognosome est d LINDMARK et MLLER [70]. Les hydrognosomes n'ont encore jamais t rencontrs chez les animaux pluricellulaires et les plantes. Ils existent dans les champignons et protozoaires cilis du rumen ainsi que dans les euglnes. Leur structure est assez rudimentaire, comportant le plus souvent une seule membrane. Ils sont en principe dpourvus d'ADN, et leur synthse interne la cellule relve de gnes localiss dans le noyau. Les cellules qui les hbergent n'ont bien souvent ni peroxysomes, ni mitochondries, et vivent gnralement en milieu quasi-anarobie. Les hydrognosomes tiennent lieu de producteurs d'nergie, non pas comme les mitochondries en faisant un potentiel membranaire, mais en synthtisant de l'ATP au niveau du substrat comme dans une fermentation. Un tableau simplifi reprsente le mtabolisme anarobie observ dans ces particules [71]. Il indique les enzymes utilises, et met en vidence le rle d'une ferrdoxine (Fd) contenant des noyaux [2Fe-2S], d'une hydrognase et du coenzyme A (CoA). La dshydrognase 2, d'un type particulier puisqu'elle conduit une dcarboxylation, est couramment appele enzyme malique chez les plantes o elle est omniprsente. Les particules comportent un certain nombre de transporteurs membranaires. Le pyruvate est issu du mtabolisme du glucose. On constate qu'il y a un seul ATP form partir d'une molcule de pyruvate. La transformation de l'actyl-CoA en actate prsente une variante intressante dans les protozoaires du rumen. Il y a d'abord conversion de l'actyl-CoA en actyl-phosphate, et c'est celui-ci qui sert de donneur la synthse d'ATP. Cette particularit est intressante, car elle est typique du mtabolisme des procaryotes dans certaines fermentations. On ne la trouve pas normalement chez les eucaryotes. Un autre caractre tonnant s'observe chez les protozoaires cilis.

236
cytoplasme CO2 pyruvate NADH 3 2 Fdox 1 CO2 CoA 2 Fdred 4 actyl-CoA 2 NAD+ malate

BIODGRADATIONS ET MTABOLISMES

hydrognosome

H2 2 H+ 5 succinyl-CoA 6 ATP ADP Pi actate

succinate

1 - Pyruvate-ferrdoxine oxydorductase 2 - Malate dshydrognase (enz. malique) 3 - NAD-ferrdoxine oxydorductase

4 - Hydrognase 5 - Actate-succinate CoA transfrase 6 - Succinate thiokinase

Tous ceux qui ont des hydrognosomes hbergent en mme temps des endosymbiontes. Les hydrognosomes et les symbiontes sont en contact assez troit l'intrieur des cellules. On s'est aperu que ces derniers taient des archaebactries mthanognes, trahis par la fluorescence de leur cofacteur F420 ! L'explication serait la suivante. Les mthanognes rcuprent le gaz carbonique et l'hydrogne, ventuellement l'actate, pour la synthse du mthane. Des changes ont lieu l'intrieur de la cellule. Les cilis dpourvus d'endosymbiontes produisent de l'hydrogne, ceux qui en possdent n'en font pas. Il y a des cas particuliers. Par exemple Giardia intestinalis, un agent banal des dsordres intestinaux, n'a pas d'hydrognosomes, et pourtant il fait de l'hydrogne, ce qui constitue une nigme [72] ! Il s'avre que les protozoaires et champignons hydrognosomes sont peut-tre lgion dans l'environnement. Au fond ces particules aident les cellules survivre dans un environnement anarobie, ce que la plupart des eucaryotes ne font que difficilement ou au prix de mtabolismes d'attente insuffisants pour la croissance. Les hydrognosomes participent au flux mtabolique de la cellule et contribuent faire de l'ATP. Mais la question de leur nature et de leur origine se pose. Ils prsentent avec les mitochondries des analogies certaines. Les similitudes portent sur les squences de diverses protines comme les ferrdoxines [73], la succinate thiokinase [74], l'adenylate kinase et des protines de transport. Un indication trs probante est la similitude constate entre les protines dites du stress*, Hsp60 et Hsp70 parmi les bactries, les mitochondries et les hydrognosomes. La parent avec les mitochondries a fait l'objet de nombreuses spculations.

4 - HYDROGNE - ACTATE - MTHANE

237

Les mitochondries sont supposes driver des -protobactries. Il est possible que les hydrognosomes rsultent d'une ou plusieurs symbioses survenues avant l'apparition des mitochondries dans les cellules des eucaryotes [75]. La dgradation des bactries d'origine serait alle plus loin, conduisant la capture totale du matriel gntique au profit du noyau, alors que les mitochondries conservent encore un ADN et des synthses autonomes. Une autre hypothse consiste supposer une origine commune aux mitochondries et aux hydrognosomes. Les premires mitochondres auraient colonis des eucaryotes primitifs dots d'un mtabolisme anarobie. Ces premires mitochondries auraient pu faire de l'ATP par respiration anarobie sur fumarate et nitrate, contrairement aux mitochondries de la quasitotalit des eucaryotes modernes qui utilisent le dioxygne. Des mitochondries utilisatrices de nitrate ont t aperues chez divers champignons et protozoaires amens manquer d'oxygne dans leur habitat. Les hydrognosomes auraient donc pu driver des mitochondries les plus primitives. La question a t relance par la dcouverte d'un ADN dans certains hydrognosomes prsents dans Nyctotherus ovalis, un cili htrotriche de l'intestin des grandes blattes (Periplaneta americana). L'ADN a t dtect par une mthode immunologique. L'amplification de cet ADN et l'examen d'une squence de 3,6 kb rvle un segment susceptible de coder pour une hydrognase fer seul, avec des sites de liaison pour le FAD et NAD+ qui suggrent une fonction de roxydation de NADH [76]. L'hydrognase prsume serait bien code en partie par l'ADN des hydrognosomes, et en partie par l'ADN nuclaire. Cette question originale et intressante pose encore plus de questions qu'elle n'en rsoud. Tous les organismes dtenteurs d'hydrognosomes vivent dans des niches cologiques anarobies ou faible taux d'O2. Ils sont nanmoins disperss dans plusieurs groupes volutifs qui contiennent des espces voisines hbergeant toutes des mitochondries. Il est donc probable qu'il y a plusieurs lignes conduisant aux hydrognosomes. L'volution et la signification de ces tranges symbiontes sont encore des challenges pour la recherche. Cette question indite et encore entoure de mystre termine point nomm un chapitre o les solutions naturelles originales n'ont pas manqu.

CONCLUSION
Dans ce chapitre nous avons ajout une pice au grand cycle du carbone dans la biosphre, soulign le rle central de l'acide actique, rencontr la biochimie trs particulire de la mthanognse. Les organismes responsables contribuent tendre aux milieux anarobies le champ des biodgradations. Ils ont diverg et se sont diversifis depuis une priode trs ancienne, utilisant des mcanismes qui ont fonctionn tout au long de la longue priode d'volution pour laquelle nous avons des traces. Dans le chapitre suivant, nous reviendrons au cycle de l'azote, dj entrevu avec l'oxydation de l'ammoniac, pour entrer dans des tapes essentielles observes l encore dans les milieux anarobies.

238

BIODGRADATIONS ET MTABOLISMES

RFRENCES
[1] V I G N A I S PM & C O L B E A U A (2004) Curr. Issues Mol. Biol. 6 : 159-188. [2] G H I R A R D I ML, Z H A N G L, L E E JW , F L Y N N T, S E I B E R T M, G R E E N B A U M E & M E L I S A. (2000) Trends Biotechnol. 18 : 506-511. [3] V O L B E D A A, C H A R O N MH , P I R A S C , H A T C H I K I A N EC , F R E Y M & F O N T E C I L L A - C A M P S JC . (1995) Nature 373 : 556-557 ; F O N T E C I L L A - C A M P S JC , F R E Y M, G A R C I N E, H A T C H I K I A N C , M O N T E T Y , P I R A S C , V E R N E D E X & V O L B E D A A ( 1997) Biochimie 79 : 661- 66 6 ; H I G U C H I Y , O G A T A H , M I K I K, Y A S U O K A N & Y A G I T (1999) Structure Fold 7 : 549-556 ; D E L A C E Y AL, S A N T A M A R I A E, H A T C H I K I A N EC & F E R N A N D E Z VM (2000) Biochim. Biophys. Acta 1481 : 371-380. [4] V O L B E D A A, G A R C I N E, P I R A S C , D E L A C E Y AL, F E R N A N D E Z VM, H A T C H I K I A N EC , F R E Y M & F O N T E C I L L A - C A M P S JC (1996) J. Am. Chem. Soc. 118 : 12989-12996. [5] V I G N A I S PM, B I L L O U D B & M Y E R J (2001) FEMS Microbiol. Rev. 25 : 455-501. [6] R O B E R T S LM & L I N D A H L PA (1995) J. Am. Chem. Soc. 117 : 2565-2572 ; P A V L O V M, S I E G B A H N PEM , B L O M B E R G MRA & C R A B T R E E RH (1998) J. Am. Chem. Soc. 120 : 548-555 ; C A M M A C K R (1999) Nature 397 : 214-215. [7] V I G N A I S PM, D I M O N B, Z O R I N NA, T O M I Y A N M A M & C O L B E A U A (2000) J. Bacteriol. 182 : 5997-6004. [8] G A R C I N E, V E R N E D E X, H A T C H I K I A N EC , V O L B E D A A, F R E Y M & F O N T E C I L L A - C A M P S JC (1999) Structure Fold 7 : 557-566. [9] P I E R I K AJ, R O S E B O O O M W , H A P P E RP, B A G L E Y KA & A L B R A C H T S P (1999) J. Biol. Chem. 274 : 3331-3337 ; G A R C I N E, V E R N E D E X, H A T C H I K I A N EC , V O L B E D A A, F R E Y M & F O N T E C I L L A - C A M P S JC (1999) Structure Fold 7 : 557-566. [10] P E T E R S JW , L A N Z I L O T T A W N, L E M O N BJ & S E E F E L D T LC (1998) Science 282 : 1853-1858 ; N I C O L E T Y , P I R A S C , L E G R A N D P, H A T C H I K I A N EC & F O N T E C I L L A - C A M P S JC (1999) Structure 7 : 13-23. [11] G L O A G U E N F, L A W R E N C E JD , S C H M I D T M, W I L S O N S R & R A U C H F U S S TB (2001) J. Amer. Chem. Soc. 123 : 12518-12527. [12] V O O R D O U W G (2000) Biophys. Chem. 86 : 131-140 ; D U B I N I A & S A R G E N T F (2003) FEBS Lett. 549 : 141-146. [13] V I G N A I S PM, D I M O N B, Z O R I N NA, C O L B E A U A & E L S E N S (1997) J. Bacteriol. 179 : 290-292. [14] R I C H A U D P, C O L B E A U A, T O U S S A I N T B & V I G N A I S PM (1991) J. Bacteriol. 173 : 5298-5392 ; E L S E N S , C O L B E A U A, C H A B E R T J & V I G N A I S PM (1996) J. Bacteriol. 178 : 5174-5181 ; E L S E N S , C O L B E A U A & V I G N A I S PM (1996) J. Bacteriol. 179 : 968-971. [15] E L S E N S , D U C H O & C O L B E A U A (2003) J. Bacteriol. 185 : 7111-7119. [16] D I S C H E R T W , V I G N A I S PM & C O L B E A U A (1999) Mol. Microbiol. 34 : 995-1006. [17] E L S E N S , D I S C H E R T W , C O L B E A U A & B A U E R C E (2000) J. Bacteriol. 182 : 2831-2837.

4 - HYDROGNE - ACTATE - MTHANE

239

[18] S W E M LR, K R A F T BJ, S W E M D L, S E T T E R D A H L AT, M A S U D A S , K N A F F D B, Z A L K E S K I JM & B A U E R C E (2003) EMBO J. 22 : 4699-4708. [19 L J U N G D A H L LG (1986) Annu. Rev. Microbiol. 40 : 415-450 ; R A G S D A L E S W (1997) Bio Factors 9 : 1-9. [20] M A K, S I E M O N S & D I E K E R T G (1987) FEMS Microbiol. Lett. 43 : 367-371. [21] K S E L K, K A R N H O L Z A, T R I N K W A L T E R T, D E V E R E U X R, A C K E R G & D R A K E H L (2001) Appl. Environ. Microbiol. 67 : 4734-4741. [22] K A R N H O L Z A, K S E L K & G N E R A, S C H R A M M A, D R A K E H L (2002) Appl. Environ. Microbiol. 68 : 1005-1009. [23] W E L L S B U R Y P, G O O D M A N K, B A R T H T, C R A G G BA, B A R N E S S P & P A R K E S RJ (1997) Nature 388 : 573-576. [24] M E N O N S & R A G S D A L E S W (1996) Biochemistry 35 : 15814-15821. [25] F U R D U I C & R A G S D A L E S W (2000) J. Biol. Chem. 275 : 28494-28499. [26] M E N O N S & R A G S D A L E S W (1999) J. Biol. Chem. 274 : 11513-11518. [27] M E N O N S & R A G S D A L E S W (1998) Biochemistry 37 : 5689-5698. [28] D O U K O V T, S E R A V A L L I J, S T E Z O W S K I JJ & R A G S D A L E S W (2000) Structure Fold Des. 8 : 817-830. [29] S E R A V A L L I J, Z H A O S & R A G S D A L E S W (1999) Biochemistry 38 : 5715-5728. [30] K E R B Y RL, H O N G S S , E N S I G N S A, C O P P O C LJ, L U D D E N PW & R O B E R T S G P (1992) J. Bacteriol. 174 : 5284-5294. [31] Q I U D , K U M A R M, R A G S D A L E S W & S P I R O TG (1994) Science 264 : 817-819. [32] S E R A V A L L I J, G U W , T A M A, S T R A U S S E, C R A M E R S P & R A G S D A L E S W (2003) Proc. Natl. Acad. Sci. 100 : 3689-3694. [33] R O B E R T S JR, L U W - P & R A G S D A L E S M (1992) J. Bacteriol. 174 : 4667-4676. [34] D A R N A U L T C , V O L B E D A A, K I M EJ, L E G R A N D P, V E R N E D E X, L I N D A H L PA & F O N T E C I L L A - C A M P S JC (2003) Nat. Struct. Biol. 10 : 271-279. [35] L O K E H K, B E N N E T T G N & L I N D A H L PA (2000) Proc. Natl. Acad. Sci. 97 : 12530-12535. [36] G O L D T (1992) Proc. Natl. Acad. Sci. 89 : 6045-6049. [37] H A C K S T E I N JH & S T U M M C K (1994) Proc. Natl. Acad. Sci. (US) 91 : 5441-5445. [38] G R O K O P F R, J A N S S E N PH , L I E S A C K W (1998) Appl. Environ. Microbiol. 64 : 960-969 ; G R O K O P F R , S T U B N E R S , L I E S A C K W (1998) Appl. Environ. Microbiol. 64 : 4983-4989. [39] W .S . R E E B U R G H & coll. (1991) Deep Sea Res. 38 : 1189-1210. En Juillet 1996 s'est runie Istambul une premire confrence internationale destine faire l'tat des lieux et proposer des mesures au niveau mondial. [40] B U L T C J & coll. (1996) Science 273 : 1058-1073 ; S M I T H D R & coll. (1997) J. Bacteriol. 179 : 7135-7155. [41] B L A U T M & G O T T S C H A L K G (1985) Trends Biochem.Sci. 10 : 486-489 ; L A N C A S T E R JR (1989) J. Bioenerg. Biomembr. 21 : 717-740. [42] F E R R Y JG (1999) FEMS Microbiol.Rev. 23 : 13-38 ; S C H F E R G , E N G E L H A R D M & M L L E R V (1999) Microbiol. Molecul. Biol. Rev. 63 : 1092-2172. [43] K A R R A S C H M, B O R N E R G , E N S S L E M & T H A U E R RK (1990) Eur. J. Biochem. 394 : 167-172.

240 [44] T H A U E R RK (1998) Microbiology 144 : 2377-2406.

BIODGRADATIONS ET MTABOLISMES

[45] C H I S T O S E R D O V A L, V O R H O L T JA & T H A U E R RK, L I D S T R O M ME (1998) Science 281 : 99-102. [46] K U N O W J, S H I M A S , V O R H O L T JA & T H A U E R RK (1996) Arch. Microbiol. 165 : 97-105. [47] E R M L E R U, M E R C K E L M, T H A U E R R & S H I M A S (1997) Structure 5 : 635-646. [48] E N S S L E M, Z I R N G I B L C , L I N D E R D , T H A U E R RK (1991) Arch. Microbiol. 155 : 483-490 ; K L E I N AR, K O C H J, S T E T T E R KO & T H A U E R RK (1993) Arch. Microbiol. 160 : 186-192. [49] K L E I N AR & T H A U E R RK (1995) Eur. J. Biochem. 227 : 169-174. [50] Z I R N G I B L C , V A N D O N G E N W , S C H W O R E R B, V O N B U N A U R, R I C H T E R M, K L E I N A & T H A U E R RK (1992) Eur. J. Biochem. 208 : 511-520. [51] S C H W R E R B, F E R N A N D E Z VM, Z I M G I B L C & T H A U E R RK (1993) Eur. J. Biochem.212 : 255-261 ; T H A U E R RK, K L E I N AR & H A R T M A N N G C (1996) Chem. Rev. 96 : 3031-3042 ; A F T I N G C , K R E M M E R E, B R U C K E R C , H O C H E I M E R A & T H A U E R RK (2000) Arch. Microbiol. 174 : 225-232. [52] B R O M M E L S T R O E T BW J , G E E R T S W J, K E L T J E N S JT, V A N D E R D R I F T C & V O G E L S G D (1991) Biochim. Biophys. Acta 1079 : 293-302. [53] B E C H E R B, M U L L E R V, G O T T S C H A L K G (1992) J. Bacteriol. 174 : 7656-7660 ; G A R T N E R P, W E I S S D S , H A R M S U & T H A U E R RK (1994) Eur .J. Biochem. 226 : 465-472 ; L I E N A R D T, B E C H E R B, M A R S C H A L L M, B O W I E N S & G O T T S C H A L K G (1996) Eur. J. Biochem. 239 : 857-864. [54] L I E N A R D T & G O T T S C H A L K G (1998) FEBS Lett. 425 : 204-208. [55] R O S P E R T S , L I N D E R D , E L L E R M A N N J & T H A U E R RK (1990) Eur. J. Biochem. 194 : 871-877 ; E R M L E R U, G R A B A R S E W , S H I N A S , G O U B E A U D M & T H A U E R RK (1997) Science 278 : 1457-1462. [56] A B K E N H J, T I E T Z E M, B R O D E R S E N J, B A M E R S , B E I F U S S U, D E P P E N M E I E R U (1998) J. Bacteriol. 180 : 2027-2032. [57] D E P P E N M E I R U,M L L E R V & G O T T S C H A L K G (1996) Arch. Microbiol. 165 : 149-163 ; I D E T, B A M E R S & D E P P E N M E I R U (1999) J. Bacteriol. 181, 4076-4080. [58] S I M I A N U M, M U R A K A M I E, B R E W E R M & R A G S D A L E S W (1998) Biochemistry 37 : 10027-10039. [59] B R O D E R S E N J, B A M E R S , A B K E N H J, G O T T S C H A L K G & D E P P E N M E I E R U (1999) Eur. J. Biochem. 259 : 218-224. [60] R U P P E R T C , W I M M E R S S , L E M K E R T, M L L E R V (1998) J. Bacteriol. 180 : 3448-3452. [61] V A N B E E L E N P, L A B R O JF, K E L T J E N S JT, G E E R T S W J, V O G E L S G D , L A A R H O V E N W H , G U I J T W & H A A S N O O T C A (1984) Eur. J. Biochem. 139 : 359-365. [62] S H I E H J & W H I T M A N W B (1988) J. Bacteriol. 170 : 3072-3079. [63] O L S E N G J & W O E S E C R (1996) Trends Genet. 12 : 377-379 ; H U B E R C & W A C H T E R S H A U S E R G (1997) Science 276 : 245-247. [64] R A G S D A L E S W (1998) Curr. Opin. Chem. Biol. 2 : 208-215. [65] G R A H A M E D A (1991) J. Biol. Chem. 266 : 22227-22233 ; G R A H A M E D A & D E M O L L E (1991) J. Biol. Chem. 271 : 8352-8358 ; M U R A K A M I T & R A G S D A L E S W (2000) J. Biol. Chem. 275 : 4699-4707. [66] K R Z Y C K I JA, M O R T E N S O N LE & P R I N C E RC (1989) J. Biol. Chem. 264 : 7217-7221. [67] K I S K E R C , S C H I N D E L I N H , A L B E R BE, F E R R Y JG & R E E S D C (1996) EMBO J. 15 :2323-2330.

4 - HYDROGNE - ACTATE - MTHANE [68] Z E N G L E R K, R I C H N O W H H , R O S S E L L - M O R A R, M I C H A E L I S W & W I D D E L F (1999) Nature 401 : 266-269. [69] H O L L I G E R C , S C H R A A G , S T U P P E R I C H E, S T A M S AJM & Z E H N D E R AJB (1992) J. Bacteriol. 174 : 4427-4434. [70] L I N D M A R K D G & M L L E R M (1973) J. Biol. Chem. 248 : 7724-7728. [71] M L L E R M (1993) J. Gen. Microbiol. 139 : 2879-2889. [72] L L O Y D D , R A L P H S JR & H A R R I S JC (2002) Microbiology 148(Pt 3) : 727-733. [73] J O H N S O N PJ, D ' O L I V E I R A C E, G O R R E L L TE & M L L E R M (1990) Proc. Natl. Acad. Sci. 87 : 6097-6101. [74] L A H T I C J, D ' O L I V E I R A C E & J O H N S O N PJ (1992) J. Bacteriol. 174 : 6822-6830. [75] B A R O I N - T O U R A N C H E A U A, D E L G A D O P, P E R A S S O R & A D U O T T E A (1992) Proc. Natl. cad. Sci. 89 : 9764-9768 ; D Y A L L S D & J O H N S O N PJ (2000) Curr. Opin. Microbiol. 3 : 404-411. [76] A K H M A N O V A A, V O N C K E N F, V A N A L E N T, V A N H O E K A, B O X M A B, V O G E L S G , V E E N H U I S M & H A C K S T E I N JH P (1998) Nature 396 : 527-528.

241

CHAPITRE 5 AZOTE ET ANAROBIOSE


Le cycle de l'azote passe par des tapes essentielles qui sont l'azote atmosphrique, l'ammoniac et le nitrate. Les aspects essentiels dvelopps ici sont l'assimilation du premier et la dnitrification qui rduit par tapes le nitrate en N2. L'assimilation de N2 n'est ralise que par des procaryotes grce leur nitrognase. La dnitrification fournit une part importante de l'nergie ncessaire au recyclage de la matire organique l'abri de l'air. Elle met en jeu des outils spcifiques. L'alternance entre les conditions arobies et anarobies dans une mme espce bactrienne met en jeu des remaniements physiologiques importants qui sont voqus la fin de ce chapitre. 5.1 - Le cycle biologique de lazote 5.2 - Ceux qui assimilent lazote 5.3 - La nitrognase 5.4 - Contrle de lassimilation de lazote 5.5 - Les voies du nitrate 5.6 - Le passage lanarobiose 5.7 - Une optimisation trs pousse 245 248 252 258 264 270 275

5 AZOTE ET ANAROBIOSE
Les biodgradations et le recyclage de la matire organique dans la biosphre dpendent pour une part de la dnitrification. Ce procd consiste utiliser l'ion nitrate comme accepteur d'lectrons en l'absence d'oxygne, et son intervention est considrable dans les biodgradations anarobies. Le nitrate est une tape fondamentale du cycle de l'azote dans la nature, comme l'est l'azote atmosphrique. Le cycle de l'azote constitue donc un tout, sans lequel on ne pourrait pas comprendre bon nombre des transformations de la biosphre.

5.1 - LE CYCLE BIOLOGIQUE DE LAZOTE


Compar au carbone, loxygne et lhydrogne, lazote est un constituant minoritaire des tres vivants, mais il est tout aussi essentiel comme chacun sait. Lazote fait souvent partie des lments limitants au cours de la croissance des plantes, sinon nul serait le besoin dutiliser autant de fertilisants azots dans lagriculture. La biosphre est en contact avec deux grands rservoirs dazote. Le premier est latmosphre, o N2 est la principale forme (78%) conjointement des composs mineurs tels que les oxydes dazote et le gaz ammoniac. Le second est constitu par le sol et les ocans [1]. L'azote est immobilis en grande quantit dans des roches o il nest pas mobilisable par les tres vivants. Il y est trs ingalement rparti, abondant sous forme de KNO3 dans le salptre et de NaNO3 dans les vaporites. Les nitrates du Chili proviennent notamment de l'important gisement de nitrate de sodium des hauts plateaux dsertiques et secs de l'Altacama. Lammonium existe en faible proportion dans les roches cristallines, o il peut remplacer le potassium des minraux. Une teneur en azote relativement leve (200 4000 ppm) sobserve dans le granite et rsulte sans doute de lassimilation de roches sdimentaires au cours de lintrusion du magma. La quantit dazote log dans les roches sdimentaires, majoritairement sous forme organique, atteindrait 1015 tonnes, principalement dans les schistes et ptroles, et le sol vgtal superficiel ne contiendrait finalement quune part trs minime de lazote terrestre. La teneur en azote dun sol est videmment trs variable. Elle oscille couramment autour de 5% en poids de N, principalement sous forme organique. Lazote directement assimilable par les tres vivants pour leurs synthses doit se trouver sous forme ammoniacale, cest--dire ltat le plus rduit. C'est sous cette forme qu'il sera intgr dans les acides amins et autres matriaux de base. Le tableau est un petit aide-mmoire pour ces voies dentre :

246 Enzyme
Glutamate dshydrognase* Aminotransfrases*

BIODGRADATIONS ET MTABOLISMES Principe ractionnel


2-oxoglutarate + NH3 + NAD(P)H, H+ F L-Glutamate + NADP+ + H2O

Glutamine synthtase* L-Glutamate + NH3 + ATP T L-Glutamine + ADP + phosphate Glutamate synthase*

L-Glutamate + 2-oxoacide F 2-oxoglutarate + acide amin

L-Glutamine + 2-oxoglutarate + NAD(P)H, H+ F 2 L-Glutamate + NADP+

Pour de trs nombreuses espces bactriennes, les ions ammonium offrent la source azote la plus favorable la croissance. On observe galement que sur un milieu riche en ammonium, la synthse des enzymes qui permettraient l'utilisation d'autres sources azotes est souvent rprime. L'activit de la glutamine synthtase est essentielle l'assimilation azote quand le milieu est pauvre en ammonium, mais elle est son niveau le plus bas si le milieu est riche en azote ammoniacal. La glutamine sert la fois d'acide amin pour la construction des protines et comme donneur d'azote dans des synthses de constituants cellulaires aussi essentiels que les bases des acides nucliques L'activit de l'enzyme est donc gnralement contrle en fonction du taux d'ammonium disponible, de faon qu'il y ait toujours suffisamment de glutamine pour le mtabolisme. Tandis que le taux de glutamine synthtase est son minimum en excs de source azote, une deuxime voie d'entre par la glutamate dshydrognase devient prpondrante. Inversement une disette en azote entrane une monte de la glutamine synthtase, dont le produite engendre du glutamate par le jeu de la glutamate synthase. Or l'azote des constituants organiques cellulaire vient du glutamate pour environ 85% ! Le cycle de lazote dans la biosphre est reprsent sur le schma suivant sous une forme trs simplifie dicte par les seuls objectifs immdiats de l'environnement. La quantit globale dazote est rgle par les apports provenant surtout de latmosphre, et par les pertes dues aux missions de gaz (N2, N2O, NH3 et composs mineurs). Lactivit humaine perturbe cet quilibre par lusage des fertilisants, la dforestation, la combustion des carburants fossiles et diverses pollutions. On sait que le nitrate est la source azote prfre des vgtaux, car il est vhicul des racines aux parties ariennes et facilement rduit en ammoniac par le pouvoir rducteur n de la photosynthse. Certaines plantes utilisent aussi lammonium, en particulier des essences forestires quand lacidit du sol nuit la nitrification [2]. La prsence de la microflore autour des racines (rhizosphre) est prendre en compte dans tous les cas de figure. Le nitrate ne concerne pas que les vgtaux terrestres. Sa rpartition a une grande importance dans la biologie des ocans la faveur des migrations du phytoplancton. Des tudes ont montr que des organismes tributaires de la photosynthse comme les diatomes (Rhizosolenia) peuvent effectuer des migrations verticales alternes travers la nitracline*, entre la surface pauvre en azote et les zones profondes plus riches en azote, en phosphates et en matires carbones [3]. Il en rsulte un apport azot la surface de vastes zones ocaniques.

