Vous êtes sur la page 1sur 167

UNIVERSITÉ CHEIKH ANTA DIOP DE DAKAR

ÉCOLE DOCTORALE: SCIENCES DE LA VIE, DE LA SANTÉ ET DE


L’ENVIRONNEMENT

FACULTÉ DES SCIENCES ET TECHNIQUES

Année : 2015 N° d’ordre : 139

THESE DE DOCTORAT

Spécialité : Entomologie

Présentée par :

Mohamed Salem Ould Ahme dou Salem

Contribution à l’étude du paludisme en Mauritanie : morbidité,


polymorphisme allélique du Plasmodium falciparum et faune
anophélienne dans deux zones géo-climatiques.

Soutenue le 28 Mars 2015 devant le jury composé de :

Pr. Oumar GAYE UCAD/FMPOS Président


Pr. Babacar FAYE UCAD/FMPOS Rapporteur
Pr. Mbacké SEMBENE UCAD/FST Rapporteur
Pr Ngor FAYE UCAD/FST Rapporteur

Dr. Ibrahima DIA IPD Examinateur

Pr. Ali O. M. Salem BOUKHARY USTM/FST, Mauritanie Directeur de Thèse


Pr. Ousmane FAYE UCAD/FST Directeur de Thèse
Publications
Cette thèse a fait l’objet des publications et communications suivantes :

I. Articles parus
1. Ould Ahmedou Salem M.S., Mint Lekweiry K., Mint Hasni M., Konate L., Briolant
S., Faye O., Ould Mohamed Salem Boukhary A. 2013.Characterization of larval
anopheline (Dipte ra: Culicidae) habitats in Nouakchott, Mauritania. J Vector
Borne Dis, 50:302–306.
2. OuldAhme dou Salem MS, Ndiaye M., OuldAbdallahi M., Mint Lekweiry K.,
Bogreau H., Konaté L., Faye B., Gaye O., Faye O., Mohamed Salem Boukhary A.
2014. Polymorphis m of the merozoite surface protein-1 block 2 region in
Plasmodium falciparum isolates from Mauritania. Malaria Journal 13: 26.
II. Article soumis
- Ould Ahme dou Sale m M.S, Basco L., Ouldabdellahi M., Lekweiry K., Konaté L.,
Faye O., Ould Mohamed Salem Boukhary A.Malaria-associated morbidity during
the rainy season in Saharan and sahelian zones in Mauritania. Acta tropica
III. Communications orales:
1. Ould Ahmedou Salem M.S, Ouldabdellahi M., Lekweiry K., Konaté L., Faye O.,
Ould Mohamed Salem Boukhary A. Malaria increase in Mauritania and its
expansion to non-ende mic regions. 7th European congress on Tropical
Medicine and Inte rnational health. October-3-6-2011. Barcelone- Spain.
2. Mohamed Salem Ould Ahmedou Salem, Khadijetou Mint Lekweiry, Eve
Pradines, Bruno Pradines, Lassana Konaté, Ousmane Faye, Ali Ould Mohamed
Salem. Inventaire de la faune anophelienne dans la région de Hodh Elgharbi
en Mauritanie. Journées de la recherche et d’échanges scientifiques. ISET-
Rosso, le 12 et 13 Décembre 2012.
3. OuldAhme dou Salem M.S., Lekweiry K., Hasni M., Konaté L., Faye O., Ould
Mohamed Salem Boukhary Ali. Caractérisation préliminaire de gites larvaires
d’anophèles à Nouakchott, Mauritanie. Congrès de SOAP, Dakar, 18-20
Décembre 2012

i
Résumé :

En Mauritanie, la situation réelle du paludisme reste jusqu’ici méconnue même si la


maladie est considérée comme étant le premier motif de consultation et d’hospitalisation après
la diarrhée et les infections respiratoires. Pour améliorer les connaissances sur l’épidémiologie
du paludisme en Mauritanie, plusieurs aspects de cette maladie doivent être davantage
élucidés.
Cette étude a été conduite dans le but d’établie des données fiables sur la morbidité
palustre, le polymorphisme allélique de Plasmodium falciparum et la faune anophélienne à
Nouakchott (zone saharienne) et au Hodh el Gharbi (Zone sahélienne). L’étude de la
morbidité palustre pendant deux saisons de transmission successives (2009 et 2010) chez
1161 sujets fébriles patients (498 à Nouakchott et 663 au Hodh Elgharbi) a montré une
prévalence de 50,8% (253/498) à Nouakchott dont 83% de monoinfection par P. vivax et 17%
de monoinfection par P. falciparum monoinfection). Au Hodh Elgharbi, 378 des 663 patients
(57.0%) avaient des gôuttes épaisses positives, majoritairement due à des monosinfections par
P. falciparum soit une prévalence de (96.6%).
Par ailleurs, l’étude du polymorphisme allélique du gène Msp-1 des isolats de P.
falciparum a montré un polymorphisme relativement élevé des familles alléliques K1, Mad20
et Ro33. En effet, 27 allèles de tailles différentes ont été trouvés chez les isolats de P.
falciparum génotypés (9 K1, 12 Mad 20 et 6 R033). De plus, une multiplicité d'infections
(MOI) relativement élevée a été observée chez les patients porteurs des isolats de P.
falciparum soit au niveau de sites d'étude (2,33 à 4,25) ou sur l'ensemble des sites d'étude
(3.22) ce qui suggère une intensité de transmission élevée du paludisme au cours de la période
d'étude.
Par ailleurs, la caractérisation de la faune anophélienne au Hodh el Gharbi et à
Nouakchott, et l’évaluation de son implication dans la transmission du paludisme ainsi que
l’identification et la caractérisation des gîtes larvaires d’anophèles à Nouakchott ont montré la
présence du complexe d’An gambiae s.l représenté par An. arabiensis et An. gambiae s.s, An.
rufipes, An. funestus et An. pharoensis au Hodh el Gharbi et seulement An. arabiensis à
Nouakchott. Au Hodh el Gharbi, aucune femelle infectée n’a été trouvée. Par contre à
Nouakchott un indice sporozoïtique de l’ordre de 1.72 % de P. vivax chez An. arabiensis a été
enregistré. D’autre part, la recherche de gîtes larvaires d’anophèles à Nouakchott a montré
que les eaux déversés de bornes fontaines et les cuves de stockage d’eau potables dans les
maisons sont les endroits privilégiés pour la reproduction et le dévelopement des stades
larvaires d’An. gambiae s.l.

Mots clés : paludisme, morbidité, polymorphisme allélique, msp-1, transmission, faune


anophéliennes, gîtes larvaires, bornes fontaines, Nouakchott, Hodh El Gharbi, Mauritanie.

ii
Abstract
In Mauritania, the epidemiology of malaria is not clear although the disease is
considered the main motive for consultation and hospitalization after diarrhea and respiratory
infections. To improve knowledge about the epidemiology of malaria in Mauritania, several
aspects of this disease should be further elucidated.

The present study was conducted to establish a reliable database on malaria morbidity,
allelic polymorphism of P. falciaprum populations and identify and characterize anopheline
fauna in Nouakchott situated in the saharan zone, and Hodh El Gharbi in the Sahelian zone.
Assessment of malaria morbidity during two successive peak transmission periods (2009 and
2010) in 1,161 febrile patients (498 in Nouakchott and 663 in Hodh Elgharbi region) showed
malaria prevalence of 50.8%(253/498) in Nouakchott (83% P. vivax monoinfections and 17%
P. falciparum monoinfection). In Hodh Elgharbi, 378 of 663 patients (57.0%) were smear-
positive, mostly due to P. falciparum monoinfections (96.6%).

Furthermore, the study of allelic polymorphism of P. falciparum isolate MSP-1 gene


of isolates showed a relatively high family allelic polymorphism of K1, Mad20 and Ro33.
Indeed, 27 alleles of different sizes were found in the genotyped P. falciparum isolates (9 K1,
12 Mad20 and 6 Ro33). In addition, a relatively high multiplicity of infection (MOI) were
observed in P. falciparum infected patients either at study sites (2.33 to 4.25) or over all study
sites (3.22) suggesting a high malaria transmission intensity during the study period.

The characterization of the anopheline fauna in Hodh el Gharbi and Nouakchott, and
evaluation of its involvement in malaria transmission and the identification and
characterization of larval Anopheles habitats in Nouakchott showed the presence of An
gambiae sl complex represented by An. arabiensis and An. gambiae ss, An. rufipes, An.
funestus and An. pharoensis in Hodh el Gharbi and only An. arabiensis in Nouakchott. In
Hodh el Gharbi, no infected female was found while in Nouakchott a P. vivax sporozoite rate
of 1.72% in An. Arabiensis was recorded. Furthermore, the search of anopheline larval
habitats in Nouakchott showed that water discharged from public standpipes and household
drinking water tanks were the prefered habitats for the rpoduction and the develpment of
laraval stages of An gambiae s.l.

Key words : malaria, morbidity, allelic polymorphism, msp-1, transmission,


anopheline fauna, larval habitat, standpipes, Nouakchott, Hodh El Gharbi, Mauritania.

iii
Remerciements
Les travaux de recherche objet de cette Thèse sont le fruit d’une collaboration fructueuse
entre l’Unité de Recherche ‘Génomes et milieux’ a la Faculté des Sciences et Techniques de
l’Université des Sciences de Technologie et de Médecine (Mauritanie), le Laboratoire
d’Ecologie Vectorielle et Parasitaire de la Faculté des Sciences et Techniques de l’Université
Cheikh Anta Diop de Dakar (Sénégal),le Service de Parasitologie-Mycologie de la Faculté de
Médecine, de Pharmacie et d’Odonto-Stomatologie de l’Université Cheikh Anta Diop
(Sénégal), et l’Unité de Parasitologie de l’Institut de Recherche Biomédicale des Armées de
Marseille (France).
Les stages et les sorties sur le terrain sont supportés par le Programme National de Lutte
contre le Paludisme (PNLP) et le Service de Coopération et de l’action culturelle (SCAC) de
l’Ambassade de France à Nouakchott que je remercie.
Au terme de ce travail, c’est avec une particulière satisfaction que j’accomplis l’agréable
devoir de remercier tous ceux qui m’ont apporté leur soutien. Je voudrais remercier en
particulier:
Monsieur le Professeur Ous mane Faye, responsable du Laboratoire d’Ecologie Vectorielle et
Parasitaire de la Faculté des Sciences et Techniques –UCAD et de la Formation doctorale
Entomologie, Co-directeur de ma thèse, qui a toujours été disponible quand j’avais besoin de
lui, pour mes nombreuses questions par mail, pour me stimuler scientifiquement, pour
corriger les articles malgré ses innombrables obligations. Ile m’a montré comment travailler
efficacement, rigoureusement, en restant toujours ouvert à de nouvelles idées scientifiques. Ile
a été d’une aide inestimable pour rédiger, pour me remettre en question et pour réfléchir au
sens de mon travail. Avec son attitude dynamique et enthousiaste, il m’a donné du courage
pour aller jusqu’au bout de ma thèse.
Monsieur le Professeur Ali OULD MOHAMED SALEM BOUKHARY, enseignant
chercheur a la Faculté des Sciences et Techniques de l’Université des Sciences, de
Technologie et de Médecine (USTM) de Nouakchott, responsable de l’Unité de Recherche
Génome et milieux, et co-directeur de ma thèse. Grâce à qui j’ai eu cette superbe occasion de
travailler dans son équipe et d’y réaliser ma thèse, il m’a montré un bel exemple de création et
de gestion d’une jeune équipe qui en quelques années a été distinguée, a décroché des projets
et multiplié ses contacts, qui a su établir de nombreux contacts de confiance avec plusieurs
partenaires, qui m’a toujours poussé à faire ce qui m’intéresse, qui m’a permis de participer à
des congrès, qui m’a donné des responsabilités, tout en me laissant une liberté d’action et en

iv
me faisant confiance, tout en veillant à la qualité scientifique du travail, des résultats, des
articles et de la thèse. J’ai appris beaucoup grâce à lui, au point de vue technique, scientifique
et au point de vue humain.

Monsieur le Professeur Oumar GAYE, Chef du Service de Parasitologie-Mycologie de la


Faculté de Médecine -UCAD, pour l'honneur qu'il m'a fait en acceptant de présider le jury de
ma thèse. Je le remercie pour son enseignement en Parasitologie que j'ai beaucoup apprécié et
aussi pour son accueil sa gentillesse lors de mon stage dans son service. Vous trouverez dans
ces mots l’expression de ma grande gratitude et de mon profond respect.

Monsieur le Professeur Babacar FAYE, du Service de Parasitologie-Mycologie à la Faculté


de Médecine -UCAD, pour sa participation au jury de ce thèse en tant que rapporteur et je le
remercie pour l’encadrement lors de mon stage au Service de Parasitologie et d’avoir
consacré de son temps a l’examen et a l’analyse critique de ce manuscrit. Je suis heureux de
lui exprimer mon estime et ma profonde reconnaissance.

Monsieur Mbacké SEMBENE, Professeur au Département de Biologie, pour l'honneur qu'il


m'a fait en acceptant de participer au jury de cette thèse en tant que rapporteur malgré vos
innombrables obligations. Vous trouverez ici, l’expression de ma reconnaissance, de mon
profond respect et de ma grande estime.
Docteur Ibrahima DIA, Chargé de recherche a l’Institut Pasteur de Dakar, pour l'honneur
qu'il m'a fait en acceptant de participer au jury de cette thèse en tant que examinateur malgré
vos innombrables obligations. Vous trouverez ici, l’expression de ma reconnaissance, de mon
profond respect et de ma grande estime.

Monsieur Ngor FAYE, Professeur au Département de Biologie, pour l'honneur que vous m'a
fait en acceptant de participer au jury de cette thèse en tant que rapporteur malgré vos
innombrables obligations. Vous trouverez ici, l’expression de ma reconnaissance, de mon
profond respect et de ma grande estime.

Docteur Lassana KONATE, du Laboratoire d’Ecologie Vectorielle et Parasitaire de la


Faculté des Sciences et Techniques-UCAD, vous avez dirigé ma thèse avant mon transfert
vers la Thèse unique votre rigueur scientifique et votre disponibilité m’ont beaucoup marqué.

v
C’est vous qui a guidé mes pas vers la recherche. Vous trouverez ici, l’expression de ma
reconnaissance, de mon profond respect et de ma grande estime.

Mes remerciements vont également aux :


Professeur Leonardo Basco
Professeur Bruno Pradines
Docteur Sébastien Briolant
Docteur Eve Pradines
Docteur Hervé Bogreau
Docteur Maguatte Ndiaye
Docteur Glana Mint Meiloud
Monsieur Mohamed Salem Ould NAMY Chef du service de personnel à l’Université de
Nouakchott, plusieurs chapitres de cette thèse ont été écrits chez lui.
Professeur Mohamed Vall Ould El mamy : Merci pour les corrections
Tous les membres de l’équipe de l’IRBA en particulier (Houssam, Adeline, Jérome,
Nathalie.)
Tous les membres de l’équipe de Laboratoire d’Ecologie Vectorielle et Parasitaire de la
Faculté des Sciences et Techniques de l’UCAD (Elhaj NIANG, KANE DIA,……………….)
Tous les membres de l’équipe du Service de Parasitologie-Mycologie de la Faculté de
Médecine de l’UCAD en particulier (Ami, Annie, Ablaye, Eljouhoude, Huguette ………….)
Tous les membres de l’Unité de recherche ‘Génomes et milieux’ (Professeur Khyarhoum,
Docteur HAMAD, Professeur Taleb Khyar, Professeur Zeine Elabidine, Docteur Houdi,
Docteur Mohamed Ahmed, Docteur Mohameden, Docteur Ould Mofid, Docteur
Fouteya,Vall, Aichetou, Mohamed Ali, Jemilla et Docteur Khadijetou sans oublier les
anciennes membres de l’équipe :Moina et Aminetou ).
Tous les professeurs et personnels de la Faculté des Sciences et Techniques de l’USTM en
particulier, le chef du Département de Biologie, le responsable de Master ainsi que tous les
enseignants de ce département et le chef du Département de Chimie et deux professeurs de ce
département (Saïd et Brahim.).
Les Dras des zones d’études ainsi que les directeurs, médecins chefs et les personnels des
sites d’études.
Les populations des sites d’études ainsi que les participants dans l’étude
A toute personne ayant contribuée de prés ou de loin à l’aboutissement de ce modeste
travail.

vi
A
Mes parents, mes amis et mon pays

Je dédie ce travail

vii
TABLE DES ILLUSTRATIONS

FIGURES
Figure 1 :Cycle Pré-érythrocytaire du Plasmodium chez l’homme…………………………...4

Figure 2 :Cycle Erythrocytaire du Plasmodium chez l’homme……………………………….5

Figure 3 :Cycle sexuée chez l’anopheles (Sporogonie)……………………………………….6

Figure 4 : Répartition du paludisme dans le monde…………………………………………...8

Figure 5 :Goutte épaissse…………………………………………………………………….12

Figure 6 :Frottis Sanguin……………………………………………………………………..12


Figure 7 : Diagnostic des Plasmodiums par PCR nichée……………………………………14

Figure 8 : Représentation schématique du gène MSP-1 et ses familles alléliques…………...19


Figure 9: Cycle biologique des anophèles…………………………………………………...22

Figure 10: Anopheles gambiae s.l……………………………………………………………25

Figure 11 : Distribution des espèces du complexe Anopheles gambiae……………………..25

Figure 12 : différents facies épidémiologiques en Afrique ………………………………….33


Figure 13 : Distribution de la végétation en Afrique………………………………………...34

Figure 14 : Découpage administrative de la Mauritanie……………………………………..41

Figure 15: Evolution de nombre de cas de paludisme de 2003 à 2010 ……………………43

Figure 16:Carte de la Mauritanie montrant les trois zones géo-climatiques du pays………..45


Figure 17 : Carte de Nouakchott et ses neuf communes……………………………………..51

Figure 18 : Carte administrative du Hodh el Gharbi…………………………………………53

Figure 19 : Groupes d’âge des patients fébriles à gouttes épaisses positives à

Nouakchott et au Hodh El gharbi en 2009 et 2010…………………………………………...62

Figure 20 : Carte de la Mauritanie montrant les zones d’études……………………………..69


Figure 21 : Borne fontaine à Teyarett (a) - la flèche indique la cuve où s’accumulent les eaux
qui se déversent pendant l’approvisionnement des charretiers - et plateau contenant les larves
d’anophèles collectées de cette cuve (b)……………………………………………………...94

viii
Tableaux
Tableau 1. Caractéristiques générales de la population objet de l’étude ……………………58

Tableau 2. Proportions des gouttes épaisses positives chez les patients fébriles durant la
saison des pluies dans deux zones en Mauritanie…………………………………………….60

Tableau 3. Les espèces plasmodiales rencontrées dans les deux zones en 2009 et 2010…..61

Tableau 4. Distribution des densités parasitaires chez les patients positifs selon l’espèce
plasmodiale dans les deux régions en 2009 et 2010………………………………………….63

Tableau 5. Séquence des oligonucléotides utilisées pour la PCR primaires et secondaires....71

Tableau 6. Caractéristiques générales de la population étudiée …………………………….73

Tableau 7. Fréquence des allèles de la région du bloc 2 du gène Msp-1 et la multiplicité


d’infection chez des isolats de P. falciparum de différents sites d’étude en Mauritanie……..75

Tableau 8. Distribution des familles alléliques du gène Msp1 en fonction de l’âge chez des
sujets infectés par P. falciparum en Mauritanie. …………………………………………….76

Tableau 9. Distribution des familles alléliques du gène Msp-1 selon les classes de parasitémie
chez des sujets infectés par P. falciparum en Mauritanie…………………………………….77

Tableau 10. Richesse spécifique de la faune anophélienne de Kobeni et Tintane (région du


Hodh el Gharbi) et de Teyarett (Nouakchott)………………………………………………...92

Tableau 11. Distribution des membres du complexe gambiae du Hodh el Gharbi et de


Nouakchott. …………………………………………………………………………………..93

Tableau 12. Résultats de la recherche des formes sporozoaires chez les Anopheles………..93

Tableau 13 : Localisation Géographique, abondance et stade larvaire de gîtes larvaires


d’anophèles au niveau de trois arrondissements de Nouakchott……………………………...97

Tableau 14. Caractéristiques physico-chimiques des gîtes larvaires positives à Nouakchott.98

Tableau 15 : Analyse bivariée par régression logistique de la positivité larvaire des


collections d’eau dans la ville de Nouakchott. ……………………………………………100

Tableau 16: Analyse bivariée par régression de Poisson de la densité larvaire dans les gîtes
larvaires au niveau des différents sites à Nouakchott……………………………………….101

ix
Table des matières
INTRODUCTION GENERALE ..................................................................... 1
PREMIERE PARTIE : REVUE DES CONNAISSANCES SUR LE PALUDISME ....... 3
CHAPITRE I : GENERALITES SUR LE PALUDISME ................................. 3
1. Définition ................................................................................................... 3
2. Agents pathogènes ...................................................................................... 3
3. Cycle évolutif du Plasmodium..................................................................... 4
4. Les vecteurs du paludisme .......................................................................... 6
5. Répartition mondiale du paludisme ............................................................. 7
6. Facteurs favorisant la transmission .............................................................. 8
7. Symptomatologie du paludisme................................................................... 9
8. Diagnostic du paludisme ........................................................................... 10
9. Lutte contre le paludisme .......................................................................... 15
9.1. Lutte contre le Parasite .................................................................... 16
10. Diversité parasitaire de P. falciparum : mécanismes et méthode de mise en
évidence....................................................................................................... 17
10.1. Le polymorphisme allélique ........................................................... 17
10.2. La variation antigénique ................................................................. 20
CHAPITRE II : VECTEURS ET TRANSMISSION...................................... 21
1. LE VECTEUR DU PALUDISME ............................................................. 21
1.1. Biologie des anophèles ..................................................................... 20
1.2. Comportement des anophèles adultes ................................................ 23
1.3. Les principaux anophèles vecteurs du paludisme en Afrique .............. 24
2. La lutte anti vectorielle ............................................................................. 27
2.1. La lutte contre les anophèles au stade adulte .................................... 27

x
2.2. Lutte contre les anophèles au stade larvaire ...................................... 29
3. Méthodes de mesure de l’efficacité de la lutte anti vectorielle..................... 28

3.1. Effet rémanent ................................................................................. 28


3.2. Effet de masse ................................................................................. 29
4. Resistance des anophèles aux insecticides.................................................. 30
4.1. Définition ........................................................................................ 30
4.2 Mécanismes de résistances ................................................................ 31
5. Paludisme et facies épidémiologiques en Afrique ....................................... 32
5.1. Définition du faciès épidémiologique ................................................ 32
5.2. Les régions naturelles de l'Afrique .................................................... 33
5.3. Répartition des facies épidémiologiques en Afrique........................... 35
6. Modifications anthropiques de l'environnement ......................................... 37
6.1. La déforestation ............................................................................... 37
6.2. La riziculture irriguée....................................................................... 37
6.3. L'urbanisation .................................................................................. 38
CHAPITRE III : SITUATION ACTUELLE DU PALUDISME EN MAURITANIE ..... 40
1. PRESENTATION DE LA MAURITANIE ................................................ 40
1.1. Présentation géographique et climatique ........................................... 40
1.2. Les vecteurs du paludisme ................................................................ 41
2. L’épidémiologie du paludisme .................................................................. 42
3. Strates épidémiologiques en Mauritanie..................................................... 44
4. Prise en charge et stratégies nationales de lutte contre le paludisme ............ 46
5. Chimiorésistance du paludisme ................................................................. 47
6. La diversité génétique du plasmodium ....................................................... 48

xi
DEUXIEME PARTIE : TRAVAUX PERSONNELS..................................... 49
CHAPITRE 4 : SAISONNALITE DU PALUDISME .................................... 49

1. Introduction.............................................................................................. 49
2. Matériels et méthodes ............................................................................... 51
2.1. Zones d’études ................................................................................. 51
2.2. Sites d’étude .................................................................................... 54
2.3. Patients et collecte des données parasitologiques ............................... 54
2.4. Réalisation du TDR.......................................................................... 54
2.5. Goutte épaisse (GE) ......................................................................... 55
2.6. Frottis sanguin ................................................................................. 55
2.7. Lecture des lames............................................................................. 56
2.8. Détermination de la densité parasitaire .............................................. 56
3. Analyse statistique .................................................................................... 57
4. Résultats .................................................................................................. 58
4.1. Caractéristiques de l’échantillon ....................................................... 58
4.2. Résultats parasitologiques enregistrés à Nouakchott en 2009 et 2010 . 59
4.3. Résultats parasitologiques enregistrés au Hodh El Gharbi en 2009 et 2010 64
5. Discussion................................................................................................ 65
6. Conclusion ............................................................................................... 67
CHAPITRE 5 : POLYMORPHISM E DU GENE MSP-1 DES ISOLATS DU P. FA LCIPA RUM ...... 68
1. INTRODUCTION.................................................................................... 68
2. Matériels et Méthodes............................................................................... 69
2.1. Zones d’études ................................................................................. 69
2.2. Patients et échantillonnage ............................................................... 70

xii
2.3. Etude du polymorphisme allélique de gène Msp1 .............................. 70
3. Résultats .................................................................................................. 73

3.1. Caractéristique général de l’échantillon............................................. 73


3.2. Polymorphisme allélique du gène MSP1 ........................................... 74
3.3. Relation entre la complexité de l’infection et les groupes d’âges ........ 75
4. Discussion................................................................................................ 78
5. CONCLUSION........................................................................................ 81
CHAPITRE 6 : FAUNE ANOPHÉLIENNE AU HODH EL GHARBI ET À NOUAKCHOTT 82
1. Introduction.............................................................................................. 82
2. Matériels et Méthodes............................................................................... 83
2.1. Les zones prospectées ...................................................................... 83
2.2. Sites d'études ................................................................................... 83
2.3. Faune anophélienne au Hodh el Gharbi et à Nouakchott .................... 85
2.4. Gîtes larvaires d’anophèles à Nouakchott. ......................................... 89
2.5. Analyses statistiques ........................................................................ 91
3. Résultat .................................................................................................... 92
3.1. Faune anophélienne ......................................................................... 92
3.2. Gîtes larvaires d’anophèles à Nouakchott .......................................... 94
4. Discussion...............................................................................................102
5. CONCLUSION.......................................................................................106
CONCLUSION GENERALE ET PERSPECTIVES .....................................107
REFERENCES BIBLIOGRAPHIQUES ......................................................109
ANNEXES .................................................................................................124

xiii
INTRODUCTION GENERALE
Malgré les différents programmes mis en place depuis plus de 50 ans pour éradiquer le
paludisme d’abord, et ensuite plus modestement pour le contrôler, cette maladie affecte
encore de nos jours plus de 40% de la population mondiale (Hay et al., 2004). Dans de
nombreux pays du monde, le paludisme représente un obstacle majeur au développement
économique et à l’amélioration du niveau de santé des populations.

Selon l’Organisation Mondiale de Santé (OMS, 2013), le paludisme est endémique


dans 104 pays du monde et on estime que 3,4 milliards de personnes sont exposées à cette
maladie. Le nombre des cas du paludisme est estimé à 207 millions et le nombre de décès
attribués au paludisme est de 627000 personnes. L’Afrique paie un lourd tribut avec 80% des
cas et 90% de décès. Les enfants âgés de moins de 5 ans représentent 77% des décès.Le
paludisme reste l’un des principaux fléaux qui touche l’Afrique.

L'impossibilité de supprimer le paludisme dans la plupart des zones d'endémie,


particulièrement en Afrique, tient à de très nombreux facteurs, entre autres à la complexité des
interactions du système parasites-vecteurs- hôtes humains-environnement, à la résistance des
Plasmodium aux antipaludéens et des vecteurs aux insecticides ainsi qu’aux systèmes de
santé défaillants dans de nombreux pays du Sud.

En Mauritanie, la situation réelle du paludisme reste jusqu’ici méconnue même si la


maladie est considérée comme étant le premier motif de consultation et d’hospitalisation après
la diarrhée et les infections des voies respiratoires dans dix des treize régions du pays où il
représente 18% des consultations externes dans les formations sanitaires. Au niveau national,
Plasmodium falciparum est l’espèce la plus fréquemment diagnostiquée (80 à 90 %), suivie
par P. malariae (environ 10 %), P. vivax (3 %) et P. ovale (0,1 %) (PNLP, 2009).

En effet, si dans la partie mauritanienne de la vallée du fleuve Sénégal, la situation est


similaire à celle de la rive sénégalaise où les espèces du complexe An. gambiae sont les
principales responsables d’une transmission saisonnière courte (Faye et al.,1993a,b; 1995a,b;
Dia et al.,2009 ; ouldabdalahi et al.,2011), l’existence d’une transmission ainsi que les
vecteurs anophéliens impliqués restent respectivement quasi incertain et inconnus dans la
partie saharienne du pays. Sur le plan parasitologique, le faible nombre de structures
sanitaires mais surtout le manque de personnel qualifié pour un diagnostic biologique correct
constitue des limites pour une bonne évaluation de la situation réelle de la maladie (Cortes et
al., 2003).

1
L’augmentation inhabituelle de la pluviométrie en particulier dans la partie saharienne
du pays occasionnant des inondations dans le Hodh El Gharbi, notamment celle survenue
dans la ville de Tintane en 2007 constitue l’un des facteurs responsables des modifications de
l’écosystème, susceptibles d’influer la transmission et l’incidence du paludisme au cours de
ces dernières années.La survenue d’accès palustres présumés autochtones à Nouakchott,
considérée jusqu’ici comme une zone indemne du paludisme a également été notée (Mint
Lekweiry et al.,2009). Les connaissances actuelles disponibles sur la situation du paludisme
en Mauritanie sont encore très fragmentaires. Pour améliorer les connaissances sur
l’épidémiologie du paludisme en Mauritanie, plusieurs aspects de la maladie doivent être
davantage élucidés.

Ce travail de thèse s’inscrit dans cette perspective par la description de quelques


aspects du paludisme à Nouakchott (zone saharienne) et au Hodh el Gharbi (zone sahélienne).
Il a pour objectifs de :
1. Evaluer la transmission palustre au niveau des deux zones,
2. Etudier la diversité génétique des souches du P. falciparum, circulant dans ces deux
zones,
3. Déterminer les espèces anophéliennes impliquées dans la transmission du paludisme
au niveau des deux zones.
Ce document comporte deux parties.
La première est une revue bibliographique sur le paludisme. Elle comprend :
1. Les généralités sur le paludisme (Chapitre 1),
2. Les vecteurs et la transmission (Chapitre 2),
3. La situation actuelle du paludisme en Mauritanie (Chapitre 3)
La deuxième partie est une présentation des travaux personnels effectués dans le cadre
de cette thèse. Elle traite :
1. La saisonnalité du paludisme au Hodh El Gharbi et à Nouakchott (Chapitre 4),
2. Le polymorphisme des isolats du P. falciparum (Chapitre 5),
3. La faune anophelienne au Hodh el Gharbi et à Nouakchott (Chapitre 6),
Enfin, une conclusion générale suivies des perspectives d’étude découlant de ces travaux pour
une meilleure compréhension de la transmissio n palustre en Mauritanie closent le présent
document.

2
PREMIERE PARTIE :

REVUE DES CONNAISSANCES


SUR LE PALUDISME
CHAPITRE I :

GENERALITES SUR LE
PALUDISME
1. Définition
Le paludisme (du latin palus = marais) ou malaria (de l'italien mal’aria = mauvais air)
est une parasitose causée par un hématozoaire du genre Plasmodium, propagée par la piqûre
de certaines espèces de moustiques du genre Anopheles.
2. Agents pathogènes
Dans la classification de Garnham, ce sont surtout des caractères morphologiques et
des particularités du cycle biologique qui ont été utilisés comme critères taxonomiques.
Aujourd’hui, le Plasmodium prend place dans le règne des Protistes et appartient au Phylum
des organismes parasites obligatoires, les Apicomplexa, à la classe des Aconoidasida, à l’ordre
des Haemosporida, à la famille des Plasmodiidae et enfin au genre Plasmodium.

Il existe cinq espèces plasmodiales impliquées en pathologie humaine : Plasmodium


falciparum, P. vivax, P. ovale, P. malariae et P. knowlesi.

- P. falciparum est l'espèce la plus redoutable, responsable de la fièvre tierce maligne


(l’intervalle qui sépare deux accès fébriles est de 48 heures) et de l'immense majorité des
décès. Elle prédomine en Afrique sub-saharienne où elle est responsable de 90 % des cas
(Jafari- Guemouri et al., 2006). Son incubation est de sept (7) à douze (12) jours. Il est très
rare de voir survenir un accès chez un individu plus de deux à trois mois après son départ
d’une zone d’endémie.

- P. vivax très répandue dans le monde (mais moins que P. falciparum), il est
responsable de la fièvre tierce bénigne. Il évolue par des accès de reviviscence, variables selon
la souche. Les accès sont en général bénins mais des cas graves ont été signalés (Mahgoub et
al., 2012). P.vivax a la particularité de ne pas reconnaître les globules rouges sans antigène
Duffy, circonstance extrêmement fréquente (85%) chez les populations d’Afrique Centrale et
Occidentale, ce qui procure une certaine protection contre P.vivax chez ces populations.
Cependant cette particularité a été récemment remise en question (Mercereau-Puijalon et al.,
2010 ; Wurtz et al., 2011).

- P. ovale est moins fréquent que P. falciparum et P. vivax. Elle a une incubation de 15
jours à quatre ans. Les rechutes tardives sont possibles jusqu'à cinq ans. En général sa forme
est une fièvre tierce bénigne.

- P. malariae a une incubation de trois semaines environ. Sa longévité est de trois ans
au moins et jusqu'à 20 ans. Sa forme est également bénigne et est responsable des fièvres dites

3
quartes (l’intervalle qui sépare deux accès fébriles est de 72 heures).

- P. knowlesi, ce Plasmodium du singe est proche génétiquement de P.vivax, et


microscopiquement de P.malariae. Il a été découvert en 1965 chez l'Homme sur l'île de
Bornéo en Malaisie (Bronner et al.,2009), mais connu bien antérieurement chez le singe. Les
cas humains sont de plus en plus fréquents. La fièvre est habituellement duale et il n'y a pas
d'accès de reviviscence (Singh et al., 2004 ; Cox-Singh et al., 2008)

3. Cycle évolutif du Plasmodium

3.1. Cycle asexué chez l’homme : schizogonie

Après une piqûre infectante, les sporozoïtes qui ont été injectés dans les capillaires
cutanés atteignent rapidement le foie. Pendant ce court laps de temps, ils sont vulnérables aux
effecteurs du système immunitaire et aux cellules phagocytaires. Seuls ceux ayant réussi à
pénétrer dans les hépatocytes pourront continuer leur maturation/réplication.

Le parasite se trouve alors dans une phase de réplication intra-hépatique (figure 1).
Celle-ci est totalement asymptomatique. Elle dure six à quinze jours et se termine par
l’éclatement des hépatocytes infectés permettant la libération d’un grand nombre de
mérozoïtes dans la circulation sanguine. P. falciparum présente une spécificité importante lors
de cette phase : il ne présente pas de persistance hépatique appelée hypnozoïte. Cette
caractéristique explique entre autre que les rechutes pouvant être observées avec Plasmodium
vivax et Plasmodium ovale ne soient pas observées dans les cas de P.falciparum.

Figure 1 :Cycle pré-érythrocytaire de plasmodium.chez l’homme (source :CDC)

4
Libérés dans le sang, les mérozoïtes envahissent des globules rouges et le cycle de
réplication érythrocytaire peut ainsi commencer (figure 1). C’est un processus cyclique, allant
de l’invasion d’un globule rouge à son éclatement, permettant ainsi la libération d’une
trentaine de nouveaux mérozoïtes qui pourront coloniser d’autres globules rouges. Pendant ce
cycle qui dure 48h pour P.falciparum, le parasite initialement présent sous la forme d’un
mérozoïte libre passe après invasion par différentes phases : anneau, trophozoïte, schizonte et
rosace. La rosace est le stade de maturation ultime qui correspond à un schizonte sur le point
d’éclater pour libérer de nouveaux mérozoïtes. L’éclatement des globules rouges, provoquant
l’anémie est à l’origine des nombreux symptômes cliniques du paludisme. Pour alimenter le
cycle de l’hôte vecteur, certains anneaux vont se différencier en gamétocytes mâles et
femelles. Ces formes non pathogènes pour l’homme circuleront dans le sang jusqu’à plusieurs
semaines après la fin de l’infection. Ces gamétocytes ingérés par un vecteur lors d’un repas
sanguin, pourront poursuivre leur développement chez l’anophèle vecteur et favoriser ainsi la
propagation de la maladie.

Figure 2 :Cycle érythrocytaire de plasmodium chez l’homme. (source :CDC)

3.2. Cycle sexué chez le moustique : sporogonie

Un repas sanguin sur un hôte humain infecté est nécessaire à l’anophèle femelle pour
ingérer le parasite sous forme de gamétocytes mâles et femelles et le cycle sexué de

5
reproduction du parasite peut commencer. Les gamétocytes parviennent dans l’estomac du
moustique et se transforment en gamètes. Le gamétocyte mâle subit un processus d’ex-
flagellation, générant ainsi huit gamètes mâles haploïdes. La fécondation d’un gamète femelle
produit un zygote qui se transforme en ookinète diploïde. Ce dernier traverse activement la
paroi stomacale du moustique et forme à la surface externe de cette paroi, un oocyste. Cet
oocyste, après maturation se rompt et libère plusieurs milliers de sporozoïtes qui gagnent
préférentiellement les glandes salivaires du moustique d’où ils pourront être injectés avec la
salive lors d’une piqûre. Chez le moustique, l’ensemble de ce cycle se déroule entre 10 et 40
jours, suivant la température extérieure et les espèces en cause.

Figure 3 :Cycle sexuée chez l’anopheles (sporogonie). (source :CDC)

4. Les vecteurs du paludisme


Les vecteurs du paludisme humain appartiennent tous au genre Anopheles. Les
anophèles appartiennent au phylum des Arthropodes, à la classe des Insectes, à l’ordre des
Diptères, au sous-ordre des Nématocères, à la famille des Culicidae à la sous famille des
Anophelinae et au genre Anopheles. Les mâles se nourrissent uniquement de jus sucrés. Bien
que les femelles se nourrissent également de jus sucrés, elles ont besoin de protéines qu’elles
puisent dans le sang des vertébrés, dont l’homme, pour assurer la maturation de leurs œufs.
Ainsi, seules les femelles sont capables de transmettre le paludisme.

6
En Afrique tropicale les vecteurs majeurs du paludisme sont :

Anopheles gambiae s.l., un complexe d’espèces jumelles, qui comprend en son sein
trois des majeurs vecteurs du paludisme présents en Afrique subsaharienne ; Anopheles
arabiensis, Anopheles melas, Anopheles gambiae s.s. A ce complexe s’ajoutent, les groupes
Anopheles funestus, Anopheles moucheti et Anopheles nili. La plupart des anophèles ne
s’éloignent guère de leur lieu d’émergence; ils sont parfois entraînés sur de grande distance
par les avions, les automobiles et à un moindre degré par les vents car les anophèles sont très
fragiles.

La transmission anophélienne du paludisme est la principale voie de contamination


mais d’autres modes de contamination (congénitale, parentérale, transfusionnelle, …) ont
également été décrits dans la transmission des Plasmodium à l’homme.

5. Répartition mondiale du paludisme

Le paludisme concerne actuellement les deux tiers de la population mondiale. C’est


une maladie essentiellement à transmission vectorielle, la présence d’anophèles ainsi que celle
d’une eau stagnante pour le développement des stades larvaires des vecteurs est primordiale.
Il faut aussi des conditions climatiques favorables à la sporogonie et une population humaine
réceptive à l’infestation plasmodiale. En zone tempérée, le paludisme a été éliminé mais des
cas d’importation (paludisme du voyageur) ou survenant aux alentours des aéroports
internationaux ont été rapportés. La zone tropicale constitue donc la zone la plus favorable au
développement du parasite (Figure 4).

7
Figure 4 : Répartition du paludisme dans le monde
La répartition géographique des espèces plasmodiales parasites de l’homme peut se
résumer ainsi:

P. falciparum est largement distribué dans toute la ceinture tropicale du


globe : Amérique, Afrique et Asie du sud-est.

P.vivax La majorité des infections à P. vivax se situe hors d’Afrique, plus


particulièrement en Asie du sud est et dans le pacifique où elle est à l’origine de 49%
des cas de paludisme.

P. ovale est essentiellement trouvé en Afrique tropicale mais il est aussi


signalé en Asie du sud-est (Vietnam).

P. malariae peut se développer sous les tropiques comme en zone tempérée


mais aujourd'hui sa distribution est sporadique et surtout tropicale.

P. knowlesi n’a, pour l’instant, identifié chez l’homme que dans le sud-est
asiatique.

6. Facteurs favorisant la transmission


La température, l’eau, l’humidité de l’air et les phénomènes anthropiques constituent
des facteurs favorisant la transmission anophélienne.

8
La température : le cycle sporogonique des Plasmodium nécessite une température
optimale qui se situe autour de 27 °C.

L’eau et l’humidité : les eaux stagnantes constituent des gîtes larvaires potentiels et
l’humidité relative influe sur la longévité du vecteur qui diminue quand elle baisse.

Les facteurs anthropiques : Les modifications du réseau hydrographique (barrage et


irrigation) entraînent la prolifération des vecteurs. Le développement des transports entraîne
une dissémination des vecteurs.

7. Symptomatologie du paludisme
- Accès palustre simple

Les accès de primo- invasion ils correspondent aux premiers cycles de développement
endo-érythrocytaire du parasite. Une hépatomégalie peut parfois être retrouvée associée ou
non à une oligurie (une raréfacation de volume des urines chez l’individu).

La phase d'état succède rapidement à la précédente et donne lieu à une


symptomatologie dont la périodicité est évocatrice. Il s'agit d'un accès fébrile, précédé de
prodromes évoquant un épisode grippal, qui se caractérise par la succession de trois stades
(frissons, chaleur, sueur).Cette description "classique" n'est en réalité que rarement retrouvée,
la symptomatologie étant le plus souvent atypique.

- Accès palustre compliqué : neuropaludisme ou accès pernicieux :

Il est toujours dû à P. falciparum. Il s’agit de troubles de conscience aboutissant à un


coma qui, s’il évolue favorablement peut ne pas laisser de séquelles. Son évolution est fatale
en absence de traitement.

L'accès palustre débute soit progressivement, soit brutalement et il se manifeste par


des troubles de conscience (de l'obnubilation au coma), des convulsions, des troubles du tonus
(hypotonie évoluant vers une rigidité de décérébration), une abolition des réflexes ostéo-
tendineux.

Des manifestations viscérales et systémiques sont associées avec une fréquence


variable, essentiellement une hypoglycémie (facteur aggravant), une anémie, un œdème
pulmonaire.

9
7.1. Paludis me viscéral évolutif
L'apparition de la chloroquino-résistance, l'inobservance fréquente de la prophylaxie et
l'automédication en zone d'endémie sont responsables de l'apparition du paludisme viscéral
évolutif. Les signes cliniques sont généralement frustres et la gravité tient au retard
diagnostique. Les symptômes sont limités à une anémie, une asthénie et une splénomégalie
inexpliquées. Pour les cas où le diagnostic est rapide, le traitement permet une sédation des
symptômes et une normalisation des paramètres biologiques sans séquelles. Rarement, le
paludisme viscéral évolutif peut être responsable d'une situation clinique plus précaire où la
notion de terrain préalablement débilité revêt une importance toute particulière.

7.2. Accès de reviviscence


Les rechutes sont favorisées par une altération de l’organisme, une agression
extérieure, une splénectomie. P. falciparum ne donne pas de formes reviviscentes. La
symptomatologie est identique à celle du paludisme de primo- invasion et variable selon les
espèces plasmodiales.

8. Diagnostic du paludisme
Le diagnostic du paludisme est l’un des piliers de la lutte contre la maladie, qu’il
s’agisse d’un indicateur pour l’organisation des actions de lutte, ou d’un diagnostic individuel
dans une structure de santé pour identifier et soigner la maladie. Différentes approches de
diagnostic peuvent être adoptées : soit on se contente d’évaluer les symptômes cliniques de
l’individu, soit on recherche la présence du parasite. Chacune de ces approches de diagnostic
présente des avantages et des inconvénients mais actuellement, le diagnostic biologique avec
le Test de Diagnostic Rapide (TDR) ou avec la microscopie est recommandé par l’OMS pour
le traitement avec les combinaisons thérapeutiques à base d’artémisinine (CTA).

8.1. Diagnostic clinique


Le diagnostic clinique constitue la méthode la plus rapide et la plus simple, puisqu’il
s’agit d’identifier des symptômes tels que la fièvre, un élargisseme nt de la rate, des céphalées,
des frissons, des sueurs et des douleurs musculaires. Il est le plus souvent utilisé dans des
structures de santé des pays endémiques où la transmission est élevée et où il y a un manque
de moyens techniques, de personnel qualifié et d’équipements pour les examens de
laboratoire. Or le diagnostic présomptif conduit souvent à une confusion entre le paludisme et
d’autres maladies transmissibles telles que la grippe, la dengue et la fièvre typhoïde. (Siala et
al., 2010) Même en respectant des algorithmes cliniques précis, cette approche reste peu
sensible et peu spécifique. (Chandramohan et al., 2002). Dans les régions à forte transmission,

10
il en résulte souvent une consommation excessive d’antipaludiques et donc une mise sous
pression médicamenteuse importante des parasites.

8.2. Diagnostic biologique


Les techniques de diagnostic actuellement utilisées comprennent la mise en évidence
de la présence de parasite de manière directe (détection du parasite, de ses protéines ou de son
ADN dans le sang) ou de manière indirecte par le biais de la réponse immunitaire (recherche
d’anticorps dirigés contre le parasite dans le sérum).

8.2.1. Diagnostic direct


Le diagnostic direct, également appelé diagnostic parasitologique, a l’avantage
indéniable de mettre en évidence la présence du parasite dans le sang. Il s’agit principalement
de la microscopie, du «quantitative buffy coat» et du diagnostic moléculaire. Les deux
premières méthodes sont plus aisément utilisables dans les structures de santé des pays
endémiques, car elles sont relativement rapides et requièrent peu d’équipements. Le
diagnostic moléculaire est plus lourd, plus coûteux et ne peut être réalisé que dans un
laboratoire suffisamment équipé.

Les techniques microscopiques conventionnelles, frottis mince, goutte épaisse


demeurent la référence, elles nécessitent une méthodologie simple, mais précise et rigoureuse
et un long apprentissage.

11
- Microscopie
La goutte épaisse

Elle est la technique de référence. Sa réalisation consiste à prélever par piqûre au doigt
à l’aide d’un vaccinostyle sur une lame porte-objet, une goutte de sang périphérique et à
défibriner immédiatement par un mouvement en spirale à l’aide d’un coin d’une autre lame.
Le mouvement aura aussi pour effet d’étaler le sang sur une surface d’environ un centimètre
de diamètre. C’est une technique de concentration des parasites.

Le prélèvement est séché puis coloré, sans fixation préalable, à l’aide d’une solution
de Giemsa diluée à 10% pendant 20mn, qui aura une double action de déshémoglobinisation
et de coloration. Après coloration, seule resteront sur la lame les leucocytes et les parasites
éventuels. L’examen se fait au microscope optique, à l’objectif 100X en utilisant de l’huile à
immersion. La numération se fait en comptant les parasites rapportés au nombre de
leucocytes.

Figure 5 :Goutte épaissse

Le frottis sanguin

C’est l’étalement mince d’une goutte de sang prélevée au doigt sur une lame de verre.
L’examen se fait après fixation à l’alcool et coloration au Giemsa. I l permet un diagnostic
d’espèce plus précis mais ne permet pas de dépister des parasitémies faibles ( Brenier-Pinchart
et al., 2002).

Figure 6 :Frottis Sanguin

12
- Le QBC (Quantitative Buffy Coat)
Cette méthode consiste à rechercher à l’aide d’un microscope à fluorescence les
parasites dans un prélèvement de sang contenu dans un tube capillaire et coloré à l’acridine
orange (AO) qui est le marqueur fluorescent. Cette technique a une sensibilité élevée mais ne
permet pas une identification précise des espèces plasmodiales ni une numération parasitaire
(Moody, 2002). Sa réalisation est simple et rapide mais nécessite un microscope à
fluorescence qui est onéreux.

- Diagnostic par PCR (Polymérase Chain Réaction)


C’est un processus d’amplification de l’ADN parasitaire utilisant des stades de
dénaturation et d’amplification du matériel génétique. Son coût élevé limite sa diffusion.

Cette technique d’amplification enzymatique in vitro a été décrite en 1985 par Kary
Mullis (Saiki et al., 1988). Différentes techniques d’amplification ont été décrites dont la PCR
classique, PCR de type nichée ou semi - nichée. Elles sont généralement basées sur
l’amplification d’un fragment d’ADN codant pour l’ARN ribosomal 18S (Kimura et al.,
1997).

La PCR nichée, mise au point par G. Snounou et collaborateurs, est aujourd'hui encore
considérée comme la technique de diagnostic moléculaire de référence. Cette technique
permet la distinction entre les différentes espèces plasmodiales (Snounou et al., 1993 et
2002).

Les principaux avantages de l’utilisation de la biologie moléculaire sont : Elle permet


de détecter le parasite chez des patients ayant une faible parasitémie et son identification avec
une spécificité de 100% (Snounou et al., 1993; Kawamoto et al.,1996).

Le principe de la PCR nichée est comme suit :

Une PCR primaire puis secondaire est réalisée avec des amorces spécifiques de
séquences du gène ARNr 18S hautement conservées dans le genre Plasmodium (zones
«blanches » dans le schéma du gène ARNr 18S), permettant ainsi un criblage rapide de tous
les prélèvements. Pour les échantillons positifs, le produit de la PCR primaire est ensuite
utilisé pour quatre réactions secondaires séparées, avec quatre couples d’amorces situées dans
une zone variable du gène (zones « roses » dans le sc héma du gène, notées V1 à V9) et
spécifiques de chacune des quatre espèces P. falciparum (ARNr 18S de type S), P. vivax
(ARNr 18S de type A), P. malariae et P. ovale. Les produits des PCR secondaires sont
analysés par électrophorèse sur gel d’agarose et co loration au BET.

13
Figure 7 : Diagnostic des Plasmodiums par PCR nichée
Malgré ses avantages, la biologie moléculaire ne peut remplacer en pratique les
méthodes de diagnostic de routine du paludisme en raison du temps de réalisation
relativement long, non compatible avec l’urgence du diagnostic du paludisme et le coût élevé
d’une manipulation (Siala et al., 2010).

8.2.2. Diagnostic indirect


Ce sont des méthodes immunologiques. La présence de Plasmodium dans le sang
provoque la formation d’anticorps dirigés contre les antigènes du parasite. On peut ainsi titrer
le complexe antigène anticorps.

Ces différentes techniques sont : l’immunofluorescence indirecte, l’hémagglutination


indirecte, le test ELISA, l’immunochromatographie.

- Immunofluorescence indirecte
C’est la mise en évidence de l’anticorps anti-parasitaire grâce à des immunoglobulines
conjuguées à une substance fluorescente (Anne-Marie et al., 1998).

- Hémagglutination indirecte
Diverses dilutions de sérum étudié sont mises en présence d’hématies jouant le rôle de
particules inertes à la surface desquelles les antigènes sont fixés (Anne-Marie et al., 1998).

- Test ELISA (Enzyme Linked Immuno Sorbent Assay)


Ce test utilise des antiglobulines conjuguées pour mettre en évidence la présence
d’anticorps spécifiques anti-parasitaires (Druilhe et al., 1985).

14
- Les tests de diagnostic rapide (TDR)
Les TDR ou tests immunochromatographiques pour le diagnostic du paludisme sont
de développement plus récent. La première évaluation sur le terrain d’un test rapide, le
Parasight F, date du début des années 1990 (Shiff, 1993). Les tests rapides permettent de
détecter des antigènes parasitaires dans le sang circulant des malades (Moody, 2002, Murray
et al., 2003, Parra et al., 1993) Ils utilisent des bandelettes de nitrocellulose: après
reconnaissance des antigènes par des anticorps monoclonaux marqués, les complexes
antigéniques sont capturés par d'autres anticorps fixés sur une membrane pour former des
bandes visibles à l'œil nu. Les antigènes ciblés sont essentiellement la protéine HRP-2
(histidine-rich protein 2), spécifiquement rencontrée chez P. falciparum, et l'enzyme LDH
(lactate deshydrogenase) présente sous différentes isoformes chez les quatre Plasmodium
humains. (Parra et al., 1993 ; Makler et al.,1998) Enfin, un nouveau test récemment
développé peut spécifiquement détecter P. vivax, mais l’antigène ciblé n’est pas décrit
(Forney et al., 2003). Des problèmes de spécificité ont été rapportés avec la protéine HRP-2 :
des résultats faussement positifs peuvent être produits par des réactions croisées avec le
facteur rhumatoïde, alors que le polymorphisme de la protéine HRP-2 peut être à l’origine de
faux résultats négatifs. (Iqbal et al., 2000, Baker et al., 2005). La chaleur et l’humidité
affectent la stabilité de nombreux tests rapides, ce qui pose un problème pour leur transport,
leur stockage et leur utilisation dans les conditions climatiques sur le terrain. Par ailleurs, les
fabricants de plus en plus nombreux n’assurent pas tous les mêmes standards de fabrication, il
est fréquent d’observer des performances variables d’un lot à l’autre, et il existe
potentiellement des copies illégales de tests rapides sur le marché.

L’OMS veut promouvoir l’utilisation des tests rapides afin de remplacer le fréquent
diagnostic présomptif par un diagnostic parasitologique simple et rapide. Ceci permettrait de
limiter au strict nécessaire la distribution des traitements CTA recommandés par l’OMS, plus
coûteux que les traitements classiques (chloroquine, sulfadoxine-pyriméthamine). Dans ce
contexte, une fiabilité absolue des tests rapides est nécessaire : un diagnostic erroné peut
retarder la prise d’un traitement et donc avoir des conséquences dramatiques pour le malade.
9. Lutte contre le paludisme
La lutte antipaludique a été définie comme l'ensemble des mesures destinées à
supprimer, ou tout au moins à réduire la mortalité et la morbidité dues au paludisme (OMS,
1974). Elle comporte des actions curatives, basées sur la chimiothérapie des malades, et des
actions préventives, basées sur la prophylaxie et/ou sur la lutte ou la protection contre les

15
vecteurs. La place d'une prévention par la vaccination n'est pas actuellement déterminée,
faute de vaccin opérationnel.

La prévention de l’infection est la première ligne de défense et a pour but d'empêcher


la contamination par le parasite :

- La prévention collective : elle est de la responsabilité de la collectivité et consiste à


jouer sur le milieu en le modifiant (exemple : assainissement des marais, lutte contre les
larves),
- La prévention individuelle : Elle consiste à se protéger individuellement des piqûres
de moustiques. Les mesures à appliquer sont entre autres l'utilisation de moustiquaires
imprégnées et de produits répulsifs cutanés.
9.1. Lutte contre le Parasite
Elle repose sur la chimiothérapie des malades et la chimioprophylaxie pour les
groupes à risque (femme enceinte, enfant de moins de 5 ans et les personnes provenant de
zones non impaludées).

9.1.1. Chimiothérapie et Chimioprophylaxie


II existe plusieurs molécules antipaludiques naturelles ou de synthèse qui peuvent être
utilisées soit en prophylaxie, soit en thérapeutique. Les molécules les plus efficaces agissent
lors de la phase d'invasion des globules rouges, laquelle phase est responsable des accès
palustres ressentis. À l'heure actuelle, moins d'une dizaine de ces produits sont disponibles,
témoignant de la difficulté d'une recherche qui s'avère peu productive et du génie évolutif des
plasmodies qui résistent de plus en plus aux médicaments.

Dans cette situation, il convient de bien connaître les quelques produits encore
utilisables afin de tirer le meilleur profit de leur qualité. Il est possible de classer les
antipaludiques en fonction de leur nature chimique (amino-4-quinolé ines, amino- 8-
quinoléines, amino-alcools, sesquiterpènes lactones...), de leur point d'impact sur l'un des
stades du cycle évolutif du parasite (gamétocytocides, schizonticides, sporontocides) et en
fonction de leur origine (naturelle, synthèse). De façon générale, les antipaludiques jusque là
mis à disposition par les firmes pharmaceutiques sont tous des schizonticides sanguins, actifs
sur les formes asexuées du parasite. Néanmoins, certains exercent une action inhibitrice sur
les gamétocytes immatures de P. falciparum (Bryskier & Labro, 1988). Les schizonticides
intra-érythrocytaires peuvent être divisés en trois classes selon leur lieu d'action : les
lysosomotropes, les antimétabolites et les antibiotiques.

16
9.1.2. Traite ment préventif intermittent (TPI) che z la fe mme enceinte
Le TPI chez la femme enceinte consiste à administrer une dose thérapeutique d’un
antipaludique efficace au cours des visites systématiques dans les services de consultation
prénatale en commençant dès l’apparition des mouvements actifs du fœtus. Actuellement, le
médicament utilisé dans la plus grande partie de l’Afrique est la sulfadoxine-pyriméthamine
(SP). Deux doses thérapeutiques de SP sont administrées durant la grossesse : la première est
faite à la seizième semaine d’aménorrhée ; la deuxième se fait au deuxième trimestre entre la
vingt-huitième et la trente-quatrième semaine d’aménorrhée. Une troisième dose à un mois
d’intervalle de la deuxième sera administrée à la femme enceinte séropositive au VIH.

L’administration est faite sous observation directe lors des consultations prénatales par
l’agent de santé. La SP est bien tolérée pendant la grossesse si elle est administrée à partir du
deuxième trimestre. Cependant, elle est contre- indiquée pendant le premier trimestre de la
grossesse. Par ailleurs, compte tenu de sa durée de vie longue, la SP ne doit pas être
administrée plus d’une fois par mois.
10. Diversité parasitaire de P. falciparum : mécanismes et méthode de mise
en évidence
Les études d’épidémiologie moléculaire ainsi que de nombreux travaux de laboratoire
sur P.falciparum ont mis en évidence le polymorphisme parasitaire remarquable de cette
espèce, dont il faut tenir compte dans l’étude des relations hôte/parasite. De nombreux
antigènes parasitaires sont polymorphes. Trois éléments majeurs contribuent à la diversité des
populations parasitaires: à savoir le polymorphisme allélique, la variation antigénique et la
recombinaison sexuée.

10.1. Le polymorphisme allélique


La diversité antigénique de P.falciparum est le reflet d’un polymorphisme allélique
important. Par conséquent, le polymorphisme génétique est défini comme étant la présence
dans une population d’au moins deux variantes alléliques d’un locus explorable par analyse
de l’ADN (Schibler et al., 2000). Les polymorphismes génétiques correspondent à des
variations de séquences nucléotidiques d'un locus donné entre des individus d'une même
espèce. Ces variations constituent la base moléculaire de la diversité phénotypique intra-
spécifique des individus.

Plusieurs études et techniques ont permis de mettre en évidence le polymorphisme


allélique, que ce soit par RFLP (Restriction Fragment Lengh Polymorphism ou
polymorphisme de la longueur des fragments de restriction) ou par typage génétique d’isolats

17
de zone d’endémie palustre par PCR ainsi que le séquençage de plusieurs allèles de certains
gènes comme MSP-1 et MSP-2.

Le parasite est sous forme haploïde tout au long de son cycle chez l’Homme. Cette
haploïdie permet au parasite une sélection aisée des mutants, une plasticité importante et une
adaptation parasitaire facilitée.

L’analyse des iso-enzymes ainsi que celle des résistances aux antipaludiques ont
permis aux études de polymorphisme de mettre en évidence la grande diversité des
populations de P.falciparum (Kemp et al., 1990).

Le développement des réactifs immunologiques polyclonaux et monoclonaux a permis


de préciser l’étendue de la diversité antigénique de nombreux composants parasitaires
(Mcbride et al.,1982 ; 1985 ; Hommel et al., 1983 ; Marsh & Howard, 1986 ; Forsyth et al.,
1989 ; Southwell et al.,1989 ; Aguiar et al., 1992 ; Iqbad et al., 1993).

Les mérozoïtes, en entrant dans le globule rouge, expriment des antigènes à sa surface
très variables comme PfEMP1. Certaines parties des antigènes variables de la surface du
mérozoÏte (MSP) sont conservées dans la plupart des souches de Plasmodium. Ces peptides
ont été retenus pour préparer un vaccin ayant pour but de bloquer le cycle érythrocytaire le
plus étudié de ces peptides c’est l’MSP1.

MSP-1 (merozoite surface protein 1)

Le mérozoite est la forme invasive de la phase asexuée des espèces de Plasmodium.


Chez P.falciparum, le gène codant pour le mérozoite surface protein number 1 (MSP-1) est
une copie unique située sur le chromosome 9. La MSP-1 est une glycoprotéine de 185 à 205
kDa qui est synthétisée au cours de la schizogonie. Plusieurs fragments de cette protéine ont
été identifiés. Ces fragments seraient probablement issus d’une protéolyse par deux protéases.
Ces enzymes semblent agir sur la protéine avant l’invasion des globules rouges. La
fragmentation conduit à des peptides de 19, 33, 42 et 83 kDa. Le fragment de 19 kDa serait
impliqué dans la reconnaissance des érythrocytes par les mérozoïtes (Perkins & Rocco, 1988)
mais son rôle reste encore à être précisé. Il est ancré à la membrane et constitue l’un des
meilleurs candidats au vaccin.

Le MSP-1 est de nature polymorphe et plusieurs spécificités ont été mis en évidence
au sein d’un même isolat. D’une part, il existe des variations ponctuelles d’acides aminés et
d’autre part, des familles alléliques ont été mises en évidence. En effet, les différentes formes
de l’antigène peuvent être regroupées en trois familles alléliques : K1, MAD20 (Mcbride et

18
al., 1985 ; Tanabe et al.,1987 ; Weber et al., 1986) et RO33 (Certa et al.,1987 ; Kimura et
al.,1990 ; Peterson et al.,1988).

Une des caractéristiques du gène est la présence de répétitions en tandem de certains


nucléotides. Elles sont variables en taille et sont ainsi utilisées pour le typage des souches. Du
bloc 5 au 6, le gène présente un dimorphisme alors que les b locs 1 et 17 sont relativement
conservés. Le bloc 3 a été décrit comme l’un des points de cassure du gène au moment des
croisements entre les chromosomes. Ainsi, le bloc 2 présente un polymorphisme et 3 allotypes
ont pu être identifiés. Ce sont les allèles K-1, MAD20 et RO33. Les allèles K-1 et MAD20
possèdent au niveau des protéines des tripeptides répétitifs alors que RO33 se caractérise par
leur perte. Un nouveau allotype a été identifié qui est un hybride des allotypes MAD20 et
RO33.

Figure 8 : Représentation schématique du gène MSP-1 et familles alléliques.

10.2. La variation antigénique


Le terme de variation antigénique est réservé à la description d'une situation où le
parasite possède une variété de gènes possibles pour une molécule donnée, et est capable
d'exprimer l'un ou l'autre de ces gènes, d'une façon séquentielle ou non séquentielle, et pourra
ainsi changer cette molécule plusieurs fois au cours de son développement chez un même
hôte.

Plusieurs études montrent que les antigènes variants PfEMP1 exposés à la surface des
globules rouges infectés par P. falciparum, appartiennent à une famille de protéines
impliquées dans la cytoadhérence (Leech et al., 1984 ; Magowan et al., 1988).

19
10.3. La recombinaison sexuée
La reproduction sexuée dans le moustique constitue une étape obligatoire du cycle
biologique du parasite et contribue à la diversité génétique des populations de P. falciparum.
La recombinaison sexuée a pu être étudiée grâce au clonage, procédure essentielle en
génétique, aboutissant à l’obtention de lignées parasitaires génétiquement pures que l’on peut
croiser et dont on peut analyser la progéniture après clonage (Zwetyenga, 1998).

20
CHAPITRE II :

VECTEURS ET TRANSMISSION
1. Le vecteur du paludisme
Les moustiques comprennent la plus grande famille de vecteurs d’agents pathogènes.
Ils ont une vie aquatique au stade larvaire puis aérienne au stade adulte. Seuls les moustiques
du genre Anopheles assurent la transmission du paludisme.

Il existe environ 400 espèces d’anophèles, parmi lesquelles seule une cinquantaine
joue actuellement un rôle dans la transmission et environ 20 espèces assurent l’essentiel de la
transmission dans le monde (Pages et al., 2007). Ainsi, la reconnaissance des espèces est
capitale pour mesurer le rôle joué par chacune d’elle dans la transmission. Presque tous les
vecteurs majeurs de Plasmodium appartiennent à des groupes (espèces très proches
morphologiquement mais qui présentent de petites différences à un stade au moins de leur
développement) ou complexes d'espèces (espèces morphologiquement identiques à tous les
stades). A l'intérieur de chaque complexe, certaines espèces sont des vecteurs avec une
anthropophilie marquée et/ou une grande longévité, alors que d'autres espèces ne transmettent
pas de Plasmodium (Carnevale et Robert, 2009).

Les espèces du genre Anopheles font partie de la famille des Culicidae et à l’ordre des
Diptères (Knight et Stone., 1977). Seules les femelles piquent et peuvent transmettre le
paludisme. Elles ont besoin de protéines pour assurer le développement de leurs oeufs; elles
les puisent dans le sang des vertébrés, dont l’Homme. C’est ainsi qu’elles peuvent transmettre
le paludisme (Mouchet et Carnevale, 1991). Les mâles se nourrissent exclusivement du nectar
des fleurs.

1.1. Biologie des anophèles


Les anophèles passent par trois stades aquatiques (œuf, larve, nymphe) avant d’arriver
au stade adulte ou imago, qui mène une vie aérienne (Mouchet et Carnevale, 1991).

1.1.1. Les stades aquatiques


La femelle dépose isolément à la surface de l’eau les œufs munis de flotteurs latéraux.
L’éclosion a lieu au bout de 24 à 48 heures en fonction de la température. Chaque œuf donne
naissance à une larve recouverte d’un tégument rigide et inextensible, l’exosquelette. Au
cours de chaque mue qu’elle subira (quatre au total), elle se débarrassera de sa cuticule et en
sécrètera une nouvelle, plus ample, qui lui permettra d’augmenter de volume et de taille. La
larve se tient parallèle à la surface de l’eau pour respirer l’air atmosphérique.

21
Au terme de la quatrième mue, la cuticule de la larve se fend dorsalement et laisse
échapper une nymphe qui sera le siège de profonds remaniements morphologiques (Carnevale
et Robert, 2009). A la fin de ce stade nymphal, qui dure en général moins de 48 heures,
l’adulte émerge et gagne le milieu aérien.

Figure 9: Cycle biologique des anophèles. Source (Caroline FOUET, 2010)


En zones tropicales, la phase aquatique des anophèles dure de une à trois semaines. En
zone tempérée, le stade larvaire peut durer plusieurs semaines ou mois, car certaines espèces
peuvent hiberner (Carnevale et Robert, 2009).