5 AZOTE ET ANAROBIOSE
N2 atmosphre 1 2

247

3 6 NH3 4 5 4

nitrate

NH3

Assimilation de N2 par bactries non symbiotiques, phototrophes, cyanobactries Assimilation symbiotique de N2 par bactries des nodules ou au niveau des tiges Dcompositions animales et vgtales, interconversions au niveau de la microflore Nitrification (en plusieurs tapes) par des chimio-lithotrophes Assimilation du nitrate par les plantes et les micro-organismes Dnitrification en oxydes dazote, N2 tant le stade final

Cycle de l'azote
La biosphre s'appauvrirait en azote sans une recharge partir de latmosphre. La rduction de N2 en ammoniac est lexclusivit absolue des procaryotes vivant dans le sol, les ocans ou en symbiose avec des plantes. Lenzyme cl est la nitrognase. Les cyanobactries unicellulaires ou filamenteuses du nanoplancton ocanique ( Trichodesmium, Richelia) apporteraient u n e contribution autrefois insouponne dans l'conomie azote de la vie sur la plante [4]. La fixation de lazote en milieu continental est ralise aussi par de nombreuses cyanobactries et des organismes qui ne sont pas tous phototrophes. Certaines bactries vivent ltat libre (type Azotobacter), dautres sont symbiotiques comme les Rhizobium et Frankia. Ce flux dentre dans les sols et les eaux compense, au moins en partie, les pertes dues la dnitrification. Celle-ci est catalyse par les bactries en respiration anarobie, change le nitrate en nitrite puis en oxydes (NO, N2O), et enfin en N2. Il en sera question plus loin dans ce chapitre. Dans les conditions naturelles la charge totale de lazote du sol cre des conditions limitantes. Lazote y est reprsent en majorit (autour de 80%) par des rsidus organiques provenant de la dcomposion des matires animales et vgtales. Lazote disponible est donc de premire importance non seulement pour lagriculture mais dans les recyclages nombreux et varis que les micro-organismes sont amens pratiquer. Les techniques dassolement de lagriculture traditionnelle utilisent comme "engrais vert" les plantes fixatrices dazote comme le trfle ou la luzerne. Un quivalent existe dans la culture du riz, grce aux petites fougres du genre Azolla porteuses de cyanobactries assimilatrices dazote.

248

BIODGRADATIONS ET MTABOLISMES

La recherche de productivit outrance ne se contente plus des anciennes techniques agricoles et a recours massivement aux engrais, notamment aux nitrates. Lemploi de ces derniers grande chelle cre les problmes denvironnement quon sait. Les nitrates en excs sont facilement entrans jusque dans les aquifres et les cours deau, o leur teneur peut dpasser largement les taux acceptables, soit 50 mg . L1 pour les nitrates, 0,1 mg . L1 pour les nitrites. L'apport des nitrates dans les eaux ctires est responsable des "mares vertes" constates depuis quelques annes l'embouchure de plusieurs rivires armoricaines, diffrentes formes d'eutrophisation accompagnent la prolifration d'algues vertes (ulves) et du phytoplancton contenant des espces toxiques (Alexandrium minutum). L'excs de nitrate a aussi l'inconvnient d'exacerber la dnitrification gnratrice doxydes dazote comme loxyde nitreux (N2O), qui est un gaz effet de serre. Peu ractif, sa dure de vie dans latmosphre est trs longue et cre au niveau de la stratosphre des ractions secondaires destructrices de la couche dozone. Leffet dun autre produit, loxyde nitrique (NO) est au contraire de contribuer la formation dozone, non pas trs haute altitude mais dans la troposphre, par une raction photochimique utilisant aussi les hydrocarbures et les gaz dchappement mis par la circulation automobile. Laccroissement continuel de la population du globe devrait saccompagner dune augmentation de la production agricole et de llevage. Le recours des engrais azots peut sembler inluctable, mais le dveloppement de nouvelles techniques agricoles (culture bio, culture raisonne) sefforcent dy remdier et de limiter la pollution par les nitrates. Des experts ont calcul que lemploi dengrais vert et de fumier animal permet desprer un apport annuel de 200 kg dazote par hectare de terre arable, et de nourrir 15 personnes dans les conditions les plus favorables possibles. Le chiffre est en ralit infrieur, cause de lutilisation de fourrage, de la culture de plantes non destines lalimentation, des incidences climatiques Le recours aux engrais azots artificiels est parfois ncessaire, notamment dans les pays en voie de dveloppement. Lhistoire retiendra sans doute la dcouverte de la synthse de lammoniac par le procd HABER-BOSCH, comme une perce technique majeure faite lore du XXme sicle. Lconomie azote de lenvironnement na pas que des incidences sur lagriculture. Ses rpercussions sont nombreuses et complexes sur la microflore, lactivit des biodgradations et des recyclages divers concernant aussi bien les dchets naturels que les pollutions de source humaine. Cela sera la toile de fond de cette introduction.

5.2 - CEUX QUI ASSIMILENT LAZOTE


Lair que nous respirons reprsente pour la biosphre un colossal rservoir dazote. Lentre de lazote ou dinitrogne (N2) chez les tres vivants a des incidences profondes sur lenvironnement, car elle est une phase cl du cycle de lazote. On ne peut la disjoindre du problme gnral des biodgradations, car beaucoup de germes assimilateurs contribuent aux quilibres naturels et participent directement ou indirectement des transformations diverses. Elle encourage le dveloppement

5 AZOTE ET ANAROBIOSE

249

de la vie dans des rgions arides ou sur des sols trs pauvres qui sont ventuellement contamins par les rejets de lactivit humaine. On se contentera ici de repres assez succincts. Pour bien comprendre les contraintes biologiques svres de la fixation de N2, il convient de se rappeler les lments suivants. La nitrognase est une enzyme procaryotique et cytoplasmique. Elle catalyse la raction : N2 + 8 e + 8 H+ + n ATP 2 NH3 + H2 + n ADP + n Pi La rduction dune molcule de N2 est irrversible et ncessite 8 lectrons. Elle ne produit pas que de lammoniac (ou des ions ammonium) mais gnre aussi de lhydrogne et hydrolyse de lATP raison dau moins 2 molcules par lectron (n est gal au minimum 16). Lenzyme est donc extraordinairement gourmande en nergie. En outre la source dlectrons exige est bas potentiel, le plus souvent une ferrdoxine rduite. Enfin une dernire contrainte est de taille, car lenzyme est immdiatement inactive par O2. On en dduit que lassimilation de lazote ne peut se faire que dans un environnement sans oxygne. Par des espces anarobies ? Pas ncessairement, si loxygne nest prsent quau compte-goutte ou s'il est consomm si rapidement la surface de la cellule quil na pas le temps de diffuser jusqu' la nitrognase. Les organismes assimilateurs de N2 sont des eubactries et archaebactries procaryotes rpartis dans plus de 100 genres. Certains fixent lazote en vivant ltat libre, dautres le font au cours d'une symbiose. Quels sont les organismes de la premire catgorie ? On y rencontre des anarobies stricts comme Clostridium pasteurianum, bactries tirant leur nergie de fermentations varies et sophistiques, et communes dans les matires vgtales en dcomposition. Des anaorobies facultatifs font partie des -protobactries (le groupe o se situe le colibacille). Klebsiella aerogenes et K. oxytoca sont des fixateurs d'azote trs tudis. On peut citer des espces arobies appartenant aux -protobactries (Azotobacter chroococcum et Az. vinelandii), et des -protobactries souvent prsentes dans la rhizosphre des plantes : Azospirillum brazilense, Azospirillum lipoferum. Les fixateurs d'azote sont galement nombreux chez les phototrophes non oxygniques comme Rhodobacter capsulatus e t Rodospirillum rubrum, ou parmi les cyanobactries (Anabaena, Nostoc). Diverses espces bactriennes spcialises se rencontrent ici et l dans la taxonomie (Acetobacter diazotrophicus, Herbaspirillum seropedicae). Ils convient de citer enfin divers mthanognes, comme Methanococcus maripaludis ou Methanosarcina barkeri. Une espce trs tudie est Azospirillum brasilense, car ce germe Gram-ngatif colonise les rhizosphres de plantes telles que les crales cultives et diverses monocotyldones tropicales. Cette espce versatile peut crotre en arobiose, anarobiose o dans les conditions micro-arophiles compatibles avec la fixation de N2 et ralises dans les rhizosphres. En labsence dair, les bactries peuvent tirer leur nergie de la dnitrification (section 5) [5]. faible concentration doxygne, une oxydase respiratoire puissante de type cytochrome cbb3 leur fournit lnergie ncessaire la fixation de lazote [6]. De faon gnrale, la fixation de lazote en prsence d'O2 exige des adaptations particulires. Aerobacter peut tolrer une teneur assez forte en oxygne parce que les oxydations respiratoires de ces bactries sont assez rapides pour l'ponger avant quil n'atteigne la nitrognase. Les cyanobactries fixatrices de N2 sont confrontes un problme

250

BIODGRADATIONS ET MTABOLISMES

particulirement critique puisque leur photosynthse fabrique du dioxygne. Elles y font face par des adaptations physiologiques spciales. Lune delles consiste cantonner l'assimilation de lazote des cellules spciales (htrocystes), o la production d'O2 par le PS2 est mise en veilleuse. L'autre solution consiste faire fonctionner la photosynthse et lassimilation en alternance. La seconde catgorie des organismes fixateurs concerne des symbioses avec des plantes ou des champignons. Trois situations diffrentes sont reprsentes par les Rhizobium et organismes de la mme famille, les Frankia, et les cyanobactries dans les lichens. Les Rhizobium et organismes voisins colonisent typiquement les racines de plantes lgumineuses herbaces (fve, luzerne) ou ligneuses (robiniers, acacias). Les bactries pntrent les racines par les poils absorbants et provoquent la formation de nodules dans lesquels elles subissent une transformation en bactrodes.

Cortex de la racine

Nodule en formation

Les germes sont attirs par des substances flavonodes mises par la plante. Ils rpondent par un signal chimique que la plante reconnat laide dune lectine* 1. Les deux partenaires se modifient mutuellement au cours de la symbiose. Les cellules bactriennes entrent par un poil absorbant, perdent leur membrane externe et changent de forme, tout en produisant une cytokinine (sorte dhormone de croissance). L'entre des bactries est lorigine dune tumorisation locale conduisant la formation dun nodule. Celui-ci peut se comparer une galle, une raction de dfense l'invasion trangre. Les cellules bactriennes de leur ct sont assez profondment modifies par la nouvelle situation. Enfermes dans une vacuole, elles subissent un remaniement important qui les conduit exploiter les facilits apportes par le vgtal. Mais elles sont destines dgnrer et disparatre sous l'effet des dfenses de la plante. Le principe de cette association est donc fort complexe. Cette symbiose tient la fois de l'infection, du parasitisme, de ractions de dfense et d'un quilibre assez tonnant entre des changes mtaboliques qu'on pourrait considrer comme des bnfices mutuels. Il y a induction de la nitrognase, rduction de N2 et apparition de divers caractres biochimiques qui autoriseront des changes de composs organiques avec lhte. Les bactrodes ont besoin de beaucoup dnergie quils tirent doxydations par loxygne, et reoivent celui-ci de la plante qui fabrique au niveau des nodules une protine fixatrice de O2, la leghmoglobine. Celle-ci est une hmoprotine analogue lhmoglobine de notre sang. Elle capte l'oxygne avec une trs haute affinit, et le distille

1 - Un ttrasaccharide sulfat et porteur d'une chane hydrophobe, qui fonctionne en quelque sorte comme une cl de sret reconnue par la serrure (la lectine).

5 AZOTE ET ANAROBIOSE

251

en petite quantit aux bactrodes [7] selon un dosage critique prservant l'intgrit de la nitrognase. Chose curieuse, les bactrodes ne sont pas capables de fabriquer par eux-mmes des molcules azotes partir de lammonium quils produisent. Cest la plante qui rcupre lammonium, et les bactrodes recevront en retour du glutamate et des substrats carbons comme le malate et le fumarate. Lassociation symbiotique est gnralement trs spcifique, chaque souche ninfectant quune espce de plante ou une gamme trs limite dhtes. Un thme de recherche important consiste slectionner des souches capables de sassocier avec une gamme de plantes cultives plus tendue. Les Frankia sont des bactries du sol organises en filaments pluricellulaires ou hyphes et appartenant au groupe des actinomyctales. La symbiose seffectue avec de nombreuses espces vgtales, souvent des arbres et arbustes croissant sur des terrains arides ou extrmement pauvres, soit pas moins de 200 dicotyldones appartenant 25 genres et 8 familles diffrentes [8]. Citons les aulnes (Alnus), les filaos (Casuarina, Allocasuarina), largousier (Hyppophae), lolivier de Bohme (Elaeagnus angustifolia), les Myrica et diverses Rosaces comme les Dryas. Les bactries pntrent les racines la faon des Rhizobium, mais leur nodulation des racines est diffrente. Le germe sy propage dans la zone corticale, produit des sporanges et des spores, ainsi que des vsicules servant de rservoir la nitrognase. La spcificit dhte est moins stricte que pour les Rhizobium. Contrairement ces derniers, les Frankia exportent des aminoacides vers la plante plutt que lammonium. La symbiose par les Frankia autorise la conqute naturelle des terrains difficiles, et offre de nombreuses applications pour lamnagement du territoire. Elles concernent le reboisement, la rsistance au sel, au feu, la pollution. Comme exemples simples, les aulnes (A. incana) colonisent les moraines et boulis des montagnes alpines, les filaos diversifis dans les pays chauds sont les pionniers des dunes, des boulis des zones semi-arides et des environnements dont les ressources sont spartiates. Une recherche systmatique des espces vgtales concernes est facilite par lamplification de fragments dADN (technique PCR) et l'emploi de sondes spcifiques, une mthodologie qui a t pratique par exemple en France lUniversit de Lyon [9]. En fait, mme si les arbres tirent bnfice de leur Frankia, linvasion de celui-ci ressemble, comme pour les Rhizobium, un mcanisme infectieux. On en veut pour preuve le taux trs lev de superoxyde dismutase chez les Frankia [10]. Pourquoi ? Lorsquune plante est attaque par un agent infectieux, elle tente de s'en protger par l'mission de superoxyde et de peroxyde [11]. Frankia dclenche cette raction, mais possde les dfenses pour y faire face. Les cyanobactries vivent en association avec des champignons dans certains lichens ou avec des fougres aquatiques (Azolla) dans les rizires 2. Les lichens reprsentent comme on le sait une association symbiotique particulirement pousse entre un champignon ascomycte et un organisme chlorophyllien qui est selon

2 - Lassociation avec Azolla est permanente, dans des lobes latraux des feuilles de fougre. Les cyanobactries (Anabaena) assimilent lazote dans leurs htrocystes. Il y a parfois un troisime larron, qui est un Arthrobacter.

252

BIODGRADATIONS ET MTABOLISMES

les espces soit une algue verte du type Trebouxia, soit une cyanobactrie (souvent un Nostoc). Seuls les lichens renfermant un partenaire cyanobactrien sont susceptibles dassimiler directement N2. Le champignon confre au lichen sa morphologie, enveloppe son partenaire phototrophe qui est confin dans certaines zones du thalle, le protge contre la dessiccation, fournit des lments nutritifs et des minraux. Il bnficie en retour des produits carbons de la photosynthse, du glucose par les cyanobactries ou des polyols (mannitol, ribitol) par les algues. Les lichens sont par essence des organismes pionniers. On a souvent dcrit leur sensibilit la pollution atmosphrique des villes, notamment par le dioxyde de soufre. Malheureusement on connat mal leur pouvoir de dcontamination. La lenteur extrme de leur dveloppement et la difficult quil y a de les tudier par les mthodes standards de la microbiologie ne facilitent pas les recherches. Certaines usnes peuvent avoir un dveloppement relativement rapide, mais des lichens comme ceux qui tapissent les rochers ont une croissance atteignant pniblement 1 mm par an. Parmi les nombreux lichens observs dans lAntarctique certains pourraient tre vieux de plusieurs milliers dannes ! Lenzyme qui fixe lazote est une sorte de petit miracle biologique. Nous avons vu que la nitrognase est purement procaryotique, quelle rduit N2 en ammoniac grand renfort dune dpense dnergie sous forme dATP, et quelle fabrique en mme temps de lhydrogne. Le travail de la nitrognase cote cher la cellule, qui a donc intrt ne lutiliser que lorsquelle est vraiment ncessaire. La bonne marche de cette assimilation de lazote obit trois conditions. La premire est une source dnergie suffisante. Chez les bactries phototrophes ou les cyanobactries, l'nergie est apporte par la lumire et la machinerie photosynthtique. Les autres espces se servent de diverses oxydations pour produire cette nergie. La deuxime condition est labsence de molcules azotes minrales ou organiques dans le milieu, car dans le cas contraire le fonctionnement de la nitrognase serait inutilement dispendieux. Il y a donc des systmes rgulateurs qui limitent la synthse de l'enzyme ou son fonctionnement. La troisime condition est labsence de O2 au contact de la nitrognase. En effet loxygne inactive vigoureusement l'enzyme, qui ne peut fonctionner thoriquement quen anarobiose complte. C'est pourquoi une chane respiratoire efficace a un rle protecteur en pongeant les molcules d'oxygne, comme il a t idiqu antrieurement. La section suivante passe rapidement en revue les diffrents aspects de cette question, si fondamentale pour lquilibre de la biosphre que sans lassimilation de N2 les rservoirs azot du monde vivant viendraient certainement spuiser.

5.3 - LA NITROGNASE
La nitrognase est bien une sorte de miracle puisquelle ralise dans des conditions physiologiques ordinaires une opration qui nest ralise dans lindustrie que sous hautes pression et temprature. Les connaissances sur la nitrognase ont fortement progress la suite de lanalyse gntique et des travaux cristallographiques, dont les premiers ont port sur l'enzyme molybdne dAzotobacter

5 AZOTE ET ANAROBIOSE

253

vinelandii, puis sur celle de Clostridium pasteurianum [12]. Lazote nest pas le seul substrat de lenzyme, qui rduit aussi loxyde nitreux (N2O), les ions cyanure, cyanate, thiocyanate, azoture, et surtout lactylne, qui offre un moyen de dosage par chromatographie en phase gazeuse. La nitrognase d'A. vinelandii rduit le sulfure de carbonyle (COS) en CO + H2S. Dans ce cas particulier, le monoxyde de carbone form est un inhibiteur de l'enzyme, et pour obtenir et mesurer la raction, il est ncessaire d'liminer au fur et mesure le CO en le fixant par l'hmoglobine. Le changement spectral d la formation de la carboxyhmoglobine sert alors mesurer la raction, freine par l'actylne et N2, alors qu'il n'y a pas d'inhibition par l'hydrogne [13]. La nitrognase a toujours une structure complexe constitue de deux parties contenant lune et lautre des centres fer-soufre. Dans le type courant la plus grosse (240 kDa environ), ou dinitrognase, est un ttramre 22 renfermant du fer et du molybdne. On la dsigne parfois comme protine Fe-Mo. La rduction de N2 se fait sur cette portion. La plus petite des deux parties (60 kDa) est la "dinitrognase rductase", un dimre ne contenant quun seul centre fer-soufre. A. vinelandii et d'autres espces renferment aussi deux dinitrognases supplmentaires, dont l'une contient du vanadium la place du molybdne, et une enzyme dite "alternative nitrogenase" ou nitrognase de remplacement, dpourvue la fois de Mo et de V qui sont remplacs par Fe. Les deux parties, rductase et dinitrognase, sont remarquables par la batterie de cofacteurs quelles renferment. La structure constitue de deux parties semblables est symbolise par un diagramme :

site ATP site ATP

symboles des cofacteurs centre P noyau [4Fe-4S] homocitrate cofacteur Fe-Mo

rductase

dinitrognase (protine Fe-Mo)

Les deux parties de la nitrognase


La rductase munie de son centre fer-soufre unique de type [4Fe-4S] reoit des lectrons un un par un donneur qui est soit une ferrdoxine ou une flavodoxine. Ces petites protines ne font que servir dintermdiaires entre une source de dpart (oxydations du mtabolisme, photosynthse) et la rductase. Cette dernire sassocie la dinitrognase (la protine Fe-Mo) et dcharge sur elle chaque lectron un par un au prix de lhydrolyse de 2 ATP. Pour rduire une molcule de N2, la dinitrognase doit donc recevoir un total dau moins 6 lectrons, et mme 8 en comptant la formation de la molcule dhydrogne. La rduction a lieu sur le noyau Fe-Mo, cofacteur spcial qui est une sorte de double noyau fer-soufre contenant du molybdne. C'est une exception dans la nature car toutes les autres enzymes contenant cet lment le renferment dans un cofacteur de type nuclotidique. Lenzyme contient aussi des centres fer-soufre doubles, sans molybdne, appels

254

BIODGRADATIONS ET MTABOLISMES

centres P. Enfin un constituant organique, lhomocitrate, est reli au noyau Fe-Mo et parat participer aux transferts dlectrons et de protons. Pourquoi faut-il autant dnergie pour le fonctionnement de la nitrognase ? Le passage de N2 NH3 implique 3 tapes de 2 lectrons chacune, produisant N2H2 (un intermdiaire trs instable qui tend se dcomposer en N2 + H2), puis H2NNH2 (lhydrazine), enfin lammoniac. Ltape la plus difficile est la premire, car elle ncessite une rduction sous un potentiel extrmement bas de lordre de 600 mV pour un lectron chang, une valeur assez peu physiologique, alors que le potentiel de la rductase au repos est estim E = 290 mV. La liaison de la protine avec 2 ATP-Mg est facilite quand elle est ltat rduit, elle provoque une contraction de la structure et abaisse ce potentiel environ 400 mV. Comment ? Certainement la faveur d'un changement de conformation de la protine, qui devient un meilleur donneur dlectron quand elle est rduite. Les deux molcules dATP sont fixes par un mcanisme coopratif en des sites relativement loigns du noyau fer-soufre. Leur hydrolyse renforce le changement structural et rend donc la protine plus facilement rductrice. Labaissement du potentiel est compens par lnergie dhydrolyse de lATP, soit une valeur 32 kJ par mole ltat standard, et une chute du potentiel de 330 mV, soit 660 mV pour 2 ATP. Un trs bas potentiel est alors atteint, de lordre de 1000 mV, une valeur suffisante pour linjection dun seul lectron sur la dinitrognase. Le transfert saccompagne du changement de conformation inverse, de la libration de lADP et du phosphate, et d'un retour aux conditions initiales.
ATP ATP ATP association 2 ADP hydrolyse d'ATP transfert d'un lectron 2 Pi 2 ATP ADP ADP dissociation ADP ADP ADP ADP protine Fe oxyde ATP ATP protine Fe rduite Fe-Mo oxyde Fe-Mo partiellement rduite Symboles

En rsum, le cycle de la dinitrognase rductase comporte successivement une rduction par ferrdoxine sur son unique noyau [4Fe-4S], la liaison cooprative avec deux molcules d'ATP, l'association de la rductase avec la dinitrognase (protine Fe-Mo), l'hydrolyse des deux molcules d'ATP, l'injection d'un lectron la dinitrognase et le retour aux conditions initiales. Un tel cycle est donc parcouru 8 fois La suite des oprations est symbolise par un diagramme qui ressemble un cycle d'hystrsis parcouru dans le sens des aiguilles d'une montre. pour qu'une seule molcule d'azote diatomique soit assimile 3. La rductase utilise ici lhydrolyse dATP comme une impulsion supplmentaire, rendant le noyau fer-soufre plus rducteur et facilitant l'apport dun lectron la

5 AZOTE ET ANAROBIOSE

255

protine Fe-Mo . La suite des oprations est symbolise par un diagramme qui ressemble un cycle d'hystrsis parcouru dans le sens des aiguilles d'une montre. Il apparat que le noyau fer-soufre de la rductase vient proximit immdiate dun cofacteur accepteur sur la Fe-Mo, probablement un centre P. En fait la protine Fe-Mo , constitue de deux parties quivalentes, peut thoriquement recevoir deux molcules de rductase. Les noyaux P et Fe-Mo de la dinitrognase ont des structures particulires, longtemps demeures mystrieuse mais claires par les travaux cristallographiques. Ce sont des centres fer-soufre doubles de structure inhabituelle et ponts par des atomes de soufre.
Cys Cys

centre P

Cys

Cys

Cys

fer soufre Mo molybdne

Cys

Cys

cofacteur Fe-Mo O C homocitrate

Mo O C O His

La spectroscopie RPE suggre que le cofacteur Fe-Mo, dont on voit la structure hypothtique sur le dessin droite, renferme lquivalent de 3 Fe(III) et 4 Fe(II), joints Mo(VI). Larchitecture trs spciale de ces diffrents noyaux intrigue les spcialistes, qui y voient une structure trs souple en cage dformable. Il faut reconnatre quil y a comme un caractre magique dans cette enzyme, la fois par sa complexit et la difficult de la raction catalyse. Le rve serait de raliser des catalyseurs artificiels fonctionnant dans lindustrie sur un principe analogue ! On connat des nitrognases sans molybdne. Les enzymes "V" d'Azotobacter vinelandii et d'A. chroococcum ont du vanadium. Un cofacteur Fe-V remplace donc le Fe-Mo, avec une organisation du mme type. Les enzymes "Fe" de A. vinelandii, Rhodobacter capsulatus et Rhodospirillum rubrum nont que du fer dans un cofacteur Fe-Fe, o le fer remplace le molybdne ou le vanadium. Ces enzymes ne semblent pas trs diffrentes de la nitrognase molybdne par leur organisation gnrale. Les trois catgories d'enzyme correspondent des ensembles gntiques dsigns dans la nomenclature officielle par nif, vnf, anf. L'existence de ces diffrentes nitrognases suggre que la prsence du molybdne dans le noyau complexe o se fait la rduction de N2 n'est pas requise. Quelle explication donner cette multiplicit ? On observe que la prsence de Mo taux trs faible dans le

256

BIODGRADATIONS ET MTABOLISMES

milieu (6 nM) rprime la synthse des autres nitrognases chez Rhodobacter et A. vinelandii. L'enzyme molybdne pourrait savrer avantageuse. Une tude dtaille de la nitrognase fer seul dans Rhodobacter capsulatus rvle quelques diffrences significatives [14]. Par exemple pour chaque N2 rduit, cette nitrognase fait environ 7,5 molcules de H2 au lieu d'une seule pour l'enzyme Mo. Cette forte production d'hydrogne est moins inhibe par d'autres substrats, l'affinit pour l'actylne est plus faible, l'enzyme est moins stable et diffre par un certain nombre de proprits cintiques. La raison physiologique de ces nitrognases multiples dans une mme espce reste encore inexplique. Revenons lenzyme Mo "canonique". Les ides de base sur le mcanisme de la nitrognase ont t poses par le modle de LOWE et THORNELEY, fond sur des tudes cintiques trs dtailles [15]. Les deux moitis de la dinitrognase fonctionneraient indpendamment. Chaque cofacteur Fe-Mo sur apparat comme le site le plus probable de la rduction de lazote. Il est attach de faon assez lche la protine et comporte une cavit centrale qui pourrait tre gomtrie variable, formant une sorte de bote lastique dont lintrieur est tapiss par du fer et du molybdne. Lazote diatomique pourrait venir sy loger, mais cette hypothse est combattue par certains auteurs. Un fait essentiel est le couplage ncessaire entre la production dhydrogne et la rduction de N2. Il na jamais t possible dobserver une assimilation d'azote sans production de H2. Le rapport entre H2 form et N2 rduit est denviron 1 : 1, mais une incertitude subsiste. Lorsque le transfert des lectrons sur la protine Fe-Mo seffectue lentement, la tendance serait de librer davantage dhydrogne, comme une sorte de fuite dtournant le pouvoir rducteur de la production dammoniac. Lenzyme se comporte alors comme une hydrognase formant H2 dans des conditions spciales, puisquil y a en mme temps hydrolyse dATP. Il est donc peu prs certain que le couplage entre production dhydrogne et rduction de lazote ne se fait pas toujours dans un rapport rigoureux. Dans les conditions normales, la nitrognase molybdne utilise 75% des lectrons la rduction de N2. Pour les nitrognases vanadium, le rapport est de 50% environ, et il est encore plus bas pour les nitrognases Fe seul : 25-30% seulement. Les bactries devraient tirer un bnfice de l'hydrogne produit par la nitrognase. En effet lhydrogne est un excellent carburant, et son oxydation a un double intrt : rcuprer de lnergie dont la nitrognase est particulirement avide, ponger le cas chant les molcules doxygne qui tranent dans le secteur et risqueraient dinactiver la nitrognase. Les bactries qui acceptent dassimiler lazote malgr une certaine arobiose ont toujours des oxydations extrmement puissantes qui deviennent une vritable dtoxification d'O2, une mthode srement efficace puisque les Azotobacter peuvent encore fixer lazote sous une pression d'oxygne atmosphrique quasi normale. Dans le modle ractionnel accept provisoirement, lapparition de lhydrogne, aprs que la protine ait reu au moins 3 lectrons et probablement 4, prcderait l'entre de N2 sur le site. Le substrat serait donc reu par une protine partiellement rduite. Le schma est une interprtation simplifie o on voit que le noyau Fe-Mo serait rduit sur le molybdne puis sur le fer avant toute fixation et attaque de N2.