La connaissance des gîtes larvaires permet de comprendre l'influence des conditions


environnementales sur la transmission du paludisme.

Il faut signaler qu'une même espèce peut coloniser d ifférents types de biotopes
(exemple : Anopheles gambiae s.l peut se retrouver dans des petites flaques d'eau temporaire
mais aussi dans des grands casiers à riz) et qu'un même biotope peut abriter plusieurs espèces
anophéliennes (Carnevale et Robert, 2009).

1.2.1. Le stade adulte ou imago


L’anophèle femelle ne s’accouple généralement qu’une seule fois dans sa vie; elle
conserve les spermatozoïdes dans un réceptacle appelé spermathèque. Lors de l’émergence,
son ovaire comporte des ovocytes peu développés qui exigent, pour leur maturation, des
protéines provenant d’un repas de sang prélevé sur un hôte vertébré. A maturité, les ovocytes
descendent dans l’oviducte où ils sont fécondés par les spermatozoïdes relargués. La femelle

22
doit alors trouver une collection d’eau pour y pondre les œufs ainsi formés. Après la ponte,
elle part à la recherche d’un nouveau repas de sang.

Le cycle biologique qui débute par la piqûre d’un vertébré, se poursuit par la digestion
du sang, puis par la ponte et la recherche d’un no uvel hôte, s’appelle cycle gonotrophique.
Dans les régions tropicales, il dure de 48 à 72 heures selon les espèces et la température. Dans
les zones tempérées et froides, il peut durer plus d’une semaine (Mouchet et al.,2004).

1.2. Comportement des anophèles adultes


A l’exception du sous- genre Kerteszia d’Amérique du Sud à activité diurne, les
anophèles ont une activité nocturne (Mouchet et al., 2004) et plus précisément entre le
coucher et le lever du soleil (Carnevale et Robert, 2009).

Certaines femelles préfèrent se nourrir à l’intérieur des habitations (endophagie) tandis


que d’autres piquent à l’extérieur (exophagie). Par ailleurs, après la prise du repas de sang,
elles se reposent soit à l’intérieur (endophilie) soit à l’extérieur (exophilie). Ces
caractéristiques varient d’une espèce à l’autre, mais également au sein d’une même espèce
selon la localisation géographique (Pages et al., 2007). De plus, plus le moustique est
anthropophile, plus sa capacité vectorielle augmente, alors que plus il a une tendance à la
zoophilie, plus son potentiel à transmettre des plasmodies humaines est réduit (Carnevale et
Robert, 2009). Différents facteurs conditionnent le niveau du contact homme – vecteur et les
différents faciès épidémiologiques du paludisme.

Ces facteurs sont :


- La diversité des comportements entre espèces et au sein d’une même
espèce d’anophèles,
- Les conditions climatiques et géographiques,
- L’action de l’homme sur le milieu.

Les anophèles sont des moustiques souvent ruraux et se rencontrent en théorie moins
en ville. Mais l’adaptation de certaines espèces au milieu urbain et la pratique du maraîchage
appliquée dans ou à la périphérie des grandes villes sont responsables de la persistance de
populations anophéliennes en milieu urbain. En dehors de l’Asie du sud-est, le paludisme
urbain est une réalité. Le risque de transmission du paludisme est hétérogène et varie au cours
du temps. Ce risque a une grande variation au sein d’un même pays, d’une même zone voire à
seulement quelques kilomètres de distance. Selon les saisons mais aussi selon les années, en
fonction du niveau des événements climatiques, la transmission palustre varie au cours du
temps (Pages et al., 2007)

23
1.3. Les principaux anophèles vecteurs du paludisme en Afrique
La transmission du paludisme est assurée par différentes espèces anophéliennes selon
les régions. En Afrique Sub-saharienne la population vectrice est dominée par le complexe
An. gambiae et le groupe An. funestus qui interviennent pour 90 % de la transmission
(Carnevale et Robert, 2009).

1.3.1. Le complexe Anopheles gambiae


Anopheles gambiae (figure 10) est un complexe d’espèces jumelles qui compte
désormais neuf espèces, après l’élévation récente au rang d’espèce des formes moléculaires M
et S (Coetzee et al., 2013): An. amharicus Hunt, Coetzee & Wilkerson, An. arabiensis Patton,
An. gambiae Giles, An. bwambae White, An. coluzzii Coetzee & Wilkerson, An. comorensis
Brunhes, Le Goff & Geoffroy, An. melas Theobald, An. merus Dönitz et An. quadriannulatus
Theobald, Coetzee & Fettene.

An. gambiae, An. arabiensis et An. coluzzii sont des vecteurs majeurs de Plasmodium
en Afrique, An. melas, An. merus, An. bwambae, An. quadriannulatus et An. amharicus, ont
un rôle faible ou nul dans l’épidémiologie de la transmission du paludisme.

Leur distribution est localisée. En revanche An. gambiae, An. coluzzii et An. arabiensis
ont une aire de répartition extrêmement vaste sur tout le continent Africain, An. gambiae étant
plutôt adapté aux zones de forêt et de savane humide alors qu'An. arabiensis peuple les
environnements plus secs jusqu'en bordure du Sahara (Coetzee et al., 2000). La zone de
recouvrement de ces deux espèces est cependant très importante et on les trouve souvent en
sympatrie. De plus, elles apparaissent extrêmement bien adaptées à l'homme et son
environnement, d'une part en termes de préférences trophiques, puisqu'elles présentent toutes
les deux un très fort taux d'anthropophilie, sauf si l’abondance du bétail (bœufs surtout) à
proximité des habitations favorise la zoophilie (Mouchet et Gariou, 1957; Robert et
Carnevale, 1984).

24
Figure 10: Anopheles gambiae s.l.

Figure 11 : Distribution des espèces du complexe Anopheles gambiae (source :


Carnevale et Robert, 2009).
D’autre part, c'est auprès de l'homme qu'elles trouvent les gîtes larvaires (Gillies & De
Meillon, 1968 ; Coluzzi, 2002) qui sont des collections d’eau stagnantes, temporaires, peu
profondes, ensoleillées et faiblement chargées en matières organiques.

25
1.3.2. Le groupe Funestus
Depuis les années 1930 on sait que le groupe Funestus est composé de plusieurs
espèces proches qui ne peuvent être différenciées que par de très discrets caractères sur les
larves ou sur les adultes. Le développement pré- imaginal est relativement long (20 à 30 jours)
et se fait dans des gîtes d’eau profonde et claire, ombragés à caractère plus ou moins
permanent avec une végétation émergente ou flottante, à faible salinité et peu riche en
matières organiques.

Ce sont généralement les marécages herbeux, les rizières enherbées, les bords des lacs,
des ruisseaux et des rivières (Hamon et al., 1956) et exceptionnellement dans les réserves
d’eau à usage domestique. La densité de la population imaginale varie avec la pluviosité, avec
un certain retard par rapport à An. gambiae s.l. Ce retard est dû à deux facteurs : d’une part, la
création des gîtes d’eaux profondes et d’autre part le développement pré-imaginal
relativement long (Gillies & De Meillon, 1968,). Dans le sahel, il a considérablement
régressé, de plus de 100 km vers le sud, au Sénégal et au Niger (Faye et al., 1995a). Il faut
cependant mentionner la réapparition de An. funestus dans la vallée du fleuve Sénégal, après
une absence de plusieurs décennies (Konaté et al.,2001).

Tout comme An. gambiae s.l., An. funestus préfère piquer l’homme mais on observe
parfois une déviation trophique en faveur du bétail, lorsque celui- ci est accessible en quantité
(Robert & Carnevale, 1984)

Le Groupe Funestus est très répandu dans toute l’Afrique subsaharienne et il est
considéré comme le second vecteur majeur de Plasmodium humain après les membres du
complexe Gambiae (Gillies et De Meillon, 1968; Gillies et Coetzee, 1987). Ce groupe est
composé de plusieurs espèces. Il s’agit de An. funestus et ses sous espèces, An. confusus, An.
leesoni, An. rivulorum et An. brucei. Parmi ce groupe seul An. funestus est considéré comme
un bon vecteur du paludisme. Dans les zones de coexistence avec An. gambiae s.l,
l’apparition tardive d’An. funestus lui permet d’assurer la continuité de la transmission
(Hamon et Coz, 1966).

1.3.3. Le groupe Nili


Anopheles nili est largement répandu en Afrique tropicale (Fontenille et al., 2003) et
apparaît comme un vecteur majeur de Plasmodium dans certaines zones rurales en Afrique.
Les larves d’An. nili s.l. sont typiques des végétations bordant les rives des rivières et fleuves.
Dans ce groupe, on distingue : An. nili s.s., An. somalicus, An. carnevalei et An. ovengensis.
Le groupe An. nili. pique volontiers l’homme, c’est un vecteur majeur de Plasmodium dans

26
les savanes humides et les zones rurales forestières (Carnevale, 1974;Carnevale et al., 1992;
Dia et al., 2003) .

1.3.4. Le complexe Moucheti


An. moucheti s.l. est un vecteur important du paludisme dans les localités situées le
long des grands cours d’eau en Afrique équatoriale (Gillies et De Meillon, 1968). Les études
effectuées dans le groupe An. moucheti ont permis d’identifier 3 formes morphologiques : An.
moucheti moucheti, An. moucheti nigeriensis et An. moucheti bervoetsi décrit pour la
première fois en République Démocratique du Congo.
2. La lutte anti vectorielle
La lutte anti vectorielle vise à supprimer ou limiter le contact homme- vecteur pour
prévenir l’infection par des plasmodiums. Elle est complémentaire de la lutte contre le
parasite lui même par la chimioprophylaxie, les traitements préventifs intermittents ou les
traitements curatifs. Aujourd’hui l’élimination des populations de vecteurs n’est pas la finalité
de la lutte anti vectorielle. Son objectif est de diminuer le poids du paludisme.

Les résultats des campagnes de lutte anti vectorielle doivent être évalués sur leur
impact en santé publique. Une évaluation entomologique est cependant indispensable pour
vérifier et surveiller l’efficacité des interventions anti vectorielles.

Les stratégies de lutte contre les vecteurs doivent être établies et adaptées localement.
Leur mise en place dépend non seulement des conditions écologiques et épidémiologiques
mais aussi des capacités socio-économiques de chaque pays et de chaque région.

2.1. La lutte contre les anophèles au stade adulte

2.1.1. Moustiquaires imprégnées d’insecticide (MII)


Les moustiquaires offrent une bonne protection mécanique pour limiter le contact
entre les vecteurs et les humains mais à condition qu’elles soient en bon état et que la taille de
leurs mailles est adaptée (Darriet et al., 2000).

Toutefois, lorsqu’elles ne sont pas imprégnées d’insecticide, elles ont une efficacité
limitée dès qu’elles sont mal bordées, trouées ou plus fréquemment, lorsqu’une partie du
corps touche le voilage permettant ainsi aux moustiques de piquer à travers les mailles.
L’imprégnation des moustiquaires, avec un insecticide de la famille des pyréthrinoïdes,
permet de compenser ces limitations. L’insecticide a plusieurs effets simultanés (Darriet et al.,
1991). A son contact, il repousse les moustiques (effet excito-répulsif), les éloignant ainsi du
dormeur. L’insecticide irrite les moustiques, les empêchant de rester posés sur la moustiquaire

27
à la recherche d’un orifice pour y pénétrer ou d’une partie du corps en contact avec le voilage.
L’insecticide a aussi une action de choc (knock down : KD) qui les tue ou les neutralise
immédiatement avant même qu’ils n’aient pu piquer le dormeur.

Lorsque les moustiques sont restés suffisamment à son contact, l’insecticide peut enfin
les tuer dans un délai plus ou moins long (effet insecticide). Un contact avec des doses non
mortelles d’insecticide contribue à raccourcir la durée de survie des adultes et, ainsi, à
diminuer la transmission en diminuant la probabilité qu’un anophèle infecté par des
plasmodiums devienne potentiellement infectant, avec des sporozoites dans les glandes
salivaires. Quel que soit l’endroit choisi pour dormir (à l’intérieur ou l’extérieur d’une
habitation), l’utilisation d’une MII protège son utilisateur. Le double effet, insecticide et
excito-répulsif, entraîne une diminution du nombre de moustiques dans les chambres où elles
sont installées, et confère donc une protection partielle à l’utilisateur lorsqu’il sort de sa
moustiquaire ou aux personnes dormant sans moustiquaire dans la même pièce. Ces
moustiquaires sont recommandées par l’OMS (http://www.who.int/whopes/en/).

2.1.2. Pulvérisation intra domiciliaire d’insecticide à effet rémanent (PID)


C’est une méthode de lutte anti vectorielle très employée. Il s’agit d’une méthode de
protection communautaire. L’effet principal des insecticides est de tuer les moustiques quand
ils pénètrent dans les maisons et se posent sur les surfaces traitées (moustiques endophages
et/ou endophiles). Les pulvérisations ne sont ni efficaces ni utiles pour lutter contre les
vecteurs qui préfèrent se poser à l’extérieur des habitations (moustiques exophiles), sauf s’ils
sont endophages. La PID dans les habitations est essentiellement protectrice par l’effet
insecticide de masse et l’effet dissuasif. Le choix de l’insecticide et de sa formulation doit
tenir compte de la sensibilité des vecteurs locaux, du support (nature des surfaces traitées) et
de la durée de l’efficacité souhaitée du produit, en particulier par rapport à la durée de la
saison de transmission. Elles ont été utilisées largement lors du programme mondial
d’éradication du paludisme avec un succès indéniable dans les zones de transmission instable
mais une efficacité plus limitée dans les zones à transmission stable avec des populations de
vecteurs en partie exophages. Actuellement, cette méthode connaît un renouveau d’intérêt
(WHO/HTM/MAL/2006).

28
2.2. Lutte contre les anophèles au stade larvaire
Les moyens de lutte contre les larves permettent d’empêcher la prolifération des
moustiques. La lutte contre les larves peut prendre plusieurs formes :

- Eliminer les lieux de ponte (drainage et assèchement des zones marécageuses),

- Les modifier pour que les larves ne puissent plus s’y développer (curage des
canaux pour que l’eau n’y soit pas stagnante),

- Rendre les lieux de ponte inaccessibles aux moustiques adultes (protection ou


couverture étanche des réserves d’eau domestique),

- Introduire dans les lieux de ponte des poissons larvivores ou d’autres


prédateurs,

- Epandre des larvicides (insecticides, préparations bactériennes).


3. Méthodes de mesure de l’efficacité de la lutte anti vectorielle
Les méthodes de lutte anti vectorielle ont plusieurs effets sur les moustiques. Il faut
des moyens qui permettent de mesurer leur efficacité. La plupart des mesures utiles sont de
nature entomologique.

3.1. Effet rémanent


La rémanence de l’effet insecticide est évaluée par un essai biologique, tel le test e n
cône. Il est le seul test qui soit assez simple et rapide pour être utilisé systématiquement sur un
grand nombre de MII ou de surfaces traitées par PID (Miller et al., 1994). Elle constitue la
principale méthode de comparaison entre plusieurs types de traitement insecticide (PID ou
moustiquaires). Cet essai biologique consiste à confiner des moustiques dans un cône fixé sur
une surface traitée par l’insecticide et à mesurer la survie des moustiques. Ce test est effectué
soit avec des moustiques d’élevage dont la sensibilité à l’insecticide est connue, soit avec des
moustiques issus de la zone d’étude. Dans les opérations courantes, les essais biologiques
permettent de contrôler la qualité du traitement et, à des intervalles d’un mois, de contrôler
l’effet rémanent de l’insecticide. Le résultat est mesuré par la proportion des moustiques qui
tombent (morts ou moribonds) après une heure d’exposition à l’insecticide sur la surface
traitée et une observation de 24h après l’exposition (WHO, 2006 ; Njunwa et al., 1991). Il
faut donc les répéter pour obtenir des résultats fiables.

29
3.2. Effet de masse
Lorsque les moyens de lutte anti vectorielle sont utilisés de façon constante dans une
zone assez étendue contre un vecteur anthropophile, les moustiques femelles risquent la mort
chaque fois qu’ils essaient de se gorger à travers une moustiquaire imprégnée ou de se poser
sur un support traité par insecticide. Dans ces cas, la densité de la population de moustiques
locale peut diminuer, tout comme l’âge moyen des femelles (mesuré par leur taux de
parturité) et l’indice sporozoïtique. Cet effet peut être mesuré par des méthodes classiques
utilisées en entomologie.

Ces méthodes sont :

- Captures de nuit sur appât humain, à l’intérieur et à l’extérieur des


habitations,
- Collecte nocturnes de moustiques par pièges lumineux,
- Récoltes de la faune résiduelle matinale.

Les moustiques capturés doivent ensuite être identifiés et les femelles des vecteurs
doivent être disséquées pour l’analyse d’une part des ovaires pour l’estimatio n du taux de
parturité et d’autre part des glandes salivaires pour l’identification microscopique directe des
sporozoites et l’estimation de l’indice sporozoïtique . Les femelles infectées peuvent aussi être
dépistées par la technique ELISA de détection de l’antigène circumsporozoïtique (Burkot et al., 1984
modifié par Wirtz et al., 1987).
4. Resistance des anophèles aux insecticides
Pour pouvoir employer efficacement les insecticides dans la lutte anti vectorielle, il
faut que les populations du vecteur ciblée soit effectivement sensibles à ces produits dans les
conditions d’utilisation sur le terrain. Les essais de laboratoire ont permis d’observer
couramment des résistances aux insecticides dans de nombreuses populations de vecteurs
partout dans le monde. Ces résistances peuvent être dues à la détoxification naturelle des
insecticides par des enzymes ou à une mutation de la cible de l’insecticide.

4.1. Définition
Selon le comité d’experts des insecticides de l’OMS (1957), la résistance aux
insecticides definie par l’apparition, chez une souche d’insectes, de la faculté de tolérer des
doses de substances toxiques qui exerceraient un effet létal sur la majorité d’individus
composant une population normale de la même espèce. Alors que l’expression résistance due

30
au changement de comportement désigne l’apparition d’une aptitude de l’insecte à éviter une
dose qui serait létale pour lui.

4.2 Mécanismes de résistance


Les mécanismes de résistance des insectes à l’action des insecticides peuvent être
regroupés en trois catégories.

4.2.1. La résistance métabolique


C’est le mécanisme le plus commun chez les insectes en général. Ce mécanisme
repose sur les systèmes enzymatiques que tous les insectes possèdent pour assurer la
détoxication naturelle des éléments étrangers. Trois catégories d’enzymes interviennent dans
la résistance métabolique les estérases, les mono oxygénases à cytochromes P450 et les
glutathion-S-transférases.

La surproduction des ces enzymes chez les moustiques résistants par rapport aux
moustiques sensibles leur permettent de métaboliser ou de dégrader les molécules
d’insecticide avant qu’elles n’exercent un effet toxique sur leur cible. Cette surproduction
peut être due à une modification d’un gène régulateur contrôlant le degré d’expression de
l’enzyme (Rooker et al., 1996) ou à une augmentation du nombre de copies des gènes qui
codent ces enzymes (Djogbénou, 2009). Ce type de mécanisme de résistance communément
trouvé chez les insectes est du à la modification de la cible de l’insecticide. Les principales
cibles des insecticides sont des récepteurs ou des enzymes du système nerveux :

- l’acétylcholinestérase (AChE),

- le canal sodium voltage dépendant (CNaVdp) et,

- le récepteur de l’acide gamma-aminobutyrique (GABA).

Les mutations au niveau de la cible constituent des mécanismes de résistance très


efficaces qui s’accompagnent de phénomènes de résistance croisée pour tous les insecticides
agissant sur la même cible.

La cible des organophosphorés et des carbamates est l’acétylcholinestérase (AChE).


L’acétylcholinestérase est une enzyme située dans les synapses des cellules nerveuses. Les
insecticides des familles des carbamates et des organophosphorés agissent sur
l’acétylcholinestérase en l’inhibant, ce qui entraîne la mort de l’insecte par accumulation de
l’acétylcholine (substrat de l’enzyme) dans la fente synaptique.

31
Plusieurs formes mutées de cette enzyme ont présenté une affinité diminuée pour ces
insecticides. La mutation retrouvée chez An. gambiae, principal vecteur du paludisme en
Afrique intertropicale, résulte d’une substitution de la glycine en position 119 par une sérine
conférant une résistance croisée aux carbamates et aux organophosphorés (Weill et al., 2004).

Les canaux Sodium Voltage-dépendants (CNaVdp) interviennent dans la transmission


de l’influx nerveux le long des axones. Les pyréthrinoïdes et le DDT agissent au niveau de
ces canaux et perturbent le fonctionnement normal des canaux et la transmission de l’influx le
long des fibres nerveuses. Les pyréthrinoïdes et le DDT provoquent chez les insectes un effet
“Knock Down”.

En Afrique de l’Ouest, une mutation ponctuelle (mutation kdr Leu-Phe) remplaçant


une leucine par une phénylalanine au niveau du sixième segment du domaine II du gène
codant le CNaVdp confère la résistance aux pyréthrinoïdes et au DDT (Dong ,1997). En
Afrique de l’Est, c’est plutôt une mutation ponctuelle (mutation kdr Leu-Ser) remplaçant la
leucine par une serine à la même position qui confère la résistance aux pyréthrinoïdes
(Verhaeghen et al., 2006).

Les organochlorés du groupe des cyclodiènes ont leur site d’action au niveau des
récepteurs de l’acide gamma-aminobutyrique (GABA) du GABA du système nerveux central.
Une seule mutation ponctuelle sur les récepteurs GABA est responsable de la résistance aux
cyclodiènes chez plusieurs espèces d’insectes. Cette mutation entraîne une modification
structurale du site d’action réduisant ainsi la fixation des cyclodiènes (Djogbénou, 2009).

4.2.2. La résistance comporteme ntale


La résistance comportementale, est moins bien connue que les autres mécanismes de
résistance. Ce mode de résistance repose sur un changement du comportement de l’insecte
résistant qui lui permet d’éviter le contact avec la molécule d’insecticide ou de limiter la durée
de ce contact (Djogbénou, 2009).
5. Paludisme et facies épidémiologiques en Afrique
5.1. Définition du faciès épidémiologique
Le concept de faciès épidémiologique (Carnevale et al., 1984) est défini comme un
ensemble de lieux dans lesquels le paludisme présente les mêmes caractéristiques, de
transmission et de stabilité, d'endémicité et de prévalence parasitaire, de développement de
l'immunité et d'incidence clinique. Il traduit ainsi la diversité de la dynamique des relations
milieu/vecteur/parasite/maladie (Mouchet et al., 2004). Initialement appliquée à l'Afrique
occidentale et centrale, la méthode a été étendue au reste de l'Afrique:

32
- Le paludisme stable qui se trouve dans les zones de transmission élevée
(de l'ordre d'une centaine à quelques centaines de piqûres d'anophèles infectés par
personne et par an) et régulière, la morbidité et la mortalité sont concentrées chez les
jeunes enfants,

- Le paludisme instable qui se trouve dans les zones où la transmission


est habituellement moins importante (une à quelques dizaines de piqûres infectées par
personne et par an), mais où peuvent exister de brefs pics de transmission intense, il y
a de grandes variations saisonnières dans l'aspect épidémiologique du paludisme,

La morbidité et la mortalité touchent alors des enfants jeunes et les plus âgés;les
adultes sont plus souvent malades. Dans les conditions où la transmission est très
basse ou interrompue pendant plusieurs années, le paludisme peut se manifester sur le
mode épidémique. La morbidité et la mortalité concernent alors indistinctement toutes
les classes d'âge de la population (Saïssy, 2001).

En Afrique, Mouchet et al., (1993) ont défini six faciès épidémiologiques, qui se
superposent globalement aux grandes régions naturelles existantes dans le continent. Il s’agit
de faciès équatorial, tropical, sahélien, désertique, austral et montagnard (figure12).

Figure 12 : Différents facies épidémiologiques en Afrique.

33
5.2. Les régions naturelles de l'Afrique
L'Afrique présente une juxtaposition de grandes régions naturelles en prenant comme
points de repère les blocs forestiers du Centre et de l'Ouest (figure 13) (Mouchet et al., 1993)

Figure 13 : Distribution de la végétation en Afrique (Source : Mouchet et al., 2004)

En Afrique occidentale, la succession des zones est très nette. En s'écartant de


l'équateur, on observe des forêts et savanes post- forestières à climat tétraorique équatorial
(quatre saisons, deux sèches et deux humides, mais aucun mois n'est réellement sec) puis des
savanes humides et le Sahel à une seule saison pluvieuse estivale. Enfin, les précipitations
s'amenuisent au fur et à mesure que l'on s'approche du désert où la pluviométrie annuelle est
inférieure à 100 mm.

A l'Est du bloc forestier centrafricain, les zones s'orientent d'Ouest en Est, avec des
savanes post-forestières tendant à supplanter la forêt en Ouganda ainsi que des savanes
humides souvent modifiées par l'altitude au Soudan, en Ethiopie, au Kenya, en Ouganda, en
Tanzanie, prolongées par des steppes arborées puis désertiques au Soudan, en Ethiopie, en
Somalie, à Djibouti. Le long de la côte qui borde l'Océan Indien, du Kenya au Mozambique,
la végétation revient à un type forestier très dégradé.

Au sud de la forêt centrafricaine, les homologues des régions soudaniennes et


sahéliennes se situent sur un plateau d'une altitude de 1000 m en moyenne et qui s'étend du
sud du Zaïre jusqu'à l'Afrique du Sud. Une saison hivernale marquée, avec des gelées locales,
s'observe en juillet et août.

34
Les zones de montagne d'Afrique de l'Est, initialement couvertes de forêt d'altitude,
ont été en grande partie défrichées pour l'élevage, la culture des bananes et les plantations de
thé (Mouchet et al., 2004).

5.3. Répartition des facies épidémiologiques en Afrique


On peut répartir les différents faciès épidémiologiques en fonction des modalités de
transmission du paludisme.

La dynamique de la transmission est définie par deux paramètres majeurs :

- L'intensité qu’indique le nombre de piqûres d'anophèles infectés reçues par un sujet


humain pendant un certain laps de temps,

- Le rythme qui dépend généralement du régime des pluies; la régularité de la


transmission dépend de la durée de persistance des gîtes larvaires, c'est-à- dire de la régularité
des pluies et de la nature des sols et des gîtes larvaires. Ainsi, par exemple, dans les ré gions
équatoriales où il pleut pratiquement toute l'année, on peut s'attendre à une présence
permanente des vecteurs et à une transmission continue (Carnevale et Robert, 2009).

5.3.1 Transmission pe rmanente


Ce type de transmission caractérise le faciès équatorial, qui concerne les forêts et
savanes post- forestières d'Afrique centrale et de l'Ouest, où le paludisme est stable. Le
nombre de piqûres d'anophèles infectés peut atteindre 1000 par individu et par an (Carnevale
et Robert, 2009), traduisant une transmission intense, qui baisse en saison sèche mais ne
s'interrompt pas pour autant. L'humidité relative élevée influe positivement sur la longévité
des vecteurs, très anthropophiles. Les gîtes larvaires sont nombreux et toujours présents
(Carnevale et Robert, 2009). Ce type de situation peut être également observé dans certaines
localités riveraines de cours d’eau permanents en zones de savane.

Dans ces zones, une forte immunité de prémunition se développe : elle apparaît vers
l'âge de cinq ans. Avant cinq ans, 30 à 50 % des fièvres sont attribuées au paludisme; les
accès graves concernent surtout cette tranche d'âge (Baudon, 2010).

On trouve comme vecteurs An. gambiae s.s., An. funestus , An. nili et An. moucheti
(Mouchet et al.,2004).

5.3.2 Transmission saisonnière longue


Dans le faciès tropical (savanes humides guinéennes et soudaniennes) la transmission
est régulière saisonnière longue, d'intensité variant d'une année à l'autre mais généralement

35
élevée : 100 à 350 piqûres d'anophèles infectés par individu et par an (Carnevale et Robert,
2009). Le paludisme est stable.

La prémunition est atteinte plus tardivement, vers l'âge de 10 ans. On observe une
morbidité plus importante en saison des pluies. Les formes graves du paludisme sont décrites
jusqu'à un âge plus avancé (Baudon, 2010).

La transmission est assurée par An. gambiae s.s., An. arabiensis et An. funestus. En
persistant plus ou moins longtemps en saison sèche, ce dernier allonge la période de
transmission (Mouchet et al., 1993). Dans certaines régions, An. nili est associé aux autres
vecteurs.

5.3.3 Transmission saisonnière courte


Elle concerne deux faciès à paludisme instable : le faciès sahélien (Sahel ouest-
africain, savanes sèches d'Afrique de l'Est). Dans ce faciès, la transmission est annue lle
épisodique très courte (pluies concentrées sur 2-3 mois), pratiquement interrompue pendant la
longue saison sèche et généralement de faible intensité : 2 à 20 piqûres d'anophèles infectés
par personne et par an (Baudon, 2010).

La prémunition apparaît d'autant plus tard que la période annuelle de transmission est
courte, d'où l'existence de nombreux cas de neuropaludisme chez les adolescents et les adultes
(Baudon, 2010). Il peut y avoir des poussées épidémiques lorsque de fortes pluies succèdent à
des épisodes de sécheresse (Carnevale et Robert, 2009). Au niveau de ce faciès Les vecteurs
sont An. arabiensis, An. gambiae s.s. et An. funestus.

5.3.4 Transmission sporadique


On trouve le faciès désertique (Sahara, désert du Kalahari et dans la Corne de
l'Afrique). Il s'agit d'un paludisme instable à transmission intervenant à la suite de
circonstances particulières dans des zones où il ne sévit habituellement pas ou ne sévit plus
(Carnevale et Robert, 2009).

Prenons l'exemple d'Ouargla, ville du Sahara algérien où les mesures de lutte


antipaludique (le drainage des eaux de palmeraie, l’introduction du poisson Gambusia comme
moyen de lutte biologique, le traitement prophylactique par la primaquine, la lutte anti-
larvaire et aspersion intra-domiciliaire d’insecticide à effe remanent (Hammadi et al., 2009)
s'étaient avérées efficaces, de sorte que l'absence de transmission avait été confirmée dans les
années 80. Des données couvrant la période 1990 à 1999 révélèrent la présence de 21 cas de
paludisme à Plasmodium falciparum, tous importés des zones subsahariennes. Hammadi et

36
al., (2009) les relient à l'ouverture de la route transsaharienne qui a d'une part occasionné des
déplacements importants des populations du Sahel vers le sud de l'Algérie (avec propagation
des vecteurs) et d'autre part donné vie aux oasis enclavées, qui sont autant de gîtes larvaires.
Les populations courent le risque d’apparition des epidemies mortelles à cause de l’absence
de la prémunition.

5.3.5 Zones sans transmission (faciès montagnard)


Il s'agit des zones situées entre 1000 et 2000 m d'altitude.(Mouchet et al.,1993) Les
populations humaines qui vivent dans ce facies courent un risque important à cause de
l'absence d’immunité. Lorsqu'elles se trouvent en contact avec le Plasmodium soit par
mouvements migratoires dans les plaines aménagées en zones hydro-agricoles soit lorsque les
vecteurs arrivent et que leur comportement endophile leur permet de vivre dans les maisons
où la température autorise l'accomplissement du développement sporogo nique du parasite
(Carnevale et Robert, 2009).

Du fait de l'altitude, les plateaux africains du faciès austral connaissent une baisse de
température au cours de la saison sèche. La transmission est complètement interrompue soit
par absence de vecteurs soit par leur incapacité à transmettre Plasmodium falciparum en
dessous d'un seuil de température moyenne de 18-20°C. Les vallées jouent un rôle important
car elles servent alors de refuges hivernaux à la faune anophélienne. Au Zimbabwe, An.
gambiae s.l. et An. funestus disparaissent des hautes terres durant l'hiver mais pullulent dans
les vallées basses d'où ils remontent en altitude pendant l'été (Mouchet et al., 1993).
6. Modifications anthropiques de l'environnement
Au sein des faciès précédemment décrits, les activités de l'homme modifient
l'environnement et, par là même, les conditions de transmission et peuvent déterminer des
faciès secondaires. A ce sujet, Mouchet et Carnevale (1991) attirent l'attention sur quelques
phénomènes.

6.1. La déforestation
En Afrique, elle favorise l'extension des espèces héliophiles du complexe An. gambiae
dans les régions originellement forestières (Mouchet et al., 2004). En Asie du Sud-Est, elle
peut être favorable à la réduction du paludisme transmis par An. dirus, anophèle forestier ;
toutefois, cette diminution doit être tempérée car An. minimus s.l. peut prendre le relais de la
transmission dans ces zones déboisées (Carnevale et Robert, 2009).

37
6.2. La riziculture irriguée
L'accroissement démographique ainsi que les irrégularités de la production agricole
sous pluies incitent le développement d'aménagements hydrauliques, notamment la riziculture
irriguée (Doannio et al., 2002). Les rizières sont un milieu évolutif où se succèdent différents
types de biotopes plus ou moins favorables aux anophèles. Ainsi, aux premières phases de la
culture, elles profitent aux espèces héliophiles. Puis, la montaison des plants de riz
s'accompagnant d'une diminution de l'ensoleillement, les casiers servent de gîtes aux espèces
recherchant l'ombre et la protection de la végétation dressée (Doannio et al., 2002 ; Mouchet
et al., 2004). De façon générale, il résulte de cette pratique une forte augmentation de la
densité anophélienne, s'accompagnant ou non d'une accentuation de la transmission du
paludisme en fonction des conditions entomologiques et épidémiologiques initiales de la zone
concernée (Carnevale et Robert, 2009).

En zones de paludisme stable, les rizières accroissent la surface des gîtes favorables
aux anophèles et, par là même, les densités de piqûres sans que cela ne se traduise
automatiquement par une augmentation particulière de la transmission et de la morbidité
palustre (Carnevale et Robert, 2009 ) comme cela a été observé dans le périmètre rizicole de
la vallée du Kou au Burkina Faso (faciès tropical) Robert et al., 1991 et dans la vallée du
fleuve Sénégal (faciès sahélien) où l'usage généralisé des moustiquaires a réduit le contact des
vecteurs avec les hôtes humains de sorte que ces vecteurs présentent une déviation zoophile
avec prise des repas sanguins sur des hôtes alternatifs, principalement des bœufs (Faye et al.,
1993a & 1995a)). Cependant, le rythme de la transmission peut être influencé par les phases
de la riziculture, en plus des variations saisonnières classiques : à Bouaké (Côte d'Ivoire), un
pic au moment de la maturation et de la récolte du riz a été observé (Dossou-Yovo et al.,
1998).

6.3. L'urbanisation
L'urbanisation entraîne une occupation du sol par des maisons ou des infrastructures et
donc diminue les surfaces disponibles pour les gîtes. De plus, les eaux de surface, souvent
polluées par des effluents domestiques et industriels, peuvent devenir impropres au
développement des anophèles. Le paludisme, ou tout au moins sa transmission, diminue de la
périphérie au centre de la ville. Deux exceptions à cette règle toutefois : pendant la
construction des villes, en Affrique notamment, les fosses d’emprunt d’argile entrainent la
pullulation de vecteur comme An. gambiae s.l, t une augmentation du nombre de cas de

38
paludisme. En Inde, les citernes au-dessus des maisons sont d'excellents gîtes à An. stephensi,
à l'origine d'un paludisme strictement urbain.

39
CHAPITRE III :

SITUATION ACTUELLE DU
PALUDISME EN MAURITANIE
1. Présentation de la Mauritanie

1.1. Présentation géographique et climatique


La Mauritanie s’étend du 5ième au 17ième degré de longitude Ouest et du 15ième au 27ième
degré de latitude Nord avec une superficie de 1.030.700 km² (Figure 14). Elle est limitée à
l’Ouest par l’Océan Atlantique, au Nord par l’Algérie, au Nord-Ouest par le Maroc, à l’Est
par le Mali et au sud par le Mali et le Sénégal. Selon les projections de l'office national de
statistiques basées sur les données du recensement administratif de 2000, sa population
s'élevait en 2013 à 3.461.041 habitants (ONS, 2013).

Sur le plan administratif, le pays est subdivisé en 13 Wilayas dont Nouakchott, la


capitale. Chaque Wilaya constitue une circonscription administrative décentralisée qui est
placée sous l’autorité d’un Wali qui représente le pouvoir exécutif.

La Wilaya est subdivisée en Moughataas placées sous l’autorité administrative du


Hakem. La plus petite unité administrative est la commune. Le nombre de Moughataas est de
53 et celui des communes de 216.

La Mauritanie est caractérisée, en général, par un climat chaud et sec. La saison des
pluies est très hétérogène dans le temps et dans l’espace. Elle s’étend sur une période de
quatre mois, de juin à octobre, selon un gradient nord-sud et ouest-est de quelques millimètres
à 500 mm/an (ONS, 2011).

Le seul cours d’eau permanent est le fleuve Sénégal qui reçoit sur la rive
mauritanienne divers affluents à régime temporaire dont les plus importants sont le Gorgol et
le Karakoro. Dans le reste du pays, les rares pluies alimentent des Oueds temporaires qui
disparaissent par infiltration et évaporation, excepté dans l’extrême sud.

La saison sèche est fraiche d’octobre à mars et chaude de mars à juin (Soule, 2003).
Les moyennes annuelles minimales et maximales des températures varient respectivement de
21,9 à 35,6°C et l’humidité moyenne de 23,2 à 59,2% (ONS, 2006).

La Mauritanie peut être globalement divisée en trois grandes régions naturelles :

‐ La zone sahélienne de la vallée du fleuve Sénégal, zone agricole caractérisée par des
précipitations annuelles qui peuvent atteindre 300 à 500 mm. La construction de plus de 500
petits/micro barrages dans cette zone a contribué à l'extension des activités agricoles, avec un
potentiel de terres cultivables estimé à 135.000 hectares,

40
‐ La zone sahélo-saharienne, située au Sud Est, le long de l’axe Nouakchott Néma,
caractérisée par des précipitations annuelles de 100 à 300 mm. C'est une zone de pâturage où
l'on pratique l'élevage et l’agriculture,

‐ La zone saharienne, immense, située au Nord de la ligne Nouakchott ‐ Néma, où les


précipitations sont irrégulières et varient entre 50 et 100 mm.

Les points d'eau y sont rares, en dehors de quelques oasis où le développement des pal
meraies et du maraîchage saisonnier a favorisé l'établissement de populations autochtones

Figure 14 : Découpage administrative de la Mauritanie

1.2. Les vecteurs du paludisme


Il y a peu de données disponibles et accessibles concernant les vecteurs du
paludismeen Mauritanie. Avant 1962, seules 4 espèces d’anophèles étaient signalées en
Mauritanie. Il s’agit d’An. funestus, An. gambiae s.l., An. pharoensis et An. rufipes (Sautet et
al., 1948). Par la suite, la présence d’An. melas et d’An. dhtali a été signalée par Holstein et
al., (1962). En plus de ces espèces, la présence d’An. rhodesiensis a été signalée (Maffi,
1964). Les espèces, An. coustani, An. ziemmani, An. funestus, An. pretoriensis, An.
squamosus et An. demelioni ont été également signalées (Hamon et al., 1964). Au total, 12
espèces anophéliennes ont été documentées en Mauritanie (Hervy et al., 1998). Signalons que
parmi ces espèces seules An. gambiae et An. funestus sont connues comme des vecteurs
potentiels du paludisme.

41
Des prospections entomologiques effectuées le long d’un transect vallée du fleuve
/plateau du Tagant ont permis de noter des similitudes dans la composition de la faune
anophélienne sur les deux rives du fleuve Sénégal (Molez & Faye, 1996). Cette enquête a
montré la présence saisonnière d’An. rhodesiensis dans le Tagant. Récemment des
prospections entomologiques effectuées au cours des mois d’octobre et de novembre 2003 par
Dia et collaborateurs au niveau de 21 localités dans les régions du Sud-est (Assaba et Hodh El
Gharbi), Sud-ouest (Trarza et Brakna) et du Centre-est (Tagant) de la Mauritanie, ont montré
qu’à l’exception de la localité de Moudjéria au Tagant, où aucun moustique n’a été capturé,
An. gambiae s.l. était non seulement présent dans toutes les autres localités visitées mais aussi
l’espèce la plus fréquemment rencontrée (92%) suivie par les espèces An. pharoensis (5%) et
An. funestus (3%). L'identification moléculaire des espèces du complexe An. gambiae dans le
pays a révélé la prédominance d’An. arabiensis, et la présence de An. gambiae forme
moléculaire M (Mint Lekweiry et al., 2009 ; Dia et al., 2009). Selon l’étude des facies
épidémiologiques du paludisme en Mauritanie réalisé au cours de la saison sèche froide de
2011, l’espèce anophélienne prédominante est Anopheles gambiae s.l. (Rapport enquête faciès
2011).

2. L’épidémiologie du paludisme
Le paludisme à P. falciparum sévit, d’une manière endémique, dans 8 régions sur 13
du pays, essentiellement au Sud et à l’Est. Chaque année, le Ministère de la Santé enregistre
entre 150 000 et 320 000 cas de paludisme présomptif, ce qui en fait la première cause de
morbidité et de mortalité, ainsi que le premier motif de consultation et d’hospitalisation, dans
les régions au Sud et au Sud- Est du pays, et le troisième motif de consultations médicales
dans les formations sanitaires au niveau national, après les infections respiratoires aigues et
les diarrhées ( PNLP, 2009). Durant la saison de transmission, 60 % des hospitalisations sont
dues au paludisme.

42
Figure 15: Evolution du nombre de cas de paludisme de 2003 à 2010. (Source PNLP)

Selon le même rapport officiel, au niveau national, P. falciparum est l’espèce la plus
fréquemment diagnostiquée (80 à 90 %), suivie par P. malariae (environ 10 %), P. vivax (3
%) et P. ovale (0,1 %).

Les premières études épidémiologiques sur le paludisme en Mauritanie ont été


réalisées aux bords du fleuve Sénégal en 1945–1946 (Sautet et al., 1948). Ces auteurs ont
trouvé 180 gouttes épaisses positives sur 307 (59 %), dont 74 % à P. falciparum, 18 % à P.
malariae et 8 % à P. vivax. Des études récentes y ont également signalé des indices
plasmodiques plus faibles (ould Abdallahi et al., 2011). Dans une enquête menée dans toute
l’Afrique Occidentale Française en 1955–1956, le peu de données recueillies (185 gouttes
épaisses réalisées) ont suggéré une faible endémicité du paludisme le long du fleuve Sénégal
(Escudié et Hamon, 1961). Une troisième enquête épidémiologique a été effectuée dans le
pays au Nord (Atar) et au Sud (Kaedi, Kiffa, Kankossa, Aioun, Tamchakett) en 1963 chez
2 723 enfants de moins de 15 ans (Barbié et Timbila, 1964). Sur 193 lames positives (soit 7
%), 96,9 % étaient de P. falciparum, 2,6 % de P. malariae et 0,5 % d’infections mixtes de P.
falciparum et P. malariae (aucun P. vivax diagnostiqué). La prévalence par région était de 0,8
% en zone saharienne (Atar), 3,8 % en zone sahélienne (Kiffa, Aioun, Tamchakett) et 29,6 %
à Kaédi dans la vallée du fleuve Sénégal. En 1984, 1 an après la construction d’un barrage au
niveau de Foum Gleita (un affluent de la rive droite du fleuve Sénégal, non loin de la ville de
Kaédi), malgré cette retenue d’eau sur environ 150 km² approvisionnant la riziculture,
seulement 2 porteurs asymptomatiques de P. falciparum et de P. malariae sur 523 personnes

43
ont été répertoriés en saison sèche (0.38%) et il n’y avait aucun anophèle dans les environs
(Baudon et al., 1986).

En ce qui concerne la prévalence sérologique du paludisme, deux études ont été


publiées jusqu’ici. La première a été menée par Monjour et al., (1984), qui ont trouvé une
prévalence variant entre 8 et 58% chez les populations des régions désertiques et semi
désertiques du pays. Par ailleurs, en 1986, Baudon et collaborateurs ont rapporté des niveaux
d'anticorps très bas avec 73% de la population qui présentent un taux inférieur ou égal à 1/40
et seulement 4% des cas atteint un taux de 1/640.

A Nouakchott, capitale du pays, une étude conduite en 1996 sur 446 patients, a montré
que 77 patients étaient porteurs de parasites ce qui représentait un taux d’infection de 18,5%.
La répartition des cas positifs selon l’espèce plasmodiale montre que 61,85% ont été infectés
par P. falciparum contre 35.5% par P. vivax (Cortes et al., 2003). Cependant, en 2007 une
prédominance de P. vivax a été rapportée par Mint Lekweiry et al., (2009), sur un total de 61
sujets fébriles présentant des formes asexuées de Plasmodium, ces auteurs ont trouvé que
70,5% des infections étaient dues à P. vivax suivi par P. ovale 24,6 % et P. falciparum 1,6%.

Etant donné le caractère saisonnier de la transmission, la prémunition contre la


maladie ne se développe pas. De ce fait, le paludisme non compliqué et le paludisme sévère et
compliqué touchent toutes les tranches d’âge en Mauritanie (Cortes et al., 2003). Faute de
données fiables, la létalité n’est pas connue avec précision (toutefois, estimée à environ 1 à 5
%). Néanmoins, le poids supposé du paludisme dans le pays est tel que l’Etat mauritanien
inscrit la lutte contre le paludisme parmi ses priorités nationales. En effet, la Mauritanie
adopte une politique et stratégie nationale de lutte contre le paludisme depuis 1997. Cette
politique de lutte s’insère dans le cadre du programme « Faire reculer le paludisme » (Roll
back Malaria) depuis 2000.

3. Strates épidémiologiques en Mauritanie


Selon MARA/ARMA et l’OMS-AFRO, la transmission du paludisme est saisonnière
et dure 2 à 3 mois (Juillet–Octobre) au Sud du pays (MARA/ARMA 2001 ; OMS, 2006). Le
paludisme est endémique le long des frontières sénégalo- mauritanienne et mauritano-
malienne. Il existe également une zone de paludisme épidémique au Sud de Nouakchott. Le
pays peut ainsi être divisé en trois strates épidémiologiques (Figure 16) :

La zone saharienne et oasienne au Nord désertique (environ 80 % de la surface du


pays ; précipitations annuelles < 100 mm) où la transmission est rare et est surtout associée

44
aux oasis. Une étude séro-épidémiologique suggère une prévalence entre 8 et 15 % des
antécédents d’une infection à P. falciparum au Nord du pays (Nouahdibou, Akjoujt, Atar,
Ksar-Torchane, Chinguetti, Ouadane) (Monjour et al., 1984) ;

La zone sahélo-saharienne (suite à la sécheresse et en fonction de la progression de la


désertification), au Sud de l’axe est-ouest entre Nouakchott et Néma, principalement au Sud-
Est (précipitations annuelles, 100–300 mm), une zone de pâturage, où le paludisme est
instable (hypo endémique) et la transmission saisonnière peut entraîner des épidémies (en
1992, 1995, 1999 et 2003).

La région zone sahélienne du Sud dans la vallée du fleuve Sénégal (l’unique cours
d’eau permanent du pays ; précipitations annuelles jusqu’à 300–500 mm), une zone agricole,
notamment la riziculture, caractérisée par la présence des barrages, où la transmission est
stable (méso-endémique) mais il existe une différence importante de prévalence entre la
saison des pluies et la saison sèche. C’est dans la zone sahélienne que se concentre la majeure
partie de la population mauritanienne.

Figure 16:Carte de la Mauritanie montrant les trois zones géo-climatiques du pays.

45
4. Prise en charge et stratégies nationales de lutte contre le paludisme
Suite à l’émergence de la résistance à la chloroquine chez P. falciparum en Afrique de
l’Ouest particulièrement dans le bassin du fleuve Sénégal, le gouvernement Mauritanien a
opté, depuis 2006, pour l’utilisation d’un nouveau traitement des cas palustres pour remplacer
la chloroquine. En effet, quelque soit l’espèce plasmodiale en cause, la prise en charge des
cas de paludisme est actuellement assurée par Artésunate-Amodiaquine comme traitement de
premier choix pour le paludisme simple, Artemether- Luméfantrine comme traitement de
deuxième choix du paludisme simple et les sels de quinine comme médicament de troisième
choix (PNLP, 2006).

Les stratégies de lutte contre le paludisme en cours sont focalisées sur la prévention et
la prise en charge appropriée du paludisme, en particulier chez les jeunes enfants de moins de
5 ans et chez les femmes enceintes (PNLP, 2009).

 Les approches de la lutte contre le paludisme développées dans le plan


stratégique national 2011- 2015 sont : la promotion de l’utilisation des moustiquaires
imprégnées d’insecticide à long durée d’action (MILDA) est la principale composante
de la lutte anti vectorielle (LAV) en Mauritanie. La stratégie nationale de LAV prévoit
également la mise en œuvre de la pulvérisation intra domiciliaire d’insecticide à effet
rémanent (PID) et de la lutte anti- larvaire dans des zones du pays où ces mesures sont
appropriées

 la prise en charge précoce et correcte des cas de paludisme avec des CTA.
Pour le traitement des cas de paludisme simple, les CTA recommandées sont
Artésunate/Amodiaquine ou Arthémeter/Luméfantrine. Pour le traitement des cas de
paludisme grave et chez la femme enceinte au cours du premier trimestre de la grossesse,
la quinine (voie parentérale) est recommandée

 Le traitement préventif intermittent chez les femmes enceintes : il consiste à


donner une dose curative de Sulfadoxine-Pyriméthamine (SP), sous observation directe,
au cours du second et troisième trimestre de la grossesse, à toutes les femmes vues en
consultation prénatale (CPN). Une troisième dose est fournie aux femmes enceintes
séropositives du VIH.

De 2006 à avril 2011, la Mauritanie a adhéré aux différentes initiatives et


résolutions internationales adoptées sur le paludisme, en particulier la Résolutions
WHA.52.11 de la 52ème Assemblée mondiale de la Santé et la déclaration sur l’accès
universel du Sommet des Chefs d’Etats et de Gouvernements d’Abuja en 2006.

46
En mai 2011, la Mauritanie a révisé pour la 2 ème fois sa politique nationale de lutte
contre le paludisme sur le paludisme pour prendre en compte les nouvelles recommandations
de l’OMS en rapport avec la confirmation biologique du paludisme et les orientations
stratégiques sur l’élimination du paludisme.
5. Chimiorésistance du paludisme
La Mauritanie enregistre un retard considérable par rapport aux autres pa ys de la sous-
région, comme le Sénégal et le Mali, dans l’évaluation de l’efficacité clinique des
médicaments antipaludiques (aussi pour les données moléculaires sur la chimiorésistance). En
1990, la Mauritanie était le seul pays de l’OCCGE (Organisation de Coopération et de
Coordination pour la lutte contre les Grandes Endémies ; Côte d’Ivoire, Dahomey [Bénin],
Haute-Volta [Burkina Faso], Mali, Mauritanie, Niger, Sénégal, Togo) qui n’a pas encore été
touché par la chloroquino-résistance (Guiguemde et al., 1991).

En 1994, une étude in vivo menée à Kiffa (au Sud du pays) chez 37 patients (dont 6
perdus de vue) avec un suivi de 7 jours montre que 3 patients sur 31 ont toujours une goutte
épaisse positive à J7 et 1 patient est fébrile à J7 (Gasquet et al., 1995). Deux études cliniques
ont été réalisées sur l’efficacité de la chloroquine en 1998 à Aioun et Kobeni (province de
Hodh El- Gharbi), avec des taux d’échec clinique de 36,3 % et 11,6 %, respectivement, qui
sont corrélés à la mutation du gène pfcrt (P. falciparum chloroquine résistance transporter),
marqueur génétique pour la chloroquino-résistance (Jelinek et al., 2002 ; OMS, 2005). La
plupart de ces isolats de P. falciparum ont des codons sauvages sur les gènes dhfr et dhps
(Eberl et al., 2001). Seuls 23 et 29 isolats sur 162, soit 14,2 % et 17,9 %, ont respectivement
des triples mutations sur le gène dhfr et une mutation Gly-437 sur le gène dhps. La moitié des
isolats comportent au moins 2 populations distinctes de parasites (Jordan et al., 2001).

Les trois études citées ci-dessus (Eberl et al., 2001 ; Jordan et al., 2001 ; Jelinek et al.,
2002) ont été réalisées par des chercheurs allemands, financées par le GTZ/Université de
Munich et effectuées sur les mêmes isolats de P. falciparum provenant des patients prélevés
lors d’une épidémie en 1998. L’efficacité clinique d’autres médicaments n’a pas été évaluée
entre 1999 et 2010 (OMS, 2010). De ce fait, la politique nationale d’utilisation des
médicaments antipaludiques en Mauritanie est alignée sur celles du Sénégal et du Mali.
L’évaluation de la situation de la chimiorésistance du paludisme n’est pas inscrite parmi les
besoins du pays pour la lutte contre le paludisme, bien qu’elle soit indispensable pour toute
stratégie de lutte contre le paludisme (PNLP, 2009).

47
6. La diversité génétique du plasmodium
La seule et unique étude sur le polymorphisme allélique des souches de Plasmodium
en Mauritanie, a été réalisée en 1998 par Jordan et al., (2001) sur des isolats de P. falciparum
collecté dans la région du Hodh El Gharbi (Sud-est de la Mauritanie). Des prélèvements de
sang sur papier Wathman ont été recueillis chez des patients fébriles aux centres de santé
d'Aioun et de Kobeni. Les gènes qui codent les protéines de surface de mérozoïtes (MSP1et
MSP2) et GLURP (Glutamate rich protein) ont été génotypés chez les isolats collectés. Avec
le gène GLURP, l’analyse a montré que tous les isolats présentent un génotype unique,
cependant avec MSP1 et MSP2 une différence entre les isolats a été remarquée surtout au
sein de la famille FC27 pour les échantillons de Kobeni, une différence qui révèle le niveau
endémique dans les régions touchées par cette maladie.

48
DEUXIEME PARTIE :

TRAVAUX PERSONNELS
CHAPITRE 4 :

SAISONNALITE DU PALUDISME
1. Introduction
En Mauritanie, la situation réelle du paludisme reste jusqu’ici méconnue même si la
maladie est considérée comme étant le premier motif de consultation et d’hospitalisation après
la diarrhée et les infections des voies respiratoires dans dix des treize régions du pays où il
représente 18% des consultations externes dans les formations sanitaires (PNLP, 2011).

En effet, si dans certaines partie de la zone sahélienne comme celles situées le long de
la vallée du fleuve Sénégal, la situation est similaire à celle de la rive sénégalaise où les
espèces du complexe gambiae sont les principaux responsables d’une transmission
saisonnière courte (Faye et al., 1993a ; 1995a ; Dia et al., 2009), l’existence d’une
transmission ainsi que les vecteurs anophéliens impliqués restent respectivement quasi
incertains et inconnus dans la partie saharienne du pays. Sur le plan parasitologique, le faible
nombre de structures sanitaires mais surtout le manque de personnel qualifié pour un
diagnostic biologique sûre constitue des limites pour une évaluation fiable de la situation de la
maladie dans le pays (Cortes et al., 2003).

Quoiqu’il en soit, il est clair que le paludisme connait une progression marquée en
Mauritanie. En effet, selon les données publiées par l’OMS, le nombre de cas enregistré s qui
n’était que de 26 000 en 1990 sur une population totale de 2 024 000 habitants (soit une
prévalence de 1,3%) a atteint en 2012, environ 200 000 cas cliniques (présomptifs) pour une
population estimée à environ 3 000 000 d’habitants soit une prévalence globale de 6,6%. Le
développement de projets agricoles dans le sud, la revitalisation des oasis du nord et la
résistance médicamenteuse ont été avancés pour expliquer la recrudescence du paludisme
(Cortes et al., 2003). L’augmentation inhabituelle de la pluviométrie, les cas d’inondation
dans le Hohd El Gharbi notamment celle survenue dans la ville de Tintane en 2007, sont
également autant de facteurs responsables de modifications sensibles de l’écosystème
susceptibles d’influer sur la transmission et l’incidence du paludisme au cours de ces
dernières années.

Le présent travail compare les données parasitologiques collectées pendant la saison


des pluies de 2009 et celle de 2010 chez des sujets fébriles en consultation dans des structures
sanitaires de la ville de Nouakchott (zone Saharienne) et de la région du Hodh el Gharbi (zone

49
Sahélienne) afin d’évaluer la transmission du paludisme dans les deux régions et la
saisonnalité de cette transmission.

50
2. Matériels et méthodes
2.1. Zones d’études
L’étude a été effectuée dans la ville de Nouakchott et dans la région du Hohd El
Gharbi (figure 18). La ville de Nouakchott capitale du pays (18°.11'N; 16°.16'W) est située
dans la zone saharienne, en bordure de l’Océan atlantique. Le centre ville de Nouakchott est
situé à une altitude de 7m au dessus du niveau de la mer. Administrativement, Nouakchott est
découpé en neuf Moughata’a (Arrondissements) en l’occurrence Teyarett, Ksar, Sebkha,
Elmina, Dar Naïm, Arafat, Riyadh, Toujounin et Tevragh Zeina.

Figure 17 : Carte de Nouakchott et ses neuf arrondissements. Source :communauté


urbaine de Nouakchott

51
Le climat est de type saharien avec une saison sèche longue relativement froide de
décembre à février et relativement chaude entre mars et juin, et une saison des pluies courte
tiède qui s’étend de juillet à septembre. La pluviométrie moyenne annuelle est de 88 mm avec
un maximum de précipitation en Août. Les températures annuelles moyennes minimales et
maximales sont respectivement de 20,5°C et 33°C.

Selon l’Office National des statistiques, la population de Nouakchott s’élève à 843 511
habitants, soit 25,6 % de la population générale du pays avec un taux de croissance de 3,75%
par an (ONS, 2013). La tranche d’âge de 15 à 44 ans représente 49,7% de la population de
Nouakchott, suivie par celle des enfants de moins de 15 ans avec un pourcentage de 37,1% et
les adultes des plus de 45 ans avec 13,2% (ONS, 2013).

Les infrastructures de santé sont composées de cinq hôpitaux, onze centres de santé,
quarante-deux postes de santé et trois unités de santé de base (PNLP, 2011). La ville de
Nouakchott dispose d’un réseau d’eau potable limité et d’un écoulement faible et discontinu,
ce qui a généré suite à la forte extension spatiale de la ville, des indisponibilités de l’eau dans
de nombreux quartiers de la capitale. Pour faire face à cette situation, des bassins de stockage
seuls où couplés à des bornes fontaines ont été construits un peu partout dans la ville. Il en est
de même pour les habitants branchés au réseau qui ne représentent, par ailleurs, que 21% des
Nouakchottois (Chateau et al., 2007).

Face à l’arrivée irrégulière de l’eau, la plupart des habitations disposent de cuves pour
le stockage d’eau potable. Le réseau d’assainissement est quasi- inexistant. La végétation à
Nouakchott se compose de jardins où on cultive, essentiellement, le palmier-dattier, la
menthe, les légumes, et la luzerne. Une ceinture verte au Nord et au Nord-est de Nouakchott a
été crée récemment par les autorités mauritaniennes pour protéger la ville contre l’avancée du
désert.

Située approximativement entre les 15ème et 17ème parallèle nord et les 9ème et
10ème méridiens ouest, la Wilaya du Hodh-el-Gharbi couvre une superficie d’environ 53 400
km2, soit 5,4% du territoire national. Elle est bordée à l’ouest et au nord par les escarpements
de l’Assaba et du Tagant qui forment ses limites géographiques avec ces deux Wilayas, au
nord-est et à l’est par la Wilaya du Hodh Echargui et au sud par la République du Mali. Elle
est traversée d’Est en Ouest par la « route de l’Espoir » et reliée à Nioro du Sahel au Mali par
une route goudronnée (Figure 18).

52
Figure 18 : Carte administrative du Hodh el Gharbi
Le découpage administratif de la région, s’appuyant sur 27 communes, distingue
quatre moughaatas: Tamchekett et Aïoun couvrent la moitié Nord, tandis que Tintane et
Kobeni se partagent le Sud de la région. La Wilaya est caractérisée par l’absence de toute
influence océanique. Les températures y sont élevées, du fait d’une forte insolation. La
constance des alizés continentaux boréaux chauds et secs induit une forte évaporation d'où un
dessèchement des sols ainsi qu'un flétrissement rapide de la végétation. La moyenne des
températures peut atteindre 36°C durant les mois les plus chauds (mai et juin), et descendre
jusqu’à 15°C en janvier.

Le Hodh el Gharbi reste cependant l’une des régions les plus arrosées du pays avec
une variabilité très prononcée entre le nord désertique (pluviométrie inférieure à 200 mm) et
les zones méridionales (près de 450 mm).

53
2.2. Sites d’étude
Pour la région du Hohd El Gharbi, les mêmes structures sanita ires ont servi de sites
d’étude pendant les deux années: il s’agit du Centre Hospitalier d’Aioun, du Centre de Santé
de Kobeni et de celui de Tintane.

- La ville d’Aioun (16°.39'N; 9°.37'W) est la capitale de la région du Hodh Elgharbi.

- La ville de Kobeni (15°.49'N; 9°.24'W) est le chef lieu de l’arrondissement de


Kobeni.

- La ville de Tintane (16°.21'N; 10°.13’W) est une commune du sud-Est de la


Mauritanie située dans la région de Hodh El Gharbi, sur la route de l'Espoir – un important
axe routier Trans mauritanien qui relie la capitale Nouakchott à Néma. Tintane est le chef- lieu
de la moughataa du même nom.

Elle se situe dans une zone aride, classée non endémique en situation normale.

2.3. Patients et collecte des données parasitologiques


En 2009, l’étude a été réalisée entre Septembre et Octobre. En 2010, elle a été
effectuée entre Septembre et Octobre au Hodh El Gharbi et entre Octobre et Novembre à
Nouakchott, ce qui correspond respectivement au milieu et à la fin de la saison des pluies
dans ces deux zones.

Tous les patients venus en consultation pour un syndrome fébrile et ayant consenti ont
été inclus dans l’étude. Pour chaque patient, un prélèvement sanguin sur tube EDTA a été
effectué et un questionnaire a été rempli. A partir de ce prélèvement, un test de diagnostic
rapide (TDR), une goutte épaisse et un frottis sanguin et un prélèvement sur papier buvard ont
été réalisés. Le test de diagnostic rapide (TDR) utilisé a été SD Bioline.

2.4. Réalisation du TDR


Le matériel utilisé comprenant une tablette avec bandelette, un vaccinostyle, une
solution tampon, du couton imbibé par l’alcool et une pipette. Le test est réalisé selon les
étapes suivantes :

 Tout d’abord, on inscrit la date et le nom du patient sur l’étiquette située


sur la tablette,

 On pique le doigt du patient à l’aide d’un vaccinostyle après l’avoir


nettoyé avec un morceau de coton imbibé d’alcool,

 On aspire alors à l’aide d’une pipette le sang libérée par la piqure,

54
 Le sang prélevé est mis dans le premier puits et dans le deuxième puits
on met 3gouttes de la solution tampon et on laisse réagir pendant 30 minutes,

 On passe alors à l’interprétation du résultat : dans le cas où le test est


négatif, on obtient un seul trait correspondant au contrôle. En revanche, l’apparition de
deux traits indique que le test est positif.

2.5. Goutte épaisse (GE)


Une grosse goutte de sang (2 fois le volume utilisé pour un frottis) est défibrée
immédiatement 6 fois par un mouvement en spirale sur une surface de 1 cm de diamètre à
l'aide du coin d'une lame rodée ou d'une pipette.

Les éléments du sang sont concentrés sur une surface beaucoup plus petite que dans le
frottis, ce qui accélère la recherche. La destruction des érythrocytes rendra la reconnaissance
des parasites plus difficile. Le gain de sensibilité par rapport au frottis est d'environ 20 fois.

On peut estimer que l'examen de 100 champs microscopiques correspond à un volume


examiné de 0,25 µl. L'examen de la goutte épaisse peut détecter des parasitémies de 10-20
parasites par µl.

Le séchage de la goutte épaisse est fait immédiatement par agitation à l’air à l’abri de
poussière et des mouches ou par sèche-cheveux. L’identification doit être faite en écrivant sur
la tête de la lame le nom du patient ou le code d’identification et la date du prélèvement.
Réaliser ensuite la déshémoglobinisation de la goutte épaisse en utilisant quelques gouttes
d’eau distillée.

2.6. Frottis sanguin


Une petite goutte du sang a été étalée sur une lame porte-objet à l'aide d'une lame
rodée. Le frottis doit être mince, régulier et comporter une tête, un corps, une queue, et deux
bords.

Pour cela, l'étalement doit se faire d'un mouvement régulier, ni trop lent (frottis trop
mince), ni trop rapide (frottis court et épais). Pour les frottis, la sensibilité est estimée à 200
hématies parasitées par μL de sang.

 Coloration des étalements sanguins.

Après la déshémoglobinisation des gouttes épaisses à l'eau distillée et la fixation des


frottis minces au méthanol, les lames ont été colorées au Giemsa 10%.

- Diluer au 1/10 la solution de Giemsa commerciale dans de l'eau neutralisée (tampon)

55
à pH7, 2 - Préparer pour 3 ml de solution finale/lame

- Filtrer la solution à l'aide d'un papier filtre

- Placer les lames à colorer sur une baguette de verre.

-Déshémoglobiniser les gouttes épaisses jusqu'à obtention d'une teinte blanchâtre (2-3
minutes)

- Couvrir les lames avec le colorant de Giemsa 10% préparé.

- Laisser agir 25 - 30 minutes.

- Laver le colorant à l'eau tamponnée (ou à défaut celle du robinet)

- Sécher en inclinant.

2.7. Lecture des lames


Après séchage, la lecture des lames au microscope optique à l'objectif x100 permet de
détecter les différents stades et espèces de Plasmodium. Il a été procédé d'abord à la lecture
des gouttes épaisses. Après examen infructueux de 200 champs microscopiques soit un seuil
de détection de Plasmodium estimé à environ 5-10 parasites/µl de sang, la lame en question
est considérée comme étant négative. Pour les lames positives, la détermination de(s)
espèce(s) plasmodiale(s) a été effectuée à partir de l'observation des frottis minces. Pour tous
les stades parasitaires de toutes les espèces plasmodiales, la chromatine est colorée en rouge.
Le cytoplasme dont la forme varie d'un anneau à une masse irrégulière, est coloré en bleu de
nuance variable selon l'espèce. Le frottis, indispensable pour le diagnostic d'espèce, est
cependant 20 fois moins sensible que la goutte épaisse.

2.8. Détermination de la densité parasitaire


Pour la détermination des espèces plasmodiales elle se fait en utilisant le frottis, elle
est basée à la fois sur des critères liés aux hématies (forme, taille, présence de granulation de
schuffner ou tâches de Maurer) qu’aux parasites : forme (amiboïde, régulière, double
chromatine, bande équatorial) et/ou état (monotone, panaché, poly parasitisme).

Alors que pour la détermination de la densité parasitaire (ou parasitémie) correspond


au nombre de parasite par microlitre de sang. L'estimation de la densité parasitaire a été faite
sur la goutte épaisse à l'aide de deux compteurs l’un pour le nombre de parasites et l’autre
pour le nombre des leucocytes par champ microscopique.