5 AZOTE ET ANAROBIOSE

257

2 e site vide MoVI Fe MoIV 2 H+ N H N H MoVI 2 e H N H MoIV N Fe 2 H+ H N MoVI N H Fe H N H H H N H H N Fe 2H


+

Fe

2 e

N H MoIV H Fe

N MoIV

Fe H2

H H

2 e 2 H+

Principe de la nitrognase
Le fer rduit forme un hydrure, et lazote se fixerait sur le complexe en chassant une molcule dhydrogne. Pour attaquer lazote et lui faire franchir la premire tape, qui est comme on le sait la plus difficile, la nitrognase devrait subir ainsi une sorte dactivation prliminaire lui permettant de traiter les substrats coriaces comme N2, et qui ne serait pas ncessaire pour dautres substrats comme lactylne, dont la rduction 2 lectrons en thylne ne produit pas dhydrogne. Deux lectrons suffisent galement pour transformer loxyde nitreux : N2 O + 2 H+ + 2 e N2 + H2O. Les protons sont oxyds dans cette raction mais ne produisent pas non plus dhydrogne. Dans le cas de lion cyanure, la raction observe est : CN + 7 H+ + 6 e CH4 + NH3. Le cyanure et HCN se lient lenzyme un stade plus prcoce que N2, et ne provoquent pas de libration dhydrogne. De faon gnrale la nitrognase admet comme substrats une gamme varie de composs faible masse molculaire caractriss par une liaison CC, CN, NN, NO ou CS double ou triple [16]. Seule dans cette srie de ractions, la rduction de lazote apparat comme une situation extrme qui se traduit par lmission supplmentaire de H2. La fixation de lazote est beaucoup plus rpandue dans lenvironnement que suppos initialement. On peut sen rendre compte laide de sondes nucliques reproduisant un consensus au niveau de la squence de la nitrognase rductase (NifH), car celle-ci prsente de grandes homologies dune espce lautre. Les expriences dhybridation molculaire ont permis de dtecter la prsence de la nitrognase dans un grand nombre de bactries du sol, avec des variantes dans le fonctionnement qui ne seront pas abordes ici. On se demande mme si de nombreuses espces bactriennes impliques dans des biodgradations, en particulier celles qui vivent de prfrence en anarobiose, ne sont pas en mme temps

258

BIODGRADATIONS ET MTABOLISMES

assimilatrices d'azote. Cette proprit a pu passer bien souvent inaperue, car elle ne se manifeste que dans des conditions dfinies, en particulier lorsqu'il n'existe aucune autre ressource azote.

5.4 - CONTRLE DE LASSIMILATION DE LAZOTE


Pour laborer une enzyme aussi perfectionne que la nitrognase, les bactries ont besoin dun nombre important de fonctions pour la synthse et linsertion des cofacteurs. Aussi l'assimilation du diazote est-elle dtermine par un grand nombre de gnes, une vingtaine au moins, qui sont les gnes nif pour l'enzyme molybdne. La gntique du systme nif a des cts spectaculaires. Chez Klebsiella pneumoniae, tous les gnes dont dpend lassimilation de lazote sont adjacents sur un mme segment dADN dune longueur de 23 kb. Ces gnes sont rpartis en 7 oprons au moins. Il existe des variantes. Chez Azotobacter, les gnes nif sont rpartis en deux ensembles. Des sries spares codent pour les nitrognases vanadium et fer, respectivement les gnes vnf et anf. Nous ne retiendrons que l'appareil nif. Un diagramme permet de se faire une ide sur la complexit de la machinerie mise en jeu, code par 29 kb d'ADN [17]. La nitrognase proprement dite est code par nifHDK, tandis que les autres gnes concernent la fabrication du cofacteur Mo et des noyaux fer-soufre. Les gnes nif d'Acetobacter diazotrophicus forment une seule unit, peut-tre la plus grande connue, d'une longueur de 30,5 kb [18]. Cette organisation gntique ne reste pas identique chez tous les cas de figure et peut prsenter des diffrences dans la disposition des gnes. Les homologies restent nanmoins fortes d'une espce l'autre et on en tire l'impression que l'arsenal gntique observ ici ou l trahit une origine volutive commune.
rductase chane chane synthse du cofacteur noyaux Fe-S activateur de rductase synthse du cofacteur flavodoxine

TY

N X

U S

WZ M

activateur de transcription rgulateur synthse du cofacteur NifA

Gnes nif d'Azotobacter vinelandii


L'opron nifHDK est repr en noir, les gnes dirigent des fonctions de service. Par exemple nifT et nifY sont transcrits en aval dans la mme unit. Le premier ne semble pas essentiel la fixation de lazote et sa fonction nest pas connue. Le second code pour une protine qui aide la maturation de la nitrognase [19]. Elle se lie lenzyme en cours dassemblage et sen dtache quand sa structure dfinitive est acquise. Plusieurs gnes sont impliqus dans la ralisation du cofacteur

5 AZOTE ET ANAROBIOSE

259

molybdne. Les protines NifU et NifS interviennent dans la synthse des noyaux fer-soufre. NifS, une soufre transfrase 3, tant charge de rcuprer le soufre dans la cystine pour le mettre la disposition des diffrents noyaux fer-soufre [20]. La protine NifV interviendrait dans la synthse de lhomocitrate. et NifWZ formerait un complexe exerant un effet protecteur sur la nitrognase contre loxygne [21]. Nous savons que la nitrognase est un outil coteux en nergie pour la cellule bactrienne. Elle est donc soumise un contrle trs strict deux niveaux, la transcription par induction et rpression, et l'activit enzymatique. Trois paramtres sont dterminants : labsence d'O2, la disponibilit de ressources nergtiques, un taux faible dazote ammoniacal. Ce problme a des aspects intressants qui mritent quelques explications. Chez les protobactries lexpression des gnes nif est en gnral sous la dpendance dun activateur spcialis, NifA, qui favorise lamorage dune transcription au niveau d'un type particulier de promoteur, reconnu par sigma-54*. En s'installant sur l'ADN, NifA vient en contact avec lARN-polymrase la faveur dune boucle de la double hlice et autorise lamorage en hydrolysant de lATP [22]. Chez les -protobactries assimilatrices de N2 comme Azotobacter vinelandii et Klebsiella pneumoniae, une seconde protine, NifL, inhibe lactivit de NifA en sassociant avec elle sans se lier directement lADN [23]. Une boucle dans lADN est donc ncessaire pour que NifA puisse se rapprocher du site damorage parce son lieu de fixation est assez loign en amont comme lindique le schma de la squence. La courbure est favorise par une protine supplmentaire, IHF, qui participe en quelque sorte au mcanisme rgulateur. C'est un problme que nous avons dj rencontr dans le chapitre prcdent. Il est assez caractristique des rgulations chez les procaryotes.
139 126

AAT TGTTCTGTTTCCCACA TTTGGTCGCCTTATTGTGCCGTTTTACGTCCTGCGCGGCGAC attachement de NifA 74 39

AAA TAACTAACTTCATAAAAATCATAAGAATACATAAC AGGCA attachement de IHF 27 15 +1 dbut de nifHDK

CGGCT GGTATGTTCCCTGC ACTTCTCTGCTGGCAAA promoteur reconnu par sigma-54

Squences reconnues par Nifa, IHF, sigma-54 (Klebsiella pneumoniae)


Les deux gnes des protines partenaires NifA et NifL sont sur un mme opron, comme on peut le voir sur la carte des gnes donne prcdemment. Chez Azotobacter, lopron nifAL est exprim en permanence (synthse constitutive).

3 - Une cystine dsulfurase, enzyme pyridoxal phosphate.

260
ADP O2 NH4+

BIODGRADATIONS ET MTABOLISMES

+ + +
NifL

NifA

La situation est un peu plus simple que chez Klebsiella o la synthse de NifA et NifL est elle-mme rgule par NtrC et GlnK.

+
transcription des gnes nif

Azotobacter

NifL canalise les rgulations, linhibition quelle exerce sur NifA est stimule par un niveau nergtique cellulaire bas (ADP > ATP), la prsence doxygne (redox lv) ou par un excs dazote ammoniacal. NifL intgre ces diffrents signaux et sa structure est faite de domaines articuls qui lui permet dtouffer laction de NifA ou de sen librer en fonction des signaux reus. Une vritable vanne de rglage. Lassimilation de N2 par la nitrognase nest quune opration particulire du mtabolisme azot en gnral, dont les rgulations dtailles ont t analyses en premier lieu chez Escherichia coli selon un mcanisme assez reprsentatif. On sait que la glutamine est lune des principales portes dentre de lazote ammoniacal dans les molcules organiques.
NtrB + GlnB

glutamine/2-oxoglutarate faible GlnD glutamine/2-oxoglutarate fort

GlnB + NtrB UMP NtrC

4
+

NifL NifA +

NH4+ O2 ADP expression des gnes nif

NtrC P

NtrA
( 54)

expression de nifA

Rgulation partielle chez Klebsiella pneumoniae


Lorsque la glutamine est taux faible, une triple cascade rgulatrice conduit : activer la synthse de la glutamine par la glutamine synthtase ; rendre fonctionnel un activateur de transcription, NtrC*, en NtrC-P ; transformer par uridylation un autre facteur rgulateur, GlnK, transform en GlnK-UMP, que nous retrouverons plus loin. Ces trois volets existent chez les assimilateurs dazote. Les circuits de rglage sont indiqus sur un tableau partiel de la cascade rgulatrice chez Klebsiella pneumoniae, une espce micro-arophile qui peut vivre avec ou sans dioxygne. Quatre niveaux daction ont t numrots sur le plan.Le niveau 1 concerne labondance de lazote dj fix sous forme organique, reprsente par la glutamine. Elle est dtecte par GlnD, qui est une enzyme fonctionnant comme uridylase ou dsuridylase (fixe ou enlve le nuclotide UMP). La cible est GlnB, ainsi quune deuxime protine qui nest pas reprsente dans un but de simplification , soit GlnK.

5 AZOTE ET ANAROBIOSE

261

Le niveau 2 est luridylation de GlnB en GlnB-UMP qui modifie lactivit de NtrB. Celle-ci est une protine kinase (avec ATP) ou au contraire une protine phosphatase (une enzyme PNLOPE qui fait et dfait) selon l'tat de GlnB. Au niveau 3, la protine NtrC est phosphoryle par NtrB, dphosphoryle par NtrB-UMP. En fonction de son tat ltape 2, NtrB phosphoryle NtrC ou la dphosphoryle. NtrC-P est un activateur de transcription qui va commander une cascade de transcriptions commenant par l'induction au niveau 4 de NtrA, appel aussi facteur sigma-54. Au niveau 5, NifA est l'activateur de transcription des gnes nif et autorgule sa propre synthse. NifL est un rgulateur contrl par l'ammonium, l'oxygne, et l'tat nergtique de la cellule. Quand celui-ci est bas, NifL freine l'activit de NifA et retarde l'expression des gnes nif (le fonctionnement de la nitrognase ne ferait qu'aggraver le dficit nergtique). Rsumons cette cascade. Un taux faible d'azote organique (glutamine/2-oxoglutarate faible) active la formation de GlnB-UMP, qui phosphoryle NtrC. Celle-ci active la synthse de NtrA, qui commande la sortie du couple rgulateur NifL/NifA. Cette dernire protine active l'expression des gnes nif. Il y a donc intgration de plusieurs paramtres, le taux d'azote organique, l'azote minral (l'ammonium), l'oxygne et l'tat nergtique de la cellule qui devient dfavorable quand le rapport ADP/ATP s'lve. Grce ce dispositif, la cellule peut assimiler le diazote seulement si elle en a besoin, pourvu quelle dispose dassez dnergie et que l'oxygne ne rduise pas ses efforts nant. On voit que cette cascade est rversible par ses effets et peut tre "allume" ou, "teinte" en fonction des conditions. La prsence des deux facteurs, la kinase NtrB et l'activateur de transcription NtrC, est une situation emblmatique dont la physiologie des procaryotes est friande (voir rgulations deux composants*). En outre il y a un effet amplificateur, car un signal faible au dpart suffit entraner une variation brutale de lexpression des gnes nif la sortie grce au robinet essentiel qui est NifA. Les deux protines NifA et NifL sont synthtises en quantits gales grce la structure de lopron qui associe les deux gnes [24]. Le subtil quilibre entre ces deux protines reprsente la vritable cl qui ouvre ou ferme les gnes nif chez les bactries qui assimilent lazote ltat libre comme Azotobacter et Klebsiella . La paire NifA/NifL est un systme d'asservissement qui permet de rgler l'expression des gnes nif dans une certain fourchette en fonction des besoins azots [25]. Comment la protine NifL intervient-elle ? C'est son niveau que se fait le rglage gnral en fonction de la prsence d'O2, de lADP et de l'ammonium. NifL est une flavoprotine portant du FAD dont l'tat doxydorduction est command par le niveau doxygne. Le cofacteur FAD se comporte de la mme faon que dans une oxydase, mais la protine est dpourvue dactivit enzymatique. Elle ne ragit que par ses changements de conformation. Cette protine serait charge de limiter les ardeurs de NifA, mais une petite simplification a t faite au tableau. NifL est sous le contrle la fois de NtrA et de GlnK. Celle-ci est soumise uridylation en fonction de labondance dazote fix (la glutamine), tout comme l'tait GlnB ci-dessus. GlnK a pour mission d'exercer un rglage fin supplmentaire sur NifL. Quand lazote de la glutamine est vraiment limitant, GlnK diminue leffet inhibiteur de NifL sur NifA, ce qui est physiologiquement logique puisque l'action activatrice de NifA sur la transcription des gnes nif sera renforce.

262

BIODGRADATIONS ET MTABOLISMES

Le principe des rglages prsents ici connat des variations dans le dtail en fonction des espces libres. Chez les phototrophes comme Rhodobacter capsulatus, un contrle supplmentaire est exerc par la photosynthse qui gnre l'nergie ncessaire la nitrognase. Les deux facteurs essentiels sont alors l'anarobiose et la lumire. Les espces symbiotiques comme Rhizobium ont des solutions diffrentes de celles de Klebsiella et adaptes aux conditions. Le principal facteur qui allume les gnes nif est alors la rarfaction de loxygne. Lentre en symbiose saccompagne dun arrt de croissance, dune diffrenciation dans un environnement microarobie et riche en molcules azotes comme la glutamine qui est fournie par la plante. Loutil essentiel chez R. meliloti est un systme classique deux composants du type NtB/NtrC, appel ici FixL/FixJ. La protine FixL est le capteur qui estime le taux d'oxygne, FixJ est un activateur de transcription favorisant l'apparition des nouveaux activateurs, NifA et FixK. La protine FixN reprsente une ferrdoxine [26].
FixJ FixL O2 P FixJ + fixK membrane FixK + fixNOQP nifA + NifA + nifHDK fixABCX nifN

Rgulation commande par FixL chez Rhizobium


Le capteur FixL est une protine kinase membranaire hminique contenant du fer(II). En labsence de O2 ou lorsque sa teneur descend au-dessous de 10 M, elle commence par sautophosphoryler, puis injecte son phosphate sur sa partenaire FixJ. En se liant l'ADN, celle-ci active la transcription des gnes nifA et fixK. Les protines correspondantes sont elles-mmes des activateurs pour les gnes nif et fix. FixK auto-limite sa propre production et celle de NifA. Loxygne inhibe toute la cascade en se fixant sur le fer du capteur. La structure de FixL est connue [27]. Son fonctionnement rappelle celui de lhmoglobine : la gomtrie du fer(II) est octadrique, mais incomplte. Quatre liaisons de coordinence sont au sein de la porphyrine, une cinquime est dans une direction orthogonale et se fait sur histidine. La sixime est libre et cest l que sinstalle loxygne. Loccupation de la sixime coordinence par O2 dclenche un petit changement de conformation qui se rpercute sur lactivit du domaine voisin comme kinase.
O2 N N N N hme de FixL His His N N N N

Dtection de l'oxygne par FixL

5 AZOTE ET ANAROBIOSE

263

La cascade commande par FixL pourrait ne pas s'arrter rapidement dans le cas d'un apport d'oxygne. L'activation des gnes placs en aval se poursuivrait intempestivement par la prsence de FixJ phosphoryle. Or celle-ci n'est pas stable et perd continuellement son phosphate dfaut d'tre recharge. Ce mcanisme permet l'arrt rapide de la cascade jusqu' une nouvelle phosphorylation dclenche par la disparition d'O2. L'activation tend cesser par dphosphorylation sponane de FixJ. La recharge en phosphate se fait continuellement en conditions de faible taux d'O2 et on s'explique aisment que l'effet activateur soit rversible. L'ajustement se fait par l'instabilit de la liaison du phosphate. Elle se dfait et se refait sans cesse. Une lgre variation du taux de phosphorylation commande par O2 suffit contrler l'effet activateur. Le modle de base prsent ici connat des variations avec les espces, souvent avec des contrles trs compliqus adapts la physiologie des cellules. Azorhizobium caulinodans peut assimiler l'azote aussi bien en croissance libre qu'en symbiose sur lgumineuses du genre Sesbania. Son assimilation de N2 est contrle la fois par le systme Ntr et par FixJ. Le travail de la nitrognase consomme toujours beaucoup d'nergie alors que les bactries doivent faire face un taux d'oxygne trs faible. Elles ont donc besoin de protines respiratoires adaptes codes par les gnes fix, en particulier une nouvelle oxydase terminale lie la membrane, de type cbb3, code par fixOQP. Toutes ces rgulations complexes sont lies au fait que la nitrognase est dcidment une enzyme coteuse pour la cellule, non seulement par le nombre de facteurs et de protines mis en jeu, mais par son fonctionnement assoiff dnergie. Les mcanismes d'induction et rpression des gnes sont efficaces mais lents. Dans la comptition vitale le facteur vitesse compte. Une nitrognase qui continuerait tourner quelques temps en conditions dfavorables consommerait inutilement de l'ATP. Il existe effectivement une rgulation rapide et rversible, qui consiste inhiber prcipitamment l'activit de lenzyme dans les conditions o elle nest pas ncessaire. Cette rgulation est base sur une ADP-ribosylation, catalyse par une ADP-ribosyltransfrase. Avec NAD+ comme donneur. L'opration inverse est faite par une glycohydrolase. Ces deux enzymes antagonistes, codes par draT et draG, exercent leur action sur la partie rductase de la nitrognase comme un interrupteur "ON/OFF". Ce mode de contrle est prsent surtout chez les phototrophes, absent chez dautres espces comme Klebsiella . En prsence dions ammonium ou dautres effecteurs, l' ADP-ribosylation inactive la rductase. Quand les conditions redeviennent favorables, le blocage est supprim par une enzyme dactivation qui limine llment ADP-ribose. Or cette "activase" est trs sensible O2 et lopration choue en cas darobiose, ce qui tombe bien puisqu'il ne convient pas de ractiver la nitrognase ! Cependant aucune solution n'est parfaite. Diverses espces gnes par l'arobiose modulent leur assimilation de l'azote par plusieurs rseaux de contrle, plusieurs nitrognases. Ainsi le phototrophe Rhodobacter capsulatus a deux nitrognases, une Mo, l'autre sans Mo ni mtal autre que le fer. L'activit de ces deux enzymes est contrle par un double circuit qui autorise certainement une meilleure optimisation dans toutes les conditions.

264

BIODGRADATIONS ET MTABOLISMES

Lassimilation de lazote repose donc sur une artillerie lourde faisant appel de nombreux cofacteurs, protines et mcanismes rgulateurs. Cette phase essentielle du cycle de lazote na pas de prix, car la recharge de la biosphre en azote organique, et par contrecoup toute l'activit de recyclage de la biosphre, en dpendent.

5.5 - LES VOIES DU NITRATE


La biosphre dispose de trois principaux rservoirs dazote minral sous forme de diazote, d'ammonium et de nitrate. Lactivit des organismes bactriens fait communiquer ces rservoirs, comme lindique un schma simplifi. On constate immdiatement que certaines tapes sont notes comme irrversibles. Il sagit de la rduction de N2 en ammonium et de celle du nitrate en N2 par le mcanisme appel dnitrification. Le cycle indiqu ne peut donc tourner que dans le sens inverse des aiguilles dune montre.
N2

fixation de l'azote diatomique

dnitrification

matires organiques azotes

NH4+

nitrification ammonification et assimilation

NO3

Grandes conversions de l'azote par les procaryotes


Les diffrents changes prtent parfois des confusions de terminologie. La rduction de N2 en ammonium engendre lazote ammoniacal directement utilisable par le mtabolisme cellulaire. Cest donc une assimilation. Le produit de lopration est l'azote ammoniacal et alimente les synthses de lorganisme. Lassimilation azote seffectue aussi massivement dans la nature aprs dcomposition des matires organiques et production dazote ammoniacal. Il existe aussi une rduction de lion nitrate qui fournit de lammonium assimilable mais produit de l'nergie et s'appelle ammonification. La dmarcation entre assimilation et dissimilation est parfois incertaine, voire arbitraire, mais le terme de dnitrification est gnralement utilis pour la rduction du nitrate dont le terme ultime est N2, non rcupr par la machinerie cellulaire et seulement limin. Sur le plan pratique, de nombreuses espces bactriennes du sol peuvent tre cultives sur nitrate qui est assimil comme seule source azote. Pour rsumer ces questions smantiques nous adopterons les conventions proposes par MORENO-VIVIAN et FERGUSON [28]. La respiration est une chane doxydorductions non assimilatrices couples la formation dun potentiel membranaire, autrement dit qui est productrice dnergie, c'est--dire lectrognique. La dnitrification sensu stricto est dans ce cas.

5 AZOTE ET ANAROBIOSE

265

Elle fonctionne en gnral lorsque loxygne est peu abondant ou absent (sauf dans certains cas [29]) et les enzymes concernes sont gnralement induites par lanarobiose. La prsence dammonium dans le milieu est en principe sans action [30]. La dissimilation offre un cadre diffrent. Elle fait passer ici le nitrate et le nitrite NH3, avec ou sans rcupration dnergie. L'ammonification entre dans ce cas de figure. En fait il existe un certain recouvrement entre respiration proprement dite et dissimilation, ne serait-ce que lors de la conversion du nitrate en nitrite. La dissimilation est caractrise par lexistence dune nitrite rductase spciale (distincte de celle qui fonctionne dans la dnitrification), car elle catalyse la rduction directe 6 lectrons du nitrite en ammoniac. Lassimilation est entirement tendue vers la production d'azote ammoniacal assimilable par le mtabolisme. Elle met en jeu des enzymes induites par le nitrate et rprimes par lammonium [31]. Revenons la dnitrification. Elle emploie le nitrate comme oxydant au mme titre que loxygne quand celui-ci fait dfaut et produit des oxydes dazote comme intermdiaires qui sont eux-mmes accepteurs d'lectrons respiratoires : l'ion nitrite (NO2), l'oxyde nitrique (NO) et l'oxyde nitreux (N2O). Les substrats initiaux sont de mme nature que ceux qui sont oxyds par respiration arobie et les transporteurs d'oxydorduction, quoique distincts, sont de mme nature. Certaines espces nont pas toutes les tapes de la dnitrification et ne sont pas considres comme de vritables dnitrifiants. Escherichia coli est dans ce cas mais peut cependant transformer le nitrate en nitrite et en tirer de lnergie. Lorsque le stade ultime (N2) nest pas atteint, il en rsulte en quelque sorte une dnitrification avorte, qui peut sarrter au stade nitrite, ou encore loxyde nitreux. Celui-ci est vacu dans latmosphre o il apporte sa contribution au fameux effet de serre. Diverses espces vont jusqu recycler le diazote qu'elles engendrent par dnitrification l'aide de leur nitrognase [32]. Il faut en dduire que la dnitrification est une source dnergie assez performante pour engendrer tout lATP dont la nitrognase a besoin. La dnitrification est galement commune chez les Rhizobium et autres bactries assimilatrices dazote qu'on trouve en symbiose avec des plantes. Le tableau rsume les diffrents niveaux d'oxydation de l'azote.
niveaux d'oxydation NO3 dnitrification NO2 NO N2O N2 +3 +2 +1 0 +5

ammonification

NH4+

266

BIODGRADATIONS ET MTABOLISMES

La dnitrification sobserve surtout parmi les protobactries, les archaebactries halophiles et hyperthermophiles. La plupart des organismes dnitrifiants sont des htrotrophes qui couplent la rduction des oxydes dazote loxydation d'une source organique, mais la dnitrification peut aussi s'exercer sur l'oxydation de divers composs soufrs, de lhydrogne ou du Fe(II) [33]. La dnitrification est donc un phnomne extrmement rpandu et vari dans lenvironnement. Elle alimente en nergie maintes biodgradations, mais peut rester incomplte en n'allant pas jusqu N2. Une vritable dnitrification va au-del du stade nitrite, et produit au moins NO ou N2O. En sarrtant au nitrite, les entrobactries avec Escherichia coli en tte ne font que le dbut du chemin. La dnitrification est au contraire complte dans le genre Pseudomonas. De nombreuses tudes ont t ralises avec P. stutzeri [34], dont lhabitat naturel est le sol, la boue, les eaux stagnantes et les djections animales. Comme les diffrentes tapes de la dnitrification oprent des potentiels doxydorduction moins levs que celui de la rduction de O2 en molcules deau, la dnitrification est toujours un peu moins efficace sur le plan nergtique quune oxydation respiratoire sur loxygne. Pour la rduction du nitrate en nitrite, le potentiel standard E'(NO3/NO2) est de + 430 mV. Du nitrite l'oxyde nitreux, le potentiel E'(NO2/NO) est de + 350 mV. Ces valeurs se comparent au potentiel de l'oxygne (+ 810 mV). Les bactries vivant en arobiose nont donc pas intrt utiliser du nitrate pour leurs oxydations, alors quelles tenteront de la faire en anarobiose. On sexplique ainsi pourquoi la dnitrification est dlaisse en prsence doxygne sauf quand il est taux trs faible, soit 1-5 M au lieu de 220-240 M saturation avec lair ambiant, conditions dites micro-arobies. Cependant la respiration sur nitrate peut supporter une certaine arobiose, et de nombreuses espces bactriennes du sol sont capables de mener de front la respiration arobie classique et la dnitrification [35]. Ce nest donc pas un choix de tout ou rien. Mais comme la respiration sur oxygne reste la solution la plus rentable, une rgulation au niveau gntique entrave plus ou moins la synthse des outils de la dnitrification en arobiose, et induit au contraire leur synthse aprs disparition d'O2. La transition supporte par les organismes dits arobies facultatifs saccompagne par un profond bouleversement de lexpression des gnes et de la carte mtabolique. Le phnomne a t tudi trs prcisment sur diverses souches de laboratoire, dont Escherichia coli o la situation, revue par COLE [36], apparat comme complexe. La prsence de nitrate permet donc une multitude despces microbiennes de se dvelopper dans les eaux ou les couches du sol o loxygne se fait rare, et autorise dans certains cas des recyclages efficaces par des voies distinctes de l'arobiose. Cela tombe bien : les nitrates souvent ajouts en excs aux cultures comme fertilisants encouragent en mme temps le nettoyage du sol ! Tournons-nous vers lammonification, qui est un passage du nitrate et du nitrite lammoniac avec production dnergie dans le passage du nitrate au nitrite. Cette opration rpond plusieurs objectifs. Le principal est la production de NH3 ou dions ammonium qui seront rcuprs par la cellule pour ses synthses, et correspond une assimilation. Mais lammonification produit de lammonium en excs sur les besoins rels de la cellule et correspond aussi une dtoxification. Elle contribue liminer les nitrites, composs trs toxiques, et permet de compenser