Le nombre de parasites par microlitres de sang est ensuite calculé sur la base d’une
leucocytémie moyenne de 8 000 globules blancs/μl de sang selon la formule suivante :
56
Parasitémie = nombre de parasite comptés x 8000/nombre de leucocytes comptés. Pour
l’expression des résultats, 5 classes de densité parasitaire ont été retenues.

Classe 1 = ≤ 49 parasites/ µl de sang

Classe 2 = 50 à 499 parasites/µl de sang

Classe 3 = 500 à 4 999 parasite/µl de sang

Classe 4 = 5 000 à 49 999 parasites/µl de sang

Classe 5 = ≥50 000 parasites/µl de sang

Un contrôle de qualité des lames a été effectué au hasard sur 10% des lames.

3. Analyse statistique
Les taux de lames positives est défini comme étant la proportion de patients présentant
des lames (gouttes épaisses) positives parmi les sujets fébriles. Ces derniers ont été
arbitrairement classés en cinq groupes d’âges regroupant les catégories suivantes : la première
catégorie comprend les moins de 5 ans, les sujets de 5 à 9 ans sont classés dans la deuxième
catégorie, le troisième groupe comprend les patients de 10 à 14 ans, les sujets de 15 à 19 ans
forment la quatrième catégorie de classe d’âge, et enfin les patients dont l’âge est supérieur à
20 ans sont regroupés dans la cinquième catégorie.

Le taux de lames positives a été déterminé pour chaque groupe d'âge afin d’apprécier
la prévalence du paludisme en fonction et en relation avec l'âge des patients.

Les données (variables continues) ont été comparées en utilisant soit le test t de
Student si les variables présentent une distribution normale ou le test non paramétrique de
Mann-Whitney U.

Les proportions ont été comparées en utilisant le test exact de Fisher pour des tableaux
de contingence 2 x 2 et le test du chi-2 des tendances pour les tableaux de contingence
contenant un plus grand nombre d'entrées. Le seuil de signification a été fixé à P <0,05.

57
4. Résultats
4.1. Caractéristiques de l’échantillon
Au total, 1161 sujets fébriles (498 à Nouakchott et 663 au Hodh El Gharbi) ont été
inclus dans l’étude en 2009 et 2010 (Tableau 1). A Nouakchott les sujets de sexe masculin
représentent 58.03% (289/498) alors que les sujets de sexe féminin représentent 41.97%
(209/498). Le test chi-2 montre des différences significatives au seuil de probabilité de 5%
entre les effectifs des deux sexes (2 = 6,15 ; P = 0,013). Au Hodh El Gharbi les sujets de
sexe masculin représentent 55.96% (371/663) alors que les sujets de sexe féminin
représentent 44.04% (292/663). Le test chi-2 montre des différences significatives au seuil de
probabilité de 5% entre les effectifs des deux sexes (2 = 4,49 ; P = 0,034). Le groupe d’âge
de 20 ans et plus est le plus représenté à la fois à Nouakchott 55.33% (275/498) et au Hodh El
Gharbi 37.41% (248/663). Le groupe d’âge le moins représenté est celui des enfants âgés de
moins de 5 ans au Hodh El Gharbi 8.75% (58/663) par contre à Nouakchott c’est le groupe
des enfants âgés de 5 à 9 ans avec 9.24% (46/498).

Tableau 1. Caractéristiques générales de l’échantillon

Caractéristiques Hodh El Gharbi Nouakchott Total

n (%) n (%) n (%)

Sexe

Masculin 371 (55.96) 289 (58.03) 660 (56.85)

Feminin 292 (44.04) 209 (41.97) 501 (43.15)

Groupe d’age

<5 58 (8.75) 52 (10.44) 110 (9.47)

5-9 114 (17.19) 46 (9.24) 160(13.78)

10–14 126(19) 61 (12.85) 187 (16.11)

15-19 117(17.65) 64(12.25) 181(15.59)

20 et plus 248(37.41) 275 (55.22) 523 (45.05)

Total 663 (57.11) 498 (42.89) 1161(100)

n: nombre d’individus

58
4.2. Résultats parasitologiques enregistrés à Nouakchott en 2009 et 2010
Des 192 et 306 sujets fébriles respectivement inclus dans l’étude en 2009 et 2010, 56
et 197 sujets ont été confirmés positifs soit des taux de prévalence respectifs de 29.2% et de
64.4% (Tableau 2). La proportion de sujets fébriles avec goutte épaisse positive a été
significativement plus élevée en 2010 (P<0.05).

En ne tenant compte que des deux Centres Hospitaliers qui ont servi de site d’étude en
2009, le taux de prévalence enregistré en 2010 de 52.94% (54 / 102 goutte épaisses
examinées) a été significativement plus élevé que celui noté en 2009 (29.16%) des 192
gouttes épaisses examinées (P < 0.0001). La prévalence plasmodiale moyenne a été plus
importante au niveau du Centre de Santé de Teyarett avec 70,1 (143/204 Goutte épaisses
examinées) qu’au niveau des deux hôpitaux suivis (P = 0,0031).

Plasmodium vivax et P. falciparum ont été les seules espèces plasmodiales rencontrées
à Nouakchott avec une prévalence respective de 18.22% (35/192) et 10.93% (21/192) en 2009
(P = 0,04) contre 57.18% (175/306) et 7.18% (22/306) en 2010 (Tableau 3) (P‹ 0,0001).

P. vivax reste donc l’espèce prédominante à Nouakchott, avec une prévalence


maximale de 45% (137/306) enregistrée au niveau du Centre de Santé de Teyarett où il a été
noté dans 69% (137/197) des gouttes épaisses positives.

59
Tableau 2. Proportions des gouttes épaisses positives chez les patients fébriles durant la saison de pluie dans deux zones en Mauritanie

Site d’etude 2009 2010

Nombre de patients Nombre de gouttes Nombre de patients Nombre de gouttes


épaisses positives (%) épaisses positives (%)

Nouakchott (Zone Saharienne)

Centre Hospitalier National 106 37 (34.9) 50 28 (56.0)

Hôpital Cheikh Zaid 86 19 (22.1) 52 26 (50.0)

Centre de Santé de Teyarett ND ND* 204 143 (70.0)

Total 192 56 (29.2) 306 197 (64.4)

Hodh El Gharbi (Zone Sahelienne)

Hopital d’Aioun 68 22 (32.4) 70 58 (82.9)

Centre de Santé de Kobeni 143 58 (40.6) 180 120 (66.7)

Centre de Santé de Tintane 82 25 (30.5) 120 95 (79.2)

Total 293 105 (35.8) 370 273 (73.8)


* ND, non déterminé.
Tableau 3. Les espèces plasmodiales rencontrées dans les deux zones en 2009 et 2010

Nombres des patients porteurs des différentes espèces plasmodiale en 2009 et 2010 (% en 2009 et 2010)*

Site d’étude P. falciparum P. vivax P. ovale P. malariae Infections mixtes**

Nouakchott (Zone Saharienne)

Centre Hospitalier National 15, 6 (14.2, 12.0) 22, 22 (20.8, 44.0) 0 0 0

Hôpital Cheikh Zaid 6, 10 (7.0, 19.2) 13, 16 (15.1, 30.8) 0 0 0

Centre de Santé de Teyarett ND, 6 (-, 2.9) ND, 137 (-, 67.2) 0 0 0

Total 43 (17.0) 210 (83.0) 0 0 0

Hodh El Gharbi (Zone Sahélienne)

Hôpital d’Aioun
21, 56 (30.9, 80.0) 0, 0 1, 0 (1.5, 0) 0, 1 (0, 0.9) 0, 1 (0, 0.5)
Centre de Santé de Kobeni
56, 117 (39.2, 65.0) 0, 0 1, 0 (0.7, 0) 1, 1 (0.7, 0.3) 0, 2 (0, 1.1)
Centre de Santé de Tintane
23, 92 (28.0, 76.7) 2, 1 (2.4, 0.3) 0, 0 0, 1 (0, 0.3) 0, 1 (0, 1.3)

Total
365 (96.6) 3 (0.8) 2 (0.5) 4 (1.0) 4 (1.0)

* Pourcentage: c’est le nombre de patients positives/ le nombre total des patients. **P. falciparum-P. vivax : infection mixte. ND, non déterminé.
(étude non effectuée au Centre de Santé de Teyarett en 2009).
La tranche d’âge des 0-4 ans a présenté un taux de prévalence parasitaire
significativement plus faible que pour les autres classes d’âge à la fois en 2009 (P = 0.016)
qu’en 2010 (P =0.0004) (Figure 19).

Nombre de patients avec GE


positives
Nombre de patients avec GE -ive

Groupe d’âge (en années) durant la période d’étude

Figure 19 : Groups d’âge des patients fébriles à gouttes épaisses positives à


Nouakchott et au Hodh El Gharbi en 2009 et 2010.

Le tableau 4 présente le nombre de Gouttes Epaisses positives, la part ainsi que la


distribution des charges parasitaires pour chaque espèce plasmodiale selon l’année d’étude.

En moyenne, les charges parasitaires comprises entre 500-4 999 parasites/ µl de sang
prédominent dans les infections plasmodiales (P < 0,001 à la fois pour 2009 et 2010). La
même observation a été notée dans les infections à P. falciparum (P<0,001) que dans celles à
P. vivax (P<0,001) où la proportion d’infection de classe 2 (50-499 parasites/ µl) et 3 (500-
4 999 parasites/ µl) n’a pas été significativement différente en 2010(Tableau 4).

62
Tableau 4. Distribution des charges parasitaires chez les patients positifs selon l’espèce plasmodiale dans les deux régions en 2009 et
2010.

Densité parasitaire (formes Nombre des patients à Nouakchott (%) Nombre des patients au Hodh El Gharbi (%)
asexue /µL) P. falciparum P. vivax P. falciparum Infection mixte P. falciparum/P. vivax

2009

< 50 0 0 0 0

50 – 499 4 (19.0) 12 (34.3) 5 (5.0) 0

500 – 4 999 11 (52.4) 20 (57.1) 67 (67.0) 0

5 000 – 49 999 6 (28.6) 3 (8.6) 22 (22.0) 0

> 50 000 0 0 6 (6.0) 0

Total en 2009 21 (100) 35 (100.0) 100 (100.0) 0

2010

< 50 0 0 0 0

50 – 499 3 (13.6) 84 (48.0) 57 (21.5) 2 (50.0)

500 – 4 999 15 (68.2) 85 (48.6) 112 (42.3) 8 (25.0)

5 000 – 49 999 4 (18.2) 6 (3.4) 89 (33.6) 1 (25.0)

> 50 000 0 0 7 (2.6) 0

Total en 2010 22 (100.0) 175 (100.0) 265 (100.0) 4 (100.0)


4.3. Résultats parasitologiques enregistrés au Hodh El Gharbi en 2009 et
2010
Des 293 et 370 sujets fébriles respectivement inclus dans l’étude en 2009 et 2010, 105
et 273 sujets ont été confirmés positifs soit des taux de prévalence respectifs de 35.83% et de
73.78% (Tableau 2). La proportion de sujets fébriles avec goutte épaisse positive a été
significativement plus élevée en 2010 (P<0.0001).

Plasmodium falciparum reste la principale espèce rencontrée dans le Hodh El Gharbi.


Sa prévalence moyenne a été de 34.1% (100/293) et de 71.6% (265/370) respectivement en
2009.

En 2010, La présence de Plasmodium vivax, Plasmodium ovale et Plasmodium


malariae a également été notée dans cette région. La prévalence cumulée de ces 3 espèces
était de 1.7% en 2009 et de 1.08% en 2010 où aucun cas de Plasmodium ovale n’a été noté
mais une prévalence d’infection mixte par Plasmodium falciparum et Plasmodium vivax de
l’ordre de 2.97% a été noté (Tableau 3).

Les tranches d’âge de plus de 14 ans ont présentés des taux de prévalence parasitaire
significativement plus faibles que les autres classes d’âge en 2009 (P = 0.0012) par contre en
2010 seule la tranche de 20 ans et plus a présenté des taux de prévalence parasitaire
significativement plus faibles que les autres classes d’âge (P <0.0001) (Figure 19).

Le tableau 4 présente le nombre de gouttes épaisses positives, la part ainsi que la


distribution des charges parasitaires pour chaque espèce plasmodiale selon l’année d’étude.

En moyenne, les charges parasitaires comprises entre 500-4 999 parasites/ µl de sang
et de 5000-4 9999 parasites/ µl de sang prédominent dans les infections plasmodiales
(P<0,001 à la fois pour 2009 et 2010) (Tableau 4).

64
5. Discussion

La présente étude a été effectuée pour évaluer la morbidité palustre à Nouakchott et au


Hodh El Gharbi en comparant les donnés parasitologiques collectés chez des sujets fébriles
pendant deux saisons de transmissions successives (2009 et 2010) dans ces deux régions.

Nouakchott et Hodh El Gharbi ont été sélectionnées comme sites d’étude pour
plusieurs raisons :(i) elles appartiennent à deux zones géo-climatiques différentes, (ii)
Nouakchott était considéré comme une zone indemne du paludisme alors que la région du
Hodh El Gharbi est une zone de forte transmission saisonnière, (iii) l’existence des
mouvements de populations entre ses deux régions qui s’intensifie en début d’hivernage de
Nouakchott vers le Hodh El Gharbi et dans la sens inverse à la fin de l’hivernage.

Les résultats obtenus lors de cette étude montrent une forte recrudescence du
paludisme en 2010 dans les deux régions en comparaison à 2009 comme en témoignent les
taux d’infection obtenus à Nouakchott (64.37% en 2010 contre 29.16% en 2009) et au Hodh
El Gharbi (73.78% en 2010 contre 35.83% en 2009).

Cette recrudescence du paludisme au Hodh El Gharbi pourrait s’expliquer d’une part,


par les précipitations abondantes enregistrées en 2010 en comparaison avec les années
précédentes et d’autre part par le comportement des populations vis-à-vis des mesures de
prévention. En effet, dans cette région les populations n’ont pas l’habitude de dormir sous
moustiquaire sauf si elles sont trop dérangées par les moustiques, l’utilisation de
moustiquaires est beaucoup plus par crainte d’être dérangé par les moustiques que par crainte
de la maladie. De plus, comme la période de transmission est très courte, le contact avec le
parasite ne dépasse pas deux mois durant toute l’année ce qui suggère que la prémunition
chez la population de cette région est très faible.

Pour Nouakchott la recrudescence du paludisme remarquée en 2010 pourrait être


expliquée d’une part par la succession de deux années pluvieuses à Nouakchott même si la
pluviométrie en 2009 a été légèrement plus élevée qu’un 2010 mais les années 2009 et 2010
sont plus pluvieuses que les cinq années précédentes. De plus, l’année 2010 avait connus la
mise en service du projet Aftout Sahli (projet d’alimentation de la ville de Nouakchott en eau
potable à partir du fleuve Sénégal). Cette mise en service avait commencé en aout 2010 par le
pompage de quantités énormes des eaux douces sur des surfaces limitrophes de Nouakchott

65
pour le nettoyage des tuyaux qui amènent l’eau du fleuve Sénégal jusqu’à Nouakchott, puis
fin Septembre 2010 par l’alimentation du réseau hydrographique de Nouakchott. Ainsi, vu la
vétusté du réseau, la pression de l’eau a été telle que bon nombre de tuyaux formant ce réseau
n’ont pas pu la supporter entrainant ainsi l’éclatement quasi-quotidien des tuyaux partout dans
les différents quartiers de la ville ce qui a crée des conditions favorables à la multiplication de
gites larvaires.

D’autre part, comme la ville de Nouakchott était considérée indemne du paludisme, les
mesures de prévention du paludisme d’ordre général sont dérisoires et les Nouakchottois
n’ont pas l’habitude de se protéger en dormant sous moustiquaire.

Deux espèces plasmodiales ont été identifiées à Nouakchott lors des saisons de pluies
de 2009 et 2010. Il s’agit de P. vivax qui prédomine parmi les consultants fébriles au Centre
de santé de Teyarett (95,8%) et P. falciparum (4,2%). La prédominance quasi-totale de P.
vivax chez les consultants fébriles à Teyarett s’explique par le fait que la structure sanitaire de
cet arrondissement reçoit des patients venant en plus de Teyarett, de l’arrondissement
limitrophe de Dar Naim. En effet, les résidents de ces deux arrondissements représentaient 65
% des consultants fébriles inclus au niveau des deux hôpitaux qui ont servis de sites d’étude
en 2009 et 2010. Par ailleurs, plus de 90% des consultants fébriles présentant une goutte
épaisse positive enregistrés lors de cette étude dans les urgences de ces deux hôpitaux
venaient de ces deux arrondissements.

La prédominance du paludisme chez les résidents de ces deux arrondissements a été


rapportée par Mint Lekweiry et al., (2009) avec un taux de 86.9% des cas positifs. Ces auteurs
ont par ailleurs rapporté la présence de P. vivax chez 43 (70,5%) des 61 sujets positifs à
Nouakchott.

La présence de P. vivax à Nouakchott a été également rapportée par Cortes et al.,


(2003) dans une étude menée en 1996. En effet, ces auteurs ont confirmés par microscopie 28
cas de P. vivax sur 77 cas trouvés positifs.

En comparant nos taux de prévalence de P. vivax de 62.5% et de 88.83% enregistrés


respectivement en 2009 et 2010 avec ceux de 35.5% et de 70.5% rapportés respectivement par
Cortes et al., (2003) et Mint Lekweiry et al., (2007) nous constatons que le taux de prévalence
du P. vivax est en augmentation continue à Nouakchott. Cette augmentation continue des cas
du paludisme à P. vivax à Nouakchott pourrait être expliquée par le fait que cette espèce a la

66
spécificité de déclencher des accès palustres par re viviscence assurés par les hypnozoïtes
(formes dormantes du parasite) qui ne sont pas pris en compte dans le schéma thérapeutique
adopté pour le traitement des accès palustres à P. vivax. En effet, la primaquine, seule
antipaludique capable d’éliminer les formes hypnozoites responsables des rechutes n’est pas
commercialisée en Mauritanie.

Concernant le P. falciparum, deuxième espèce palasmodiale rencontré à Nouakchott


en 2009 et 2010, la majorité des sujets positifs avaient des notions de voyage récentes vers
trois régions du pays (Assaba, Hodh El Gharbi et Hodh El Chargui) où des cas de paludisme à
P. falciparum sont régulièrement rapportés (Gasquet et al., 1995 ; Jodan et al., 2001). Ce qui
pourrait suggèrer que ces cas fussent d’origine allochtone.

En revanche 10 sur les 22 cas du paludisme à P. falciparum enregistré à Nouakchott


en 2010 n’ont jamais quitté Nouakchott ce qui suggère aussi que ces cas pourraient être
d’origine autochtones.

Au Hodh El Gharbi, les quatre espèces plasmodiales sont présentes avec une
prédominance quasi-totale de P. falciparum dans plus de 96% des cas.

Cette prédominance de P. falciparum au Hodh El Gharbi a été rapportée par Jordan et


al., en 2001 dans une étude effectuée à Aioun et à Kobeni pendant la saison de transmission
de 1998 où l’infection par P. falciparum a été confirmée par PCR chez 173 (44.8%) de 386
échantillons collectés durant cette étude dans les deux localités prospectées.

6. Conclusion

Il ressort de cette étude l’existence d’une transmission palustre en saison de pluies de


2009 et 2010 dans les deux zones avec une recrudescence en 2010.

Une prédominance quasi-totale du P.falciparum au Hodh el Gharbi (Zone Sahélienne)


contre une prédominance de P.vivax à Nouakchott (Zone Saharienne).

67
CHAPITRE 5 :

POLYMORPHISME DU GENE
MSP-1 DES ISOLATS DU P.
FALCIPARUM
1. Introduction
Plasmodium falciparum constitue le principal agent responsable du paludisme dans le
monde. En Mauritanie, cette espèce est responsable de plus de 90% des cas du paludisme
enregistrés. C’est un organisme eucaryote avec un génome d’une taille d’environ 28 Mpb
réparti en 14 chromosomes (de 0,7 à 3,4 Mpb), On estime par ailleurs que le génome de P.
falciparum contient 6000 à 7000 gènes (Gardner, 1998).

Il est aujourd’hui admis que P. falciparum est une espèce très polymorphe. Trois
facteurs majeurs sont à l’origine de cette diversité parasitaire : le polymorphisme allélique, le
cycle de reproduction sexuée et la variation antigénique. Cette particularité a constitué une
contrainte sérieuse pour les stratégies de lutte contre le paludisme dans le Monde, notamment
pour la mise au point d’un vaccin et le contrôle de la maladie.

Lorsqu’un moustique ingère des gamétocytes de parasites génétiquement différents,


les recombinaisons méiotiques produisent ainsi un brassage des gènes à l'origine de nouvelles
combinaisons alléliques et de nouveaux haplotypes (Su et al., 2007). L’intensité de la
transmission du paludisme dépend de la densité de l’infestation anophélienne et de la
variation du taux du parasite chez l’homme (Peyerl-Hoffmann et al., 2001). Dans les régions
endémiques, le nombre de clones des parasites de P. falciparum est un indicateur du niveau
de transmission et/ou de l’immunité de l’hôte (Owusu-Agyei et al., 2002).

Le gène msp- l, localisé sur le chromosome 9, code pour un antigène majeur de surface
du mérozoïte. Les données de la littérature indiquent que le domaine variable localisé près de
l'extrémité 5' du gène, appelé bloc 2, est particulièrement polymorphe (Miller et al., 1993).

L'amplification des séquences du bloc 2 est utilisée pour le typage des isolats de
Plasmodium (Contamin et al., 1995). Les allèles msp- l sont classés en 3 grandes familles
alléliques: KI, MAD20 et Ro33.

La diversité génétique de P. falciparum a été largement étudiée dans diverses parties


du monde, mais peu de données sont disponibles sur la Mauritanie. La seule étude sur la
structure génétique des populations de P. falciparum remonte à 2001 (Jordan et al., 2004). La
présente étude a pour objectif d’examiner et comparer la diversité génétique des isolats de P.
falciparum prélevés chez des porteurs symptomatiques recrutés dans des structures de santé

68
de Nouakchott et de la région du Hodh El Gharbi, pendant la saison de transmission du
paludisme, en utilisant le gène codant pour la protéine de surface des mérozoïtes (MSP-1).

L’objectif de ce travail est d’évaluer le polymorphisme allélique des isolats de


P.falciparum de la Mauritanie en vue d’élucider cet aspect du paludisme.

2. Matériels et Méthodes
2.1. Zones d’études
Le génotypage du gène Msp1 a été effectué pour des isolats de P. falciparum collectés
à l’Hôpital d’Aioun, le Centre de Santé de Kobeni et celui de Tintane pour la région du Hodh
el Gharbi et au Centre Hospitalier National, Centre Hospitalier Cheikh Zayed et Centre de
Santé de Teyarett pour la ville de Nouakchott.(Figure 21)
La ville de Nouakchott et la région du Hodh el Gharbi sont précédemment présentés
au chapitre 4

Figure 20 : Carte de la Mauritanie montrant les zones d’études

69
2.2. Patients et échantillonnage
L’étude a été effectuée sur 113prélèvements de sang collectés sur papier buvard chez
113 sujets porteurs symptomatiques de Plasmodium falciparum échantillonnés par tirage au
sort à partir de 276 (114 isolats de Koubeni, 89 isolats de Tintane, 55 isolats d’Aioun et 18
isolats de Nouakchott) porteurs symptomatiques du Plasmodium falciparum recrutés en 2010
au Hodh el Gharbi (Aioun, Tintane et Kobeni) et à Nouakchott selon la méthodologie
précédemment décrite dans le chapitre 4.

Brièvement, des gouttes épaisses et des frottis minces ont été confectionnés che z tous
les sujets recrutés. Une goutte de sang est également prélevée sur papier buvard pour l’analyse
moléculaire. Les étalements sanguins sont colorés au Giemsa et lus au microscope au
grossissement 100. La densité parasitaire a été calculée à partir de la goutte épaisse par une
formule présentée au chapitre précédent:
2.3. Etude du polymorphisme allélique de gène Msp1
Le polymorphisme allélique de gène MSP-1 a été mis en évidence par Nested-PCR ou
PCR nichée. Cette technique correspond à une succession d e deux PCR. La première
amplification est réalisée avec des amorces dites externes qui bornent la séquence à amplifier.
La seconde PCR est à l’intérieur de la première et utilise un second couple d’amorces dites
internes. Cette technique permet une amplification plus importante et plus spécifique que la
PCR classique.
Les différents allèles amplifiés ont été déterminés par leur taille sur gel d’agarose.

2.3.1. Extraction de l’ADN des isolats de P. falciparum


L’ADN génomique est extrait à partir des échantillons de sang sur papier buvard par la
méthode de Méthanol décrite par Djimde et al., en 2001.

Brièvement, 500ul de méthanol a été mis dans un tube Eppendorf de 1,5 ml contenant
3 à 4 morceaux de papier buvard. Après une incubation à température ambiante pendent 15
minutes. Le méthanol a été complètement enlevé et un volume de 50-70ul d’eau distillé stérile
a été ajouté sur les morceaux de papier buvard, une incubation à 95-100c a été effectuée
pendant 15 minutes durant cette incubation le tube a été vortexé chaque 5 minutes. Enfin les
échantillons ont été centrifugés et les extraits de l’ADN ont été conservés au -20 avant d’être
utilisé pour les réactions d’amplifications.

70
2.3.2. Génotypage
Brièvement les régions polymorphes du bloc 2 du gène MSP-1 de P. falciparum ont
été amplifiées par Nested-PCR (Ariey et al., 1999). Dans une première PCR, des couples
d’amorces correspondant aux séquences variables de MSP-1 ont été utilisés et dans une
deuxième PCR, des amorces spécifiques aux différentes familles sont utilisées pour amplifier
les familles alléliques : K1, MAD20, et RO33 du gène MSP-1.

Les amplifications sont réalisées dans un volume final de 25µl contenant 1µl d’ADN,
200µM de dNTP (déoxynuclèotides triphosphatés), 1µM de chaque amorce, 0,5 U de Taq
polymérase, 15mM de MgCl2. (Annexe 1)

Le mélange est ensuite mis dans un thermocycleur PTC-100 Peltier Applied


Biosystem 272

Tableau 5: Séquences des oligonucléotides utilisées pour PCR primaires et secondaires.

Amplification/Amorce Sequence Polymorphisme


PCR primaire
Msp1F 5’AA GCCTTA GAA GATGCA GTATTGA C3’ Conservé

Msp1R 5’ATTCATTAATTTCTT CATATCCATTATC3’

PCR sécondaire
K1F 5’AA GAAATTACTACAAAA GGTG3’ Famille specifique K1

K1R 5’TGCA TCA GCTGGA GGGCTTGCA CCAC3’ Famille specifique K1

Ro33F 5’A GGATTTGCA GCA CCTGGA GATCT3’ Famille specifique Ro33

Ro33R 5’GA GCAAATACTCAAGTTGTTGCA3 Famille specifique Ro33

Mad20F 5’TGAATTATCTGAA GGATTTGTA CGTC3’ Famille specifique Mad20

Mad20R 5’GAA CAA GTCGAA CA GCTGTTA3’ Famille specifique Mad20

Les Nested-PCR sont pratiquées à partir de 2 µl de produit de PCR primaire. Des


amorces spécifiques (Tableau 5) des familles alléliques ont été utilisées dans cette seconde
amplification. Pour le gène MSP-1, les amorces K1F-K1R, Mad20F-MadR et R033F-R033R
ont été respectivement utilisées pour la famille allélique K1, MAD20 et RO33. Les produits
d’amplification sont par la suite maintenus à 4°C jusqu’à l’analyse des différentes tailles.

71
2.3.3. Visualisation et analyse des produits de PCR
Dans un milieu liquide, les acides nucléiques se déplacent à la même vitesse
(Charlionet & Rivat, 1990) donc ils ne peuvent y être séparés en fonction de leur taille. Les
milieux utilisés en PCR sont ceux qui freinent les molécules en fonction de leur taille, c’est le
cas des gels.

L’électrophorèse est une méthode permettant la séparation de particules chargées sous


l’action d’un champ électrique uniforme.

A pH neutre, les molécules d’ADN sont chargées négativement du fait de la présence


de groupements phosphates, et migrent vers l’anode quand elles sont soumises à un champ
électrique. Ces molécules se séparent en fonction de la facilité avec laquelle elles progressent
à travers les mailles constituées par le gel ; leur rapport charge/taille étant constant. La
séparation est ainsi assurée par l’effet de la filtration du gel. La vitesse de la migration d’une
molécule d’ADN dépend de deux paramètres : sa taille et la concentration en agarose du gel,
mais le voltage et la force ionique du tampon interviennent aussi.

Avant le dépôt des échantillons dans les puits du gel ; ceux-ci sont mélangés avec un
tampon de charge contenant notamment du glycérol et du bleu de bromophénol. :

 Le glycérol permet d’augmenter la densité de la solution d’ADN à déposer dans le


gel afin de pouvoir l’entraîner vers le fond du puits, cela évite à l’échantillon de remonter à la
surface du tampon et donc contaminer les autres puits.

 Le bleu de bromophénol permet de suivre la migration des échantillons.

Nos produits amplifiés sont déposés sur un gel d’agarose à 2 %. Lors de la


polymérisation, ce gel définit des mailles plus ou moins régulières entre lesquelles passent les
molécules à des vitesses différentes selon leur taille. Plus le fragment est de grande taille,
moins la migration électrophorètique par rapport au puits d’inclusion sera importante. À
l’opposé, les fragments de petite taille auront une distance de migration plus grande. La
vitesse de migration sera dépendante de la masse moléculaire, donc du nombre de bases de
l’ADN testé, la présence et les tailles des amplicons pourront être vérifiées. Ces tailles ont été
estimées en utilisant un marqueur de poids moléculaire qu’on dépose dans un puits du gel en
même temps que les échantillons.

Les produits de PCR sont révélés après marquage. La méthode de marquage que nous
avons utilisée au laboratoire est celle du Bromure d’Ethidium (BET). Ce bromure est une
molécule qui s’intercale entre les bases de la molécule d’ADN double brin. Ce bromure donne

72
une fluorescence orange en présence de rayons ultra- violets (UV). Cette fluorescence est
prononcée dans les zones où sont concentrées les molécules d’ADN. Cependant, il faudrait
beaucoup d’attention lors de la manipulation de ce produit car il est très cancérigène. Il est
conseillé de toujours porter des gants et des masques pour le manipuler.

La révélation se fait par exposition du gel d’agarose aux radiations UV. Les fragments
d’ADN se présentent sous forme de bandes fluorescentes. La taille des bandes a été estimée
en utilisant un marqueur de poids moléculaire qu’on dépose dans un puits du gel en même
temps que les échantillons.

3. Résultats
3.1. Caractéristique général de l’échantillon
Au total 113 échantillons ont été génotypés. La répartition de ces échantillons selon le
site d’étude est comme suit : 31.8% (36/113) de Koubeni, 34.5% (39/113) de Tintane, 17.7%
(20/113) d’Aioun et 16% (18/113) de Nouakchott (Tableau 6).

Les sujets de sexe masculin représentent 61,9%(70/113) contre 38.1% (43/113) de


sexe féminin. Les patients de tranche d’âge 5-19 ans sont les plus représentés 55.8%(63/113)
suivi par la tranche d’âge de 20-39 ans 28.3%(32/113). Les adultes de 40 ans et plus
représentent 12.4%(14/113) et les enfants de moins de 5 ans représentent 3.5%(4/113).

Tableau 6. Caractéristiques générales de la population étudiée

Caractéristiques Kobeni Tintane Aïoun Nouakchott Total


n (%) n (%) n (%) n (%) n (%)
Sexe
Masculin 20(55.6) 27(69.2) 12(6) 11(61.1) 70 (61.9)
Feminin 16(44.4) 12(30.8) 8(4) 7(38.9) 43 (38.1)

Groupes d’age

<5 1(2.8) 1(2.56) 2(10.0) 0 4 (3.5)


5-19 21(58.3) 23(59.0) 13(65.0) 6(33.3) 63 (55.8)
20–39 13(36.1) 7(17.95) 4(20.0) 8(44.5) 32 (28.3)
≥40 1(2.8) 8(20.5) 1(5.0) 4(22.2) 14 (12.4)
Total 36 (31.8) 39 (34.5) 20 (17.7) 18 (16.0) 113 (100)

n: nombre d’individus

73
3.2. Polymorphisme allélique du gène MSP1
Le genotypage a montré un polymorphisme allélique élevé du gène Msp1 chez les
isolats du P.falciparum en Mauritanie.
Les familles alléliques K1, Mad 20 et Ro33 du gène Msp1 ont été identifiées.
Au total 27 allèles différents ont été retrouvés chez notre échantillon pour les trois
familles alléliques. Parmi eux, 9 allèles de K1 qui varient entre 160 et 360pb ,12 allèles de
Mad20 qui varient entre 140 et 400pb et 6 allèles de Ro33 qui varient entre 160 et 360pb. Les
fréquences de différents allèles de Msp1, leur combinaison et la complexité des infections
sont présentées dans le tableau 7.
La fréquence, des échantillons qui ont seulement la famille allélique K1, Mad20 et
Ro33, est de 10,6% (12/113), 2,6% (3/113) et 4,4% (5/113) respectivement.
Les combinaisons K1/Mad20, K1/Ro33 et Mad20/Ro33 représentent, dans notre
échantillon, 21.2% (24/113), 16.8% (19/113) et 2.6% (3/113) respectivement et 41,6%
(47/113) d’entre elles possèdent les trois familles alléliques à la fois. Les prévalences des
familles alléliques K1, Mad20 et Ro33 ont été de 90 % (102/113), 68,1% (76/113) et 65,5%
(74/252) respectivement. Les infections à multiple clones représentent 82,3% (93/113) avec
un minimum de 72,2% (13/18) à Nouakchott et un maximum de 90.0% (18/20) à Aïoun.
La complexité de l’infection (MOI) est plus élevée chez les patients infectés par P.
falciparum à Aioun (4,3 clones/infection) et plus basse chez les sujets Nouakchottois
(2.3clones/infection). Cependant les différences entre la complexité de l’infection MOI
obtenues n’étaient pas statistiquement significatives (p=0,56). La complexité de l’infection
(MOI) globale est estimée à 3,2 génotypes par infection.