5 AZOTE ET ANAROBIOSE

267

lexcs de pouvoir rducteur dans certaines circonstances physiologiques, empchant ainsi le potentiel redox datteindre des valeurs trop basses qui sont mal supportes par beaucoup de micro-organismes. Les diffrents modes de rduction des nitrates et nitrites fonctionnent parfois simultanment, avec les mmes outils. On tendait autrefois opposer dissimilation et assimilation. La dissimilation dsignait tout ce qui ne produisait pas quelque chose que la cellule ne rcuprait pas comme substrat pour ses synthses. La dnitrification tait donc considre comme une dissimilation. Une bactrie trs commune que lon croyait autrefois strictement arobie, Bacillus subtilis, peut faire en anarobiose une respiration qui va du nitrate au nitrite (donc productrice dnergie), puis passe directement lammoniac par une nitrite rductase dissimilatrice facilement inactive par loxygne [37]. En fonction des diffrents impratifs de croissance, les bactries disposent de plusieurs botes outils, et cest sans doute pour cela que dans une mme espce on voit assez souvent des nitrate et nitrite rductases diffrentes prsentes en double ou en triple. Des enzymes varies rpondent toutes les situations. Ces rductases seront examines au Chapitre 6. La dnitrification contribue aux changes considrables entre les sols, les eaux et latmosphre terrestre. Rappelons que l'oxyde nitreux ou N2O (appel encore oxyde de diazote) est un gaz effet de serre. Malgr sa faible concentration de (0,3 ppmv), il reprsente prs dun cinquime de leffet produit par le dioxyde de carbone car son pouvoir rflchissant est 230 fois plus lev masse gale. Sa teneur est en lente augmentation (0,2 0,3% par an), peut-tre par suite de lusage accru des fertilisants azots. Il a dj t signal que le gaz N2O est accus d'accentuer les dommages faits la couche dozone par des contaminants halogns comme les fluorocarbones du type Fron. En somme la dnitrification suscite trois grands courants dintrt. Le premier est tout simplement la consommation en pure perte du nitrate ajout grand frais comme engrais par les fermiers, car il est la fois consomm par les micro-organismes et entran par l'eau avec la pollution des rivires que l'on sait. Le second thme de proccupation est la monte de leffet de serre, favoris par la dnitrification et encourag par la culture intensive. Le troisime sujet dintrt concerne laction bnfique de la dnitrification comme moteur de la destruction de certains polluants organiques en absence doxygne. La dnitrification est difficile mesurer avec prcision parce que tous les composs minraux azots sont facilement diffusibles comme gaz ou solubiliss par leau. NO et N2 O sont des tapes obligatoires de la dnitrification, mais apparaissent de faon fugitive car ils sont limins rapidement. Le premier est un radical qui s'oxyde spontanment en NO2 par loxygne selon une raction trimolculaire : 2 NO. + O2 2 NO2. Il en rsulte que sur le plan cintique la vitesse de cette oxydation dpend du carr de la concentration de NO. La raction est cependant lente dans les conditions de la dnitrification, o NO ne saccumule pas (il serait dailleurs toxique). La demi-vie de NO dans lair ne descend au-dessous dune heure que si sa concentration en ordre de grandeur dpasse 100 ppmv. La dnitrification, favorise en principe par lanarobiose, tolre la prsence d'O2 taux significatif chez diverses espces. Or la prsence de loxygne favorise loxydation en retour de lammoniac, de NO et NO2, avec comme stade ultime la

268

BIODGRADATIONS ET MTABOLISMES

formation de nitrate, travail ralis par les bactries nitrifiantes. Lorsque ces oxydations surviennent en mme temps que la dnitrification, elles compliquent forcment les mesures. Voici un exemple. Nitrosomonas eutropha est une espce nitrifiante : elle oxyde lammoniac avec O2, opration productrice d'nergie. Ce litho-autotrophe obligatoire est capable de produire N2O et mme N2 partir de nitrite. On a pu le dmontrer laide dexpriences de marquage par lazote-15 [38]. Pourtant lorsquelle est place en anarobiose, son mtabolisme se branche sur la dnitrification. Il se produit alors une chose intressante. En atmosphre contenant le dioxyde dazote (NO2), elle oxyde lammoniac en passant par lhydroxylamine (NH2OH), NO et le nitrite, et rcupre ces deux derniers comme accepteurs pour produire... N2O et N2. Il y a donc bien nitrification et dnitrification simultanes [39]. Cette espce est autotrophe, et se dveloppe efficacement en prsence de NH3, de NO2 et de CO2, ce qui est une faon de visiter tous les rteliers. Cette situation est sans doute assez rpandue dans lenvironnement. Dans le cas de Pseudomonas putida, un htrotrophe, loxydation de NH3 en hydroxylamine, nitrite et nitrate, est possible en anarobiose. Puis le nitrite et le nitrate sont utiliss leur tour comme accepteurs, et il se forme un peu de NO [40]. Un autre Pseudomonas, cultiv sur actate en prsence d'O2, oxyde lhydroxylamine comme source dnergie additionnelle. Il apparat du nitrite, ainsi que N2O qui est la marque dune dnitrification arobie [41]. Cette facult des bactries de jouer sur tous les tableaux fait que lapparition des oxydes dazote, NO et N2O, nest plus la marque dune activit anarobie, comme on avait pu le croire antrieurement. Lapparition de ces gaz en arobiose est lie en grande partie la nitrification par des germes comme Nitrosomonas, alors quen anarobiose les responsables sont plutt les dnitrifiants orthodoxes comme Pseudomonas et Alcaligenes [42]. Lextrapolation sur le terrain des observations de laboratoire semble valable. Des auteurs belges [43] ont montr que des boues dpuration limites en oxygne, dans les conditions dites OLAND*, oxydent lammoniac la fois en nitrite, nitrate et N2. Ce dernier emporte 40% de lazote initial. Il est suppos que les boues effectuent une nitrification qui est couple une dnitrification partielle : le nitrite et le NO forms conduiraient N2 en servant daccepteurs dlectrons. En conclusion, il existe un recouvrement assez large entre la dnitrification et les oxydations inverses dans une gamme tendue de situations. Ces relations sont reprsentes par un schma avec dsignation des enzymes responsables [44]. Le cycle indiqu par le tableau ci-contre met contribution plusieurs sortes dorganismes, avec des transferts de matires d'un biotope un autre dans les sols et les eaux, et offrant toutes les combinaisons possibles. La nitrognase (raction 6) est un maillon important de ce cycle approvisionn par trois grandes sources, qui sont latmosphre (raction 6), les dcompositions de matires organiques gnratrices dammoniac, et les nitrates apports par les engrais agricoles et l'oxydation de l'ammoniac. La raction 8 appartient lhydroxylamine oxydorductase. Elle fait fonction de NH2OH dshydrognase et produit la fois du nitrite et du diazote (N2). Le passage de lhydroxylamine au nitrite limine lui seul 4 lectrons. O vont-ils ? La nitrification est ncessairement arobie.

5 AZOTE ET ANAROBIOSE
NO2 11 NO3 1 9 5 fertilisants NH2OH 7 NH3 NO2 2 NO 12 3 8 N2O 4 10 N2 6 8 matires organiques atmosphre

269

123456-

Nitrate rductase Nitrite rductase Oxyde nitrique rductase Oxyde nitreux rductase Ferrdoxine-nitrite rductase 4 Assimilation de N2 (nitrognase)

7 - Ammoniac mono-oxygnase (AMO) 8 - Hydroxylamine oxydorductase 9 - Nitrite oxydase 10 - (incompltement caractrise) 11 - Oxydation spontane de NO par O2 12 - (incompltement caractrise)

Interconversions azotes
Sur les 4 lectrons, deux iront loxy-gne par une oxydase terminale selon : NH2OH + O2 NO2 + H+ + H2O O vont les deux autres lectrons ? Ils sont rcuprs par l'oxydation de lammoniac en hydroxylamine (raction 7) catalyse par l'ammoniac mono-oxygnase, qui a besoin la fois d'O2 et d'une source rductrice auxiliaire. Loxydation de lhydroxylamine produira de lnergie et fournira en mme temps ces lments rducteurs dont loxygnation de NH3 a besoin, selon : NH3 + O2 + 2e + 2 H+ NH2OH + H2O Les bactries peuvent se dvelopper en arobiose sur hydroxylamine [45]. L'tude a montr que ltape nergtique de la nitrification par Nitrosomonas europaea est bien loxydation de lhydroxylamine en nitrite et non pas la raction de loxygnase. Si un dficit en O2 survient, les bactries se tournent vers un mtabolisme de dnitrification o le nitrite prend la place d'O2 comme accepteur dlectrons. Dans ce chass-crois de ractions, l'analyse exprimentale a souvent recours des inhibiteurs spcifiques pour bloquer telle ou telle tape. C'est le cas de lactylne. Il bloque la fois ltape 4 de la dnitrification catalyse par N2O rductase, et la raction 7 de lammoniac mono-oxygnase (AMO). L'actylne est un outil pour valuer lintensit de la dnitrification sur le terrain et dans une culture, car il conduit une accumulation mesurable du gaz N2O. Un inhibiteur trs classique de lammoniac mono-oxygnase est la nitrapyrine. Cet inhibiteur est en fait un agent "multicarte" car il inhibe dautres activits enzymatiques*. On continue passer au crible dautres inhibiteurs potentiels [46]. La raction 1 1 seraitlgrement stimule par lactylne. Le dioxyde form (NO2) 5 est capable de fonctionner exprimentalement comme accepteur dlectrons au mme titre que le 4 - Lenzyme (EC 1.7.7.1) est assimilarice, elle a t tudie notamment chez les vgtaux. 5 - On peut obtenir le dioxyde par action de lacide nitrique dilu sur des copeaux de cuivre. Lacide agit ici comme oxydant, gnre NO qui soxyde son tour lair en NO2.

270

BIODGRADATIONS ET MTABOLISMES

nitrite ou le nitrate (tape 12). Le dioxyde dazote sous lclairement solaire ragit avec loxygne de lair et les vapeurs dhydrocarbures pour engendrer de lozone et diffrents produits irritants contribuant la pollution des villes et aux fameux smog au-dessus des grandes agglomrations. Nous laisserons de ct le ttraoxyde de diazote (N2O4) form par dimrisation de NO2, produit essentiellement par lactivit humaine. Il a des applications dans la fabrication de carburants pour fuses spatiales. On terminera cette section en signalant qu'il existe une dnitrification chez les champignons et levures. Elle est rvle par lmission de NO, N2O et N2, mais les connaissances sont plus rcentes. Il est possible que la rduction du nitrate dans les sols et sdiments corresponde un mtabolisme de secours lorsque loxygne est limitant ou absent. Elle est pratique par des Fusarium, Giberella, Penicillium, Aspergillus et autres [47]. Certaines espces vont jusquau stade N2. Contrairement une ide reue, la respiration des champignons ne se limite donc pas lemploi d'O2 comme accepteur, mais peut se tourner vers la dnitrification [48]. La production d'nergie chez les eucaryotes non photosynthtiques est tributaire de leurs mitochondries. Auraient-elles perdu leur ancien mtabolisme anarobie ? Cest possible, puisque les mitochondries de Fusarium oxysporum et Cylindrocarpon tonkinense sont capables de prendre en charge une vritable dnitrification sur malate ou pyruvate comme substrat, en faisant de l'ATP par couplage avec les transferts dlectrons [49]. Ces mitochondries "anarobies" sont peut-tre les vestiges dune situation ancestrale, car elles sont munies des enzymes ncessaires la rduction des diffrents oxydes dazote et fonctionnent avec des chanes doxydorduction standards sensibles aux inhibiteurs habituels du type antimycine ou rotnone. Lexistence de ces mitochondries spcialises agrandit notre vision de la biologie des milieux privs dair. Ce que lon croyait tre lapanage des procaryotes appartient aussi aux champignons et aux levures. On peut sattendre de leur part une grande diversit dans ce domaine et une intervention dans lenvironnement plus grande que prvue.

5.6 - LE PASSAGE LANAROBIOSE


Puisque loxygne molculaire est laccepteur respiratoire le plus favorable sur le plan nergtique, il remporte la prfrence sur tous les autres accepteurs possibles quand il est prsent. Sa disparition ncessite une rvision rapide du mtabolisme vers des respirations de remplacement, et nous savons que la dnitrification est lune des solutions possibles. Rappelons le principe gnral de cette conversion mtabolique. Une rgulation denvergure se fait au niveau de la transcription de lADN et se traduit par lexpression de nouvelles familles de gnes, alors que dautres sont mis en veilleuse. La transition se fait avec des modalits diverses selon les espces et ncessite typiquement deux mcanismes molculaires : la dtection du signal physiologique, qui est ici le taux doxygne ; lactivation de la transcription au niveau des gnes concerns en fonction de la valeur du signal.

5 AZOTE ET ANAROBIOSE

271

Pour simplifier lextrme : un capteur, un disjoncteur. Ces deux fonctions sont assures le plus souvent par deux protines distinctes, mais il arrive quune mme protine cumule les deux oprations. Un principe simple en apparence. Malheureusement nous serons vite confronts des situations plus compliques dont la recherche est loin davoir explor toutes les avenues. On sait que la transcription catalyse par lARN-polymrase dmarre au niveau d'un promoteur reconnu par un facteur damorage (ou facteur sigma). Lefficacit de lamorage est variable et dpend de la nature du promoteur ou dautres facteurs comme la conformation locale de la double hlice dADN. Souvent la triple association polymrase-sigma-ADN nest pas suffisante, et cest justement ce qui se passe pour la plupart des gnes du mtabolisme azot. Lapport dune protine supplmentaire est alors requis. Ce nouveau facteur est un activateur de transcription. Dans le cas le plus simple, lactivateur sinstalle sur lADN en amont immdiat du promoteur. Dans dautres cas lactivateur sassocie lADN une certaine distance en amont du promoteur, et entre en contact avec la polymrase la faveur dune dformation de la double hlice. Cest le principe dj entrevu et symbolis par un petit dessin :
activateur IHF ARN-polymrase

ADN

ADN

squences de liaison

facteur sigma

promoteur

amorage, transcription

Protines auxiliaires (principe)


De nombreux gnes du mtabolisme azot sont transcrits partir de promoteurs appartenant une mme famille et reconnus par un facteur sigma spcialis, sigma-54 ou RpoN. La squence consensus reconnue est TGGCACxxxxxTTGCA allant des positions 12 24 (les positions GG et GC places aux extrmits sont absolument ncessaires). Sigma-54 nest gnralement pas capable damorcer tout seul la transcription. Des activateurs supplmentaires sont ncessaires et se fixent en amont de la zone reconnue par sigma-54. Ils entrent en contact avec lARN-polymrase la faveur du repli de la double chane dADN sur elle-mme, favorise par la protine appele IHF. En somme la polymrase ne commence son vritable travail quaprs en avoir reu lautorisation. L'activateur fait office de disjoncteur qui allume ou teint lexpression des gnes que la polymrase est charge de transcrire. Ce disjoncteur reconnat lui-mme une condition physiologique particulire, ou ne le fait que par lintermdiaire dune protine fonctionnant comme capteur (ou dtecteur) sensible un signal spcifique. Le contrle seffectue alors par la collaboration de deux protines, un capteur et un activateur capable de se lier lADN. Examinons la dnitrification proprement dite. Lobjectif de base est de compenser par un oxyde dazote la disparition de loxygne comme accepteur respiratoire. Cest l quintervient la protine FNR. Cest une protine activatrice dont la

272

BIODGRADATIONS ET MTABOLISMES

fonction est de mettre en route lexpression dune foule de gnes concerns par la vie en anarobiose, ou inversement de les mettre en veilleuse aprs larrive de loxygne. Dans Escherichia coli o FNR a t dcouverte initialement, la rgulation globale dont elle est responsable ne commande pas moins de 125 gnes et on commence avoir une ide assez prcise de son fonctionnement [50]. FNR pratique le cumul des mandats, car elle est la fois capteur et activateur [51]. Au repos cest une protine monomrique avec deux zones essentielles. La partie N-terminale de la squence a un domaine fer-soufre jouant le rle de dtecteur, et la partie C-terminale possde une rgion responsable de lattachement lADN. La FNR de E. coli prsente de fortes similitudes structurales avec une autre protine activatrice qui est CRP* dans le domaine qui sattache lADN. La protine FNR est un peu larchtype dune famille de rgulateurs, dont font partie les protines FixK de la section prcdente. La mme architecture et des homologies de squence se retrouvent dans tous ces rgulateurs, ce qui ne veut pas dire que le mode de dtection du signal soit identique dans tous les cas. Comment la protine FNR saperoit-elle quil ny a plus doxygne ? Elle est prsente un taux faible mais pratiquement constant, que les cellules soient places en arobiose ou non. Elle ne sattache pas lADN sous forme monomrique. Elle devient activatrice sous forme dun dimre, par association symtrique de deux chanes identiques. La dtection se fait donc par une transformation qui affecte la structure de FNR elle-mme et non pas son abondance intracellulaire. La pice matresse est un noyau fer-soufre de type [4Fe-4S]2+ similaire celui quon trouve dans bon nombre de ferrdoxines. Il est li par 4 restes de cystine dont trois sont dans la partie la plus N-terminale. Dans une ferrdoxine, le fer-soufre est alternativement oxyd ou rduit entre les tats [4Fe-4S]2+ et [4Fe-4S]+, et li 4 cystines. Lattachement dans FNR ne se fait pas avec quatre cystines, mais sur un mode un peu diffrent. Le noyau sous forme oxyde, [4Fe-4S]2+, stabilise la protine sous sa forme dimrique, celle qui active la transcription. Elle se fixe lADN sur une squence palindromique consensus, TTGATnnnATCAA, centre environ 41 bases en amont du point de dpart de la transcription. La monte de loxygne va faire sauter cette association. Le noyau fer-soufre est fragile. Il est facilement dtruit par O2, et sa destruction rompt la forme dimrique de FNR, qui revenue l'tat monomrique est contrainte de quitter lADN. Un progrs majeur a t ralis aprs clonage du gne, surexpression pour en avoir une quantit suffisante et purification conduite strictement labri de lair. La protine est alors obtenue principalement sous forme de dimre, avec un fer-soufre par chane, et peut se lier lADN [52]. La spectroscopie MOSSBAUER [53] suggre que O2 dclenche la transformation des noyaux [4Fe-4S]2+ en [2Fe-2S]2+, mais le mode exact nest pas dfinitivement tabli. On a suppos aussi quil pouvait se faire en [3Fe-4S]+ et un ion Fe3+, une conversion qui correspondrait une oxydation avec perte de fer et provoquerait la dissociation du complexe FNR-ADN. La teneur en oxygne ncessaire pour supprimer de moiti le pouvoir activateur de FNR est trs basse, de lordre de 0,1 0,5% de la teneur normale en quilibre avec lair. La transformation de FNR parat rversible. La rcupration aprs puisement complet de loxygne suppose lintervention dun facteur enzymatique charg de remodeler le noyau fer-soufre, et du mme coup de restaurer la protine. On pense

5 AZOTE ET ANAROBIOSE

273

que cette fonction revient la protine NifS. Loxygne a dtach FNR de lADN et la protine NifS permet lopration inverse. Le schma est un modle provisoire symbolisant le passage dun tat lautre. Il y a peut-tre plusieurs formes non actives, [2Fe-2S] indique ici, [3Fe-4S] et une forme dpourvue de fer-soufre.

[2Fe-2S]2+ FNR non active

anarobiose 2 Fe2+, 2 S2 NifS Fe2+, S2 O2

[4Fe-2S]2+ FNR ADN active

NADH dshydognase cytochrome o diverses oxydations FNR

dnitrification fumarate rductase DMSO rductase formiate dshydrognase pyruvate-formiate lyase glycrol-3P dshydrognase oxydations diverses

FNR alterne entre deux tats


Parmi les facteurs de la dnitrification se trouvent des enzymes, des transporteurs, des systmes de capture de mtaux et de synthse des cofacteurs Les gnticiens diraient que la commande de tout cela correspond un rgulon*. Par exemple dans le systme deux composants NarX/NarL, lactivateur NarL, renseign par NarX, commande le rgulon de lutilisation du nitrate 6. Un autre rgulon commande lutilisation du nitrite et se voit lui-mme contrl en amont. Une supervision gnrale est effectue par FNR, qui contrle plusieurs rgulons lis la dnitrification, ainsi que dautres oprations qui lui sont trangres comme la rduction du fumarate, ou encore le fonctionnement de la pyruvate-formiate lyase. On dit que FNR est le rgulateur dun modulon ou systme de rgulation globale. Il existe donc une hirarchie entre niveaux de rgulation pour une optimisation des diffrentes voies. FNR est comparable un disjoncteur gnral contrlant un grand nombre de fonctions. Sur chaque ligne existent des disjoncteurs particuliers, sur lesquels sont branchs des circuits distincts. Voici quelques exemples de protines rgulatrices adoptant une structure comparable (en particulier dans la partie liant lADN). Certaines reconnaissent directement loxygne (cas de FNR), dautres sont actives au sein dun systme deux composants (type FixK).

6 - Comme dans un systme classique deux composants, NarX, qui reconnat le nitrate, active la protine NarL en la phosphorylant sur aspartate.

274 Rgulateur Espce bactrienne FNR ANR FnrA FnrP NNR FixK2 DNR AadR
Escherichia coli Pseudomonas aeruginosa Pseudomonas stutzeri Paracoccus denitrificans Paracoccus denitrificans Bradyrhizobium japonicum Pseudomonas aeruginosa Rhodopseudomonas palustris

BIODGRADATIONS ET MTABOLISMES Oprons cibles 7 nar, nap, fdr, nir nar, nir, nor,nos, arc arc, ccp nar, cco, ccp nir, nor nar, rpoN 8, fix nir, nor nar, nir Dtection par fer-soufre (O2) fer-soufre (O2) fer-soufre (O2) fer-soufre (O2) oxyde nitrique [54] FixJ/FixL (O2) nitrite fer-soufre (O2)

On connat actuellement une bonne cinquantaine de protines rgulatrices de la superfamille FNR-CRP. La comparaison des squences montre quil sagit dune diversification volutive partir de la mme solution ancestrale [55]. La plasticit structurale et volutive du modle qu'elles reprsentent est remarquable. Il a t possible par mutation dobliger CRP reconnatre des promoteurs activs par FNR, et rciproquement [56], ce qui ne semble possible que si les modes dattachement lADN sont pratiquement les mmes. cela sajoutent diverses fonctionnalits : allongement de la squence et modifications locales pour recevoir un noyau fer-soufre (FNR), cration dun site daffinit pour des oxydes dazote, ou un nuclotide (AMP cyclique), acquisition dun site phosphorylable (FixK), insertion dune porphyrine La reconnaissance de O2 comme effecteur apparat comme un cas particulier, elle nest effective que pour certains membres de cet ensemble. Se rattachent aussi cette grande famille dautres protines montrant une ressemblance structurale avec FNR, notamment NarL dont il sera question plus loin [57]. Le signal O2 est-il toujours reconnu par un noyau fer-soufre ? La rponse est ngative. Parmi les autres protines qui partagent avec la FNR du colibacille des ressemblances de squence et de structure, on distingue au moins deux groupes : le type FNR, dont le systme de reconnaissance est fond sur un noyau fer-soufre, et le type FixK utilisant une porphyrine. Dans le premier existe ce quon appelle une "signature" (un consensus) dans la partie N-terminale de la squence prsume recevoir le noyau fer-soufre : Cys-x2-Cys-x5-Cys (FNR, ANR) ou Cys-x2-3-Cys-x7-Cys (AadR). Cette signature est absente dans le deuxime groupe contenant les DNR et les FixK, apparemment dpourvues de fer-soufre, et prsentes dans les bactries fixatrices dazote. Elles reoivent leurs ordres dans un systme rgulateur deux composants : FixL/J. Nous avons dj rencontr FixL propos de la fixation de lazote. Rappelons que cette protine hminique fixe O2 sur le fer(II) de sa porphyrine. En oxygne absent ou faible, FixL phosphoryle FixJ, qui active son tour FixK2. Le vritable activateur est FixK2 [58].

7 - nar : nitrate rductase membranaire. nar : idem, priplasmique. fdr : fumarate rductase. nir : nitrite rductase. nor : NO rductase. nos : N2O rductase. arc : catabolisme de larginine. ccp : cytochrome c peroxydase. cco : cytochrome cbb oxydase. rpoN : expression des gnes fix (fixation de lazote) et nif (nitrognase). 8 - Appel aussi NtrA.

5 AZOTE ET ANAROBIOSE

275

Nous avons maintenant lhabitude des protines rgulatrices qui font office de disjoncteur sur lADN. Elles autorisent ou non le dmarrage dune transcription. Lassociation sur lADN prs du promoteur peut se faire en un site unique ou sur des sites secondaires. Les rgles dassociation sur lADN sont presque toujours du mme type. La squence reconnue est palindromique et obit des critres de dimension bien dfinis. La protine sinstalle sous forme dun dimre et lADN subit au cours de lassociation une courbure ou une dformation plus ou moins prononce qui est essentielle lorsque le site de liaison est loign du promoteur. Le processus a besoin de facteurs auxiliaires tels que IHF, qui facilitent la torsion de la double hlice. Les protines du type NtrA ou FNR ont-t-elles une valeur universelle ? On sait dj que non. Bacillus subtilis est une espce Gram-positive sporulante longtemps considre comme exclusivement arobie. L'intervention d'un rgulateur tel que FNR ne devrait pas tre ncessaire. En fait ces bactries ont galement une aptitude se dvelopper en anarobiose, notamment par rduction du nitrate. Elles assimilent l'azote ammoniacal uniquement par la glutamine synthtase, et celle-ci n'apparat pas rgule comme celle du colibacille. Le contrle s'exerce par au moins trois protines rgulatrices, TnrA, GlnR et CodY, qui ont chacune leur secteur d'influence sur les gnes du mtabolisme azot en fonction des conditions physiologiques [59]. CodY est un rpresseur dans les cellules en multiplication rapide sur des acides amins comme source azote, GlnR rprime en excs d'azote dans le milieu, TnrA active ou rprime quand les ressources en azote sont limites. Le plan directeur des rgulations est rendu complexe chez B. subtilis du fait que les enzymes de dgradation des acides amins servant de source d'azote ont un rle cl la fois au cours de la sporulation et de la germination des spores.