74
Tableau 7. Fréquence des allèles de la région du bloc 2 du gène Msp-1 et la multiplicité
d’infection chez des isolats de P. falciparum de différents sites d’étude en Mauritanie.

Kobeni Tintane Aïoun Nouakchott Total


Allèles
n (%) n (%) n (%) n (%) n (%)

K1 4(11.1) 6(15.4) 1(5.0) 1(5.5) 12(10.6)

Mad20 1(2.8) 0 1(5.0) 1(5.5) 3(2.6)


Ro33 0 2(5.1) 0 3(16.7) 5(4.4)

K1/Mad20 7(19.4) 10(25.6) 6(30.0) 1(5.5) 24(21.2)

K1/Ro33 9(25.0) 4(10.2) 0 6(32.3) 19(16.8)

Mad20/Ro33 2(5.5) 0 0 1(5.5) 3(2.6)


K1/Mad20/Ro33 13(36.1) 17(43.6) 12(60.0) 5(27.8) 47(41.6)

Total 36(100.0) 39(100.0) 20(100.0) 18(100.0) 113(100.0)

Total K1 33(91.6) 37(94.9) 19(90.0) 13(72.2) 102(90.0)

Total Mad20 23(63.8) 27(69.2) 19(90.0) 7(38.8) 77(68.1)

Total Ro33 24(66.6) 23(58.9) 12(60.0) 15(83.3) 74(65.5)

Isolats à multiclones 31(86.1) 31(79.5) 18(90.0) 13(72.2) 93(82.3)

MOI 3.1 3.2 4.3 2.3 3.2

n: nombre d’individus; MOI: multiplicité d’infection.

3.3. Relation entre la complexité de l’infection et les groupes d’âges


La répartition des groupes d'âge des patients infectés par P. falciparum et le type
allélique de msp-1 bloc 2 est présentée dans le tableau 8. La prévalence de K1, Mad20, Ro33
et leurs différentes combinaisons était significativement plus élevée chez les patients âgés de
5-19 ans par rapport aux autres groupes d'âge (p <0,05) (Tableau 8). Cependant, aucune
corrélation significative entre la multiplicité de l’infection et les groupes d'âge des patients
(Spearman rank = 0,2, p = 0,8) n’a été notée. La répartition des familles alléliques K1, Mad20
et Ro33 selon la parasitémie est présentée dans le tableau 9.

75
Tableau 8. Distribution des familles alléliques du gène Msp1 en fonction de
l’âge chez des sujets infectés par P. falciparum en Mauritanie.

Groupe d’age (ans)

Familles alléliques <5 5–19 20–39 ≥40 Total

n (%) n (%) n (%) n (%) n (%)

K1 1(0.9) 8(7.1) 1(0.9) 2(1.8) 12(10.6)

Mad20 0 1(0.9) 2(1.8) 0 3(2.6)

Ro33 0 2(1.8) 2(1.8) 1(0.9) 5(4.4)


K1/Mad20 1(0.9) 17(15.0) 6(5.3) 0 24(23.0)

1(0.9) 10(8.8) 6(5.3) 2(1.8) 19(16.8)

K1/Ro33

Mad20/Ro33 0 2(1.8) 1(0.9) 0 3(2.6)


K1/Mad20/Ro33 1(0.9) 23(20.3) 14(12.4) 9(7.9) 47(41.6)

Total 4(3.5) 63(55.7) 32(28.4) 14(12.4) 113(100.0)

Total K1 4(100.0) 58(92.1) 27(84.3) 13(92.8) 102(90.3)

Total Mad20 2(50.0) 43(68.2) 23(71.8) 9(64.3) 77(68.1)

Total Ro33 2(50.0) 37(58.7) 23(71.8) 12(85.7) 74(65.5)

Isolats à multiclones 3(2.6) 52(46.0) 27(23.9) 11(9.7) 93(82.3)

MOI 3.25 3.21 3.03 3.37 3.2

n: nombre d’individu; MOI: multiplicité d’infection.

Cette étude a révélé que la distribution individuelle de K1, Mad20 et Ro33 n'était pas
significativement différente selon les groupes de parasitémie (p = 0,94).

76
Tableau 9. Distribution des familles alléliques du gène Msp-1 selon les classes de
parasitémie chez des sujets infectés par P. falciparum en Mauritanie.

Parasitémie*
Familles alléliques 50-499 500-4999 5000 Total
n(%) n (%) n(%)

K1 1(0.9) 6(5.3) 5(4.4) 12(10.6)

Mad20 1(0.9) 2(1.8) 0 3(3.5)

Ro33 0 2(1.8) 3(2.6) 5(4.4)


K1/Mad20 1(0.9) 10(8.8) 13(11.5) 24(21.2)

K1/Ro33 6(5.3) 9(7.9) 4(3.5) 19(16.8)

Mad20/Ro33 0 1(0.9) 2(1.8) 3(2.6)

K1/Mad20/Ro33 2(1.8) 22(19.5) 23(20.3) 47(41.6)

Total 11(9.7) 52(46.0) 50(44.3) 113(100.0)

Total K1 10(90.9) 47(90.4) 45(90.0) 102(90.3)

Total Mad20 4(36.4) 35(67.3) 38(76.0) 77(68.1)

Total Ro33 8(72.7) 34(65.4) 42(84.0) 74(65.5)

Isolats à multiclones 9(7.9) 42(37.2) 42(37.2) 93(82.3)

MOI 2.6 3.4 3.6 3.2

(*) parasite/µl de sang; n: nombre d’individu; MOI: multiplicité d’infection.

77
4. Discussion
Une meilleure compréhension de la structure génétique de la population de P.
falciparum peut être un élément important pour la mise en œuvre des stratégies de lutte contre
le paludisme dans notre pays.

Les résultats de génotypage des isolats de P. falciparum ont montré un polymorphisme


relativement élevé des familles alléliques K1, Mad20 et Ro33 du gène msp-1. En effet, 27
allèles de tailles différentes ont été trouvés chez les isolats de P. falciparum génotypés (9K1,
12Made 20 et 6 R033).

Des résultats similaires ont été trouvés par Jordan et al., (2003) ces auteurs ont noté
11, 8 et 2 allèles de tailles différentes, respectivement de K1, Mad20 et Ro33 chez des isolats
de P. falciparum prélevés chez des patients atteints de paludisme recrutés à Aïoun et à Kobeni
zone située au sud-est du pays.

Le nombre de différents allèles de msp-1 observé chez les isolats de P. falciparum est
également comparable à celui rapporté par Konaté et al., (1999) à Dielmo (une zone
holoendémique) du Sénégal où 33 allèles de MSP-1 ont été mis en évidence, mais moins que
celui rapporté par Soulama et al., (2009) qui a trouvé 41 allèles de taille différente pour msp-1
chez des isolats de P. falciparum recueillis auprès des enfants atteints d’accès palustre simple
au Burkina Faso.

L'étude a également révélé la prédominance des allèles de type K1 soit a u niveau de


chaque site d'étude ou dans l’ensemble des isolats par rapport à Mad20 et Ro33. Ce constat a
été déjà fait chez les isolats de P. falciparum d’Aïoun et de Kobeni (Jordan et al., 2003). A
Dakar, le génotypage des isolats de P. falciparum prélevés chez 48 patients hospitalisés pour
des accès palustres a montré une prévalence de 68% pour les allèles K1 (Henry et al., 2006).

La majorité des isolats ont présenté des infections mixtes (82,3%) qui abritaient plus
d'un type d'allèles. Toutefois, la prévalence des patients présentant des infections mixtes était
similaire dans tous les sites étudiés.

Une grande majorité d’infections comportant plus d’un clone a été notée et les
infections à 2 et 3 clones par isolat ont été les plus fréquentes parmi les isolats polyclonaux
obtenus dans toutes les localités. De nombreuses études ont rapporté une majorité d’infections
polyclones indépendamment de la saison et du statut clinique des porteurs de parasites
(Issifou et al.,2001; Aubouy et al., 2003; Joshi et al.,2007; Zhong et al.,2007).

78
Nous avons noté également que les infections qui contenaient le KI (KI/Mad20/Ro33,
KI/Mad20, KI/Ro33) étaient les plus fréquemment rencontrées (82, 3%) avec les infections
KI/Mad20/Ro33 à la plus forte fréquence (41,6%). Nous avo ns par contre constaté que les
infections mixtes qui ne contenaient pas le KI, notamment les infections avec Mad20 /Ro33
étaient très faiblement représentées (2,6%). Cette tendance des infections mixtes a également
été confirmée dans une étude conduite au Gabon (Fousseyni et al., 2007).

Une multiplicité d'infections (MOI) relativement élevé e a été observée chez les
patients porteurs des isolats de P. falciparum soit au niveau de sites d'étude (2,33 à 4,25) ou
sur l'ensemble des sites d'étude (3.22) ce qui suggère une intensité de transmission élevée du
paludisme au cours de la période d'étude.

Le génotypage de 63 et 110 isolats de P. falciparum prélevés sur des patients fébriles


respectivement à Aïoun et à Kobeni, a révélé une multiplicité d’infection de 1,57 et 2,34,
respectivement (Jordan et al., 2003)

La multiplicité d'infection chez un patient infecté peut être due à un taux important
d’inoculation entomologique comme indiqué dans le village de Dielmo où les patients
reçoivent un grand nombre de piqûres infectantes (Konate et al., 1999), ou par un seul
moustique porteur de plusieurs clones des parasites dans son inoculum (Druilhe et al., 1998).

Le polymorphisme génétique est donc plus important dans les régions où la


transmission du paludisme est intense, car le parasitisme humain est fréquemment polyclonal
(multiparasitisme), et les recombinaisons méiotiques chez le moustique après repas sanguin
surviennent alors fréquemment entre des parasites génétiquement différents. Il apparaît au
contraire limité dans les zones de faible transmission (Anderson et al., 2000; Bogreau et al.,
2006).

Dans notre étude, il est difficile de spéculer sur l'influence du nombre de piqûres sur la
multiplicité d'infection, car aucune donnée sur les piqûres infectées de vecteur n’est
disponible pour les sites d'étude.

Les valeurs de MOI rapportées dans notre étude sont similaires à celles observées dans
les régions qui ont un niveau d’endémicité palustre élevé (Babiker et al., 1997). En outre, il
n'y avait pas d'association entre MOI et l'âge des patients. Au Sénégal, chez des porteurs
asymptomatiques, la complexité et la distribution des allèles sont dépendantes de l’âge à
Dielmo où la transmission anophélienne est pérenne. Par contre, dans le village voisin de

79
Ndiop où la transmission est saisonnière, il n’a pas été noté de lien entre la complexité des
infections et l’âge des porteurs (Zwetyenga et al., 1998).

Les enquêtes menées au Sénégal (village de Ndiop où le paludisme est méso-


endémique et saisonnière) et au Bénin (Cotonou), indique que MOI n'a pas été affectée par
l'âge des patients paludéens (Konate et al., 1999, Issifou et al., 2001).

Des études antérieures concernant la variation de MOI sur l'âge ont suggéré que
l'influence de l'âge sur la multiplicité d'infection est fo rtement affectée par l'endémicité
palustre qui est probablement le reflet de l'évolution de l'immunité spécifique anti-parasite
(Vafa et al., 2008).Toutefois, ce résultat contraste avec les rapports d'autres endroits (Soulama
et al., 2009, Konate et al., 1999, Smith et al., 1999).

Une corrélation positive entre la multiplicité de l'infection et la densité parasitaire a été


observée dans cette étude (MOI = 2,6-3,6). Cela concorde bien avec de nombreuses études
antérieures démontrant que les densités parasitaires élevées augmentent la probabilité de
détecter des clones différentes simultanées chez un individu (Peyerl-Hoffmann et al., 2001,
Farnert et al., 2001).

Notre étude a utilisé des isolats de P. falciparum prélevés chez des patients
symptomatiques, de sorte que la MOI peut être inférieure à celle observée chez les patients
asymptomatiques (Magesa et al., 2002).

De nombreux études ont montré que MOI refléterait que la personne infectée jouit de
l'immunité contre le paludisme (Konate et a.l, 1999). Ainsi, MOI devrait être étudiée dans la
population asymptomatique de P. falciparum infectée en Mauritanie en outre, en particulier
chez les enfants.

La similitude entre les souches de P. falciparum pourrait s'expliquer par la migration


de la population entre les sites d'étude qui peuvent permettre des échanges de population de
parasites. Des résultats similaires ont été observés dans de nombreuses régions d'endémie du
paludisme (Snounou et al., 1999, Basco et al., 2001).

La présente étude est la deuxième de son genre après l’étude menée par Jordan et al., à
Aïoun et à Kobeni du Hodh el Gharbi et la première de son genre pour l’arrondissement de
Tintane et la ville de Nouakchott, capitale du pays. Elle démontre que les populations de
P.falciparum, à Kobeni et à Aioun, avaient maintenu un niveau élevé de polymorphisme.

80
Des études utilisant un plus grand nombre d'échantillons de sang prélevés en différents
endroits géographiques du pays sont nécessaires non seulement pour déterminer
l'hétérogénéité du parasite à l'échelle nationale et l'épidémiologie du paludisme détaillée, mais
aussi de mettre en œuvre des programmes de contrôle dans notre pays contre ce fléau qui est
le paludisme.

5. CONCLUSION
Les résultats de genotypage du gène Msp1 chez les isolats de P.falciparum montrent
que ces isolats présentent un haut degré de polymorphisme allélique et que la plupart des
patients porteurs des isolats de P.falciparum portent plusieurs clones de parasites à la fois ce
qui reflète un niveau d’endémicité palustre élevé dans les sites d’étude durant cette saison qui
correspond à la transmission palustre.

81
CHAPITRE 6 :

FAUNE ANOPHÉLIENNE AU
HODH EL GHARBI ET À
NOUAKCHOTT
1. Introduction

Les données sur la faune anophélienne de la Mauritanie sont très limitées et


fragmentaires. Il ressort des travaux de recherche disponibles sur la faune anop hélienne que
douze espèces d’Anophèles sont présentes en Mauritanie (Hervy et al., 1998). Trois espèces
d’Anopheles prédominent dans les régions du Sud, de l’Est et du Centre du pays : An.
gambiae s.l.représentée majoritairement par An. arabiensis dans les trois régions et An.
funestus et An. pharoensis au sud dans la vallée du fleuve Sénégal (Dia et al., 2009). Par
ailleurs, An. gambiae s.l. était le principal vecteur de P. falciparum.

La situation de la transmission palustre au niveau de la vallée du fleuve est similaire à


celle de la rive sénégalaise où les espèces du complexe gambiae sont les principaux
responsables d’une transmission saisonnière courte (Dia et al., 2009). La nature de la
transmission ainsi que les vecteurs anophéliens impliqués sont méconnues dans le reste du
pays dont la région de Hodh el Gharbi et celle de Nouakchott.

Au Hodh el Gharbi des espèces (An. pharoensis, An. rhodesiensis, An. rufipes) ont été
rapportées par Nabeth et al., (2001), suite à une épidémie de la vallée du Rift dans cette
région.

A Nouakchott, la présence d’Anopheles a été signalée à Toujounine (quartier de la


ville) (Coulibaly, 1997). Récemment, la présence d’An. arabiensis et An. pharoensis ont été
rapportés dans cette ville (Mint Lekweiry et al., 2009). Cependant, l’implication de ces
anophèles dans la transmission du paludisme dans cette ville reste inconnue et leurs gîtes
larvaires n’ont jamais été identifiés.

L’objectif de ce travail est de caractériser la faune anophélienne au Hodh el Gharbi et


à Nouakchott, d’évaluer son implication dans la transmission du paludisme et d’identifier et
caractériser les gîtes larvaires d’anophèles à Nouakchott.

82
2. Matériels et Méthodes
2.1. Les zones prospectées
Les prospections entomologiques ont été effectuées en 2010 dans deux zones géo-
climatiques différentes du pays. Deux arrondissements de la région de Hodh el Gharbi située
dans la zone Sahélienne et trois arrondissements de Nouakchott qui est située en zone
Saharienne.

2.2. Sites d'études


2.2.1. Nouakchott
La collecte de la faune résiduelle a été effectuée à Teyarett, alors que la recherche des
gîtes larvaire a été faite, en plus de Teyarett, à Dar naim et à Arafat. Les arrondissements de
Teyarett et Dar Naim ont été choisis en raison, d’une part, de l'incidence élevée du paludisme
chez leurs résidents et d’autre part, par le fait que la présence de l’anophèle adulte a été
rapporté dans ces deux quartiers par contre le quartier d’Arafat a été choisi comme témoin du
fait de l’absence du paludisme chez ses résidents et que le vecteur du paludisme n' y a jamais
été retrouvé.

- Arrondissement de Dar Naïm

Il s’agit d’un arrondissement situé au Nord-est de la capitale. Sa population s’élève à


64 000 habitants. Leurs différents quartiers abritent des jardins maraîchers dominés par la
culture de la menthe. On y trouve aussi le palmier dattier. Dans chaque jardin, on trouve des
bassins ouverts remplis en permanence d’eau servant à l’irrigation des jardins.

- Arrondissement de Teyarett
Cet arrondissement est situé dans la partie nord de la capitale. Il compte environ
50 748 habitants. Teyarett se caractérise par la présence de nombreuses bornes
fontaines servant à alimenter les habitants en eau potable.
- Arrondissement d’Arafat
Cet arrondissement, situé au Sud de Nouakchott, se caractérise par une densité
démographique très élevée (102 000 habitants) et l’absence totale d’activités agricoles.

2.2.2. Hodh el Gharbi


- Moughataa (Arrondissement) de Tintane
Situé au Sud-est de la Mauritanie, cette Moughataa abrite 77 184 habitants. Elle est
limitée au Nord par la Moughata de Tamcheket, au Sud par la République du Mali, à l’Est par

83
Aioun, capitale de la Wilaya, au Sud-ouest par Kenkoussa (Wilaya de l’Assaba) et à l’Ouest
par Kiffa, la capitale de la Wilaya de l’Assaba. A vocation agropastorale, cette Moughataa
constitue aussi un grand centre commercial dans cette zone.

Le climat de type sahélo-saharien peut être subdivisé en trois saisons :


· Saison de pluie de juin-septembre
· Saison sèche douce d’octobre-Mars
· Saison sèche chaude de Mars-juin

L’agriculture pratiquée est essentiellement de type pluviale (mil, sorgho, maïs,


haricot), le commerce et l’élevage constituent les principales activités économiques des
habitants de la ville à l’instar de celles de toute la région.

- Arrondissement de Kobeni

Kobeni est une commune de Mauritanie située dans le département de Kobeni de la


région de Hodh El Gharbi. Elle constitue une ville frontière avec la région de Nioro du
Sahel au Mali.

La commune se caractérise par ses deux entités : une première entité urbaine est
constituée par la ville de Kobeni et la deuxième entité correspond à celle de la zone rurale où
ont été recensés 16 villages.

Kobeni est soumise à des vents chauds et secs soufflant du Nord et du Nord-Est
pendant les mois de mars à juillet. Ces vents connaissent un refroidissement pendant les
saisons hivernales et post hivernales qui vont du mois d’août au mois de février.

Le relief de la commune se compose de trois entités :


- Au Nord–Est, aux frontières avec les communes de Gougy et de Timizine, le
territoire de la commune est montagneux,
- Au Sud-Ouest, à la frontière de la commune de Medbougou, les paysages sont
sablonneux,
- Au centre et au Sud de la commune, les paysages sont plats et parsemés d’oueds.
La zone humide de la commune est caractérisée par la présence de deux importantes
mares (tamourts) qui jouent un rôle appréciable dans l’alimentation en eau du cheptel. Il s’agit
de la
Tamourt Oum El Akriche et les 3 tamourts de Talli 1, Talli 2 et Talli 3.

84
Le caractère urbain n’est pas suffisamment marqué dans la commune de Kobeni.
Même si les populations ne pratiquent plus la transhumance comme par le passé, il n’en
demeure pas moins que les habitants de la commune ont encore leurs animaux qui, le soir,
envahissent les rues et ruelles des localités. L’habitat se résume à quelques hangars construits
en matériaux locaux ou des huttes en paille. Les habitations sont construites de manière
anarchique et ne répondent à aucun critère, ni à aucune norme urbaine. L’assainissement et
l’hygiène sont souvent absents dans la plupart des habitations.

L’activité de l’élevage se pratique dans sa grande majorité dans la partie rurale de la


commune. Les effectifs du cheptel sont de 10.720 petits ruminants et 2.727 bovins

L’essentiel des activités agricoles de la commune de Kobeni concerne les cultures sous
pluies, les cultures derrière barrages et le maraîchage. Les spéculations pratiquées sont le
sorgho et le maïs ; elles sont le plus souvent associées avec des légumineuses telles que le
niébé et l’arachide.

2.3. Faune anophélienne au Hodh el Gharbi et à Nouakchott


2.3.1. Récolte de la faune résiduelle
La récolte de la faune résiduelle a été faite entre 07H et 09H du matin. Elle consiste à
collecter les moustiques dans leurs lieux de repos le matin. Les investigations n'ont porté q ue
sur la faune endophile des habitations humaines. Après avoir recouvert le plancher de draps
blancs et fermé hermétiquement la pièce, il est procédé à une pulvérisation de pyréthrinoides
(YOTOX). Au bout de 10 minutes d’attente, les moustiques tombés (effet Knock down) sont
prélevés à l’aide de pinces souples dans des boîtes de Pétri. Sur chaque boîte sont reportés un
numéro et un indice correspondant respectivement à la localité et à la chambre.

Dans chaque localité, 10 chambres ont été prospectées lors de chacune des deux
enquêtes. Les récoltes ont été effectuées à Tintane et Koubeni pour la région du Hodh el
Gharbi et à Teyarett pour la ville de Nouakchott en 2010. La pulvérisation à été faite chaque
15 jours pendant la saison des pluies (Juillet, Aout, Septembre et Octobre).

2.3.2 Identification morphologique des moustiques adultes


Sur le terrain, les moustiques capturés ont été identifiés morphologiquement sous la
loupe binoculaire.

85
2.3.3. Conservation des moustiques adultes
Les femelles d'An. gambiae s.l. sont placées dans des micro tubes contenant un
dessiccateur (silica gel) et portant un numéro correspondant à celui du moustique sur la fiche
de terrain. Les têtes et thorax serviront pour la recherche de l'antigène circumsporozoïtique
par la technique ELISA et le reste de la femelle pour l'identification de l'espèce par la
technique PCR (pour le complexe An. gambiae)

2.3.4. Identification des me mbres du complexe gambiae


Les espèces du complexe Anophele gambiae sont indiscernables par la morphologie.
L’identification des espèces de ce complexe se fait alors par la PCR.

C’est une caractérisation basée sur l’ADN ribosomal (Scott et al., 1993) qui permet
d’identifier l’espèce où la forme moléculaire à laquelle appartenait chaque spécimen.

- Amorces utilisés

Cette PCR fait intervenir quatre amorces (Eurogentec) de 20 nucléotides dont un est
appelé universelle (UN), les trois autres sont spécifiques d’une des espèces du complexe An.
Gambiae. Les séquences de ces amorces sont les suivantes :

Universel (UN) : 5’ GTG TGC CCC TTC CTC GAT GT 3’ ;

An. gambiae s.s. (AG) : 5’ CTG GTT TGG TCG GCA CGT TT 3’ ;

An. arabiensis (AR) : 5’ AAG TGT CCT TCT CCA TCC TA 3’ ;

An. melas et An. merus (ML) : 5’ TGA CCA ACC CAC TCC CTT GA 3’

Ces amorces sont conditionnées en solution, dans l’eau ultra-pure à une concentration
de 100µM. Elles sont utilisées à 10µM, après une dilution de la solution mère.

- Extraction de l’ADN

La technique d’extraction d’ADN appliquée consiste à extraire l’ADN à partir des


pattes et des ailes de moustiques par le kit QIAamp Media MDx (QIAGEN 965752) en
utilisant l’appareillage Tissue Lyser (QIAGEN 85220) suivant les instructions du fabriquant.

- Procédures de la PCR

La PCR est effectuée dans un volume final de 25 µl du milieu réactionnel composé de:
8,4µl d’eau, 5µl du Tampon Taq, 1,5µl de MgCl2 (25 mM), 1 µl de la solution dNTPs
(20mM), 1 µl de chaque amorce (10µM), 5µl de l’ADN extrait (dilué1/10 dans l’eau ultra
pure) et 0,1 µl du Taq polymérase (Go Taq Flexi, 500 unités).

86
Le programme de l’amplification utilisé est le suivant : une étape de dénaturation à
94°C pendant 3 minutes, suivies de 40 cycles comportant chacun : une étape de dénaturation
pendant 30 secondes à 94°C, une hybridation pendant 30 secondes à 50°C et une étape
d’élongation pendant 30 secondes à 72°C. Une élongation finale à 72°C pendant 5 minutes a
été programmée à la fin du dernier cycle.

- Visualisation des produits de la PCR

Les produits de la PCR sont visualisés par une électrophorèse sur gel d’agarose à 2%

Préparé en dissolvant 2 g de poudre d’agarose dans 100 ml de Tris Borate EDTA


(TBE 1x).

La préparation est portée à ébullition pendant 2 minutes dans un four à micro-onde,


puis 5 µl de Bromure d’éthidium (BET) sont ajoutés au gel ava nt de le couler dans un moule
d’électrophorèse. Après la polymérisation du gel, 6 µl de mélange produit PCR et le tampon
de charge a été déposé par puits. Un marqueur de poids moléculaire de 100 paires de bases
(Smart Ladder) est introduit dans le gel pour l’estimation de la taille de différentes bandes.
L’électrophorèse se déroule sous une tension de 150 voltes à 100 mA pendant environ 1
heure. En fin le gel est placé dans une chambre à UV pour la visualisation des différents
fragments amplifiés sous la lumière ultraviolette pour déterminer les tailles des différents
fragments amplifiés.

Les tailles attendues des bandes sont : 315 pb pour An. arabiensis; 390 pb pour

An. gambiae s.s. et 464 pb pour An. melas et An. merus.

2.3.5. Recherche des formes sporozoites dans les glandes salivaires des moustiques
Pour chercher la présence de formes sporozoïtes du Plasmodium dans les glandes
salivaires des anophèles, nous avons utilisés la technique ELISA ou Enzyme-Linked
Immunosorbent Assay.

- Principe de la technique d’ELISA

Le principe de cette technique est de mettre en évidence, grâce à des anticorps


monoclonaux spécifiques, la présence, de l'antigène circumsporosoïtique (CSP), chez le
moustique vecteur. Cet antigène est la principale protéine de la surface des sporozoïtes de
Plasmodium humain.

La technique que nous avons utilisée est celle de " L’ELISA sandwich " indirecte de
Burkot et al., (1984) modifiée par Wirtz et al.,, (1987). Elle consiste à capturer l'antigène

87
circumsporozoïtique (CSP) grâce à un anticorps monoclonal anti-CSP (fixé sur les parois de
la plaque) et un autre anticorps monoclonal anti-CSP conjugué à la peroxydase.

La préparation des solutions et réactifs est présenté en (Annexe 2)

Procédures d’ELISA

- Préparation des échantillons à analyser

La tête et le thorax de chaque anophèle sont récupérés dans les tubes d’une plaque de
96 puits adapté au tissus lyser (Qiagen, 19560et 19566), puis sont ramollis avec 20µl de la
solution BB/Igepal et laissés à température ambiante pendant au moins une Heure. A l’aide
d’un broyeur automatique (Tissus lyser), les préparations sont broyées dans 190 µl de BB puis
compléter à 380 µl avant d’être conservées à – 20 C°.

- Sensibilisation des plaques avec les anticorps monoclonaux de


capture

Les puits des plaques d’ELISA sont sensibilisés, toute une nuit à température
ambiante, avec des solutions d’anticorps monoclonaux anti- CSP de capture (Pf2A10-CDC-
01, Pv-210-CDC ou Pv-247-CDC) à raison de 50µl par puits.

Le lendemain, les puits des plaques sont vidés sans lavage puis 200 µl de BB sont
distribués par puits pour saturer les sites non occupés par les anticorps anti- CSP de capture
puis laisser incuber pendant 1heure. En fin d’incubation les plaques sont vidées sans lavage.

- Addition des broyats de moustiques et révélation

Cinquante µl de broyat des anophèles sont distribués à raison d’un moustique par
puits. Pour les témoins positifs, 50 µl d'une solution d'antigène CSP synthétique est ajouté (en
ordre de 2pg/µl pour P.falciparum, 182pg/µl pour P. vivax 210 ou 91pg/µl pour P. vivax 247)
et pour les témoins négatifs on ajoute 50 µl de BB par puits.

Après deux heures d’incubation à la température ambiante, les puits des plaques sont
vidés puis lavés deux fois par le tampon phosphate salin (PBS) additionné au Tween 20.

Après lavage, les puits des plaques sont remplis à raison de 50 µl du mélange
d’anticorps monoclonaux anti-CSP conjugués à la peroxydase (Peroxidase labeled Pf2A10
Protéine A, Peroxidase labeled Pv-210-CDC ou Peroxidase labeled Pv-247-CDC).

Après une heure d’incubation à température ambiante, les puits des plaques sont vidés
puis lavés quatre fois au PBS-Tween 20. Après ce lavage, 100 µl de substrat de peroxydase

88
sont déposés par puits. Les plaques sont gardées à l’obscurité pendant 30 minutes puis 50 µl
d'acide sulfurique 4N sont ajoutés par puits pour arrêter la réaction enzymatique.

- Lecture

La lecture des plaques est faite à l’aide d’un lecteur ELISA à 450 nm. Le seuil de
positivité est défini en calculant le double de la moyenne des densités optiques des témoins
négatifs. Chaque échantillon positif a été vérifié par un deuxième test ELISA puis par une
PCR.

2.3.6. Confirmation de résultats d’ELISA par PCR


Nous avons fait appel à la biologie moléculaire pour confirmer l’infection des
Anophèles par Plasmodium. L’ADN parasitaire a été extrait à partir des mêmes broyats de
moustiques analysés en ELISA (en utilisant le kit d’extraction QIAamp Media MDx) pour la
caractérisation de l’espèce. Après cette extraction, l’amplification génomique de l’ADN est
faite par une PCR nichée.

2.4. Gîtes larvaires d’anophèles à Nouakchott.


Les prospections des collections d’eau, ont été effectuées durant la période allant de
Septembre à Octobre 2012, à raison d’une prospection chaque deux semaines. D’abord des
collections d’eau issues de pluie ont été prospectées mais après deux prospections
successives, qui consistent à vérifier la présence ou l’absence des larves de moustique, aucune
collection n’a été trouvée positive.

Ce constat nous a orientés vers la prospection des collections d’eau artificielles dont
les collections issues des eaux déversées de bornes fontaines (figure 22) et les cuves de
stockage d’eau potable dans les maisons.

Pour chaque gîte prospecté on a procédé comme suit :

- Prélèvement d’un échantillon d’eau pour les analyses physico-chimiques,

- Mesure de la densité larvaire

- Prélèvement d’un échantillon des larves,

En même temps que l'échantillonnage des larves, les dimensions des gîtes (Longueur,
largueur et profondeur) ont été mesurés à l'aide d'une règle métallique et les cordonnées GPS
ont été prises à l’aide d’un appareil type Garmin,).

89
Les paramètres physico-chimiques tels que le PH, la température, la turbidité, la
salinité, la conductivité et l’oxygène dissous ont été déterminés pour les eaux des gîtes
larvaires.

Les appareils utilisés pour déterminer ces paramètres sont :

- Un pH- mètre portatif HM-20P (DKK-TOA Corporation, Japon),

- Un turbidimètre portable TB-25A (DKK-TOA Corporation, Japon),

- Une conductivité mètre CE-21P (DKK-TOA Corporation, Japon),

- Un DO mètre-24P (DKK-TOA Corporation, Japon).

- Un thermomètre

Pour mesurer la densité des larves nous avons appliqué la méthode préconisée par
l’OMS. L’équipement de base de cette technique comprend:

- Une louche (environ 300 ml);

- Un plateau en plastique blanc de taille suffisante pour renverser le contenu de la


louche de manière à repérer les larves, à les individualiser et à les compter;

- Des pipettes en plastique souple avec un réservoir pour prélever les larves.

Utilisation de la louche

 Plonger la louche doucement dans l’eau en faisant un angle de 45°, jusqu’à ce


qu’un bord soit juste sous la surface.
 Pendant ce geste, il faut faire attention de ne pas déranger les larves et de ne pas
les faire disparaître au fond. Si elles ont été dérangées, attendre une minute ou deux et
continuer la récolte.
 Se déplacer le long du gîte, en effleurant la surface de l’eau avec la louche.
 Sortir la louche de l’eau en faisant attention de ne pas renverser l’eau contenant
les larves et les pupes.
 Garder la louche immobile jusqu’à ce que les larves et les pupes viennent à la
surface de l’eau.
 Aspirer les larves et les pupes à l’aide d’une pipette et les transférer dans un
flacon ou un tube.
 Ne pas rejeter l’eau restante dans le gîte, pour ne pas déranger les larves
et les pupes qui s’y trouvent encore.