5.7 - UNE OPTIMISATION TRS POUSSE


Lalternance entre arobiose et anarobiose est chaque fois une vritable crise dans la vie cellulaire. Elle provoque un profond bouleversement dans l'expression de nombreux gnes, modifie des enzymes du mtabolisme et les chanes de transport d'lectrons. La protine FNR contribue grer cette crise. En fait elle n'est pas seule le faire. Si le nitrate et autres oxydes de lazote sont des accepteurs respiratoires, cest--dire des succdans de loxygne lorsque celui-ci fait dfaut, il existe d'autres accepteurs possibles en fonction des disponibilits. Nous les retrouverons par la suite : dimthyl-sulfoxyde, trimthylamine N-oxyde (TMMO), fumarate (chez le colibacille), et les trs importants ions sulfate chez les sulfatorducteurs. Ces diffrents accepteurs ne sont pas tous aussi favorables sur le plan thermodynamique. Cela dpend du potentiel doxydorduction de laccepteur et du mcanisme concern. Lorsque plusieurs possibilits soffrent simultanment, les bactries ont intrt privilgier un accepteur efficace plutt quun autre moins performant. Un bon accepteur est le nitrate, dont le potentiel est bien plus favorable que celui du fumarate. Encore faut-il quil y ait du nitrate, sinon la bactrie serait condamne gaspiller son nergie en fabriquant des enzymes inutiles. Il y a

276

BIODGRADATIONS ET MTABOLISMES

donc un choix qui est assez bien connu pour le colibacille. Lorsqu'il est plac en anarobiose, FNR donnera le feu vert pour une activation en bloc des gnes de la dnitrification, mais dautres rgulateurs vont ouvrir ou fermer les voies autorises par FNR en fonction des facteurs disponibles et de leur efficacit. Par exemple lutilisation du fumarate (notamment lopron frdABCD de la fumarate rductase) ne sera mise en route quen anarobiose et en absence de nitrate. Si ce dernier est disponible, la fumarate rductase sera au contraire rprime pour donner la prfrence la dnitrification. Le choix des diffrentes voies autorises par FNR ncessite donc des contrles secondaires. Une rgulation centrale de nombreux oprons par FNR, des rgulations satellites sur les oprons individuels. Voici comment sexerce le choix entre nitrate et fumarate. Le colibacille peut utiliser un deuxime rgulateur de transcription, qui est NarL. Cette protine fait partie dun systme deux composants, soit un capteur (NarX) et un activateur (NarL). NarX est charg de dtecter s'il y a du nitrate ou pas. Dans le premier cas, il agit sur NarL qui renforce lactivation des gnes de lutilisation du nitrate condition que lopration soit autorise par FNR (du nitrate, mais pas de O2). Mais voici le point important : la protine NarL, au lieu de favoriser lexpression des gnes du fumarate, fait exactement linverse, entrave leur expression et fonctionne comme rpresseur. Consquence : le nitrate sera rduit en priorit. Le nitrate une fois puis, NarL perdra son affinit pour lADN et cessera son action. En labsence de O2, FNR activera lexpression des gnes du fumarate sans que NarL n'y mette dentrave.
NarX priplasme cytoplasme N His ATP C nitrate rductases (narGHJI,napA) nitrite rductases (nirBDC, nrfABCDEFG) exportateur de nitrite (narK) formiate dshydrognase (fdnGHI) DMSO/TMNO rductase (dmsABC) fumarate rductase (frdABCD) alcool dshydrognase (adhE) pyruvate-formiate lyase (pfl) ADP C P His P Asp N NarL Asp NarX-P nitrate

+
NarL

NarX reconnat le signal nitrate et rgule NarL


La protine NarX est membranaire, elle comporte une partie qui dpasse dans le priplasme et reconnat la prsence du nitrate lextrieur, ainsi que le nitrite. Elle

5 AZOTE ET ANAROBIOSE

277

possde aussi un domaine cytoplasmique porteur de lactivit autokinase comme dans tous les systmes deux composants. Lautophosphorylation de NarX s'effectue en continu mme en l'absence du signal nitrate, elle est seulement acclre dans un rapport de 2 10 aprs arrive du nitrate. NarX phosphoryle NarL aprs stre phosphoryle elle-mme un taux suffisant. Lexistence dun taux de base permanent autorise peut-tre une plus grande rapidit de rponse larrive du signal. Par mutation de la squence qui dpasse dans le priplasme, on peut crer une situation o NarX sautophosphoryle au taux maximum et transmet le signal mme quand il ny a pas de nitrate (verrouillage ON), alors que dautres mutations ont leffet inverse (verrouillage OFF). La reconnaissance du nitrate est donc lorigine dun changement de conformation qui se transmet travers la membrane et agit sur le taux dautophosphorylation [60]. NarX devenu NarX-phosphate agit comme une kinase, elle transmet son phosphate NarL ( NarL-phosphate). Ces deux protines ont t caractrises dabord dans le colibacille, mais se retrouvent sous des formes voisines chez les diffrentes espces bactriennes dnitrifiantes tudies. Cette rgulation est en double chez le colibacille. Un systme NarQ/NarP est homologue du prcdent. Les deux systmes dtectent la fois le nitrate et le nitrite. Le partage des comptences relles entre les deux tandems rgulateurs, NarX/NarL et NarQ/NarP, nest pas clairement lucid. La rponse au nitrate est la plus vive, elle est dclenche pour un seuil de 5 M dans NarX (avec une phosphorylation 50% pour 35 M) contre des doses au moins 50 fois plus leves avec le nitrite [61]. Il y a probablement des diffrences daction sur plusieurs voies mtaboliques cellulaires, permettant un rglage fin de la machinerie gnrale. La liaison phosphate sur ces protines est labile, ce qui garantit qu'en cas de disparition du signal le systme retourne la case dpart. Sinon NarL-phosphate sassocie lADN sur un mode remarquable. La reconnaissance seffectue sur un site heptamrique (squence de 7 nuclotides), de type TACYNMT (Y est C ou T, M est A ou C, N est nimporte quel nuclotide). Or il y a plusieurs heptamres chelonns en amont du gne rgul. Ces heptamres se prsentent en motifs isols ou par paires. Par exemple en amont du gne narG, qui est celui de la nitrate rductase, il ny a pas moins de 8 sites heptamres allant des positions 57 208 9. La transcription en aval est donc le rsultat d'un jeu subtil de reconnaissance du promoteur, d'interaction avec lARN-polymrase, de l'intervention dautres protines (qui facilitent ou entravent les associations), d'une courbure de lADN (induite en particulier par IHF). Une illustration montre la disposition constate chez le colibacille en amont de lopron nir qui code pour une nitrite rductase cytoplasmique. Lactivation seffectue la fois par la disparition d'O2 (reconnue par FNR) et par la prsence de nitrite (NarL et NarQ). Ce systme a t tudi en dtail en Angleterre par le groupe de BUSBY (WU et coll [62]). De nombreuses mutations ont t introduites des positions comprises entre 150 et 11 en amont du dpart de la transcription, tout en faisant varier la distance entre les sites de FNR et de NarL. Lamorage par sigma-54 (RpoN) ne

9 - Positions repres par la technique des empreintes la Dnase I (footprinting).

278

BIODGRADATIONS ET MTABOLISMES

peut pas se faire sans lassociation lADN de NarL (ou de NarP) et de FNR. Les rglages sont complexes. FNR serait lactivateur principal de la transcription, mais son action serait contrecarre par une ou plusieurs protines se liant spcifiquement en amont du site de NarL et agissant comme rpresseurs. Lune de ces protines a t identifie (Fis) et se lie vers 140. Le rle de NarL serait dcarter ces gneurs et de dgager FNR de toute inhibition. Cette interprtation, qui nest probablement pas gnralisable dautres oprons, montre que lintervention des rgulateurs sur lexpression des gnes quils gouvernent peut obir des rgles varies et parfois compliques.
69,5

TACCCATTAAGGAGTA ATGGGTAATTCCTCAT
69,5 41,5

TACCCATTAAGGAGTATATGGATGTGAATTTGATTTACATCAAT

69,5 site NarL, NarP

41,5 site FNR

26 10 rgion reconnue par sigma-54

+1 dpart de la transcription

Rgion rgulatrice en amont de l'opron nar


En fonction de tout cela, on voit nouveau quil existe une hirarchie dans les protines rgulatrices. Aprs les rgulateurs comme FNR qui commandent des grandes options du mtabolisme, dautres protines modulent les dtails, et leurs organisation dpend de ladaptation physiologique des espces. Le colibacille, contient plus de cinquante protines rgulatrices et les rgions reconnues par elles sur lADN, non transcrites, correspondent une part importante du gnome total [63]. Le diagramme inspir de WALTER ZUMFT (1997) montre comment une dnitrification complte, symbolise par la zone dintersection ombre, est obtenue par le fonctionnement simultan de plusieurs rgulons, reprsents chacun par un cercle.

respiration nar (NarL) Dn.

respiration nir, nor (DNR)

Trois grandes tapes sont rgules par des protines diffrentes.

respiration nos (NosR)

nar nir, nor nos

rduction nitrate nitrite rduction nitrite NO N2 rduction N2O N2

Dnitrification complte (Dn.)

5 AZOTE ET ANAROBIOSE

279

La dnitrification est une fonction modulaire correspondant au moins trois respirations anarobies diffrentes qui sont ingalement reprsentes selon les espces. Par exemple, le passage de N2O N2 manque chez Escherichia coli. Malheureusement il est trs difficile de donner un plan absolument gnral. Le schma suivant, inspir nouveau de ZUMFT (1997), a le mrite de comparer trois solutions parmi celles qui sont possibles chez les Gram-ngatives, correspondant au tableau des protines type FNR rencontr plus haut. Ce sont seulement trois exemples, un chantillonnage srement insignifiant face lnorme diversit naturelle. Un rectangle du tableau correspond aux oprons activs par un mme rgulateur (flche).
DNR FnrD NirL NNR

nir nar

nor nos arc ANR 1

nir nar

nor nos arc, ccp NosR

nir nar

nor

cco, ccp FnrP 3

NarL 2

FnrA

Trois solutions
Ces quelques indications nous montrent la complexit des rgulations cellulaires en fonction de lespce et de la nature du milieu. Elles nont ici quune valeur dexemple. Ce que nous voyons est une optimisation pousse qui est le fruit dune longue volution. La population des micro-organismes dans les milieux naturels est le sige de comptitions o chaque forme sefforce doptimiser son mtabolisme. Il en rsulte une grande plasticit oprationnelle autorisant des biodgradations anarobies dans une gamme tendue de conditions diffrentes. Pour jeter un regard plus synthtique sur ces questions importantes o s'entrecroisent beaucoup de donnes, un rsum rassemblera les quatre mcanismes de base qui permettent aux cellules anarobies facultatives d'adapter leur mtabolisme en passant de l'arobiose l'anarobiose, et vice versa, ou encore de rsister la prsence de l'oxygne. Les deux premiers sont des modulons, ils concernent chacun une palette de fonctions diffrentes. Le troisime et le quatrime sont des rgulons, dont la vocation est plus spcialise. quelle teneur du milieu en O2 l'interconversion se fait-elle ? Elle est forcment variable avec les espces, mais rappelons que la limite se situe vers 0,1 0,5% du taux maximum de O2 en quilibre avec l'air.

280 Rgulateur Dtection


FNR Oxydation et destruction rversible de [4Fe-4S]2+ par O2.

BIODGRADATIONS ET MTABOLISMES Fonction


Utilisation du nitrate, du nitrite et du fumarate comme accepteurs. Agit comme activateur ou rpresseur, interagit avec la sous-unit de l'ARN-polymrase. La plupart des oprons contrls le sont aussi par d'autres protines. Rprime le gne fnr, active arcA. ArcA phosphoryle en ArcA-P (systme deux composants), se lie l'ADN et rprime en gnral les gnes impliqus dans l'arobiose. Dphosphorylation par ArcB non phosphoryle. SoxR oxyde stimule l'amorage par l'ARNpolymrase et active la transcription de soxS. SoxS se lie aux promoteurs des gnes de dfense contre le superoxyde et y stabilise l'attachement de la polymrase OxyR autorgule sa propre expression, rgule 20-30 gnes concerns par la rsistance aux peroxydes.

ArcA

Phosphorylation de ArcB en ArcB-P stimule par divers mtabolites (lactate, pyruvate) et un potentiel redox bas. SoxR avec 2 [2Fe-2S]+ oxyds par superoxyde. Taux cellulaire constant. Li l'ADN. Oxydation de OxyR sur thiols en prsence de H2O2. Taux cellulaire constant.

SoxR,S

OxyR

CONCLUSION
La dnitrification pratique par les bactries apporte une solution puissante au recyclage des matires carbones en anarobiose tant que le nitrate est prsent. Cette activit donne lieu des rglages sophistiqus sur le plan de l'expression des gnes, car elle est tributaire de la production de nitrate par oxydation de l'ammoniac, et cette partie du cycle de l'azote fait intervenir une comptition avec les plantes et les champignons. Les bactries dnitrifiantes sont souvent capables d'effectuer en anarobiose de nombreuses biodgradations et se montrent capables d'utiliser des accepteurs de remplacement quand le nitrate fait dfaut. La dnitrification reste dans tous les cas un maillon quasi essentiel dans les biodgradations anarobies.

RFRENCES
[1] F A U R E G (1991) Principles and Applications of Inorganic Geochemistry, Macmillan Publishing Co., New York. [2] A B E R JD (1992) Trends in Ecology Evolution 7 : 220-223. [3] V I L L A R E A L TA, P I L S K A L N C , B R Z E Z I N S K I M, L I P S C H U L T Z F, D E N N E T T M & G A R D N E R G B (1999) Nature 397 : 423-425. [4] Z E H R JP, W A T E R B Y JB, T U R N E R PJ, M O N T O Y A JP, O M O R E G L E E, S T E W A R D G F , H A N S E N A & K A R L D M (2001) Nature 412 : 635-638.

5 AZOTE ET ANAROBIOSE [5] N E Y R A C , D B E R E I N E R J, L A L A N D E R & K N O W L E S R (1977) Can. J. Microbiol. 23 : 300-305 ; N E L S O N LM & K N O W L E S R (1977) Can. J. Microbiol. 24 : 1395-1403.

281

[6] Z H U L I N IB, B E S P A L O V VA, J O H N S O N MS & T A Y L O R BL (1996) J. Bacteriol. 178 : 5199-5204 ; M A R C H A L K, S U N J, K E I J E R S V, H A A K E R H & V A N D E R L E Y D E N J (1998) J. Bacteriol. 180 : 5689-5696. ]7] V A R G A S C , W U G , D E L G A D O MJ, P O O L E RK & D O W N I E JA (1996) Microbiology 142 : 41-46. [8] B A K E R D D & S C H W I N T Z E R C R (1990) Introduction, The biology of Frankia and Actinorhizal Plants, Academic Press : 1-13. [9] S I M O N E T P, N G U Y E N TL, T E S S I E R D U C R O S E & B A R D I N R (1988) Appl. Environ. Microbiol. 54 : 2500-2503. [10] P U P P O A, D I M I T R I J E V I C L & R I G A U D J (1989) Physiologia Plantarum 77 : 308-311. [11] L E V I N E A, T E N H A K E N R, D I X O N R & L A M B C (1994) Cell 79 : 583-593. [12] K I M J & D .C . R E E S (1992) Nature 360 : 553-560 ; K I M J & coll. (1993) Biochemistry 32 : 7104-7115. [13] S E E F E L D T LC , R A S C H E ME & E N S I G N S A (1995) Biochemistry 34 : 5382-5389. [14] S C H N E I D E R K, G O L L A N U, D R T T B O O M M, S E L S E M E I E R - V O I G T S & M L L E R A (1997) Eur. J. Biochem. 244 : 789-800. [15] L O W E D J & T H O R N E L E Y RN (1984) Biochem. J. 224 : 877-886 ; T H O R N E L E Y RN & L O W E D J (1984) Biochem. J. 224 : 887-894 ; L O W E D J & T H O R N E L E Y RN (1984) Biochem. J. 224 : 895-901. [16] S E E F E L D T LC , R A S C H E ME & E N S I G N S A (1995) Biochemistry 34 : 5382-5389 ; R A S C H E ME & S I E F E L D T LC (1997) Biochemistry 36 : 8574-8585. [17] J A C O B S O N MR, B R I G L E KE, B E N N E T T LT, S E T T E R Q U I S T RA, W I L S O N MS , C A S H VL, B E Y N O N J, N E W T O N W E & D E A N D R (1989) J. Bacteriol. 171 : 1017-1027 ; P A U RN (1989) Trends Biochem. Sci. 14 : 183-186. [18] L E E S , R E T H A, M E L E T Z U S D , S E V I L L A MV & K E N N E D Y C (2000) J. Bacteriol. 182 : 7088-7091. [19] H O M E R MJ, P A U S T I A N TD , S H A H VK & R O B E R T S G P (1993) J. Bacteriol. 175 : 4907-4910. [20] N I S H I O K & N A K A I M (2000) J. Biol. Chem. 275 : 22615-22618 ; L E I M K H L E R S & R A J A G O P A L A N KV (2001) J. Biol. Chem. 276 : 22024-22031. [21] L E E S H , P U L A K A T L, P A R K E R KC & G A V I N I N (1998) Biochem. Biophys. Res. Comm. 244 : 498-504. [22] B A R R E T T J, R A Y P, S O B C Z Y K A, L I T T L E R & D I X O N R (2001) Mol. Microbiol. 39 : 480-493. [23] R E Y E S - R A M I R E Z F, L I T T L E R & D I X O N R (2001) J. Bacteriol. 183 : 3076-3082. [24] G O V A N T E S F, M O L I N A - L O P E Z JA & S A N T E R O E (1996) J. Bacteriol. 178 : 6817-6823. [25] D I X O N R (1998) Arch. Microbiol. 169 : 371-380 ; M O N E Y Y , B A R R E T T J, D I X O N R & A U S T I N S (2001) J. Bacteriol. 183 : 1359-1368. [26] E A R L C D , R O N S O N C W & A U S U B E L FM (1987) J. Bacteriol. 169 : 1127-1136. [27] G O N G W , H A O B, M A N S Y S S , G O N Z A L E Z G , G I L L E S - G O N Z A L E Z MA & C H A N MK (1998) Proc. Natl. Acad. Sci 95 : 15177-15182. [28] M O R E N O - V I V I A N C & F E R G U S O N S J (1998) Molec. Microbiology 29 : 664-666. [29] S A B A T Y M, G A G N O N J & V E R M E G L I O A (1994) Arch. Microbiol. 162 : 335-343. [30] S T E W A R T V (1988) Microbiol. Rev. 52 : 190-232 ; H O C H S T E I N LI & T O M L I N S O N G A (1988) Annu. Rev. 42 : 231-261.

282

BIODGRADATIONS ET MTABOLISMES

[31 ] C R A W F O R D NM & A R S T J R . H N (1993) Annu. Rev. Genet. 27 : 115-146 ; L I N JT & S T E W A R T V (1998) Adv. Microb. Physiol. 39 : 1-30. [32] K R O T S K Y A & W E R N E R D (1987) Arch. microbiol. 147 : 48-57. [33] S T R A U B KL, B E N Z M, S C H I N K B & W I D D E L F (1996) Appl. Environ. Microbiol. 62 : 1458-1460. [34] C A R L S O N C A & I N G R A H A M JL (1983) Appl. Environ. Microbiol. 45 : 1247-1253 ; B R A U N C & Z U M F T W G (1992) J. Bacteriol. 174 : 2394-2397. [35] C A R T E R JP, H S A I O Y H , S P I R O S & R I C H A R S O N D J (1995) Appl. Environ. Microbiol. 61 : 2852-2858. [36] C O L E J (1996) FEMS Microbiol. Lett. 136 : 1-11. [37] H O F F M A N N T, F R A N K E N B E R G N, M A R I N O M & J A H N D (1998) J. Bacteriol. 180 : 186-189. [38] P O T H M & F O C H T D D (1985) Appl. Environ. Microbiol. 49 : 1134-1141 ; P O T H M (1986) Appl. Environ. Microbiol. 52 : 957-959. [39] S C H M I D T I & B O C K E (1997) Arch. Microbiol. 167 : 106-111 ; Z A R T D , B O C K E (1998) Arch. Microbiol. 169 : 282-286. [40] D A U M M, Z I M M E R W , P A P E N H , K L O O S K, N A W R A T H K & B O T H E H (1998) Curr. Microbiol. 37 : 281-288. [41] J E T T E N MS , D E B R U I J N P & K U E N E N JG (1997) Antonie Van Leeuwenhoek 71 : 69-74. [42] A N D E R S O N IC , P O T H M, H O M S T E A D & J , B U R D I G E D (1993) Appl. Environ. Microbiol. 59 : 3525-3533 ; Z A R T D & B O C K E (1998) Arch. Microbiol. 169 : 282-286. [43] K U A I L & V E R S T R A E T E W (1998) Appl. Environ. Microbiol. 64 : 4500-4506. [44} C O N R A D R (1996) Microbiological Rev. 60 : 609-640. [45] H Y M A N MR & A R P D J (1995) J. Bacteriol. 177 : 4974-4979. [46] K E E N E R W K, R U S S E L L S A & A R P D J (1998) Bichim. Biophys. Acta 1388 : 373-385. [47] B L E A K L E Y BH & T I E D J E JM (1982) Appl. Environ. Microbio. 44 : 1342-1348 ; B U R T H L, B E N C K I S E R G & O T T O JC G (1982) Naturwissenschaften 69 : 598-599 ; S H O U N H , K I M D H , U C H I Y A M A H & S U J I Y A M A J (1982) FEMS Microbiol. Lett. 94 : 277-281 ; N A K A H A R A K, T A N I M O T O T, H A T A N O K, U S U D A K & S H O U N H (1993) J. Biol. Chem. 268 : 8350-8355 ; U S U D A K, T O R I T S U K A N, M A T S U O Y , K I M D H & S H O U N H (1995) Appl. Environ. Microbiol. 61 : 883-889. [48] S H O U N H , K I M D H , U C H I Y A M A H & S U G I Y A M A J (1992) FEMS Microbiol. Lett. 73 : 277-281. [49] K O B A Y A S H I M, M A T S U O Y , T K I M O T O A, S U Z U K I S , M A R U O F & S H O U N H (1996) J. Biol. Chem. 271 : 16263-16267. [50] S A W E R S RG , Z E H E L E I N E & B C K A (1988) Arch. Microbiol. 149 : 240-244 ; K I L E Y PJ & B E I N E R T H (1999) FEMS Microbiol. Rev. 22 : 341-352. [51] S P I R O S & G U E S T JR (1990) FEMS Microbiol. Rev. 75 : 399-428 ; U N D E N G & S H I R A W S K I J (1997) Mol. Microbiol. 25 : 205-210. [52] L A Z A Z Z E R A BA, B E I N E R T H , K H O R O S H I L O V A N, K E N N E D Y MC & K I L E Y PJ (1996) J. Biol. Chem. 271 : 2762-2768. [53] P O P E S C U C V, B A T E S D M, B E I N E R T H , M N C K E & K I L E Y PJ (1998) Proc. Natl. Acad. Sci. 95 : 13431-13435 ; K I L E Y PJ & B E I N E R T H (1999) FEMS Microbiol. Rev. 22 : 341-352. [54] H A S E G A W A N, A R A I H & I G A R A S H I Y (1998) FEMS Microbiol. Lett. 166 : 213-217.

5 AZOTE ET ANAROBIOSE [55] F I S C H E R H M (1994) Microbiol. Rev. 58 : 352-386 ; V O L L A C K KU, H R T I G E, K R N E R H & Z U M F T W G (1999) Molec. Microbiol. 31 : 1681-1694. [56] S A W E R S G , K A I S E R M, S I R K O A & F R E U N D L I C H M (1997) Molec. Microbiol. 23 : 835-845. [57] B A I K A L O V L, S C H R D E R I, K A C Z O R - G R Z E S K O W I A K M, G R Z E S K O W I A K K, G U N S A L U S RP & D I C K E R S O N RE (1996) Biochemistry 35 : 11053-11061. [58] G I L L E S - G O N Z A L E Z MA, G O N Z A L E Z G & P E R U T Z MF (1995) Biochemistry 34 : 232-236. [59] F I S H E R S H (1999) Molecular Microbiol. 32 : 223-232. [60] C A V I C C H I O L I R, C H I A N G RC , K A L M A N LV & G U N S A L U S RP (1996) Molec. Microbiol. 21 : 901-911. [61] L E E AI, D E L G A D O A & G U N S A L U S RP (1999) J. Bacteriol. 181 : 5309-5316. [62] W U H C , T Y S O N KL, C O L E JA & B U S B Y S JB (1998) Molecul. Microbiol. 27 : 493-505. [63] T H I E F F R Y D , S A L G A D O H , H U E R T A AM & C O L L A D O - V I D E S J (1998) Bioinformatics 14 : 391-400.

283

RDUCTION DES OXYDES D'AZOTE


Ce chapitre examine les enzymes qui transforment progressivement le nitrate en azote gazeux ou en ammoniac, par les tapes entrevues dans le chapitre prcdent. On s'intressera au mcanisme daction des diffrentes rductases qui participent la dnitrification, sans lesquelles, bien des biodgradations seraient impossibles. Les bactries n'en ont pas l'exclusivit, et l'intervention des champignons sera voque en fin de chapitre. 6.1 - Nitrate rductases et molybdne 6.2 - Nitrate rductases varies 6.3 - La rduction des nitrites 6.4 - Le passage direct du nitrite lammonium 6.5 - De loxyde nitrique loxyde nitreux 6.6 - De N2O au diazote 6.7 - Des champignons dnitrifient 287 290 293 301 303 307 309

CHAPITRE 6

6 RDUCTION DES OXYDES D'AZOTE


Le grand cycle de lazote dans la nature comporte un va-et-vient entre la forme la moins oxyde, qui est lammonium, et la plus oxyde, qui est le nitrate. Le chapitre prcdent nous a permis dentrevoir quelques tapes fondamentales, comme la raction de la nitrognase. Ce nouveau chapitre est surtout enzymologique. Il tente de dcrire le mcanisme daction des diffrentes rductases qui participent la dnitrification. En labsence de celle-ci, bien des biodgradations deviendraient impossibles. La dnitrification fait partie des grands agents moteurs de la biochimie de lenvironnement au mme titre que les oxydations effectues laide de loxygne.

6.1 - NITRATE RDUCTASES ET MOLYBDNE


de rares exceptions prs, la rduction biologique du nitrate, quelle soit respiratoire ou assimilatrice, a besoin de molybdne, un oligo-lment dont cest lune des contributions biologiques essentielles. Nous l'avons trouv dans la nitrognase, l'enzyme charge de rduire le diazote en ammoniac. Le molybdne sy rencontrait dans un noyau fer-soufre dun type particulier, mais la nitrognase est une exception parmi les enzymes molybdne. Dans tous les autres cas o il intervient, le molybdne est log dans un cofacteur nuclotidique. Les molybdo-enzymes sont nombreuses et varies. Le mtal oscille entre les stades Mo(VI) et Mo(IV). Ce n'est que le trente-cinquime lment par ordre dabondance dans la crote terrestre et son importance biologique n'attire pas toujours l'attention qu'elle mriterait. On trouvera la page suivante un petit tableau pour souligner le rle de Mo dans la nature, nitrognase exclue. Les ractions catalyses et des renseignements supplmentaires sont donns en glossaire. Il est noter que le molybdne a son double qui est le tungstne. Ce mtal a peut-tre particip au dveloppement de la vie ds les temps les plus anciens, car il se rencontre chez des bactries rputes hritires des formes les plus primitives. Le tungstate est volontiers un inhibiteur des enzymes molybdne, mais il est requis pour lactivit de certaines enzymes comme la formiate dshydrognase des archaebactries hyperthermophiles et des mthanognes (voir Tungstne*). Il existe donc des tungsto-enzymes, o le mtal est li un cofacteur organique de mme nature que celui qui renferme du molybdne [1]. Le cofacteur nuclotidique molybdne fut dcouvert lorigine dans un mutant nit-1 de Neurospora crassa. Sa nitrate rductase tait sans action mais un mlange de constituants faible masse

288

BIODGRADATIONS ET MTABOLISMES

molculaire pouvait la ractiver [2]. Les mutants de ce type ont souvent des dfauts multiples au niveau des diverses enzymes maintenant rpertories comme molybdo-enzymes. La nitrate rductase en fait partie. Labsence dune nitrate rductase fonctionnelle entrane une proprit caractristique, qui est la rsistance au chlorate (NaClO3). L'explication est la suivante : la nitrate rductase rduit le chlorate en produits hautement toxiques, comme lhypochlorite, et un dfaut de cette enzyme met le mutant labri de cet inconvnient.
Exemples Nitrate rductase Slniate rductase Arsniate rductase Formiate dshydrognase 2-oxocarboxylate rductase Sulfite rductase FormylMF* dshydrognase TMAO** rductase DMSO*** rductase Polysulfure rductase Aldhyde oxydorductase Sulfite oxydase Xanthine oxydase Aldhyde oxydase Fonction catalytique Rduction des nitrates en nitrites Rduction des slniates en slnites Rduction des arsniates en arsnites Oxydation du formiate en CO2 Rduction en (2R)-hydroxycarboxylate Rduction de lhydrosulfite en sulfure Oxydation du formylMF Rduction du TMAO en trimthylamine Rduction du DMSO en dimthylsulfure R. respiratoire du polysulfure en sulfure Conversion aldhyde/acide Oxydation du sulfite en sulfate Oxydation des purines en acide urique Oxydation des aldhydes en acides Localisation Procaryotes, vgtaux Bactries (Thauera) Bactries (Chrysiogenes) Procaryotes Bactries (P. vulgaris) Procaryotes, vg., an. Mthanognes Bactries Bactries Bactries (Wolinella) [3] Bactries (Desulfovibrio) Animaux Animaux, champignons Animaux

* Formylmthanofurane, ** Trimthylamine-N-oxyde, *** Dimthylsulfoxyde

La structure chimique du cofacteur indique ici est celle du molybdoptrine-guanine dinuclotide ou MGD, prsent dans Rhodobacter sphaeroides IL106 [4]. On reconnat facilement la position du molybdate Mo(VI), li deux atomes de soufre (thiolne), et droite la structure dun nuclotide guanine. Chez certaines espces la guanine est remplace par dautres bases. Les cofacteurs portant du molybdne forment une famille de produits. La moiti gauche de la formule montre ici comporte un cycle pyrane, qui est ferm par un atome doxygne. Le cycle peut tre ouvert (avec apparition dun OH) par un mcanisme doxydorduction rversible qui ferait partie du fonctionnement du cofacteur.
O O HN H2N H N N H S Mo S O P O P O CH2 N N N O O NH
NH2

HO

molybdoptrine

O O O O HO OH

Molybdoptrine-guanine dinuclotide (MGD)

6 RDUCTION DES OXYDES D'AZOTE

289

L'ensemble du MGD est donc une structure forme par deux nuclotides souds par leurs phosphates comme dans la structure du NAD ou du FAD. Les prcurseurs sont deux units indpendantes de GMP (guanosine-monophosphate). Lun de ces nuclotides est transform en molybdoptrine sous laction dune synthase, qui introduit les atomes de soufre et autorise ainsi la mise en place du molybdate. L'opration est suivie de la soudure des deux nuclotides. Le molybdate est la principale source de Mo dans les eaux et le sol, o son abondance est modeste, soit 0,04 0,2 ppm, bien moindre que celle du fer ou du manganse. Laccumulation des dbris vgtaux reprsente un rservoir de molybdne dans la biosphre. La teneur des tissus vgtaux est en moyenne de 0,8 5 ppm. Une carence en molybdne des plantes cultives est favorise par un sol acide. La synthse de ce cofacteur a t tudie en dtail dans E. coli et on suppose que son principe est gnralisable aux autres espces. Grce des systmes trs efficaces de capture et de transport, la rcupration de Mo par les bactries nest pas un problme physiologique majeur. La question a t examine en dtail chez plusieurs Gram-ngatifs. Le transport est de type ABC, dont le reprsentant le plus tudi dans la recherche est celui du maltose [5]. Cette dsignation fait allusion trois parties, une protine priplasmique trs haute affinit pour le compos piger (ici le molybdate), un transporteur log dans la membrane cytoplasmique, et une ATPase du ct interne. Ce mcanisme est trs rpandu chez les bactries et possde son quivalent chez les eucaryotes. Aprs capture du molybdate, celui-ci se voit donc transmis et concentr dans la cellule bactrienne avec laide dune hydrolyse dATP comme source dnergie 1. Les cellules disposent dune petite rserve de mtal grce une protine de stockage, qui a t dtecte dans un Gram-positif (Clostridium pasteurianum) l'aide de molybdate marqu [6]. La fonction de Mo dans certaines enzymes doxydorduction est maintenant assez bien connue. Une petite parenthse peut tre ouverte en citant la formiate dshydrognase-H (FDH-H) dEscherichia coli . Sa structure dtaille est connue. Le molybdne y est li non seulement au cofacteur MGD dcrit plus haut, mais au slnium de la slnocystine, et le mcanisme de la catalyse est maintenant assez bien cern [7]. La structure en dinuclotide du MGD ne se retrouve pas dans toutes les molybdoenzymes. Le cofacteur peut navoir que la partie molybdoptrine ou MPT, qui est dans le cadre gris de la formule prsente plus haut. Si le molybdne est gnralement indispensable la rduction biologique du nitrate, on connat tout de mme de petites exceptions. la fin de 1998, des auteurs russes ont fait tat de la dcouverte dun Pseudomonas (Ps. isachenkovii), dont la nitrate rductase tait dpourvue de molybdne et du cofacteur correspondant [8]. Lenzyme tait priplasmique et renfermait du vanadium. Une autre rductase tait membranaire et ne possdait ni molybdne, ni vanadium. La question se pose donc de savoir sil sagissait dun cas exceptionnel, ou dune situation plus commune qu'escompt,

1 - Au laboratoire, les cultures en milieu dfini peuvent exiger lintroduction de faibles quantits de molybdate. mais les impurets des produits commerciaux peuvent suffire, ainsi que l'acier inox des rcipients.

290

BIODGRADATIONS ET MTABOLISMES

qui aurait chapp aux investigations antrieures. La section suivante sintresse aux nitrate rductases bactriennes Mo, pices classiques de la dnitrification. Les nitrate rductases "courantes" se rpartissent grosso modo en trois plans structuraux. Lanalyse des squences montre quil y a de fortes homologies lintrieur de chacune des trois familles, dont la section suivante nous donnera les principaux caractres.

6.2 - NITRATE RDUCTASES VARIES


La multiplicit des nitrate rductases microbiennes a t rsume dans un tableau o apparaissent les sigles gntiques de base. Dans la premire colonne, larchtype de la nitrate rductase respiratoire et membranaire est le complexe NarGHI dEscherichia coli. Ce systme est rprim par O2. Il intervient dans la dnitrification. La colonne suivante cite la rductase NapAB loge dans le priplasme. Elle peut commander un mcanisme nergtique, donc une respiration de remplacement sur nitrate quand les conditions sont arobies. Si NapAB peut effectivement se substituer NarGHI en prsence dair, il s'agira d'une source nergtique d'appoint car la respiration sur O2, plus efficace sur le plan thermodynamique, conservera le rle prdominant. Fonction
Localisation Structure sous-units Sigle gntique Cytochromes Induction par nitrate Rpression par NH4+ Rpression par O2 Transport nitrate exig M sous-unit catalytique

Respiration sur nitrate [9]


Membrane 222 + narGHJI, narZYWV Type b (NarI) oui non oui oui 150 kDa (NarA)

Respiration ou contrle redox [10]


Priplasme + cytochr. membr. napABC Type c (NapB) oui non non non 90 kDa (NapA)

Assimilation du nitrate [11]


Cytoplasme nasA (aucun) oui oui non oui 92 kDa

NarGHI du colibacille est larchtype du complexe membranaire de la nitrate rductase respiratoire. Ce systme est rprim par O2. Dans la colonne du milieu, la rductase NapAB situe dans le priplasme peut donc commander une rduction du nitrate en arobiose comme il a t dit. NasA est une rductase soluble fonction assimilatrice qui ne participe pas une rcupration dnergie. Les lectrons prlevs sur nitrate par les rductases respiratoires sont capts par un ou plusieurs cytochromes. L'un d'eux est NarI qui fait partie intgrante du complexe NarGHI. Celui-ci est associ la membrane et participe la conservation dnergie sous forme d'un potentiel p. Les lectrons prlevs sur le nitrate par la rductase priplasmique NapAB parviennent aux chanes de transport dlectrons de la membrane sur sa face externe avec conservation dnergie. Toutes ces rductases ont un cofacteur molybdne et sont des protines fer-soufre. Lorsquelles rduisent le

6 RDUCTION DES OXYDES D'AZOTE

291

nitrate sur la face cytoplasmique de la membrane (NarGHI) ou dans le cytoplasme lui-mme (NasA), un mcanisme de transport des ions nitrite et nitrate est rendu ncessaire, car la membrane ne leur est pas directement permable. La NarGHI de E. coli fonctionne grce un antiporteur* : pour chaque nitrate qui rentre, il y a un nitrite qui sort. Cet antiporteur est cod par narK et inductible en mme temps que la rductase [12]. Dans le cas de la rductase cytoplasmique assimilatrice existe un transporteur spcial observ dans Klebsiella pneumoniae et un Synechococcus. La plupart des bactries dnitrifiantes semblent avoir au moins deux rductases, voire trois, et il existe mme plusieurs varits dans chaque catgorie ! Les nitrate rductases respiratoires ont fait lobjet dune attention particulire. ct de la rductase membranaire du colibacille qui est la mieux connue et code par l'opron narGHJI, existe un deuxime complexe cod par l'opron narZYWV. Celui-ci est fortement homologue du prcdent et dtermine une nitrate rductase dont les sousunits sont interchangeables avec la premire [13]. Cette situation est assez rpandue dans les espces dnitrifiantes, dont Pseudomonas aeruginosa, Ps. stutzeri, Paracoccus denitrificans, Bacillus subtilis, Staphylococcus carnosus et autres. Voici la composition du complexe NarGHJI du colibacille. Il possde sa chane d'oxydorduction interne avec NarH et NarI. La partie NarI contribue ancrer solidement l'difice molculaire la membrane : un chaperon molculaire particulier pour la nitrate rductase et linsertion du cofacteur molybdne dans la partie NarG [14]. Sous-units M(kDa) Cofacteur associ Fonction NarG NarH NarI NarJ
138,7 57,7 26,5 25,5 MGD [3Fe-4S], 3 [4Fe-4S] cytochrome b aucun Catalytique, rduit le nitrate Transfre les lectrons de NarJ NarG Ancre membranaire, rduit par mnaquinol Stabilisateur, agit comme chaperon molculaire

La sous-unit NarH a quatre centres fer-soufre numrots de 1 4. tudis par RPE et potentiomtrie, ils prsentent une cascade de potentiels doxydorduction diffrents, respectivement + 80, + 60, 200 et 400 mV. Le centre 2 est un [3Fe-4S]. Chose curieuse, lactivit rductase n'est pas supprime si le centre 1, dont le potentiel est le plus lev, est limin aprs mutation 2. Les lectrons sont probablement achemins au sein du complexe par le canal de ces noyaux fer-soufre dont la chane n'a pas besoin d'tre complte [15]. cette chane fait suite le dispositif de NarI, qui est un cytochrome b comportant deux hmes B [16] et possde deux potentiels diffrents, soit + 17 et + 122 mV. La structure du cytochrome deux fois hminique semble obir un schma courant observ dans les complexes bc1 comme celui qu'on trouve dans la mitochondrie. La nitrate rductase est donc un complexe macromolculaire amenant les lectrons petits pas vers le nitrate, lequel est rduit sur la face cytoplasmique de la membrane. D'o viennent les lments rducteurs ? Ils seraient fournis par un quinol respiratoire (quinone rduite) ou un mnaquinol.

2 - Les centres fer-soufre sont lis ordinairement la protine par des rsidus de cystine (Cys). Une mutation remplace un Cys par la srine ou lalanine et empche linsertion correcte du cofacteur.

292

BIODGRADATIONS ET MTABOLISMES

Contrairement lenzyme membranaire, la nitrate rductase priplasmique n e rduit pas le chlorate mais accepte une certaine arobiose. Cette rductase ou NapABC est btie sur un plan assez diffrent du prcdent d'aprs les tudes faites sur Ralstonia eutropha et lespce photosynthtique Rhodobacter sphaeroides [10] : Sous-units M(kDa) Cofacteur associ NapA NapB NapC NapD, NapE
93,3 18,9 27 25,5 MGD, [4Fe-4S] Cytochrome c dihme Cytochrome c ttrahme [4Fe-4S]

Fonction
Catalytique, rduit le nitrate Transfre les lectrons de NapC NapA Rduit NapB, insr dans la membrane Incompltement tudis, fonct. mal connue

En arobiose, lenzyme respiratoire NarGHJI est hors course, car il y a rpression de sa synthse, mais la rductase priplasmique peut prendre le relais et aurait une double fonction. Elle dissiperait lexcs de pouvoir rducteur, notamment dans les espces photosynthtiques comme Rhodobacter o il peut y avoir une sorte de "surchauffe" en clairement fort. Elle peut aussi faire du nitrite dont la dnitrification peut se poursuivre en prsence de O2. La rductase priplasmique pourrait aussi faciliter la transition au fonctionnement anarobie en cas dpuisement soudain en oxygne, laissant le temps au cellules de refaire leur stock en NarGHJI. Un diagramme rsume ce qui prcde. Une quinone respiratoire et sa forme quinol sont dsignes par Q et QH2. Sont figures la nitrate rductase respiratoire NarGHI et lenzyme priplasmique NapABC. La protine membranaire NarK est le transporteur.
NapABC NO2 priplasme (I) membrane NarK (H) Fe-S NO3 b (G) MGD QH2 Q (C) (A) MGD (B) QH2 Q

cytoplasme

NarGHI

Nitrate rductases
Les acteurs de la dnitrification ont donc une palette doutils de base pour faire face des besoins varis et fluctuants, mais il ne s'agit que du dbut du processus. Il nous reste examiner rapidement les systmes qui rduisent les nitrites, NO et N2O. Une mine de trouvailles a permis de comprendre un peu mieux un cycle biochimique dont les rpercussions sur lagronomie et la dfense de lenvironnement sont l'vidence essentielles.

6 RDUCTION DES OXYDES D'AZOTE

293

6.3 - LA RDUCTION DES NITRITES


Lion nitrite est le premier intermdiaire dans la rduction du nitrate. Il est rduit son tour par une nitrite rductase dans une raction nergtique : NO + 2 H+ + e NO. + H O (G = 76,2 kJ . mol1)
2 2

Ce sont des protines solubles. Un seul lectron est mis en jeu pour aboutir un radical, loxyde nitrique, dont la toxicit sexplique par les nombreuses ractions secondaires quil peut donner avec loxygne, le superoxyde, les mtaux de transition, les amines, les thiols et la tyrosine. Il est considr comme agent mutagne. Loxyde nitrique est pourtant un produit biologique important. Il est engendr par la NO synthase rpandue chez les eucaryotes, mais dcele aussi chez des bactries du genre Nocardia. La synthse de NO a lieu partir de larginine, exerce un contrle multidirectionnel, par exemple dans le mtabolisme du fer, la pression artrielle, ou comme neurorgulateur. Une surproduction de NO est lie au processus inflammatoire. Malgr ces tats de service, l'oxyde nitrique est bien un produit risque dans la nature. Cette question vaut bien une petite parenthse. Parmi les entits les plus toxiques lies au mtabolisme d'O2 et de lazote figurent le radical hydroxyle (OH) et lanion peroxynitrite (ONOO). Le premier est produit par la raction de FENTON*, le deuxime par raction de NO. sur le superoxyde. Le peroxynitrite ragit avec CO2 pour donner des intermdiaires instables qui contribuent son limination en se dcomposant nouveau pour donner du nitrate et librer nouveau CO2. La dcomposition du peroxynitrite dans l'eau pH 7 est rapide, avec une vie moyenne de l'ordre de la demi-seconde et le superoxyde est lui-mme encore plus instable. Mais la raction du peroxynitrite avec le superoxyde est beaucoup plus rapide et produit deux radicaux, hydroxyle (OH.) et dioxyde d'azote (NO2). Leur apparition peut crer une situation dangereuse dont les cellules se protgent en acclrant la disparition du superoxyde par la superoxyde dismutase. Existe-t-il galement une protection contre le peroxynitrite ? La rponse est affirmative d'aprs BRYK et coll [17]. L'intervention est due une enzyme, l'alkylperoxyde rductase, observe dans diverses espces bactriennes. L'enzyme AhpC est code par l'opron ahpCF de Salmonella typhimurium, conjointement avec une flavoprotine (AhpF). Cet opron est activ par la protine rgulatrice du stress oxydant OxyR* et intervient certainement dans la rsistance l'oxygne de nombreux micro-organismes, en particulier les formes micro-arophiles. Conclusion : le monoxyde d'azote est bien un produit potentiellement dangereux pour la vie cellulaire. Revenons la nitrite rductase et la dnitrification proprement dite. Il existe deux catgories denzymes compltement diffrentes, mais jamais prsentes ensemble dans les mmes cellules. Les premires sont des cytochromes 4 hmes, les cytochromes cd1. Les secondes ou CuNIR sont des protines contenant du cuivre. Le tableau en donne une comparaison sommaire :

294 Cytochrome cd1


Structure Localisation Cofacteur Donneur de Distribution Homodimre, environ 120 kDa Priplasmique 2 (hmes C et D1) Azurine, pseudo-azurine, cyt. c551 Prdominent : bactries du sol (Pseudomonas, Ralstonia)

BIODGRADATIONS ET MTABOLISMES CuNIR


Homotrimre (3), 85-110 kDa Priplasmique 2 Cu2+, types 1 et 2 3, par sous-unit Azurine, pseudo-azurine, cyt. c552, Alcaligenes, Bacillus, Rhodobacter, Achromobacter, Nitrosomonas

La rpartition des deux catgories dans lenvironnement ne fait pas bon mnage avec la taxonomie. Par exemple il y a des Pseudomonas munis de la rductase cuivre, dautres avec le cytochrome. Rhodobacter sphaeroides a lenzyme cuivre, Rhodobacter denitrificans a le cytochrome. Il y a des variantes intressantes. Par exemple une souche sulfato-rductrice appartenant l'espce Desulfovibrio desulfuricans possde une nitrite rductase cytochrome dote en mme temps d'une forte activit comme sulfite rductase [18]. Pourquoi ces deux solutions concurrentes ? Nous nen avons aucune ide, mais il est possible que la raction catalyser soit assez difficile pour appeler la slection de systmes trs particuliers, loigns des enzymes doxydorduction les plus courantes. La question se pose notamment pour le cytochrome cd1. En effet lenzyme a deux hmes distincts, C et D1 ; le second lie O2, CO, NO et NO2, a une formule particulire, et ncessite lui tout seul une voie de biosynthse spciale partir de luroporphyrinogne III*.
protine Cys H3C S COOH CH3 Cys S H3C N Fe N H3C CH2 CH2 COOH CH2 CH2 COOH N CH3 H3C CH2 CH2 COOH CH2 CH2 COOH N N CH3 H2C O N Fe N CH3 N CH3 O COOH CH2 CH3

Hme C

Hme D1

Le cytochrome cd1 est une enzyme intressante. Il a t dcouvert paradoxalement comme une cytochrome oxydase induite par le nitrate dans Pseudomonas aerugnosa [19], car il utilise un cytochrome c comme donneur et peut accessoirement rduire O2 en 2 molcules de H2O avec transfert de 4 lectrons comme 3 - Distinction explique dans le Glossaire, rubrique Cuivre*.

6 RDUCTION DES OXYDES D'AZOTE

295

dans une chane respiratoire arobie classique. Nanmoins la ractivit du cytochrome cd1 pour le nitrite est au moins cent fois plus grande que pour l'oxygne. Son fonctionnement comme oxydase est un peu particulier. La rduction de O2 se fait sur le fer de lhme D1 et non pas sur un centre bi-mtallique Fe-Cu comme dans loxydase mitochondriale. Il s'agit peut-tre dune triple adaptation : la nitrite rductase cd1 serait amene faciliter la dnitrification en prsence dun peu d'oxygne, contribuerait ponger ce dernier quand il est prsent au cours de la dnitrification, et servirait dtoxifier le nitrite au cours de larobiose. La nitrite rductase cd1 est un dimre symtrique, chaque sous-unit tant munie dun hme C et dun hme D1, que la figure ci-aprs compare entre eux. Le premier, gauche, a la structure classique de la molcule appele protoporphyrine IX, prsente dans lhmoglobine, mais il est attach la protine par des liens covalents sur cystine (Cys). Le second, droite, na pas de tels liens, et on devine que sa ralisation hors norme va ncessiter lintervention dans la cellule bactrienne des enzymes spcialises supplmentaires. La structure du cytochrome cd1 est connue grce lanalyse cristallographique faite Oxford [20]. Les noyaux porphyriques sont superposs dans la nitrite rductase comme lindique un schma montrant les deux sous-units identiques agences symtriquement par rapport un axe, et contenant au total 4 hmes figurs en trait paissi. Seule est reprsente la charpente de chaque polypeptide ou chane primaire, lexclusion des chanes latrales des acides amins qui sont au nombre de 567. La rduction de chaque molcule de NO saccompagne, daprs lanalyse structurale, dun va-et-vient entre deux conformations lgrement diffrentes, comme si le dimre palpitait dans son ensemble au cours de la catalyse.

hme C

hme D1

Structure du cytochrome cd1


Les lectrons venant un un dun donneur extrieur passeraient par lhme C. Un cheminement interne la protine ferait alors parvenir chaque lectron lhme D1 qui est assez proche et constitue le ple ractif sur lequel le nitrite ou loxygne sont rduits. Le cheminement serait donc : Donneur (azurine*) surface de la protine hme C chane interne hme D1

296

BIODGRADATIONS ET MTABOLISMES

Chacune des deux sous-units est donc structure pour faire marcher par ellemme la raction. Elle comporte deux "domaines", celui de lhme C en haut sur le croquis, et celui de lhme D1. Ce dernier est log dans une portion assez rigide, consolide par des barreaux bta* : la chane forme autour du D1 une sorte de couronne de ptales orients un peu comme les pales dune turbine. Le D1 est rendu accessible au substrat (le nitrite) par une ouverture dispose dans la partie infrieure telle que la molcule est oriente sur le dessin. Un autre croquis explicatif montre les traits suivants. droite est reprsente une sous-unit isole, la prsence du fer tant repre par les boules grises, et la portion charpente par des barreaux bta en trait paissi. gauche est indiqu lenvironnement du fer dans chaque hme. La cinquime coordinence est occupe par de lhistidine (avec numro dans la squence), la sixime par lhistidine dans lhme C. En ce qui concerne lhme D1 du site actif, la sixime coordinence est vide (ou faiblement occupe par une molcule deau retenue par deux histidines, non reprsentes). Cest l que viendra sinstaller lion nitrite, ou le cas chant une molcule de O2. La tyrosine-25 (Tyr-25) pourrait bien prendre la place, mais elle est facilement tire en arrire par le reste de la chane. Un petit dtail important comme nous allons le voir.

5e histidine-69

6e histidine-17

Fe

tyrosine-25 OH 5e histidine-200 6e N O

O nitrite

D1

Le dessin suivant montre lune des communications entre les deux hmes. Le premier est attach la protine par deux cystines. On observera la position de lhistidine-17 en sixime coordinence. La communication stablit ici par le segment His-17 Tyr-25 de la squence. La lettre N dsigne la position du nitrite. Quel est le principe de ce mcanisme ? Rappelons la raction : NO2 + 2 H+ + e NO + H2O. Il faut donc 2 protons et 1 lectron. On pense que les deux protons sont injects partir de His-345 et His-388 situs proximit de l'hme D1 et sont compenss partir du reste de la protine et par lextrieur. Chaque lectron arrive par le canal de lhme C jusqu lhme D1, suivant un cheminement qui emprunte la chane polypeptidique le long du segment His-17-Tyr-25.

6 RDUCTION DES OXYDES D'AZOTE


His-69 Cys-65 Ala-66 Gly-67 Cys-68 Arg-20 Asp-22 Tyr-25 His-345 His-200 His-388 Thr-21 N D1 Tyr-25 His-345 His-388 Thr-19 His-17 Lys-18 Cys-68 Cys-65 C

297

His-17

a - sans les porphyrines

b - avec les hmes en place

L'environnement des hmes


Voil le principe essentiel qui semble se profiler. La tyrosine-25 sintresse beaucoup au fer, mais la rduction du D1 provoque un petit changement de conformation de la protine qui la tire en arrire, dgageant du mme coup la sixime position sur le fer. Cest l que le nitrite vient sinstaller librement. La spectroscopie RPE suggre que son azote tablit la sixime coordinence et rtablit ainsi la symtrie autour du mtal. Les oprations peuvent se rsumer ainsi (en noir lhme D1 oxyd, en blanc lhme rduit) :
nitrite 2 H+ NO

D1
e

D1

D1

NO2
H2O

D1

NO+

D1

NO

D1

Il sest form une combinaison ractive : D1-Fe2+-NO+ . Le fer sefforce de cder un lectron, tandis que son ligand charg positivement ne demande qu en rcuprer un. Le passage de lun lautre conduit D1-Fe3+-NO, o le produit de la rduction de lion nitrite est NO qui reste li au fer. Lassociation de NO lhme est extrmement forte si le fer est rduit. dfaut de loxydation du fer, loxyde nitrique devrait rester bloqu en permanence sur sa position. Le passage du fer ltat Fe3+ et la prsence de la tyrosine-25 corrigent cet inconvnient. La tyrosine stait carte, mais la faveur du changement de conformation inverse du premier, elle revient sur le fer et contribue chasser NO. Ce dispositif spcial utilise donc une porphyrine modifie et un changement de conformation dans une molcule trs complexe, pour en fin de compte pouvoir chasser loxyde nitreux ! Le changement de conformation est ltape la plus lente de la raction (0,1 0,5 s1), mais nempche pas lenzyme de rester trs efficace dans la rduction de lion nitrite ! Ce phnomne intressant a t pass au peigne fin grce lanalyse structurale

298

BIODGRADATIONS ET MTABOLISMES

haute rsolution. Les cristaux se laissent assez facilement rduire 4, et on peut mme y faire diffuser le substrat. On sait maintenant que le cycle catalytique met en jeu un changement conformationnel global, qui modifie la distribution des liaisons hydrogne internes et implique Tyr-25. En outre la rduction de lhme C perturbe lenvironnement du fer et remplace His-17 par un rsidu voisin (Met-106) [21]. De tels rsultats sont extrmement importants sur un plan gnral pour comprendre le fonctionnement des transferts dlectrons intramolculaires et c'est pourquoi nous nous y sommes attards ici. L'enzyme est un outil performant slectionn en vue dliminer le plus vite possible le nitrite et NO, dont laccumulation dans lenvironnement aurait des effets dltres sur la microflore ! Lexistence intermdiaire dune entit trs ractive indique prcdemment est certainement responsable des ractions secondaires de la nitrite rductase observes sur les amines, lazoture (ou "azide") et lhydroxylamine. Ces ractions sont des nitrosations. Elles conduisent des produits trs toxiques, en particulier les nitrosamines. Cest peut-tre l'inconvnient majeur du nitrite qui peut se comporter comme un cancrigne. La nitrite rductase contenant du cuivre est compltement diffrente de la prcdente, n'ayant aucune homologie avec elle bien que la raction catalyse soit la mme. Rappelons-nous. Au sein de la nitrite rductase les lectrons provenant dun donneur (du type azurine ou cytochrome c) taient canaliss jusquau substrat par deux hmes successifs. Une autre solution conM 121 siste remplacer les hmes par 2 ions cuivre dans H 117 une tine darchitecture diffrente mais fonctionS nant de manire comparable.
HN N Cu S C 112 G 45 N NH

O C

CH NH

H 46

Le cuivre dans l'azurine

La prsence du mtal confre ces enzymes une couleur assez intense, bleue (595 nm) ou verte (plusieurs bandes vers 460, 590, 700 et 850 nm) et des signaux caractristiques en RPE. Les deux ions Cu2+ (I) et (II) ont une gomtrie de coordination diffrente dans les deux cas. Le cuivre de type I est coordonn par 4 rsidus dacide amin (2 His, Met, Cys) et confre la protine sa couleur bleue ou verte. Le dessin montre ce type de coordination dans l'azurine de Pseudomonas aeruginosa, qui change un lectron avec le cytochrome c551 [22]. Trois liaisons avec histidine et cystine dfinissent un plan, les deux autres avec mthionine et un carbonyle tant au-dessus et au-dessous.

4 - On ne peut pas faire cette rduction par le donneur dlectrons naturel, qui nentrerait pas dans le cristal. On utilise un rducteur artificiel, dithionite ou viologne rduit. Le cristal passe du brun au vert par rduction.