90
- On note les références du gîte sur les contenants des larves et sur une fiche.

- On note la date, l’heure, le nombre de prélèvements (nombre de louchées) par gîte.

- On calcule la densité larvaire qui est égale au nombre de larves de 3ème et 4ème stades,
récoltées pour n louchées par gîte, rapporté à un litre d’eau du gîte.

De chaque gîte positif, jusqu'à cinq larves d'anophèles ont été recueillies et conservés
dans de l'éthanol 70° pour une identification ultérieure et les autres ont été placés dans des
cristallisoirs recouverts de moustiquaire et conservées vivantes jusqu'à l'émergence des
imagos. Les moustiques adultes émergents des ces échantillons ont été récoltés et identifiés
morphologiquement sous une loupe binoculaire à partir de clés de détermination (Gillies &
De Meillon, 1968 ; Gillies & Coetzee, 1987). Les spécimens adultes sont conservés
individuellement dans du Silicagel, à – 20°C, pour d’éventuelles analyses ultérieures.

L’ensoleillement de chaque gite larvaire a été estimé et la présence ou l’absence de


végétation a été vérifiée. Toutes les prospections ont été effectuées entre 12 H et 14H du
matin.

2.5. Analyses statistiques


Les données ont été enregistrées à l'aide d'Excel et ont été vérifiées pour la cohérence
avant l'analyse statistique en utilisant le logiciel R (version 2.10.1).

Toutes les variables qualitatives ont été construites pour avoir des effectifs équilibrés
dans les groupes.

Pour chaque collection d’eau positive, La présence de larves a été analysée en étant
une variable dépendante en utilisant un modèle de régression logistique.

Tout d'abord, une analyse descriptive des variables indépendantes a été réalisée puis
une analyse bivariée a été réalisée en introduisant chaque variable indépendante dans un
modèle de régression logistique.

La densité des larves pour chaque habitat a été analysée comme une variable
dépendante en utilisant une régression de Poisson. Tant pour la regression logistique que pour
le modèle de regression de Poisson, les variables ont été retenus pour l'analyse multivariée
lorsque leur effet a une valeur de p < 0,25.

Une procédure de sélection pas à pas en utilisant le critère d'information d'Akaike


(Akaike, 1973) a été appliquée pour retenir la signification à (p <0,05) des variables
indépendantes et de leurs interactions dans le modèle final.

91
3. Résultat
3.1. Faune anophélienne
3.1.1. Richesse spécifique de la faune anophélienne au Hodh el Gharbi et à Nouakchott.
Au total 1095 anophèles ont été récoltés dans tous les sites prospectés. L’identification
morphologique de ces anophèles a montré la présence de quatre espèces : An. rufipes qui
représente 52,79% (578/1095), An. gambiae s.l. qui représente 46,48% (509/1095) An.
pharoensis et An. funestus qui représente respectivement 0,46% (5/1095) et 0,27% (3/1095).
(Tableau10). Ces quatre espèces sont présente au niveau de deux sites du Hodh el Gharbi
(Kobeni et Tintane) par contre au niveau de site prospecté à Nouakchott (Teyarett) la seule
espèce rencontrée est An. gambiae s.l.

Tableau 10 : Richesse spécifique de la faune anophélienne de Kobeni et Tintane


(région du Hodh el Gharbi) et de Teyarett (Nouakchott) République Islamique de Mauritanie,
selon le site
Espèces identifiées
Nbre collectés An. gambiae s.l An. rufipes An. funestus An.pharoensis
Site d’étude
Hodh el Gharbi
Kobeni 693 293 394 2 4
Tintane 326 140 184 1 1
Total 1019 433 578 3 5
Nouakchott
Teyarett 76 76 0 0 0
Total 1095 509 578 3 5

3.1.2. Distribution des membres du complexe An. gambiae selon le site d’étude
Au total 506 spécimens appartenant au complexe An. gambiae s.l ont été identifiés par
la biologie moléculaire. Les résultats, de cette identification moléculaire, présentés dans le
tableau 11 montrent la présence de deux sous-espèces du complexe An. gambiae. Il s’agit
d’An. arabiensis qui prédomine (486/506) et An. gambiae s.s. qui est minoritaire (20/506). Ils
montrent aussi que ces deux espèces coexistent au niveau de deux sites de la région de Hodh
el Gharbi. Par contre à Nouakchott la seule espèce rencontrée est An. arabiensis (76/76).

92
Tableau 11: Distribution des membres de complexe gambiae du Hodh el Gharbi et de
Nouakchott selon le site.

me mbres du complexe gambiae identifiés


Nbre identifiés par PCR An. arabiensis An. gambiae.s.s An. melas An. merus
Site d’étude
Hodh el Gharbi
Kobeni 290 274 16 0 0
Tintane 140 136 4 0 0
Total 430 410 0 0 0
Nouakchott
Teyarett 76 76 0 0 0
Total 506 486 20 0 0

3.1.3. La présence de l’antigène circumsporozoïtique che z les anophèles


Sur un total de 506 anophèles (486 An. arabiensis et 20 An. gambiae s.s.) testés par
ELISA, une seule a présenté l'antigène circumsporosoïtique de P. vivax type VK210. Il s’agit
d’une An. arabiensis récoltée à Nouakchott. Ce qui correspond à un taux d’infection par P.
vivax de l’ordre de 1,72% (1/76). Ce résultat est confirmé par la biologie moléculaire qui a
démontrée la présence chez le même anophèle, d’une bande de 120 pb caractéristique de
P.vivax. Par contre à Nouakchott tous les anophèles ont été trouvés négatifs pour P.
falciparum.

Les résultats de l’ELISA montre aussi qu’aucun anophèles testé du Hodh el Gharbi
n’était trouvé porteur de l'antigène circumsporosoïtique de P. falciparum ni de P. vivax.

Tableau 12 : Résultats de la recherche des formes sporozoaires chez les Anopheles.

ELISA CSP Confirmation par PCR


Nbre de femelles testées P.vivax P.falciparum Nombre
Site d’étude
Hodh elgharbi
Kobeni 290 0 0 0
Tintane 140 0 0 0
Total 430 0 0 0

Nouakchott
Teyarett 76 1 (1.72%) 0 1

Total 506 1 (0.20%) 0 1

93
3.2. Gîtes larvaires d’anophèles à Nouakchott
Au total 51 collections d’eau (40 collections d’eau issues des pluies et 11 collections
issues des créations humaines dont 8 issues d’eau déversée des bornes fontaines et 3 cuves de
stockage d’eau potable ont été prospectées au niveau des arrondissements de Teyarett, Dar
Naim et Arafat. Aucune des 40 collections d’eau de pluies n’a été trouvé positive. Par contre
8/11 collections artificielles d’eau (issue des créations humaines) ont été trouvées positives
dont 7 issues des eaux déversées des bornes fontaine (Figure 21) et une cuve de stockage
d’eau potable.

Figure 21 : Borne fontaine à Teyarett (a) - la flèche indique la cuve où s’accumulent


les eaux qui se déversent pendant l’approvisionnement des charretiers - et plateau
contenqnt les larves d’anophèles collectées de cette cuve (b).

94
3.2.1. Caractéristiques générales des gîtes larvaires d’anophèles positifs

Le tableau 13 présente les noms, le type, la position géographique, l’abondance des


larves et les stades larvaires rencontrés pour les gîtes larvaires artificielles à Nouakchott. Il
montre que les gîtes larvaires se repartissent en sept collections d’eau déversée de borne
fontaine et une cuve de stockage d’eau de maison. L’abondance des larves varie entre 20 à 80
larves (le nombre moyen de larves collectées lors de cinq prélèvements de chaque gite
larvaire). Les stades larvaires L2 et L4 sont présents dans chaque gite larvaire sauf dans celui
d’Elmechroue qui contient seulement les stades L1 et L2.

Au total 132 anophèles gambae s.l ont émergés a partir des larves collectées de ces
gites positives à Nouakchott.

95
Tableau 13 : Localisation géographique, abondance et stade larvaire de gîtes larvaires d’anophèles au niveau de trois
arrondissements de Nouakchott.

Arrondissement Sites Type d’habitat Longitude Latitude Altitude (m) Abondance des larves Stades larvaires

Dar Naim Ould Badou Eau déversée de borne fontaine 18°06’60’’N 15°55’20’’W 2 50 3rd , 4th

Hay Saken Eau déversée de borne fontaine 18°07’27’’N 15°55’60’’W 6 80 3rd , 4th

Teyarett Mgueizira Eau déversée de borne fontaine 18°06’59’’N 15°56’21’’W 4 30 3rd , 4th

Lycée Teyarett (1) Eau déversée de borne fontaine 18°07’37’’N 15°56’13’’W 2 20 3rd , 4th

Lycée Teyarett (2) Eau déversée de borne fontaine 18°07’36’’N 15°56’12’’W 1 25 3rd , 4th

Dar el Barka Eau déversée de borne fontaine 18°08’22’’N 15°55’29’’W 3 40 3rd , 4th

El Mechrou Cuve d’eau de maison 18°08’05’’N 15°55’58’’W 3 50 1st , 2nd

Arafat Mallah Eau déversée de borne fontaine 18°04’08’’N 15°56’50’’W 5 25 3rd , 4th
3.2.2. Caractéristiques physico-chimiques des gîtes positifs à Nouakchott.
Le tableau 14 représente les caractéristiques physico-chimiques des gîtes larvaires
positifs. Les profondeurs des gîtes, largeurs et longueurs variaient de 25 à 150, 60 à 170 et 30
à 250 cm respectivement. La température des gîtes larvaires lors de la collecte des larves a
varié de 25° C à 29° C. Les résultats d’analyses chimiques montrent que le pH varie peu entre
les gîtes larvaires (7,41 à 8,22). La salinité de l'eau a varié entre 0,07 g / l pour le gite d’El
Mechroue et 0,2 g / l pour les gîtes du Lycée Teyarett 1 et 2. La conductivité des échantillons
d'eau testés est généralement faible. La conductivité la plus élevée (1949μs/cm), par rapport
aux autres gîtes larvaires d’anophèles positifs, a été enregistré au niveau de gite larvaire Ould
Badou située à Dar Naim

L’échantillon d'eau d’El Mechroue (réservoir d'eau potable des ménages) était cla ir
(turbidité = 0,98 NTU) suivi des échantillons de Hay Saken et Mgueizira (eau déversée de
bornes fontaines) qui sont légèrement troubles avec une turbidité de 24 et 25 NTU
respectivement et les échantillons restants, toutes les eaux évacuées de bornes fontaines
publiques, étaient troubles avec une turbidité allant de 70 à 157 NTU.

La concentration en oxygène dissous la plus faible (0,9 mg / l) a été observée au


niveau de gite larvaire de El Mechroue (cuve d’eau potable). La concentration en oxygène
dissous la plus élevée (8,01 mg / l) a été notée dans l'échantillon Mgueizira.

Toutes les collections d’eau échantillonnées, sauf celle d'El Mechroue, avaient un
ensoleillement partiel ou total.

97
Tableau 14. Caractéristiques physico-chimique des gîtes larvaires positives à Nouakchott.

Oxygène
Largeur Longueur Conductivité Turbidité Température
Sites Profondeur (cm) Salinité (g/l) pH dissous Situation d’ensoleillement
(cm) (cm) (µsec/cm) (NTU) (°C)
(mg/l)

Ould Badou 45 80 170 1949 88 26 0.10 7.41 7.87 Ensoleillement total

Hay Saken 110 170 30 252 24 25 0.10 7.61 7.1 Ensoleillement total

Mgueizira 30 60 60 275 25 27 0.10 7.50 8.01 Ensoleillement partiel

Lycée Teyarett 130 150 150 437 70 29 0.20 7.60 7.20 Ensoleillement partiel
(1)

Lycée Teyarett 65 150 250 378 157 28 0.20 7.69 7.50 Ensoleillement partiel
(2)

Dar el Barka 80 150 150 182 80 25 0.10 8.04 7.05 Ensoleillement partiel

El Mechrou 150 150 200 135 0.95 26 0.07 8.22 0.90 Ombragé

Mallah 25 100 200 131 92 25 0.10 7.52 7.04 Ensoleillement partiel


3.2.3. Analyse bivariée par régression logistique et de Poisson des facteurs physico-
chimiques contribuant à la positivité des gîtes.
Pour étudier les facteurs physicochimiques contribuant à la positivité des gîtes
prospectés d’une part et conditionnant d’autre part, la densité larvaire dans ces gîtes, nous
avons procédé respectivement à une analyse bivariée par régression logistique et de Poisson.
Les résultats de ces analyses sont présentés respectivement dans les tableaux 15 et 16.

D’après le tableau 15, la positivité des collections d’eau prospectées à Nouakchott


dépend significativement des paramètres stabilité (p = 0,0001), ensoleillement (p = 0,0004),
profondeur de la collection d’eau (p = 0,0053), largeur et salinité de la collection d’eau (p =
0,0259), longueur et conductivité de la collection d’eau (p = 0,0322) et l’oxygène dissous (p =
0,0439).

Une analyse bivariée par régression de Poisson appliquée aux gîtes positifs pour
modéliser la densité larvaire (tableau 16) montre que les paramètres relatifs à la profondeur du
gîte (p = 0,0009), la conductivité (p = 0,0001), la température (p < 0,0001), la salinité (p <
0,0001), le pH (p = 0,0001), l’oxygène dissous (p = 0,0001), l’ensoleillement du gite (p <
0,0001) et la turbidité (p = 0,0257) sont significativement corrélés à la densité larvaire.

99
Tableau 15 : Analyse bivariée par régression logistique de la positivité larvaire des
collections d’eau dans la ville de Nouakchott.

Paramètres N P % (95%IC) ORb (95%IC) p-value


Stabilité
Stable 8 7 87.5 (47.3-99.7) 1.00
Eau instable et recyclée 43 1 2.3 (0.1-12.3) 0.01 (0.00-0.09) 0.0001
Profondeur
≤ 25 cm 32 1 3.1 (0.1-16.2) 1.00
> 25 cm 19 7 36.8 (16.3-61.6) 22.56 (2.53-201.41) 0.0053
Largeur
< 180 cm 25 8 32.0 (15.0-53.5) 1.00
≥ 180 cm 26 0 0.0 (0.0-13.2) 0.09 (0.01-0.74) 0.0259
Longueur
≤ 250 cm 26 8 30.8 (14.3-51.8) 1.00
> 250 cm 25 0 0.0 (0-13.7) 0.09 (0.01-0.82) 0.0322
Conductivité
< 2500 µsec/cm 26 8 30.8 (14.3-51.8) 1.00
≥ 2500 µsec/cm 25 0 0.0 (0-13.7) 0.09 (0.01-0.82) 0.0322
Turbidité
< 10 NTU 20 1 5.0 (0.1-24.9) 1.00
≥ 10 NTU 31 7 22.6 (9.6-41.1) 6.61 (0.76-57.62) 0.0875
Température
≤ 26°C 36 5 13.9 (4.7-29.5) 1.00
> 26°C 15 3 20.0 (4.3-48.1) 1.25 (0.27-5.83) 0.7763
Salinité
< 2.2 g/L 25 8 32.0 (15.0-53.5) 1.00
≥ 2.2 g/L 26 0 0.0 (0.0-13.2) 0.09 (0.01-0.74) 0.0259
Ph
< 7.7 24 6 25.0 (9.8-46.7) 1.00
≥ 7.7 27 2 7.4 (0.9-24.3) 0.38 (0.08-1.71) 0.2044
Oxygène dissous
< 6 mg/L 28 1 3.6 (0.1-18.3) 1.00
≥ 6 mg/L 23 7 30.4 (13.2-52.9 5.69 (1.05-30.83) 0.0439
Ensoleillement
ensoleillement total 40 2 4.8 (0.6-16.2) 1.00
Ombragé 9 6 66.7 (29.9-92.5) 26.00 (4.23-159.91) 0.0004

N = total ; P = collections d’eau positives. ORb = Odd ratio brut (rapport des cotes) ;
IC95% = intervalle de confiance à 95%.

100
Tableau 16: Analyse bivariée par régression de Poisson de la densité larvaire dans les
gîtes larvaires au niveau des différents sites à Nouakchott.

Paramètres N ORb (95%IC) p-value


Stabilité
Stable 7 1.00
Eau instable et recyclée 1 1.3 (0.96-1.75) 0.0919
Profondeur
< 73 cm 4 1.00
≥ 73 cm 4 1.46 (1.17-1.83) 0.0009
Largeur
< 150 cm 3 1.00
≥ 150 cm 5 1.23 (0.97-1.55) 0.0838
Longueur
< 160 cm 4 1.00
≥ 160 cm 4 0.88 (0.71-1.10) 0.2640
Conductivité
< 263 µsec/cm 4 1.00
≥ 263 µsec/cm 4 0.64 (0.51-0.80) 0.0001
Turbidité
< 75 NTU 4 1.00
≥ 75 NTU 4 0.78 (0.62-0.97) 0.0257
Température
≤ 26°C 5 1.00
> 26°C 3 0.51 (0.39-0.66) < 0.0001
Salinité
≤ 0.1 g/L 6 1.00
> 0.1 g/L 2 0.49 (0.61-0.97) < 0.0001
pH
< 7.61 4 1.00
≥ 7.61 4 1.56 (1.25-1.95) 0.0001
Oxygène dissout
≤ 7.1 mg/L 4 1.00
> 7.1 mg/L 4 0.64 (0.51-0.80) 0.0001
Ensoleillement
ensoleillement total 2 1.00
Ombragé 6 0.49 (0.39-0.61) < 0.0001

N = total. ORb = Odd ratio brut (rapport des cotes) ; IC95% = interva lle de confiance
à 95%.

101
4. Discussion
Les investigations entomologiques avaient pour objectifs de caractériser la faune
anophélienne au Hodh el Gharbi et à Nouakchott, d’évaluer son implication dans la
transmission du paludisme et d’identifier et caractériser les gîtes larvaires d’anophèles à
Nouakchott. Les méthodes de collecte de moustiques utilisées s'inscrivent dans cette optique.
En l'absence des classiques captures nocturnes sur homme volontaire, nous avons
préférentiellement ciblé les espèces endophiles collectées après pulvérisation intra-
domiciliaire de pyréthrinoîdes en 2010. Cependant, en 2012 les prospections ont été
consacrées à la recherche des gîtes larvaires d’anophèles à Nouakchott.

La richesse spécifique a varié selon la région. Ainsi au Hodh el Gharbi, le nombre


d'espèces anophéliennes récoltées était de quatre. Alors qu’à Nouakchott il y avait une seule
espèce. La comparaison de la faune anophélienne des deux régions montre la présence d’An.
rufipes, An. funestus et An. pharoensis au Hodh el Gharbi et l’absence de ces espèces à
Nouakchott. La présence de ces trois espèces au Hodh El Gharbi a été précédemment signalée
par Nabeth et al., 2001 au cours d’une enquête entomologique suite à une épidémie de la
fièvre de la vallée du Rift survenue en 1998 dans cette région.

Par contre An. gambiae s.l est présent dans les deux régions mais elle est la seule
espèce rencontrée à Nouakchott. La présence d’An. gambiae s.l à Nouakchott (Zone
Saharienne) a été signalée pour la première fois lors d’une enquête de l’OMS (Coulibaly,
1997). Cette présence a été confirmée 12 ans plus tard par Mint Lekweiry et al., (2009) qui
ont identifiés An. arabiensis et An. pharoensis dans l’arrondissement de Dar Naim.

La prédominance du complexe An. gambiae en Mauritanie a été rapportée par les


différentes enquêtes entomologiques conduites jusqu’à nos jours dans le pays (Sautet et al.,
1948; Dia et al., 2009; Mint Lekweiry et al., 2009).

La présence remarquable d’An. rufipes au Hodh el Gharbi 578/1019(56.75%) et son


absence totale à Nouakchott pourrait être expliquée par l’effet que les localités prospectés au
Hodh el Gharbi (Kobeni et Tintane) sont des localités d’élevage. la présence dans les
habitations humaines de cette espèce n'est pas rare (Julvez et al., 1998 ; Hamon et al., 1964)
surtout dans les localités d'élevage. Cette espèce endophile se nourrit sur les animaux
domestiques et n'est qu'accidentellement capturée sur l'homme.

L'identification par PCR des espèces du complexe An. gambiae a révélé la présence
d'An. arabiensis et d'An. gambiae s.s. à Kobeni et à Tintane, dans la région du Hodh el Gharbi
avec prédominance d'An. arabiensis. A Teyarett, arrondissement de Nouakchott,

102
l'identification An. gambiae s.l. a révélé la présence uniquement d'An. arabiensis. La
prédominance d’An. arabiensis au sein du complexe An. gambiae était attendue en
Mauritanie. Elle confirme les observations faites sur la distribution des espèces du complexe
An. gambiae (Coetzee et al., 2000).

Deux (An. gambiae s.s. et An. arabiensis) des trois espèces ouest africaines du
complexe An. gambiae ont été identifiées en sympatrie dans les sites du Hodh el Gharbi. Ces
deux espèces sont des vecteurs majeurs du paludisme en Afrique de l’ouest (Mouchet et
Carnevale, 1991, Faye et al., 1993, 1995a & b ; Konaté et al., 1994). .

Selon Coz (1973), la zone de recouvrement de ces deux vecteurs est très importante et
on les trouve souvent en sympatrie.

Aucune femelle infectée n’a été trouvée au Hodh el Gharbi. Un indice sporozoïtique
de l’ordre de 0,45% (2/444) avait été enregistré par Hamon et al., (1964). Cet indice avait été
trouvé après dissection des glandes salivaires des femelles. L’indice sporozoïtique nul
enregistré dans notre cas pourrait être expliqué par l’effet que son évaluation a été effectuée
sur un effectif moins nombreux et collecté par une seule technique et à un seul moment.
Cependant une meilleure évaluation de l’indice sporozoïtique dans une zone comme la notre
où la transmission du paludisme est supposée être saisonnière courte nécessite de tester un
grand effectif d’An. gambiae s.l. collecté à différents moments et par différentes techniques.

Par contre à Nouakchott un indice sporozoïtique de l’ordre de 1.72 % de P. vivax chez


An. arabiensis a été enregistré. Ce résultat prouve une fois de plus l’existence à Nouakchott
d’une transmission autochtone du paludisme à P. vivax et l’implication de An. arabiensis dans
cette transmission.

Par ailleurs, La recherche de gîtes larvaires d’anophèles à Nouakchott nous a amené à


prospecter deux types de collection d’eau à savoir, les collections d’eau issues des pluies et
celles issues d’activés humaines.

Toutes les collections d’eau issue de pluies prospectées ont été trouvées négatives.
L'absence de larves d'anophèles dans les collections d'eau issues des pluies dans la ville de
Nouakchott (milieu urbain) pourrait être expliquée par : i) la texture sableuse du sol des sites
prospectés qui ne sont pas en mesure de préserver les eaux des précipitations sur la surface. ii)
l'absence à Nouakchott d'un réseau d'évacuation des eaux usées, d'un enlèvement régulier des
ordures domestiques et déchets divers, les collections d’eau dans la ville sont fréquemment
sales, fortement polluées: les larves ne peuvent s'y développer.

103
En revanche, toutes les collections d’eau artificielles prospectées ont été productives
pour les larves d'anophèles. Ces créations humaines sont constitués de deux types : les eaux
déversées des bornes fontaines et les cuves de stockage d’eau potable dans les maisons.

D’après plusieurs auteurs, les anophèles appartenant au complexe An. gambiae sont
connus pour leur capacité d’utiliser des collections d’eau de types variés comme des gîtes
larvaires, notamment les mares résiduelles ensoleillées, eaux saumâtres, etc. ( Mouchet et al.,
2004, Kiszewki et al., 2004 et Gimonneau et al., 2012).

A. gambiae s.l. utilise de façon préférentielle des mares résiduelles des surfaces
stagnantes ensoleillées dans plusieurs régions d’Afrique (Mouchet et al., 2004 ; Diabaté et al.,
2013).

La présence des larves d’anophèles dans les collections d'eau résultant des activités
humaines a également été signalée (Gimning , 2001, Fillinger et al.,2009).

L’identification morphologique des imagos ayant émergé des larves d’anophèles


prélevées de ces gîtes, montre qu’ils sont tous des anophèles gambiae s.l.

La présence d’Anopheles gambiae s.l à Nouakchott a été rapportée précédemment


(Mint Lekweiry et al.,2009).

L'importance d’An. gambiae (s.l.) dans la ville de Nouakchott est clairement établie
par notre étude. L’An. gambiae (s.l) semble être la seule espèce endophile responsable de la
transmission du paludisme dans cette ville.

La même situation a été observée dans d’autres villes à Kinshasa (Coene et al., 1993),
au Cameroun (Manga et al., 1997), en Gambie (Jawara et al., 2008) et au Sénégal, ou les
céanes (puits sans margelle utilisés pour les activités maraîchères) de la région de Dakar
constituent des gîtes hébergeant les stades pré imaginaux d’An. arabiensis (Awono-Ambene,
1996).

Les larves de complexe An. gambiae, en particulier An. arabiensis et An. gambiae s.s.
sont généralement associées à des petites et peu profondes collections d'eau douce (Gilles MT
et Coetzee MA., 1987). Les femelles du complexe An. gambiae sont connues pour préférer les
milieux ensoleillés ouverts, sans végétation pour la ponte et souvent avec de l'eau trouble et
de basses conductivités (Edillo et al., 2002, Shililu et al., 2003).

La présence de l’An. gambiae s.l. dans la ville de Nouakchott a été clairement associée
à la productivité et à la permanence des gîtes larvaires, qui sont liés aux activités anthropiques
et l’urbanisation.

104
D’autre part, un autre phénomène peut contribuer à la propagation et l’installation du
vecteur dans la ville de Nouakchott qui profite de la dégradation du réseau d’eau potable, mal
entretenu pour venir pondre dans les flaques d’eau temporaire ou les diverses petites mares
créées par les fuites (Karch et al.,1992 ; Gimonneau et al., 2012). Cependant, depuis la mise
en service du projet Aftout Sahli (projet d’alimentation de la ville de Nouakchott en eau
potable à partir du fleuve Sénégal) en 2010, vu la vétusté du réseau, la pression de l’eau a été
telle que bon nombre de tuyaux formant le réseau n’ont pas pu la supporter entrainant ainsi
l’éclatement quasi-quotidien des tuyaux partout dans les différents quartiers de la ville.

Les caractéristiques physico-chimiques des gîtes larvaires des anophèles à Nouakchott


sont généralement en accord avec les gîtes larvaires d’anophèles précédemment décrits.

Ces gîtes larvaires diffèrent dans leurs caractéristiques physiques ainsi que chimiques
et biologiques, qui influent directement sur la répartition et l'abondance de populations
larvaires dans la nature.

La positivité larvaire des collections d’eau prospectées à Nouakchott dépe nd des


paramètres stabilité, ensoleillement, profondeur, largeur et salinité, longueur et conductivité et
oxygène dissous de la collection d’eau.

La densité larvaire dans les gîtes positifs est corrélée avec les paramètres relatifs à la
profondeur du gite, sa conductivité, sa température, sa salinité, son pH, sa turbidité,
l’ensoleillement du gite et sa teneur en oxygène dissous.

L'écologie des larves d’anophèles étant complexe, nécessite de développer un cadre


rationnel pour entreprendre des études d’écologie larvaire locales afin de déterminer les
paramètres bioécologiques influant sur la dynamique de la population des larves de
moustiques (Imbahale et al., 2011; Diabaté et al., 2013).

Cependant, il ressort de nos résultats que les paramètres bioécologiques étudiés,


notamment la profondeur de gite, sa conductivité, sa température, sa salinité, son pH, sa
turbidité, l’ensoleillement du gite et sa teneur en oxygène dissous, sont des facteurs corrélés
avec la densité larvaire, dans les gîtes larvaires positifs à Nouakchott.

Il est donc clair qu’à Nouakchott, le développement de bornes fontaines publiques et


l'utilisation de réservoirs de stockage d'eau des ménages ont généré des conditions favorables
pour le développement des stades aquatiques d’anophèles dans cette ville saharienne.

105
5. CONCLUSION
Il ressort des investigations entomologiques entreprises à Nouakchott et au Hodh el
Gharbi, la présence de deux (An. gambiae ss et An. arabiensis) des trois espèces ouest
africaines du complexe An. gambiae ont été identifiées en sympatrie au Hodh elgharbi. Ces
deux espèces sont des vecteurs majeurs du paludisme en Afrique de l’ouest (Mouchet et
Carnevale, 1991, Faye et al., 1993 ; 1995a & b ; Konaté et al.,1994 ). Ces deux espèces sont
impliquées dans la transmission palustre dans cette région prédominée par P. falciparum.

À Nouakchott An. arabiensis est responsable d’une transmission palustre à P. vivax.


Les eaux déversées de bornes fontaine et les cuves de stockage d’eau potable dans les
maisons constituent des gites larvaires d’anophèles dans cette ville.

Cependant, il ressort de nos résultats que les paramètres bioécologiques étudiés,


notamment la profondeur de gite, sa conductivité, sa température, sa salinité, son pH, sa
turbidité, l’ensoleillement du gite et sa teneur en oxygène dissous, sont des facteurs corrélés
avec la densité larvaire, dans les gîtes larvaires positifs à Nouakchott. Il est donc clair que le
développement de bornes fontaines publiques et l'utilisation de réservoirs de stockage d'eau
des ménages ont généré des conditions favorables au développement des stades aquatiques
d’anophèles dans cette ville saharienne.

106
CONCLUSION GENERALE
ET PERSPECTIVES
L’étude de la morbidité palustre, du polymorphisme allélique des isolats de P.
falciparum ainsi que les investigations entomologiques effectuées à Nouakchott (Zone
Saharienne) et au Hodh el Gharbi (Zone Sahélienne) en Mauritanie a permis de dégager les
conclusions suivantes :

 Une forte incidence saisonnière du paludisme à P. falciparum et à P. vivax


respectivement au Hodh el Gharbi et à Nouakchott. Cette forte incidence
reflète une forte transmission saisonnière dans les deux zones.

 Un polymorphisme des familles alléliques K1, Mad20 et Ro33 du gène msp-1


et des valeurs de MOI relativement importants des isolats de P. falciparum
comparables à ceux observés dans les régions ayant un niveau d’endémicité
palustre élevé.

 La mise en évidence d’une transmission autochtone du paludisme à P. vivax à


Nouakchott assurée par An. arabiensis qui est la seule espèce rencontrée dans
la ville.

 Les eaux déversées de bornes fontaines et les cuves de stockage d’eau potable
des habitations sont les principaux gîtes d’anophèles à Nouakchott.

 La présence, en sympatrie, au Hodh el Gharbi d’An. gambiae s.s et d’An.


arabiensis, deux espèces vectrices du paludisme en Afrique de l’Ouest et leur
implication dans la transmission palustre dans cette région.

107
Pour mieux approfondir les connaissances sur la transmission du paludisme en Mauritanie,
il conviendrait de :
 Conduire des recherches entomologiques approfondis en utilisant plusieurs
techniques et méthodes (capture sur appât humain, la dissection, Elisa repas du sang,
faune résiduelle…….) pour déterminer les principaux paramètres entomologiques liés
à la transmission,

 Elargir l’étude à d’autres sites sentinelles pour évaluer la transmission en identifiant


les espèces d’Anopheles présentes et en déterminant leur rôle dans la transmission,

 Réévaluer la transmission palustre à Nouakchott et au Hodh Elgharbi à un intervalle


régulier ;

 Estimer le niveau de susceptibilité aux insecticides chez les vecteurs majeurs et


identifier d’éventuels mécanismes de résistance aux insecticides chez les populations
naturelles de vecteurs.
 Comparer en utilisant la génétique de populations la faune anophelienne de
Nouakchott à celle du Hodh Elgarbi,

 Evaluer la prévalence du déficit en Glucose-6-Phosphate Déshydrogénase (G6PD)


chez la population Nouakchottoise, dans la perspective de l’introduction de la
primaquine dans le schéma thérapeutique du paludisme à P. vivax à Nouakchott. La
primaquine est efficace contre les formes hépatiques dormantes (hypnozoites) de cette
espèce qui sont à l’origine des reviviscences qui caractérise le paludisme à P. vivax.

108
REFERENCES
BIBLIOGRAPHIQUES
Aguiar. J. C., Albrecht. G. R., Cegielski. P., Grenwood. B. M., Jensen. J. B., Lallinger. G.,
Martinez. A., McGregor. I. A., Minjas. J. N. & Neequaye. J. 1992. Agglutination
of P. falciparum – infected erythrocytes from east and West African isolates by
human sera from distant geographic regions. American Journal Tropical Medicine
Hygiene; 47 (5) : 621-632.

Anderson TJ, Haubold B, Williams JT, Estrada-Franco JG, Richardson L, Mollinedo R,


Bockarie M, Mokili J, Mharakurwa S, French N, Whitworth J, Velez ID,
Brockman AH, Nosten F, Ferreira MU et Day KP. 2000 Microsatellite markers
reveal a spectrum of population structures in the malaria parasite Plasmodium
falciparum. Mol Biol Evol 17(10): 1467-82.

Anne-Marie. D., Levillayer. H & Jean-Louis. P. 1998. Diagnostic de paludisme.


Développement et santé : 138.

Ariey. F., Chalvet. W., Hommel. D., Peneau. C., Hulin. A., Mercereau-Puijalon. O.,
Duchemin. J-B., Sarthou. J-L., Reynes. J-M & Fandeur. T. 1999. Plasmodium
falciparum parasites in french Guiana: Limited genetic diversity and High selfing
rate. Am.J.Trop.Med.Hyg, 61(6): 978-985.