6 RDUCTION DES OXYDES D'AZOTE

299

Cette structure subit une lgre dformation au cours de l'oxydorduction et la petite protine ragit de faon dynamique par un changement de structure au cours du transfert. Le cuivre de type II est li trois rsidus seulement (3 His), la quatrime coordination tant occupe par une molcule deau que le substrat vient bousculer. Les deux ions Cu oscillent entre les tats Cu+ et Cu2+, les lectrons cheminent dans le sens Type I Type II par un transfert intramolculaire [23]. Il existe une analogie du fonctionnement avec celui du cytochrome cd1 [24] :
2+ e nitrite + + 2 H+ + 2+ NO 2+

Cu

Cu

Cu

NO2
H2O

Cu

NO

Cu

NO

Cu

La structure dtaille de la nitrite rductase dAchromobacter cycloclastes est connue [25]. Lenzyme est un trimre de trois polypeptides identiques de 340 rsidus chacun. Chaque sous-unit est articule en deux domaines, dont lun porte les deux ions Cu essentiels. Un dessin tente de rsumer cette disposition. La coordinence du cuivre de type I avec la cystine, et la gomtrie ttradrique plus ou moins dforme autour du mtal a des effets sur le spectre dabsorption et dtermine la couleur bleue ou verte de lenzyme.
Tyr-134 His-95 Cu(I) Cu(II) Leu-94 His-135 Cys-136 His-145 substrat His-100 Cu(II) Met-150 Cu(I) Phe-99

Trp-144

His-306 appartenant la sous-unit d'en face

Nitrite rductase d'Achromobacter cycloclastes


La partie droite permet de constater trois lments intressants. Tout d'abord le cuivre de type I fait une coordinence avec latome de soufre de la cystine-136, qui jouxte lhistidine-135 dans la squence. Or ce dernier est li galement au cuivre de type II. Il y a donc un court cordon de communication entre les deux ions cuivre renforc par l'empilement des cycles de la tyrosine-134 et de la phnylalanine-99. On voit ensuite que la sphre de coordination du cuivre de type II est incomplte. Une case vacante est occupe par une molcule deau avec une interaction faible en position dattente. Elle est facilement remplaable par le substrat. Cest donc le ple ractionnel de la protine et il est suppos actuellement que lion nitrite

300

BIODGRADATIONS ET MTABOLISMES

interagit avec le cuivre par lun de ses atomes doxygne [26]. Le troisime point considrer est la coordination du cuivre de type II par l'histidine-306 appartenant la sous-unit voisine. Le site catalytique est donc construit dans la surface de contact entre les deux parties symtriques du dimre. Toutes les nitrite rductases contenant du cuivre seraient bties sur ce modle sauf diffrences de dtail, et des lments de squence sont fortement conservs. Voici la ressemblance dune portion de squence entre trois espces au niveau de plusieurs rsidus coordonnant le Cu de type I (1) et le Cu de type II (2). Les trois espces bactriennes sont Pseudomonas aureofaciens (P.a), Achromobacter cycloclastes (A.c) et Alcaligenes faecalis (A.f). On repre facilement, par exemple, la succession YHC. L'histidine-306, non montre sur ce segment, est galement conserve.
1 2 21 1 1

P.a NSMP H NVDF H AATGALGG AGLTQVVPGQEVVL RFKA DRSGT FVY HC AP QGMVPW H VVSG M NGALMV A.c N T L L H NIDF H AATGALGG GALTQVNPGEETTL RFKA TKPGV FVY HC AP EGMVPW H VTSG M NGAIMV A.f NTLM H NIDF H AATGALGG GGLTEINPGEKTIL RFKA TKPGV FVY HC AP QGMVPW H VVSG M NGAIMV

Ces rductases sont-elles spcifiques du nitrite ? Il y a de petites diffrences parmi la douzaine de cas de figures examins dans la littrature. Souvent quelques pour cent de N2O sont produits en plus du NO. Parfois apparaissent un peu dhydroxylamine et dammoniac, mais ces ractions nont peut-tre pas dimportance physiologique [27]. Il arrive enfin que O2 soit rduit comme dans le cas du cytochrome cd1. Les donneurs dlectrons partenaires des nitrite rductases sont des protines, soit des cytochromes c, soit des cuprdoxines, c'est--dire des protines doxydorduction contenant du cuivre. Parmi ces dernires, lazurine et la pseudo azurine 5. Ce sont les donneurs prfrs des rductases cuivre, mais la rductase de Rhodobacter sphaeroides utilise plutt un cytochrome c2. Lazurine et la pseudoazurine ont une faible masse molculaire, un seul ion Cu, et ont des structures trs comparables. Le cuivre de lazurine est entour par Cys, Met et deux His comme le Cu de type I de la rductase. Lazurine travaille surtout avec les rductases bleues, la pseudo-azurine avec les vertes. Pourquoi cette slectivit ? Probablement pour une question de complmentarit de surface. Pour que deux protines entrent en change doxydorduction, il faut quelles saccolent dune certaine faon, et leur adhrence est ici facilite par la distribution des charges ioniques de leur priphrie. Autrement dit, la slectivit serait en grande partie une question de complmentarit ionique [28]. Quelle est la source dlectrons en amont de la cuprdoxine ? La chane respiratoire bactrienne joue ce rle, et utilise ici la nitrite rductase comme exutoire. La rduction du nitrite en NO au cours de la dnitrification ne participe pas directement la production dnergie. C'est tout 5 - La palette des petites protines dpourvues dactivit enzymatique et servant de transporteurs dlectrons dans la nature contient des lments varis: cuprdoxines (contenant du cuivre), des ferrdoxines (avec noyau fer-soufre), rubrdoxines (du fer, mais pas de soufre acido-labile), thiordoxines (avec deux thiols adjacents), flavodoxines (avec FMN), cytochromes de type c, et on en passe.

6 RDUCTION DES OXYDES D'AZOTE

301

simplement la chane des transporteurs respiratoires dans la membrane qui assume cette fonction. Les nitrite rductases sont donc des enzymes intressantes sur le plan fondamental et en mme temps fort essentielles dans l'environnement. On s'attend les trouver dans de nombreuses espces du sol. Par exemple des actinomyctes sont capables de transformer le nitrate en nitrite et N2O, et on a mis en vidence rcemment chez Streptomyces thioluteus une nitrite rductase cuivre, fonctionnant avec une azurine comme donneur [29].

6.4 - LE PASSAGE DIRECT DU NITRITE LAMMONIUM


La rduction de lion nitrite peut se faire dans deux directions, soit vers la formation doxyde nitrique qui a retenu l'attention de la section prcdente, soit par conversion directe en NH4+. La premire fait partie de la dnitrification, la seconde fait partie de la voie appele ammonification : NO2 + 6 e + 8 H+ NH4+ + 2 H2O

Rappelons les faits. Cette conversion 6 lectrons peut donner lieu une rcupration dnergie par la cellule (dissimilation) ou la fabrication parallle de lazote ammoniacal ncessaire la synthse des produits azots (assimilation). Le potentiel correspondant au couple NO2/NH4+ est E = + 340 mV. Il nest pas trs diffrent de celui du couple NO2/NO (E = +350 mV), mais cette conversion est catalyse par une rductase distincte des nitrite rductases entrevues dans la section prcdente. Les vgtaux chlorophylliens, qui bnficient la lumire dune nergie bon march, se contentent de faire lassimilation du nitrate pour en tirer lammonium ncessaire leurs synthses et utilisent une stratgie particulire que nous n'aborderons pas ici. Un rcapitulatif trs succinct concernant le monde vgtal est donn en glossaire (voir Assimilation du nitrate*). Il ne sera question maintenant que des cytochrome c nitrite rductases dissimilatrices conduisant l'ammoniac. Elles forment une troisime famille d'enzymes rduisant le nitrite, diffrentes de celles que nous connaissons dj par la section prcdente et sans homologie avec elles. Ces nouvelles rductases sont hminiques. Le colibacille fait une enzyme de ce type en anarobiose et rduit le nitrite en utilisant le formiate comme donneur dlectrons. Elle est dsigne par NrfA et contient une ribambelle de noyaux hminiques de type C (soit 5 au total par sous unit) [30]. Linsertion des hmes est facilement reprable dans la squence par le motif caractristique Cys-x-x-Cys-His qui marque la position des liens covalents entre hme et protine. Ces liaisons sont sur cystine, et lhistidine est lun des ligands du fer, ce dispositif tant caractristique des cytochromes c. Lun des hmes fait exception, car il est li par un motif Cys-x-x-Cys-Lys. Ces enzymes multihminiques participant la dissimilation de lion nitrite sont attachs la membrane et reoivent apparemment leurs lectrons dun autre cytochrome c. Leur caractrisation dtaille a dj t faite dans plusieurs espces : Desulfovibrio desulfuricans [31], Wolinella succinogenes [32] et Sulfurospirillum deleyianum, avec dans ce cas la structure dtaille [33]. La nitrite rductase du S. deleyianum est un

302

BIODGRADATIONS ET MTABOLISMES

dimre contenant au total dix galettes hminiques de type C places au voisinage les unes des autres. Dans chaque sous-unit, l'hme dont le fer est li la lysine au lieu de l'histidine est li aussi un ion sulfate et c'est son niveau que se fait la catalyse. Ce modle structural fond sur chane dhmes C n'a rien d'exceptionnel dans la nature et rpond des adaptations intressantes. Par exemple la nitrite rductase de Desulfovibrio desulfuricans a aussi une chane d'hmes et rduit galement le sulfite [34]. Cette rductase a une activit si forte sur le nitrite (1,05 millimole de NO2 rduit par minute et par mg pH 7) qu'elle a permis la conception d'un biocapteur [35]. L'arrangement des hmes C dans la cytochrome c nitrite rductase de Sulfurospirillum deleyianum est symbolis en a sur le dessin. Le site actif est l'hme n1, symbolis en b.

a
site actif 1 3 4

b
NO2 Gln Ca Tyr S 2 5 Cys Cys Lys His Fe

Cytochrome c nitrite rductase


Les trois rductions successives seffectueront ce niveau comme indiqu sur un schma. Loxyde nitreux et lhydroxylamine (H2NOH) sont des intermdiaires qui ne quittent pas l'enzyme. Au niveau de chaque hme C attach par liens covalents sur son consensus Cys-x-x-Cys-His, la liaison histidine-fer est perpendiculaire au plan de la porphyrine. Le rsidu d'histidine contracte une liaison de coordination sur le fer perpendiculairement la porphyrine.
Fe
III

Fe

III

Lys nitrite HO N Fe
III

Lys NH4+ O

O N
II

OH H2N Fe 2 e 3 H+
III

H3N Fe 2 e 2 H+ H2O
III

H+

Fe 2 e H+ H2O

Lys

Lys

Lys

Lys

Mcanisme de la rduction du nitrite

6 RDUCTION DES OXYDES D'AZOTE

303

La lysine remplace l'histidine sur l'hme du site actif, et le sulfate (non figur) est li par un atome d'oxygne en sixime coordinence de l'autre ct du fer. Le substrat dplace le sulfate en s'installant sa place. Le site actif s'entoure de glutamine, histidine, tyrosine et quelques molcules d'eau. En outre au voisinage immdiat se trouve un ion calcium. Lexistence de lhydroxylamine est hypothtique mais considre comme trs probable, car lenzyme rduit aussi NO et lhydroxylamine si on lui offre ces drivs comme substrats. D'autre part elle prsente des analogies trs nettes avec une hydroxylamine oxydorductase dcrite chez Nitrosomonas europaea, bactrie du sol bien connue pour effectuer la raction inverse de l'oxydation de lammoniac en nitrite [36]. Chose intressante, lanalyse structurale a montr que lion nitrite accde au site par une ouverture comportant des charges positives, et que lammonium repart en direction oppose par un tunnel charg ngativement. Cette disposition facilite un courant unidirectionnel de llment azot en jouant sur la diffrence de charge entre le substrat et le produit de la raction. Ce courant sens unique travers la protine expliquerait la trs grande efficacit catalytique de lenzyme. Quant aux autres hmes C prsents, ils servent certainement acheminer des lectrons vers le site actif. Les porphyrines et leurs groupes latraux propioniques sont trs proches les uns des autres et formeraient une sorte de fil conducteur. Ce dispositif molculaire perfectionn contribue sans doute aussi la rapidit d'action de l'enzyme.

6.5 - DE LOXYDE NITRIQUE LOXYDE NITREUX


Nous tions passs du nitrite l'ammoniac. Cette section fait retour la dnitrification, dont le stade ultime nest pas NH3 mais N2. Elle devrait nous apporter quelques nouvelles surprises. Une dnitrification nest pas toujours complte et sarrte parfois au stade N2O chez diverses espces bactriennes qui sont dpourvues de N2O rductase. Cette situation existe notamment chez la plupart des carboxydotrophes [37]. En revanche certaines espces peuvent effectuer une respiration sur N2O sans pour autant utiliser le nitrate cet effet : Wolinella succinogenes. Ce germe peut crotre sur N2O et le rduit en N2 sans bnficier d'une NO rductase, en consquence de quoi il ne produit pas de N2 partir de nitrate. Celui-ci est rduit en nitrite puis en ammoniac pendant loxydation du formiate comme principale source carbone [38]. Il peut donc y avoir une respiration sur N2O qui fournit lnergie pour faire marcher tout le reste, y compris lutilisation de nitrate comme source dammoniac. Le tableau rsume quelques lments sur les enzymes concernes. Ce sont des critres moyens, les rsultats tant souvent discordants et parcellaires dune espce lautre. Aprs la dcouverte des bases de la dnitrification, il a fallu quelques annes avant que NO apparaisse comme un vritable intermdiaire. Il est difficile mesurer et se prte mal la croissance des bactries dnitrifiantes. En outre sa nature radicalaire est lorigine de ractions parasites.

304 NO rductase [39]


Raction Localisation Structure Masse molculaire Cofacteurs Donneur de Inhibiteurs

BIODGRADATIONS ET MTABOLISMES N2O rductase [40]

2 NO + 2e + 2 H+ N2O + H2O N2O + 2e + 2 H+ N2 + H2O Membranaire Priplasmique ? (NorB, NorC) 2 (NosZ) 170-180 kDa 120 kDa Hmes B, C + Fe (rapports 2:1:1) [41] 4 Cu par sous-unit Cyt. c, PMS, TMPD, ascorbate Cytochrome c Actylne, cyanure, azoture, Zn2+

Loxyde nitrique est produit dans le priplasme et capt sur place par la NO rductase. Bien que trs diffusible, il na pas le temps datteindre un niveau nocif dans le cytoplasme cellulaire. Quon juge aussi de limportance chimique de cette raction : avec la nitrognase, elle est la seule tablir la liaison trs stable entre deux atomes dazote. Elle est donc nergtique et la conversion de NO en N2O a un potentiel lev (E = + 1177 mV), comme dailleurs celle de N 2 O en N2 (+ 1352 mV). Lnergie libre standard mise en jeu est respectivement 306 et 399 kJ . mol1, plus importante que celle de la conversion du nitrate en nitrite. Il y a donc matire une vigoureuse production dnergie par la cellule bactrienne, contrairement la raction de la nitrognase qui est consommatrice 6. La NO rductase a deux atouts : elle est membranaire et possde des cytochromes b et c, quon a lhabitude de rencontrer comme intervenants dans les chanes respiratoires. Lexemple le plus clbre est le complexe bc1 de la membrane interne mitochondriale, connu comme site de conservation dnergie parce que la translocation de protons couple au passage des lectrons contribue btir le potentiel de membrane. En est-il de mme pour la NO rductase ? On pense actuellement que lenzyme na pas ce pouvoir. Elle reoit ses lments rducteurs dune chane respiratoire qui renferme le complexe bc1, qui serait le vritable site de conservation dnergie. L'tude de ce complexe dans Pseudomonas stutzeri montre qu'il collecte des lectrons provenant de plusieurs voies dont celle de la NO rductase. Une autre voie part du NADH, utilise le canal de la NADH dshydrognase membranaire et une quinone. C'est donc la fonction du bc1 de produire de l'nergie et d'envoyer les lectrons vers NO qui est un accepteur terminal. Les connaissances sur la NO rductase restent fragmentaires, mais un aspect intressant mrite dtre signal. La raction catalyse ressemble celle dune cytochrome c oxydase, soit O2 + 4 e + 4 H+ 2 H2O. Or il existe une ressemblance de squence entre la chane NorB de la NO rductase et la sous-unit I de la cytochrome c oxydase de Paracoccus denitrificans. La ressemblance est assez forte pour indiquer une structure similaire [42]. Rappelons que la structure minimale dune cytochrome c oxydase comporte des sous-units I, II et III dont la nature a t conserve au cours de lvolution (y compris dans les mitochondries). La sous-unit I de l'oxydase aa3 est la plus grosse et opre la rduction du dioxygne.

6 - Les valeurs sont prcises ltat standard qui est trs loign des conditions relles. La concentration de NO en rgime stationnaire est faible, et lnergie mise en jeu cette tape devrait tre infrieure.

6 RDUCTION DES OXYDES D'AZOTE

305

Ses lments essentiels sont un hme A et un centre bi-mtallique (un second hme A3 et du cuivre). NorB offre une disposition comparable. La partie renfermant l'hme C (NorC) rduit un premier hme B, qui rduit son tour la partie bimtallique forme par le deuxime hme B et le fer non hminique. Voici un dessin imit de VAN DER OOST et coll. [43] :
C priplasme C H+ H+ H+

Q
B B B B A A B B

Type cbb (NO rductase) hme B ou A

Type cbb3 hme C

Type aa3 fer non hminique

Type bb3 cuivre

NO rductase et oxydases terminales


La NO rductase, gauche, du type cbb, est compare aux trois oxydases labores par Paracoccus denitrificans, considres comme des translocateurs de protons et figures dans un cadre [44]. Les trois sous-units NorB, NorC et NorE sont les parties fondamentales de la NO rductase imitant la structure de base de la cytochrome c oxydase mitochondriale. Elles sont homologues respectivement des sous-units I, II et III de loxydase. Le type aa3 reprsent ici est celui de la principale oxydase de Paracoccus ses heures arobies. Loxydase cbb3 intervient en oxygne limitant et la bb3 est une quinol oxydase. La NO rductase cbb est une quatrime machinerie produite au cours de la dnitrification. Les deux hmes B de la sous-unit principale (NorB) dans cette enzyme sont assez proches lun de lautre en tablissant une communication intramolculaire. Le premier hme reoit du cytochrome c (NorC) lunique lectron ncessaire la raction, et le deuxime hme tablit le noyau bi-mtallique avec le fer non hminique. Le passage des lectrons dans cet ordre est considr comme probable par comparaison avec les cytochrome oxydases. Dans le premier hme, le fer est hexacoordonn, sa gomtrie est complte et lui donne la proprit bas spin, au contraire du deuxime qui est un fer haut spin*. Les coordinations sont tablies par des rsidus dhistidine. Un court segment faisant partie dune hlice relie les deux premiers atomes de fer. C'est peut-tre le "fil lectrique" qui relie les deux, ainsi qu'un fil de traction comme dans le cd1. Le mcanisme exact de la soudure entre atomes d'azote reste problmatique. Une hypothse considre linstallation de deux molcules de NO cte cte entre les deux ions fer du site bi-mtallique avant formation de la liaison N=N. Lune de ces molcules est retenue par lhme rduit, avec une affinit extrmement forte qui a probablement pour effet dempcher toute "fuite" prmature. La deuxime molcule appele par le fer non hminique tablirait la combinaison transitoire ON=NO que postulent certains auteurs [45]. L'un des atomes d'oxygne serait alors emport dans une molcule d'eau.

306

BIODGRADATIONS ET MTABOLISMES

His noyau bimtallique et site actif

1er hme B

Fe

His

His His Fe Fe His His 2e hme B

Les sites mtalliques de NorB


Le plus extraordinaire est que la NO rductase na pas lexclusivit de cette raction. Dautres protines sont capables de former un peu de N2O : la ribonuclotide rductase arobie, lhmocyanine et mme la cytochrome c oxydase [46], trois systmes qui bnificient d'un noyau bi-mtallique, respectivement Fe-Fe, Cu-Cu et Fe-Cu. Inversement on connat la NO rductase cbb de Paracoccus denitrificans qui est capable de rduire O2 [47]. Cette question amne invitablement des spculations sur l'histoire de la vie. On considre gnralement que la monte de loxygne dans latmosphre terrestre a t le rsultat de la photosynthse oxygnique, qui est lie la dissociation de leau. Les premiers anctres des cyanobactries actuelles auraient provoqu une lente rvolution plantaire dans la biochimie des organismes. Il a fallu sadapter un potentiel doxydorduction plus lev, rsister aux effets nocifs d'O2, ou mme lutiliser. Daprs certains auteurs tels que CASTRESANA, LUBBEN ET SARRASTE [48], le monde vivant aurait pu conserver un modle unique denzyme respiratoire utilisant NO ou loxygne. La NO rductase aurait prcd lapparition des cytochrome oxydases, puis des quinol oxydases. Elle pourrait correspondre une dnitrification primitive antrieure la photosynthse oxygnique. Les premires oxydases seraient apparues ensuite, antrieurement la sparation des eubactries et des archaebactries. Latmosphre terrestre primitive contenait sans doute de petites quantits doxygne et doxyde nitrique forms par des ractions photochimiques sur leau de la surface des ocans et sur lazote molculaire. La monte d'O2 aurait exig une adaptation et une diversification des outils dj disponibles. Lacquisition dune translocation de protons et de nouvelles rgulations aurait fait partie des nouvelles avances. La dnitrification est-elle la respiration la plus archaque ? Il y a beaucoup plus de suppositions que de certitudes dans ce domaine, qui offre nanmoins un terrain de rflexion fascinant.

6 RDUCTION DES OXYDES D'AZOTE

307

6.6 - DE N2O AU DIAZOTE


Diverses espces bactriennes ne franchissent pas le stade N2O au cours de la dnitrification et librent celui-ci dans latmosphre. Au contraire dautres agents de dnitrification peuvent se dvelopper sur N2O comme seul accepteur respiratoire au cours de la dgradation de composs organiques tels que le benzne et des alkylbenznes [49]. Bien que loxyde nitreux rductase (NosZ) soit une enzyme priplasmique soluble, elle participerait une conservation dnergie [50]. Le bouclage du grand cycle de lazote plantaire se fait avec le concours du cuivre. Nous avons dj rencontr ce mtal plusieurs fois et nous le retrouvons dans la N2O rductase. Celle-ci catalyse la conversion N2O + 2 e + 2 H+ N2 + H2O, qui a un potentiel E de + 1350 mV, soit une variation dnergie libre de 339 kJ . mol1. Loxyde nitreux est donc un excellent oxydant potentiel quand il se dbarrasse de son atome doxygne. Lopration a pourtant besoin dun activateur qui est en gnral un mtal de transition. Sans cette activation, N2O est aussi inerte dans les conditions physiologiques que lest N2 lui-mme. Aussi la vie moyenne dune molcule doxyde nitreux dans latmosphre, estime 150 ans environ, fait de ce gaz un des acteurs de leffet de serre. Un mtal de transition not Mn facilite la scission de N2O par : Mn + N2O + 2 H+ N2 + H2O + Mn+2. La N2O rductase a donc recours un mtal qui est encore le cuivre. Le caractre indispensable de Cu dans la rduction de N2O a t mis en vidence indirectement dans Pseudomonas stutzeri, qui offrait un cadre favorable sa dtection. En effet cette espce utilise un cytochrome cd1 comme nitrite rductase et na pas de cuprdoxine, donc pas de cuivre "tranger" qui serait la source d'un bruit de fond. ZUMFT et coll. ont caractris lenzyme dans cette espce et d'autres comme Pseudomonas aeruginosa, Achromobacter cycloclastes, Paracoccus denitrificans et Wolinella succinogenes [51]. Il y a gnralement deux sous-units identiques de 66 kDa environ, et 8 atomes de cuivre en tout par dimre. Chaque monomre renferme deux centres bi-mtalliques, un noyau CuA (dessin page suivante) contenant 2 Cu et donnant un signal en RPE, un second noyau Cu-Cu (CuZ) silencieux en RPE. Le site CuA est dsign ainsi parce quil ressemble au CuA prsent dans la sousunit II de la cytochrome oxydase. Autrefois on croyait que cette dernire avait un lment CuA mono-mtallique coordonn par des atomes de N et de S (2 His, 2 Cys). Le cuivre de la N2O rductase a servi de matriel favorable des tudes spectroscopiques pousses (optique, dichrosme, RPE, RAMAN, EXAFS) [52] qui ont conduit la structure indique par le schma o les deux atomes mtalliques partagent leur degr d'oxydation. La ressemblance de squence avec la sous-unit II a permis de se rendre compte que le CuA de la cytochrome oxydase tait bi-mtallique lui aussi. Une exprimentation volumineuse a t faite avec CuA, notamment par mutagense dirige afin de modifier les rsidus d'acides amins lis aux atomes mtalliques.

308
Cys His

BIODGRADATIONS ET MTABOLISMES
Asp ?

N Cu1 Cu2

N S S
Met Cys His

Structure du noyau CuA


Une structure consensus entre N2O rductases provenant de six espces bactriennes diffrentes concerne la portion de squence liant CuA. Les rsidus portant Cu1 et Cu2 dans le schma sont reprs dans la squence par les chiffres 1 et 2. Les lettres en caractre gras notent les positions identiques dans la sous-unit II des cytochrome c oxydases de trois espces bactrienne, de la levure, du bl et de l'homme. Ces positions cls sont donc espaces de la mme manire et correspondent visiblement une architecture prcise autour du noyau bi-mtallique.
1 1 2 1 2 2 1

E D Vx H GFxxxxxxxxxxxx P QxTxxxxFxxxxP G xxWxY C xxF C HsL H xE M xxRMxVE

Squence consensus dans NosZ


La structure du second noyau bi-mtallique, CuZ, nest pas connue avec certitude, mais on le considre comme le site essentiel de la catalyse enzymatique. Lenzyme a des proprits assez complexes accompagnant des variations spectrales : un tat I violet (lenzyme prpare en labsence de O2), un tat II rose, et un tat III bleu (inactif). Son mcanisme consiste peut-tre lier la molcule de N2O (ou N=N=O) par les deux bouts, un azote sur un cuivre, un oxygne sur lautre. On peut imaginer que le pont ainsi form fragiliserait le substrat et arracherait latome doxygne. NO et lion cyanure se lient aussi CuZ et sont des inhibiteurs de la raction, ainsi que diffrentes molcules analogues du substrat qui sont N3, NCO et CNS. L'actylne est un autre inhibiteur. Les positions conserves suggrent que le noyau CuZ est coordonn par des rsidus dhistidine, mais il reste beaucoup faire pour connatre plus prcisment le fonctionnement dtaill de cette enzyme trange qui na cependant pas la stricte exclusivit de la rduction de loxyde nitreux en azote molculaire. La raction a t observe dans la nitrognase, la CO dshydrognase, la mthionine synthase et quelques mtalloprotines contenant Fe, Cu, Ni, Co ou Mo. Linhibition par lactylne est utile en pratique pour mesurer limportance de la dnitrification dans les sols. Lchantillon est brass en suspension pendant plusieurs heures dans un flacon ferm sous atmosphre inerte contenant 10% (en volume) dactylne. Le liquide contient du nitrate (1 mM) et

6 RDUCTION DES OXYDES D'AZOTE

309

une source de carbone (glucose). Le N2O form (gazeux et dissous) est dos par chromatographie en phase gazeuse [53]. Cette mthodologie a souvent servi de base aux estimations de la dnitrification sur le terrain. Puisque nous en sommes rflchir sur la diversification des rductases au cours de lvolution, voici loccasion de faire un petit dtour vers la NO rductase de Fusarium oxysporum. Avant de quitter la NO rductase, il convient en effet de revenir sur les champignons dnitrifiants dont l'existence a t signale dans le chapitre prcdent. Ils ont une NO rductase qui na rien voir avec celle des bactries. La dnitrification chez eux ne va pas jusqu'au stade du diazote, et s'arrte l'oxyde nitreux. La section suivante est un aperu de cette question.

6.7 - DES CHAMPIGNONS DNITRIFIENT


Les bactries n'ont pas le monopole de la dnitrification. Les champignons la font aussi : cest la perspective importante laquelle nous revenons. Fusarium oxysporum plac en absence plus ou moins complte d'oxygne transforme le nitrate en N2 O [54], et renferme une nitrite rductase cuivre qui a t rcemment purifie [55]. F. oxysporum et Cylindrocarpum tonkinense ont ainsi une vritable dnitrification, qui est confirme par les observations montrant que la rduction du nitrate et du nitrite seffectuent au niveau des mitochondries. Il a t prouv dautre part que ces oprations sont couples une synthse nette dATP [56]. Les outils sont diffrents de ceux des bactries. Ils participeraient la fois la dtoxification du nitrite intermdiaire et la conservation dnergie par couplage avec les transporteurs respiratoires. Le fait marquant est la transformation de NO en N2O laide d'une NO rductase particulire. Bien que les champignons soient des eucaryotes, la NO rductase est ici soluble, monomrique (44 kDa) et ne fait pas partie des mitochondries. Ses proprits spectrales en absorption optique et RPE montrent que l'enzyme appartient la vaste famille des cytochromes P450, conclusion corrobore par des critres de structure et d'homologie de squence. Que sont ces P450 ? Nous les examinerons en dtail avec l'oxydation des hydrocarbures aliphatiques, mais on pourra s'en faire une ide rapide par le glossaire. Ces protines sont habituellement des mono-oxygnases hminiques utilisant comme substrats la fois O2 et une source dlectrons qui sont achemins par des lments auxiliaires tels qu'une rductase et une ferrdoxine. La NO rductase de Fusarium oxysporum est un cytochrome P450 soluble tout fait atypique, qui ne se comporte pas comme une mono-oxygnase la faon des P450 ordinaires. On dsigne ce systme par P450nor [57]. La raction globale est : 2 NO + NADH + H
+

N2O + NAD+ + H2O,

Lenzyme bas potentiel ( 307 mV) fixe NO sur son Fe3+. Comme lenzyme est monomrique et na quun seul hme lexclusion de tout autre cofacteur alors que la raction implique deux molcules de NO, on peut supposer quune premire molcule de NO se fixe sur le fer, puis ragit in situ avec la deuxime molcule aprs lapport de deux lectrons venant du NADH. Le mcanisme est diffrent de

310

BIODGRADATIONS ET MTABOLISMES

celui des NO rductases bactriennes. Contrairement aux autres cytochromes P450, celui de Fusarium nutilise pas O2. Il est donc inhabituel. En outre il emploie directement du NADH comme source dlectrons sans autre intermdiaire, ce qui rappelle certains P450 des vgtaux. Le P450nor est soluble comme ceux des bactries. Son absence d'intgration la membrane mitochondriale et lutilisation directe de NADH, si ces caractres sont confirms, laisseraient penser que la NO rductase de Fusarium ne constitue pas une tape de couplage nergtique. Une molcule de cette enzyme peut transformer plus de 1000 molcules de NO par seconde, tmoignant d'une activit trs forte. Certains auteurs pensent que sa fonction principale serait la dtoxification de NO. Un systme enzymatique similaire a t dcrit chez Cylindrocarpum tonkinense [58]. Le mcanisme utilis par le P450nor a fait lobjet dun examen dtaill par des auteurs japonais utilisant des techniques spectroscopiques et la cintique rapide [59]. Le mcanisme serait en gros le suivant : lenzyme fixerait une premire molcule de NO puis serait rduite par deux lectrons en formant un "complexe I" [Fe3+-NO]2, H+. Ce nouvel tat trs ractif recevrait la deuxime molcule de NO, provoquerait la soudure des deux atomes dazote et l'expulsion de N2O. Il y a donc une diffrence de principe avec les NO rductases bactriennes. L'vnement de dpart est la fixation de la premire molcule de substrat, avec un changement de ltat de spin du fer et une modification conformationnelle qui active lintervention de la source dlectrons. Le schma est celui de SHIRO et coll., et fait tat dun transfert de deux lectrons sous forme d'hydrure partir de NADH sans oxydorduction du fer. La rduction directe par NADH est une diffrence fondamentale avec les oxygnases P450 que nous trouverons par la suite, et rend impossible l'utilisation du dioxygne.
NO Fe3+ NO H2O + N2O NO NO
2

Fe3+

NADH + H+ NAD+ Fe3+ H+

Le cycle de la NO rductase de Fusarium


Les donnes cintiques et spectroscopiques sont en faveur de lexistence de lintermdiaire I, dont la charge se rpartit en fait entre le fer et la porphyrine. Il apparat en prsence d'une mole de NO par mole denzyme et aprs addition de NADH. Lintermdiaire I disparat rapidement aprs ajout dun excs de NO. Lexistence de cette NO rductase est doublement intressante. En premier lieu cette dnitrification fongique, dont lenzyme est une pice particulire, laisse entendre que limmense cohorte des champignons de la biosphre pourrait avoir des

6 RDUCTION DES OXYDES D'AZOTE

311

potentialits qui restent sous-estimes. Du fait de limportance des mcanismes anarobies dans les biodgradations, de nombreuses espces de champignons, moisissures, levures, apportent peut-tre une contribution capitale. On peut prvoir que le champ des recherches, qui a longtemps privilgi les bactries pour des raisons qui tiennent la commodit des exprimentations, va s'intresser davantage aux champignons du sol. Le deuxime ple dintrt concerne la ressemblance structurale avec les autres P450 et la question de leur origine volutive [60]. Le cytochrome P450 fongique pourrait tre lhritier lointain dune forme ancestrale dont auraient diverg galement les cytochromes P450 utilisateurs d'O2 et les mono-oxygnases actuelles places sur le devant de la scne. Le cytochrome P450 de Fusarium serait-il plus proche de l'origine ancestrale de toutes ces protines ? Cette question peut rserver des surprises dans le futur, et cest la raison pour laquelle elle a t un peu dveloppe ici.

EN GUISE DE CONCLUSION
Le grand rservoir dazote de la biosphre se trouve dans latmosphre, qui est constitue pour prs des quatre cinquimes par N2. La fixation biologique de cet azote en composs organiques ou minraux est norme, plus de 100 millions de tonnes par an, maintenant bien davantage par suite de lpandage des engrais, de la culture des lgumineuses et de rejets industriels. La fixation de lazote est uniquement procaryotique, et se fait aussi bien dans les sols continentaux que dans les ocans. Parmi les composs dont laccumulation risque davoir des effets nuisibles sur l'environnement sont les ions nitrate, loxyde nitrique (NO, peu abondant dans latmosphre) et loxyde nitreux (N2O). Les deux derniers sicles ont amen une forte augmentation du nitrate retenu dans les glaces du Groenland, tandis que la teneur de latmosphre en N2O augmentait rgulirement de 0,3% par an. Les nitrates ne sont pas toxiques par eux-mmes, mais leur ingestion excessive dans les eaux de boisson induit la production de nitrite et de nitrosamines cancrignes par la flore intestinale. L'oxyde nitrique diffuse dans le sang et ragit avec lhmoglobine pour faire une methmoglobine inactive, crant une situation risque connue en particulier chez les nourissons o la rduction du nitrate est favorise par un pH intestinal plus alcalin. La methmoglobine n'assure plus le transport d'O2. Chez l'enfant et l'adulte, le dfaut est heureusement rpar en grande partie par une rductase au sein des globules rouges, sinon les effets du nitrite seraient analogues ceux d'un empoisonnement par le monoxyde de carbone. Daprs la norme en vigueur, une eau cesse dtre potable quand la teneur en nitrate excde 50 mg par litre. Le nitrate en excs tend saccumuler dans les plantes et des accidents ont t observs chez les animaux dlevage par la consommation de certains fourrages. Un excs de nitrates se traduirait par une absorption d'eau accrue par les plantes jointe une baisse de leur teneur en facteurs importants tels que la vitamine C ou le fer. Les vgtaux sont la principale source de nitrites pour l'organisme humain tandis que le taux naturel du nitrate dans la viande est considr comme insignifiant. Ces inconvnients ont conduit

312

BIODGRADATIONS ET MTABOLISMES

limiter l'utilisation de nitrate pour la conservation des produits alimentaires (salaisons), et mme l'interdire dans plusieurs pays. Les nitrates sont des sels stables dans les sols ars, mais ils sont trs solubles et sont facilement entrans par les eaux, beaucoup plus facilement que les phosphates ajouts dans les fertilisants. En outre lion nitrate par sa charge ngative est beaucoup moins bien retenu par les argiles et composs humiques, eux-mmes porteurs de charges ngatives. On a dcouvert que lazote nitrique non consomm immdiatement par les plantes peut perdurer assez longtemps dans les sols jusqu' ce qu'il soit facilement entran dans les nappes phratiques aprs une priode de pluie. Ces caractres font que l'pandage en excs des fertilisants nitrats est une source de pollution pour les eaux. Les pratiques de la culture intensive ont t montres du doigt. Par exemple dans la culture du bl, un rendement de 60 quintaux lhectare tait considr autrefois comme correct. On dpasse maintenant 80 quintaux. Il faut alors apporter plus de 250 kg dazote lhectare, compte tenu des pertes. Daprs MARIOTTI [61], les pertes sadditionnent au cours des annes et peuvent conduire des accumulations considrables. La dnitrification naturelle vacue vers latmosphre des oxydes tels que N2O, mais comme celui-ci a un temps de rsidence trs long, il apporte une contribution croissante leffet de serre. Des rgions naturelles de savane, bien que pauvres en azote minraux, seraient nanmoins rendues trs fertiles avec suffisamment deau, car lazote y intervient en circuit ferm. Les matires vgtales mortes produisent de lammonium qui est facilement retenu grce sa charge positive par largile et lhumus. Cet azote ammoniacal nest pratiquement pas nitrifi et les plantes le rcuprent sur place avec un minimum de pertes. Les plantes adaptes auraient donc la capacit dutiliser efficacement NH3 sans dpendre de la nitrification dans le sol. L'agriculture intensive n'est pas seule responsable de la charge en nitrate des rivires et des eaux ctires dans les rgions o existent des levages industriels. Le rejet des lisiers a t incrimin, par exemple en Bretagne. Des mares vertes sont apparues le long du littoral. L'excdent de nitrate amen par les rivires y dclenche une prolifration d'algues et de phytoplancton. La Vilaine, la Rance, l'Elorn et la Loire dversent parfois dans la mer des eaux colores. La couverture des eaux par les ulves perturbe l'quilibre biologique sousjacent et encourage une prolifration intense de dinoflagells, Alexandrium minutum et Dinophysis, qui prsentent un risque toxique important. Ces organismes sont responsables des "eaux rouges", se concentrent dans les bivalves et les rendent impropres la consommation cause des toxines qu'ils scrtent. On a galement relev des teneurs anormales en pesticides, notamment dans plusieurs rivires bretonnes. Le problme a pris des dimensions proccupantes et parfois scandaleuses. Ces dernires annes en France, l'eau potable tait produite pour 60% partir des nappes souterraines par captage ou forage profond. Le reste tait pomp dans les fleuves, les rivires et les lacs et distribu aprs retraitement. Comment peut-on liminer les nitrates ? Un procd parmi d'autres consiste utiliser le pouvoir dnitrifiant des bactries en anarobiose, condition qu'elles puissent se dvelopper avec des ressources nutritives prsentes ou ajoutes dans l'eau pollue. Des minraux et une source carbone, qui sera dtruite au cours du traitement, permettent d'activer le dveloppement des germes. Voici pour

6 RDUCTION DES OXYDES D'AZOTE

313

illustration le principe d'une installation o une tape de dnitrification sans air (avec perfusion ventuelle d'azote) est suivie d'une puration par aration, et enfin d'une filtration.
dnitrifieur arateur unit de filtration

excs de boues eau brute

ozoniseur

source carbone et sels minraux

air

eau traite

La ncessit moderne de lutter contre l'excs de nitrate dans les eaux a stimul de gros efforts techniques. Des procds utilisent l'osmose inverse, l'change d'ions, l'lectrodialyse combine un bioracteur membrane, ou encore une filtration sur des membranes cramiques retenant les bactries dnitrifiantes, mais les quantits traiter et les prix de revient sont videmment des facteurs dterminants.

RFRENCES
[1] K R A F F T T, B O K R A N Z M, K L I M M E K O , S C H R O D E R I, F A H R E N H O L Z F, K O J R O E & K R O G E R A (1992) Eur. J. Biochem. 206 : 503-510. [2] J O H N S O N JL, R A J A G O P A L A N KV, M U K U N D S & A D A M S MW (1993) J. Biol. Chem. 268 : 4848-4852 ; K L E T Z I N A & A D A M S MW (1996) FEMS Microbiol. Rev. 18 : 5-63. [3] H I N T O N S M & D E A N D (1990) Crit. Rev. Microbiol. 17 :169-188. [4] J O H N S O N JL, B A S T I A N NR & R A J A G O P A L A N KV (1990) Proc. Natl. Acad. Sci. US 87 : 3190-3194. [5] H I G G I N S C F (1992) Annu. Rev. Cell Biol. 8 : 67-113 ; E H R M A N N M, E H R L E R, H O F M A N N E, B O O S W & S C H L S S E R A (1998) Molecular Microbiol. 29 : 685-694. [6] H I N T O N S M & M O R T E N S E N LE (1985) J. Bacteriol. 162 : 485-493. [7] B O Y I N G T O N JC , G L A D Y S H E V VN, K H A N G U L O V S V, S T A D T M A N TC & S U N PD (1997) Science 275 : 1305-1308. [8] A N T I P O V AN, L Y A L I K O V A NN, K H I J N I A K TV & L V O V NP (1998) FEBS Lett. 44 : 257-260. [9] B L A S C O F, P O M M I E R J, A U G I E R V, C H I P P A U X M & G I O R D A N O G (1989) Mol. Microbiol. 6 : 221-230. [10] S I D D I Q U I RA, W A R N E C K E - E B E R T Z U, H E N G S B E R G E R A, S C H N E I D E R B, K O S T K A S & F R I E D R I C H B (1993) J. Bacteriol. 175 : 5867-5876 ; R E Y E S F, R O L D A N MD , K L I P P W , C A S T I L L O F & M O R E N O - V I V I A N C (1996) Molec. Microbiol. 19 : 1307-1318. [11] L I N JT, G O L D M A N BS & S T E W A R T V (1994) J. Bacteriol. 176 : 2551-25559. [12] D E M O S S JA & H S U PY (1991) J. Bacteriol. 173 : 3303-3310.

314

BIODGRADATIONS ET MTABOLISMES

[13] B L A S C O F, N U N Z I F, P O M M I E R J, B R A S S E U R R, C H I P P A U X M & G I O R D A N O G (1992) Mol. Microbiol. 6 : 209-219. [14] L I U X, D E M O S S JA (1997) J. Biol. Chem. 272 : 24266-24271 ; B L A S C O F, D O S S A N T O S JP, M A G A O N A, F R I X O N C , G U I G L I A R E L L I B, S A N T I N I C L & G I O R D A N O G (1998) Mol. Microbiol. 28 : 435-447. [15] A U G I E R V, A S S O M, G U I G L I A R E L L I B, M O R E C , B E R T R A N D P, S A N T I N I C L, B L A S C O F, C H I P P A U X M & G I O R D A N O G (1993) Biochemistry 32 : 5099-5108. [16] M A G A L O N A, L E M E S L E - M E U N I E R D , R O T H E R Y RA, F R I X O N C , W E I N E R JH & B L A S C O F (1997) J. Biol. Chem. 272 : 25652-25658. [17] B R Y K R, G R I F F I N P & N A T H A N C (2000) Nature 407 : 211-215. [18] P E R E I R A IC , A B R E U IA, X A V I E R AV, L E G A L L J & T E I X E I R A M (1996) Biochem. Biophys. Res. Comm. 224 : 611-618. [19] Y A M A N A K A T (1992) In "The Biochemistry of Bacterial Cytochromes", Springer Verlag KG, Berlin ; H E N R Y Y & B E S S I R E S P (1984) Biochimie 66 : 259-289 ; S I V E S T R I N I MC , G A L E O T T I L, G E R V A I S M, S C H I N I N E, B A R R A D , B O S S A A F & B R U N O R I M (1994) Biochimie 76 : 641-654. [20] F L P V, M O I R JW B , F E R G U S O N S J & H A J D U J (1995) Cell 81 : 369-377. [21] W I L L I A M S PA, F L O P V, G A R M A N EF, S A U N D E R S NFW , F E R G U S O N S J & H A J D U J (1997) Nature 389 : 406-412. [22] N A R H , M E S S E R S C H M I D T A, H U B E R R, V A N D E K A M P M & C A N T E R S G W (1991) J. Mol. Biol. 221 : 765-772. [23] F A R V E R O , E A D Y RR, A B R A H A M ZH & P E C H T I (1998) FEBS Lett. 436 : 239-242. [24] S U Z U K I S , Y O S H I M U R A T, K O Z H U M A T, S H I D A R A S , M A S U K O M, S A K U R A I T & I W A S A K I H (1989) Biochem. Biophys. Res. Comm. 164 : 1366-1372 ; H U L S E C L, A V E R I L L BA & T I E D J E JM (1989) J. Amer. Chem. Soc. 111 : 2322-2323 ; H O W E S BD , A B R A H A M ZH L , L O W E D J, B R S E R T, E A D Y RR & S M I T H BE (1994) Biochemistry 33 : 3171-3177. [25] A D M A N ET, G O D D E N JW & T U R L E Y S (1995) J. Biol. Chem. 270 : 27458-27474. [26] M U R P H Y ME, T U R L E Y S & A D M A N ET (1997) J. Biol. Chem. 272 : 28455-28460. [27] M A S U K O M & I W A S A K I H (1984) Plant Cell. Physiol. 25 : 439-446 ; J A C K S O N MA, T I E D J E JM & A V E R I L L BA (1991) FEBS Lett. 291 : 41-44. [28] K U K I M O T O M, N I S H I Y A M A M, T A N O K U R A M, A D M A N ET & H O R I N O U C H I S (1996) J. Biol. Chem. 271 : 13680-13683 ; D O D D FE, V A N B E E U M E N J, E A D Y RR & H A S N A I N S S (1998) J. Mol. Biol. 282 : 369-382. [29] S H O U N H , K A N O M, B A B A I, T A Y A K A N, M A T S U O M (1998) J. Bacteriol. 180 : 4413-4415. [30] E A V E C D J, G R O V E J, S T A U D E N M A N N W , J A M E S P, P O O L E RK, W H I T E S A, G R I F F I T H S I & C O L E JA (1998) Molec. Microbiol. 28 : 205-216. [31] L I U MC & P E C K H D J (1981) J. Biol. Chem. 256 : 13159-13164. [32] B L A C K M O R E R, R O B E R T S O N A & B R I T T A I N T (1986) Biochem. J. 233 : 547-552. [33] S C H U M A C H E R W , H O L E U & K R O N E C K PMH (1994) Biochem. Biophys. Res. Comm. 205 : 911-916 ; E I N S L E O , M E S S E R S C H M I D T A, S T A C H P, B O U R E N K O V G P, B A R T U N I K H D , H U B E R R & K R O N E C K PMH (1999) Nature 400 : 476-480.

6 RDUCTION DES OXYDES D'AZOTE [34] P E R E I R A IC , A B R E U IA, X A V I E R AV, L E G A L L J & T E I X E I R A M (1996) Biochem. Biophys. Res. Comm. 224 : 611-618.

315

[35] M O R E N O C , C O S T A C , M O U R A I, L E G A L L J, L I U MY , P A Y N E W J & V A N D I J K C & M O U R A JJ. (1993) Eur. J. Biochem. 212 : 79-86. [36] I G A R A S H I N, M O R I Y A M A H , F U J I W A R A T, F U K U M O R I Y & T A N A K A N (1997) Nature Struct. Biol. 4 : 276-284. [37] F R U N Z K E K & M E Y E R O (1990) Arch. Microbiol. 154 : 168-174. [38] Y O S H I N A R I T (1980) Appl. Environ. Microbiol. 39 : 81-84 ; T E R A G U C H I S & H O L L O C H E R TC (1989) J. Biol. Chem. 264 : 1972-1979. [39] H E I S S B, F R U N Z K E K & Z U M F T W G (1989) J. Bacteriol. 171 : 3288-3297 ; J O N E S AM & H O L L O C H E R TC (1993) Biochim. Biophys. Acta 1144 : 359-366 ; Z U M F T W G , B R A U N C & C U Y P E R S H (1994) Eur. J. Biochem. 219 : 481-490 ; K A S T R A U D H W , H E I S S B, K R O N E C K PMH & Z U M F T W G (1994) Eur. J. 222 : 293-303 ; G I R S C H P & D E V R I E S S (1997) Biochim. Biophys. Acta 1318 : 202-216. [40] C O Y L E C , Z U M F T W G , K R O N E C K PMH , K R N E R H & J A K O B W (1985) Eur. J. Biochem. 153 : 459-467 ; R I E S T E R J, Z U M F T W G & K R O N E C K PMH (1989) Eur. J. Biochem. 178 : 751-762 ; S O O H O O C K & H O L L O C H E R TC (1991) J. Biol. Chem. 266 : 2203-2209 ; S O O H O O C K, H O L L O C H E R TC , K O L O D Z I E J AF, O R M E - J O H N S O N H & B U N K E R G (1991) J. Biol. Chem. 266 : 2210-2218. [41] G I R S C H P & D E V R I E S S (1997) Biochim. Biophys. Acta 1318 : 202-216. [42] Z U M F T W G , B R A U N C & C U Y P E R S H (1994) Eur. J. Biochem. 219 : 481-490. [43] V A N D E R O O S T J, D E B O E R AP, D E G I E R JW , Z U M F T W G , S T O U T H A M E R AH & V A N S P A N N I N G RJ (1994) FEMS Microbiol. Lett. 121 : 1-9. [44] D E G I E R JW , S C H E P P E R M, R E I J N D E R S W N, V A N D Y C K S J, S L O T B O O M D J, W A R N E A, S A R A S T E M, K R A B K, F I N E L M, S T O U T H A M E R AH , V A N S P A N N I N G RJ & V A N D E R O O S T J (1996) Mol. Microbiol. 20 : 1247-1260. [45] Y E RW , A V E R I L L BA & T I E D J E JM (1994) Appl. Environ. Microbiol. 60 : 1053-1058. [46] H A S K I N C J, R A V I N, L Y N C H JB, M N C K E & Q U E L (1995) Biochemistry 34 : 11090-11098 ; V E R P L A E T S E J, V A N T O R N O U T P, D E F R E Y N G , W I T T E R S R & L O N T I E R (1979) Eur. J. Biochem. 95 : 327-331 ; B R U D V I G G W , S T E V E N S TH & C H A N S I (1985) Biochemistry 19 : 5275-5285. [47] F U J I W A R A T & F U K U M O R I Y (1996) J. Bacteriol. 178 : 1866-1871. [48] C A S T R E S A N A J & S A R A S T E M (1995) Trends in Biochem. Sci. 20 : 443-448. [49] P I C H I N O T Y F, M A N D E L M, G R E E N W A Y B & G A R C I A J- L (1979) Ann. Inst. Pasteur Microbiol. 128A : 75-87 ; H U T C H I N S S R (1991) Appl. Environ. Microbiol. 57 : 2403-2407. [50] K U N D U B & N I C H L A S D JD (1985) Arch. Microbiol. 140 : 358-364 ; P A R S O N A G E D , G R E E N F I E L D AJ & F E R G U S O N S J (1986) Arch. Microbiol. 145 :191-196 ; R I C H E R D S O N D J, B E L L LC , M C E W A N AG , J A C K S O N JB & F E R G U S O N S J (1991) Eur. J. Biochem. 199 : 677-683. [51] Z U M F T W G & M A T S U B A R A T (1982) FEBS Lett. 148 : 107-112 ; Z U M F T W G , D H L E R K, K R N E R S , L C H E L T S , V I E B R O C K A & F R U N Z K E K (1988) Arch. Microbiol. 149 : 492-498.

316

BIODGRADATIONS ET MTABOLISMES

[52] K R O N E C K PMH , A N T H O L I N E W A, R I E S T E R J & Z U M F T W G (1988) FEBS Lett. 242 : 70-74 ; J I N H , T H O M A N N H , C O Y L E C L & Z U M F T W G (1989) J. Am. Chem. Soc. 111 : 4262-4269. [53] T I E D J E JM (1994) In "Methods of Soil Analysis" part 2, W E A V E R RW , A N G L E JS & B O T T O M L E Y PJ eds, Soil Sci. Society of America, Madison, Wis. : 245-267. [54] S H O U N H & T A N I M O T O T (1991) J. Biol. Chem. 266 : 11078-11082. [55] K O B A Y A S H I M & S H O U N H (1995) J. Biol. Chem. 270 : 4146-4151. [56] K O B A Y A S H I M, M A T S U O Y , T A K I M O T O A, S U Z U K I S , M A R U O F & S H O U N H (1996) J . Biol. Chem. 271 : 16263-16267. [57] S H O U N H & T A N I M O T O T (1991) J. Biol. Chem. 266 : 11078-11082 ; S H I R O Y , F U J I I M, I S O G A I Y , A D A C H I S I, L I Z U K A T, O B A Y A S H I E, M A K I N O R, N A K A H A R A K & S H O U N H (1995) Biochemistry 34 : 9052-9058 ; N A K A H A R A K & S H O U N H (1996) J. Biochem. 120 : 1082-1087. [58] T O R I T S U K A N, S H O U N H , S I N G H UP, P A R K S Y , I Z U K A T & S H I R O Y (1997) Biochim. Biophys. Acta 1338 : 93-99. [59] S H I R O Y , F U J I I M, I I Z U K A T, A D A C H I S I, T S U K A M O T O K, N A K A H A R A K & S H O U N H (1995) J. Biol. Chem. 270 : 1617-1623. [60] O K A M O T O N, I M A I Y , S H O U N H & S H I R O Y (1998) Biochemistry 37 : 8839-8847. [61] M A R I O T T I A (1998) Pour La Science 249 : 60-65 ; M A R I O T T I A (1994) Hydrogologie 3 : 43-68.

CHAPITRE 7 OXYDATIONS ANAROBIES DIVERSES


Nous savons que le potentiel lectrochimique membranaire est une forme de stockage de l'nergie directement produite par les oxydorductions respiratoires. Quand l'oxygne fait dfaut, les respirations dites anarobies prennent le relais en utilisant des accepteurs de remplacement. La dnitrification est l'une des solutions. D'autres respirations sont tout aussi importantes et maintes biodgradations en sont tributaires. Dans ce chapitre sont examines quelques-unes de celles qui apparaissent comme les principales. Certaines sont surprenantes, comme l'intervention de l'humus du sol ou du fumarate. Mais la rduction du sulfate et des composs soufrs a une fonction majeure dans l'environnement partout o ils sont abondants. La rduction d'lments mtalliques, comme le fer et le manganse, est tout aussi importante et reprsente peut-tre un mcanisme nergtique trs ancien de l'histoire de la vie. Nous terminerons par une surprise que nous offrent les halorespirations, o les accepteurs sont des drivs chlors ou des oxydes de chlore, dont certains sont des produits polluants rpandus par l'industrie. La respiration anarobie est rserve essentiellement aux procaryotes et reste exceptionnelle chez l'norme majorit des eucaryotes dont le dveloppement normal est tributaire de l'oxygne. 7.1 - Des accepteurs varis et inattendus 7.2 - Du sulfate au sulfure 7.3 - Biochimie de la rduction du sulfate 7.4 - Le fer et le manganse comme accepteurs anarobies 7.5 - Dshalognation respiratoire - Oxyde de chlore 319 326 332 340 35 1

7 OXYDATIONS ANAROBIES DIVERSES


Le potentiel lectrochimique membranaire est une forme de stockage de l'nergie. Celle-ci est utilise directement, notamment pour des transports actifs ou la mobilit (rotation des flagelles), ou convertie secondairement en ATP par l'ATP synthase de type F0F1. Sa prsence inhibe le fonctionnement des autres formes de respiration, soit en bloquant indirectement l'expression des gnes concerns, soit en inhibant directement les enzymes qui participent. Les accepteurs de remplacement sont gnralement des produits abondants dans l'environnement, ou engendrs par voie biologique, mais leur utilisation des fins respiratoires est rserve aux procaryotes. La respiration anarobie n'est qu'exceptionnelle chez les eucaryotes qui restent tributaires de l'oxygne dans leur norme majorit pour tout dveloppement normal.

7.1 - DES ACCEPTEURS VARIS ET INATTENDUS


Les biotopes anarobies n'ont que l'embarras du choix pour remplacer l'oxygne, qui est l'accepteur au potentiel le plus lev. Nous avons dj rencontr les nitrates et autres oxydes d'azote. Dautres accepteurs respiratoires extrmement importants dans la nature sont divers composs soufrs dont le sulfate, des mtaux comme Fe(III), Mn(IV), une foule de composs organiques halogns ou non dont la liste ne cesse de sallonger, et mme certains constituants du sol. Parmi ces derniers, lhumus figure en bonne place. Un accepteur rpandu est le fumarate. Ce compos est un intermdiaire mtabolique des oxydations arobies dans le cycle de Krebs, o il est form partir du succinate. La raction inverse s'observe en anarobiose, o la rduction du succinate en fumarate voque une fermentation. Une vritable fermentation devrait conduire directement une formation d'ATP, mais dans bien des cas la rduction du fumarate ne correspond pas une fermentation, parce que la raction est couple avec une extrusion de protons travers la membrane et reprse