Aubouy. A., Migot-Nabias. F & Deloron. P. 2003. Polymorphism in two merozoite surface
proteins of P.falciparum isolates in Gabon. Malaria Journal; 2: 1-6.

Awono-Ambene H.P. 1996 Bioécologie préimaginale d’Anopheles arabiensis (Diptera :


Culicidae) dans les céanes (puits maraîchers) de Dakar, Sénégal. Mémoire de
DEA. Université de Dakar Sénégal, 83 pages.

Babiker HA, Lines J, Hill WG, Walliker D. 1997 Population structure of Plasmodium
falciparum in villages with different malaria endemicity in east Africa. Am J Trop
Med Hyg 56:141–147.

Baker J., et al., 2005 Genetic diversity of Plasmodium falciparum histidine-rich protein 2
(PfHRP2) and its effect on the performance of PfHRP2-based rapid diagnostic
tests. J Infect Dis, 2005. 192(5): p. 870-7.

Barbié Y et Timbila R. 1964 Notes sur le paludisme en République Islamique de Mauritanie.


Med Trop 24: 427-436 .

Basco LK, Ringwald P. 2001 Molecular epidemiology of malaria in Yaounde, Cameroon.


VIII. Multiple Plasmodium falciparum infections in symptomatic patients. Am J
Trop Med Hyg 65:798–803.

109
Baudon D, Robert V, Darriet F, Huerre M. 1986. Impact de la construction d’un barrage avec
retenue d’eau sur la transmission du paludisme. Enquête paludologique menée
dans le Sud-Est de la Mauritanie. Bull Soc Pathol Exot 79:123–129.

Baudon D. 2010 Les faciès épidémiologiques des paludismes en Afrique subsaharienne:


conséquences pour la lutte antipaludique. Sci Méd Afr2, (1), 141-145.

Bogreau H, Renaud F, Bouchiba H, Durand P, Assi SB, Henry MC, Garnotel E, Pradines B,
Fusai T, Wade B, Adehossi E, Parola P, Kamil MA, Puijalon O et Rogier C 2006.
Genetic diversity and structure of African Plasmodium falciparum populations in
urban and rural areas. Am J Trop Med Hyg 74(6): 953-9.

Brenier-Pinchartm M P, Pinel C, Grillot R, Ambroise-Thomas P. 2000 Le diagnostic du


paludisme dans les régions non endémiques : valeur, limites et complémentarité
des méthodes actuelles. Ann Biol Clin 58 : 310-6.

Bronner U., Divis, P.C.S., Farnert, A., Singh, B., 2009 Swedish traveller with Plasmodium
knowlesi after visiting Malaysian Borneo: a case report. Malaria Journal 8,15.

Bryskier A., Labro. 1988 Paludisme et Médicaments. Edit. Arnette. 2, rue Casimir-Delavigne
Paris.

Burkot TR, Williams Jl and Schneider I: Identification of Plasmodium falciparum- infected


mosquitoes by a double antibody enzyme- linked immunosorbent assay. The
American Journal of Tropical Medicine and Hygiene 1984, 33: 783-788.

Carlson J., Olson, K., Higgs, S., et Beaty, B. 1995 Molecular genetic manipulation of
mosquito vectors: Annual Review of Entomology, v. 40, p. 359-388.

Carnevale P. 1974 Variations saisonnières d’une population d’Anopheles nili (Theo), 1904 en
république populaire de Congo. Ent Méd et Parasitol 12(3) : 165-174.

Carnevale P and Mouchet J. 1990 Vector control and malaria control. Med Trop 50: 391–8.

Carnevale P, Le Goff G, Toto JC and Robert V.1992 Anopheles nili as the main vector of
human malaria in villages of southern Cameroon. Med Vet Entomol 6:135-138.

Carnevale P., Robert V. 2009 Les anophèles, Biologie, transmission du Plasmodium et lutte
antivectorielle. Marseille : IRD Éditions 391 p.

Certa. U., Rotmann. D., Matile. H. & Reber-Liske. R. 1987. A naturally occurring gene
encoding the major surface antigen precursor p 190 of Plasmodium falciparum
lacks tripeptide repeats. The EMBO Journal; 6: 4137-4142.

Chandramohan D., Jaffar S. and Greenwood B. 2002 Use of clinical algorithms for
diagnosing malaria. Trop Med Int Health 7(1): p. 45-52.

110
Charlionet. R. & Rivat. C. 1990. Electrophorèse- Principes et concepts méthodologiques.
Edition INSERM, Paris, : 155 pages.

Chateau B, Perrin N, Ould Samba D, Diarra T.2007 La distribution d’eau potable dans la ville
de Nouakchott, Mauritanie: Analyse des points de vente d’eau CUN, IDF, GRET
25.

Coene J, 1993. Malaria in urbain and rural Kinshasa: the entomological input. Med Vet
Entomol ; 7: 127 - 37.

Coetzee M., Craig M. & le Sueur D., 2000 - Distribution of African malaria mosquitoes
belonging to the Anopheles gambiae complex. Parasitology Today 16 (2), 74-77.

Coluzzi, M., 2002 Plasmodium falciparum en Afrique subsaharienne. Spéciation récente des
vecteurs, transmissibilité, évolution de la pathogenèse contrôle de la malaria et
capacité vectorielle. : Ann. Inst. Pasteur Actualites, p. 81-99.

Contamin H., Fandeur T., Bonnefoy S., Skouri F., Ntoumi F. & Mercereau-Puijalon O. 1995.
PCR Typing of Field Isolates of Plasmodium falciparum. Journal of Clinical
Microbiology; 33 (4): 944-951.

Cortes H, Morillas-Marquez F and Valero A.2003 Malaria in Mauritania: the first cases of
malaria endemic to Nouakchott. Trop Med Int Health 8:297-300.

Coulibaly A.1997. Analyse du syste`me vectoriel du district de Nouakchott. Programme


National de Lutte Contre le Paludisme,OMS Mauritanie.

Cox-Singh J., Timothy D., Kim-Sung L., Sunita S., Asmad M. et al., 2008. Plasmodium
knowlesi malaria in human is widely distributed and potentially life threatening.
Clinical infectious diseases: an official publication of the Infectious Diseases
Society of America, 46 (2): 165-171.

Coz J., 1973 Contribution à l’étude du complexe An. gambiae. Répartition géographique et
saisonnière en Afrique de l’Ouest. Cah. ORSTOM, Sér. Ent. Méd. Parasitol., 11,
(1), 3-31

Curtis C.F. 1996 Impregnated bed nets, malaria control and child mortality in Africa: Tropical
medicine and international Health, v. 1, p. 137 - 138.

Darriet F., N’guessan R., Carnevale P.2000 Evaluation en cases-pieges de l’effet protecteur
de moustiquaires non impregnees d’insecticides dans la prevention des piqures
d’Anopheles gambiae s.s. Cahiers Santé, 10 : 413-417.

Dia I, Ba H, Ould mohamed S A, Diallo D, Lo B and Diallo M. 2009 Distribution, host


preference and infection rates of malaria vectors in Mauritania. Parasites and
Vectors 2:61.

111
Diabaté A, Bilgo E, Dabiré KR and Tripet F. 2013 Environmentally friendly tool to control
mosquito populations without risk of insecticide resistance: the Lehmann's funnel
entry trap.Malaria Journal, 12:196.

Djimde A, Doumbo OK, Cortese JF, Kayentao K, Doumbo S, Diourte Y, Dicko A, Su XZ,
Nomura T, Fidock DA, Wellems TE, Plowe CV, Coulibaly D. 2001 A molecular
marker for chloroquine-resistant falciparum malaria. N Engl J Med 344:257–263.

Djogbénou L. 2009 Lutte antivectorielle contre le paludisme et résistance des vecteurs aux
insecticides en Afrique. Med Trop 69 : 160-164.

Doannio J.M.C., Dossou- yovo J., Diarrassouba S., Rakotondraibe M.E., Chauvancy G.,
Chandre F., Riviere F., Carnevale P. 2002 La dynamique de la transmission du
paludisme à Kafiné, un village rizicole en zone de savane humide de Côte
d'Ivoire. Bull Soc Pathol Exot 95, (1), 11-16.

Dong K. 1997 A single amino acid change in the para sodium channel protein is associated
with knockdown-resistance (kdr) to pyrethroid insecticides in German cockroach.
Insect Biochem Mol Biol 27 : 93-100.

Dossou-yovo J., Doannio J.M.C., Diarrassouba S., Chauvancy G. 1998. Impact


d'aménagements de rizières sur la transmission du paludisme dans la ville de
Bouaké, Côte d'Ivoire. Bull Soc Pathol Exot 91, 327-333.

Druilhe P, Daubersies P, Patarapotikul J, Gentil C, Chene L, Chongsuphajaisiddhi T, Mellouk


S, Langsley G. 1998 A primary malaria infection is composed of avery wide
range of genetically diverse but related parasites. Am J Clin Invest 101:2008–
2020.

Eberl KJ, Jelinek T, Aida AO, Peyerl-Hoffmann G, Heuschkel C, El Valy AO and


Christophel EM. 2001 Prevalence of polymorphisms in the dihydrofolate
reductase and dihydropteroate synthetase genes of Plasmodium falciparum
isolates from southern Mauritania. Trop Med Int Health 6:756–60.

Edillo FE, Toure YT, Lanzaro GC, Dolo G, Taylor CE. 2002 Spatial and habitat distribution
of Anopheles gambiae and Anopheles arabiensis (Diptera: Culicidae) in
Banambani village, Mali. J Med Entomol 39: 70–7.

Escudié A, Hamon J. 1961 Le paludisme en Afrique Occidentale d’expression française. Méd


Trop (Marseille) 21:661–687.

112
Farnert A, Arez AP, Babiker HA, Beck HP, Benito A, Bjorkman A, Bruce MC, Conway DJ,
Day KP, Henning L, Mercereau-Puijalon O, Ranford-Cartwright LC, Rubio JM,
Snounou G, Walliker D, Zwetyenga J, Do Rosario VE.2001 Genotyping of
Plasmodium falciparum infections by PCR: a comparative multicentre study.
Trans R Soc Trop Med Hyg 95:225–232.

Faye O., Fontenille D., Herve J. P., Diack P. A., Diallo S. & Mouchet J. 1993 Le paludisme
en zone sahélienne du Sénégal. 1. Données entomologiques sur la transmission.
Ann. Soc. Belge Méd. Trop. 73, 21-30.

Faye O., Gaye O., Fontenille D., Sy N., Konate L., Hebrard G., Herve J.P., Trouillet J., Diallo
S. & Mouchet J., 1995a. Comparaison de la transmission du paludisme dans deux
faciès épidémiologiques au Sénégal : la zone côtière sahélienne et la zone
méridionale soudanienne. Dakar Méd. 40, 201- 207.
Faye O., Fontenille D., Gaye O., Sy N., Molez J.F., Konaté L., Hébrard G., Hervé J.P., Trouillet J.,
Diallo S. & Mouchet J. 1995 b. Paludisme et riziculture dans le delta du fleuve Sénégal (Sénégal).
Ann. Soc. belge Méd. trop., 75 : 179 – 189.

Fillinger U, Sombroek H, Majambere S, Loon Ev, Takken W, Lindsay SW. 2009 Identifying
the most productive breeding sites for malaria mosquitoes in the Gambia. Malar J
8: 62

Fontenille D., Cohuet A., Awono-Ambeme P., Antonio-Nkondjio C., Wondji C., Kengne P.,
Dia I., Boccolini D., Duchemin J-B., Rajaonarivelo V., Dabire R., Adja-Akre M.,
Ceainu C., Le Goff G. and Simard F. 2003 Systématique et biologie des anophèles
vecteurs de plasmodiums en Afrique, Données récentes. Méd. Trop. 63: 247-253

Forney J.R. et al., 2003 Devices for rapid diagnosis of Malaria: evaluation of prototype assays
that detect Plasmodium falciparum histidine-rich protein 2 and a Plasmodium
vivax-specific antigen. J Clin Microbiol 41(6): p. 2358-66.

Forsyth. K. P., Philip. G., Smith. T., Kum. E., Southwell. B. & Brown. G. 1989. Diversity of
antigens expressed on the surface of erythrocytes infections with mature
Plasmodium falciparum parasites in Papua New Guinea. American Journal
Tropical Medecine Hygiene, 41 (3): 259-265.

Fousseyni S, Toure PHD; Odile ouwe- missi-oukem-boyer PHD; Jerome mezui- me- ndong
MS; Guy roger ndong-atome Phd student; Ulrick bisvigou MD; Dominique
mazier MD, PHD; AND Sylvie bisser MD, PHD. 2007 Cytoadherence and
Genotype of Plasmodium falciparum Strains from Symptomatic Children in
Franceville, Southeastern Gabon. Clinical Medicine&. Research Volume 5,
Number 2:106- 113

Gasquet M, Delmont J, Le Bras J, Delmas F, Capdegelle P and Timon-David P. 1995.


Chloroquineresistant falciparum malaria in Mauritania. Lancet, 346:1556.

113
Gillies M.T. & Coetzee M.1987. A supplement to the Anophelinae of Africa South Africa of
the Sahara. A supplement to the Anophelinae of Africa South of the Sahara.
Publication of the South African Institut for Medical Research, 55, 143.

Gillies M.T. & De Meillon B. 1968 The Anophelinae of Africa south of Sahara, South African
Institute of Medical Research, Johannesburg, 2nd edition.

Gimning JE. 2001 Characteristics of larval anopheline (Dip tera: Culicidae) habitats in western
Kenya. J Med Entomol 38: 282–8.

Gimonneau G, Pombi M, Choisy M, Morand S, Dabiré K.R, and Simard F.2012 Larval
habitat segregation between the molecular forms of the mosquito, Anopheles
gambiae in a rice field area of Burkina Faso, West Africa Med Vet Entomol.
26(1): 9–17.

Guiguemde TR, Gbary AR, Ouedraogo JB, Gayibor A, Lamizana L, Maiga AS, Boureima
HS, Comlanvi CE, Faye O and Niang SD 1991 Point actuel sur la
chimioresistance du paludisme des sujets autochtones dans les états de l’OCCGE
(Afrique de L’ouest). Ann Soc Bel Med Trop 71: 199-207.

Hammadi D., Boubidi S.C., Chaib S.E., Saber A., Khechache Y., Gasmi M., Harrat Z. 2009
Le paludisme au Sahara algérien. Bull Soc Pathol Exot 102, (3), 185-192.

Hamon J et Coz J. 1966 Épidémiologie générale du paludisme humaine en Afrique


occidentale. Répartition et fréquence des parasites et des vecteurs et observations
récentes sur quelques-une des facteurs gouvernant la transmission de cette
maladie. Bulletin de la Société de Pathologie exotique 59 (4) : 466-483.

Hamon J, Maffi M, Ouedraogo CS et Djime D. 1964 Notes sur les moustiques de la


République Islamique de Mauritanie (Dipt. Culicidae)(1ére partie). Ann Soc Ent
Fr, 69: 233-253.

Hamon J., Adam, J.P., et Grjebine, A.1956 Observation sur la répartition et le comportement
des anophèles de l’Afrique Equatoriale française, du Cameroun et de l’Afrique
Occidentale. : Bulletin de l’Organisation mondiale de la santé, v. 15, p. 549-591.

Hay SI, Guerra CA, Tatem AJ, Noor AM, Snow RW.2004 The global distribution and
population at risk of malaria: past, present, and future. Lancet Infect Dis 4(6):327-
336.

Henry M, Diallo I, Bordes J, Ka S, Pradines B, Diatta B, M'Baye PS, Sane M, Thiam M,


Gueye PM, Wade B, Touze JE, Debonne JM, Rogier C, Fusai T.2006 Urban
malaria in Dakar, Senegal: chemosusceptibility and genetic diversity of
Plasmodium falciparum isolates. Am J Trop Med Hyg 75:146-151.

114
Hervy JP, Le Goff G, Geoffroy B, Herve JP, Manga L et Brunhes J.1998 Logiciel
d'identification et d'enseignement. Les anophèles de la région afrotropicale CD-
ROM Ed. ORSTOM, Série Didactiques, ORSTOM/OCEAC.

Holstein MH., 1951 Epidemiology of malaria in French West Africa. Bull. World Health
Organisation. 4(3): 463-73

Holt R.A., Subramanian, G.M., Halpern, A., Granger G. et al.,, 2002 The Genome Sequence
of the Malaria Mosquito Anopheles gambiae Science v. 298, p. 129 - 149.

Hommel. M., David. P., Oligino. L. 1983. Surface alteration of erythrocytes in Plasmodium
falciparum malaria . Antigen variation, antigen diversity, and role of the spleen.
The journal Experimental Medecine; 157: 1137-1148.

Ilboudo-Sanogo, E. 2001 Influence des rideaux imprégnés d’insecticides sur les paramètres
entomologiques de la transmission du paludisme en zone rurale au Burkina Faso.
[Doctorat Unique thesis]: Ouagadougou, Université de Ouagadougou.

Imbahale SS, Paaijmans KP, Mukabana WR, van Lammeren R, Githeko AK and Takken W.
2011 A longitudinal study on Anopheles mosquito larval abundance in distinct
geographical and environmental settings in western Kenya. Malar J. 10; 10:81.

Iqbal J., Sher A. and Rab A. 2000 Plasmodium falciparum histidine-rich protein 2-based
immunocapture diagnostic assay for malaria: cross-reactivity with rheumatoid
factors. J Clin Microbiol 38(3): p. 1184-6.

Iqbal. J., Perlman. P. & Berzins K. 1993. Serological diversity of antigens expressed on the
surface of erythrocytes infected with Plasmodium falciparum. Transactions of the
royal Society of Tropical Medicine & Hygiene; 87 (5): 583-588.

Issifou S., Djikou S., Sanni A., Lekoulou F. & Ntoumi F. 2001. Pas d’influence de la saison
de transmission ni de l’âge des patients sur la complexité et la diversité génétique
des infections dues à Plasmodium falciparum à Cotonou (Bénin). Bulletin Société
Pathologie exotiques ; 94 (2 bis) : 195-198.

Jafari-Guemouri. S., Boudin. C., Fievet. N., Ndiaye. P & Deloron. P. 2006. Plasmodium
falciparum genotype population dynamics in asymtomatic children from Senegal.
Microbes and Infections; 8: 1663-1670.

Jawara M, Drakeley CJ, Nwakanma DC, Jallow E, Bogh C, Lindsay SW, and Conway DJ
.2008 Dry season ecology of Anopheles gambiae complex mosquitoes in the
Gambia. Malaria J. 18; 7: 156.

115
Jelinek T, Aida AO, Peyerl-Hoffmann G, Jordan S, Mayor A, Heuschkel C, el Valy AO, von
Sonnenburg F, et Christophel EM. 2002. Diagnostic value of molecular markers
in chloroquine-resistant falciparum malaria in Southern Mauritania. Am J Trop
Med Hyg. 67(5):449-53.

Jordan S, Jelinek T, Aida AO, Peyerl-Hoffmann G, Heuschkel C, El valy AO and Christophel


EM. 2001 Population structure of Plasmodium isolates during a epidemic in
southern Mauritania. Trop Med Int Health 6:761-766.

Joshi. H., Valecha. N., Verma. A., Kaul. A., Mallick. P. K., Shalini. S., Prajapati. S. K.,
Sharma. S. K., Dev. V., Biswas. S., Nanda. N., Malhotra. M. S., Subbarao. S. K &
Dash. P. A. 2007 Genetic structure of Plasmodium falciparum field isolates in
eastern and north-eastern India. Malaria Journal; 6: 60.

Julvez J., Mouchet J., Suzzoni J., Larrouy G., Fouta a. & Fontenille D. 1998. Les anophèle du
Niger. Bull. Soc. Path. Ex, 91 (4), 321-326.

Karch S., Mouchet J. 1992 Anopheles paludis vecteur important du paludisme au Zaire.Bull.
Soc. Path. Exot., 85 : 388-389.

Kawamoto F. et al. 1996 Sequence variation in the 18S rRNA gene, a target for PCR-based
malaria diagnosis, in Plasmodium ovale from southern Vietnam. J Clin Microbiol,
34: p. 2287-9.

Kemp. D. J., Cowman. A. F & Walliker. D. 1990. Genetic diversity in Plasmodium


falciparum. Advances in parasitology; 29: 75-149.

Kimura M, Kaneko O, Liu Q, Zhou M, Kawamoto F, Wataya Y, Otani S, Yamaguchi Y and


Tanabe K. 1997 Identification of the four species of human malaria parasites by
nested PCR that targets variant sequences in the small subunit rRNA gene.
Parasitol Int 46: 91-5.

Kimura. E., Mattei. D., Di Santi. S. M. & Scherf. A. 1990. Genetic diversity in the major
merozoite surface antigen of Plasmodium falciparum : high prevalence of a third
polymorphic form detect in strains derived from malaria patients. Elsevier Science
Publishers B. D (Biomedical Division); 91: 57-62.

Kiszewki A, Mellinger A, Spielman A, Pia M, Sachs E and Sachs J.2004 Global distribution
(Robinson Projection) of dominant or potentially important malaria vectors.
American Journal of Tropical Medicine and Hygiene 70 (5):486-498.
Knight KL and Stone A. 1977 A catalog of the Mosquitoes of the World (Diptera : Culicidae).
Washington, Thomas Say Foundation1977, 611 p.

116
Konate L, Zwetyenga J, Rogier C, Bischoff E, Fontenille D, Tall A, Spiegel A, Trape JF,
Mercereau-Puijalon O. 1999 Variation of Plasmodium falciparum msp1 block 2
and msp2 allele prevalence and of infection complexity in two neighbouring
Senegalese villages with different transmission conditions.Trans R Soc Trop Med
Hyg 93(Suppl 1):21–28.

Konate L., Diagne N., Brahimi K., Faye O., Legros F., Rogier C., Petrarca V. & Trape J.F.
1994 Biologie des vecteurs et transmission de Plasmodium falciparum, P.
malariae et P. ovale dans un village de savane d’Afrique de l’Ouest. Parasite 1,
325-333.

Konaté L., Diop A., SY N., Faye M.N., Dieng Y., Izri A., Faye O. & Mouchet J. 2001.
Comeback of Anopheles funestus in Sahelian Senegal. The Lancet, 28th July 2001,
(9278), 336.

Lacey, L. A., M.J.Urbina and C. M. Heitzman. 1984 Sustained release formulations of


Bacillus sbhaericus and Badllus thurinEiensis (H-14) for control of conminer
breeding Culex quinEtefasrJalru. Mosq. News 44:26-32

Leech. J. H., Aley. S.B., Miller. L. H & Howard. R. J. 1984. Plasmodium falciparum malaria :
cytoadherence in infected erythrocytes to endothelial ce lls and associated changes
in the erythrocyte membrane. Progress in clinical & Biological Research ; 155:
63-77.

Maffi 1964 Contribution à la connaissance de la faune anophèlienne de la Mauritanie. WHO


Mal 434, Genève.

Magesa SM, Mdira KY, Babiker HA, Alifrangis M, Farnert A, Simonsen PE, Bygbjerg IC,
Walliker D, Jakobsen PH. 2002. Diversity of Plasmodium falciparum clones
infecting children living in a holoendemic area in north-eastern Tanzania. Acta
Trop 84:83–92

Magowan. C., Wollish. W., Anderson. L & Leech. J. 1988. Cytoadherence by Plasmodium
falciparum –infected erythrocyte is correlated with the expression of a family of
variable proteins on infected erythrocyte. The journal of Experimental Medicine;
168: 1307-1320.

Mahgoub H, Gasim GI, Musa IR and Adam I. 2012. Severe Plasmodium vivax malaria among
Sudanese children at New Halfa Hospital, Eastern Sudan. Parasites & Vectors
5:154.

Makler M., R. Piper, and W.1998 Milhous, Lactate Dehydrogenase and the diagnosis of
malaria. Parasitol Today 14(9): p. 376-7.

Manga L, Bouchite B, Toto J C et Froment A. 1997 La faune anophélienne et la transmission


du paludisme dans une zone de transition forêt/savane au centre du Cameroun.
Bull Soc Pathol Exot; 90 (2) 128-130.

117
Maureen Coetzee,Richard H. Hunt, Richard Wilkerson, Alessandra Della Torre, Mamadou B.
Coulibaly & NORA J. Besansky Anopheles coluzzii and Anopheles amharicus,
new members of the Anopheles gambiae complex Zootaxa 3619 (3): 246–274

McBride. J., Walliker. D. M. & Morgan. G. 1982. Antigenic diversity in the human malaria
parasite Plasmodium falciparum. Science; 271: 254-257.

Mercereau-Puijalon O, Menard D. 2010 Plasmodium vivax and the Duffy antigen: a paradigm
revisited. Transfus Clin Biol 17:176-183.

Miller J.E., Lindsay, S.W. Armstrong-Schellenberg J.R.M., Adiamah J., Jawara. M. et Curtis,
C.F.1995 Village trial of bednets impregnated with wash-resistant permethrin
compared with other pyrethroid formulations Medical and Veterinary
Entomology, vol. 9, p. 43-49.

Miller. L. H., Roberts. T., Shahabuddin. M. & McCutchan. T. F. 1993. Analysis of the
sequence diversity in Plasmodium falciparum merozoite surface protein-1(MSP-
1). Molecular Biochemy Parasitology ; 59 (1) : 1-14.

Mint Lekweiry K, Abdallahi MO, Ba H, Arnathau C, Durand P, Trape JF et Ould Mohamed


Salem A 2009. Preliminary study of malaria incidence in Nouakchott, Mauritania.
Malar J 8:92.

Molez J.F. & Faye O.1996 Transect Sud-Nord Fleuve / Oasis : vecteurs du paludisme et
incidence palustre. Document ORSTOM Dakar nº21/97-MZ/DK, 27 pages.

Monjour L, Richard-Lenoble D, Palminteri R, Daniel Ribeiro C, Alfred C and Gentilini M.


1984. A sero-epidemiological survey of malaria in desert and semi-desert regions
of Mauritania. Annals of Tropical Medecine and Parasitology 78: 71-73.

Moody A. 2002, Rapid diagnostic tests for malaria parasites. Clin Microbiol Rev, 15: p. 66-
78.

Mouchet J et Gariou J. 1957 Exophilie et exophagie d’Anopheles gambiae dans le Sud


Cameroun. Bull. Soc. Path. Exo 50 : 446-460.

Mouchet J, Carnevale P, Coosemans M, Fontenille D, Ravaonjanahary C, Richard A et


Robert V.1993 Typologie du paludisme en Afrique. Cahiers Santé 3: 220-238

Mouchet J, Carnevale P, Coosemans M, Julvez J, Manguin S, Richard- lenoble D et Sircoulon


J : Biodiversité du paludisme dans le monde. Montrouge, John Libbey Eurotext
2004, 428 p.

Mouchet J. & Carnevale P., 1991 Les vecteurs et la transmission du paludisme. Etudes

Murray C.K., et al. 2003, Rapid diagnostic testing for malaria. Trop Med Int Health,. 8: p.
876-83.

118
Nabeth P, Kane Y., Abdelahi M.O., Diallo M., Ndiaye K., Schneegans F., Sall A.A. &
Mathiot C. 2001. Rift valley fever outbreak, Mauritania 1998: Seroepidemiologic,
virologic, entomologic and zoologic investigations. Em. Infect. Dis.7 (6), 1052-
1054.

Nébié I. 2002 Influence à long terme des rideaux imprégnés d’insecticide sur l’immunité anti-
palustre chez des enfants vivant en zone rurale au Burkina Faso [Doctorat unique
thesis], Université de Ouagadougou.

Nevill, C.G., Some, E., Mungàl .A, et Col. 1996 Insecticide tread bednets reduce mortality
and severe morbidity from malaria among children of Kenya. Trop Med Int
Heath. 1: 139-149.

Njunwa K.J., Lines J.D., Magesa S.M., Mnzava A.E.P., Wilkes T.J., Alilio M., Kivumbi K. et
Curtis C.F. 1991 Trial of pyrethroid impregnated bed- nets in an area of Tanzania
holoendemic for malaria. Part 1. Operation methods and acceptability Acta
Tropica, vol. 49, p. 87-96.

Organisation Mondiale de la Santé, 2013. World malaria report, Génève, 286 p.

Office National de Statistique(ONS) : Annuaires statistiques 1995–2005 Ministère des


affaires économiques et du développement, Mauritanie, 144p.
Office National de Statistique(ONS) : Annuaire statistique 2013 Ministère des affaires
économiques et du développement, Mauritanie, 125 pages.

OULD A BDALLAHI M., OULD BEZEID M., DIEYE M., YACINE B. & FAYE O. 2011. Étude de la part
du paludisme chez les consultants fébriles et des indices plasmodiques chez des
écoliers dans la région du Trarza, République islamique de Mauritanie Bulletin de
la Société de pathologie exotique, DOI: 10.1007/S13149-011-0157-

Owusu-Agyei. S., Smith. T., Beck. H-P., Ameng-Etago. L & Felder. I. 2002. Molecular
epidemiology of Plasmodium falciparum infection among asymptomatic
inhabitants of a holoendemic malarious area in northern Ghana. Tropical
Medicine and International Health; 7 (5): 421-428.

Pages F, Orlandi-Pradines E, Corbel V, 2007. Vecteurs du paludisme : biologie, diversité,


contrôle et protection individuelle. Méd Mal Infect 37 : 153-61.

Parra M.E., C.B. Evans and D.W. 1991 Taylor, Identification of Plasmodium falciparum
histidine-rich protein 2 in the plasma of humans with malaria. J Clin Microbiol
29(8): p. 1629-34.

Perkins ME, Rocco LJ 1988. Sialic acid-dependent binding of Plasmodium falciparum


merozoite surface antigen, Pf200, to human erythrocytes. J Immunol 141: 3190-
3196.

119
Peterson. M. G., Coppel. R. L., Moloney. M. B. & Kemp. D. J. 1988. Third form of the
precursor of the major merozoite surface antigens of Plasmodium falciparum.
Molecular and Cellular Biology; 8: 2664-2667.

Peyerl- Hoffmann G, Jelinek T, Kilian A, Kabagambe G, Metzger WG, Von Sonnenburg F.


2001 Genetic diversity of Plasmodium falciparum and its relationship to parasite
density in an area with differ-ent malaria endemicities in West Uganda. Trop Med
Int Health 6:607–613.

Programme national de lutte contre le paludisme(PNLP) 2005 : Plan stratégique national de


lutte contre les épidémies de paludisme, 2006–2010.

Programme national de lutte contre le paludisme(PNLP) 2009 : Évaluation des besoins pour
la lutte contre le paludisme 2009-2013.

Quinones, M.L., Lines, J.D., Thomson, M.C., Jawara, M., Morris, J., et Greenwood, B.M.
1997 Anopheles gambiae gonotrophic cycle duration, biting and exiting behaviour
unafflected by permethrin impregnated bednets in the Gambia, : Medical and
Veterinary Entomology, , v. 11, p. 71-78.

Robert V & Carnevale P. 1984. Les vecteurs des paludismes en Afrique subsaharienne.
Etudes médicales, 2, 79-90.

Robert V & Carnevale P. 1984. Les vecteurs des paludismes en Afrique subsaharienne.
Etudes médicales, 2, 79-90.

Robert V., Petrarca V., Coluzzi M., Boudin C., Carnevale P. 1991. Etude des taux de parturité
et d'infection du complexe Anopheles gambiae dans la rizière de la vallée du Kou,
Burkina Faso. In Le Paludisme en Afrique de l'Ouest. Paris: ORSTOM p. 17-35.

Rooker S, Guillemaud T, Bergé J, Pasteur N, Raymond M. 1996 Coamplification of esterase


A and B genes as a single unit in Culex pipiens mosquitoes. Heredity 77: 555-61.

Saiki. R. K., Gelfand. D. H., Stoffel. S., Scharfs. J., Hugushi. R., Horn. G. T., Mullis. K. B. &
Erlich. H. A. 1988. Primer-directed enzymatic amplification of DNA with a
thermolable DNA polymerase. Science; 239: 487-491

Saissy J.M., Rouvin R., Koulmann P. 2003 Le paludisme grave en réanimation en 2003. Med.
Trop. 63,258-266.

Sautet J., Ranque. J. & Vuillet J. 1948 Quelques notes parasitologiques sur le paludisme et
l’anophélisme en Mauritanie. Méd. Trop 8, 34-39.

Schibler. L., Vaiman. D. & Cribiu. E. P. 2000. Origine du polymorphisme de l’ADN. INRA
Production Animale : 37- 43.

120
Service, M.W. 1993 Mosquitoes (culicidae): Lane R.P. et Crosskey R.W.(eds), Medical
insects and Arachnids. Chapman and Hall, London. p. 51-77.

Shiff C.J., Premji Z., and J.N. Minjas, 1993. The rapid manual ParaSight-F test. A new
diagnostic tool for Plasmodium falciparum infection, Trans R Soc Trop Med
Hyg,. 87: p. 646-8.

Shililu J., Ghebremeskel T., Mengistu S., Fekadu H., Zerom M.,Mbogo C., Githure J.,
Weidong GU, Novak R. & Beier J. C.2003 Distribution of Anopheline
mosquitoes in Eritrea. American Journal of Tropical Medicine and Hygiene.
69(3): 295-302.

Siala E, Ben Abdallah R, Bouratbine A et Aoun K.2010 Actualités du diagnostic biologique


du paludisme. Revue Tunisienne d’Infectiologie 4: 5 – 9

Siala E, Ben Abdallah R, Bouratbine A et Aoun K: Actualités du diagnostic biologique du


paludisme. Revue Tunisienne d’Infectiologie 2010, 4: 5 – 9.

Singh N., Mishra S. S., Singh M. P., et Sharma V. P. 2000. Seasonality of Plasmodium vivax
and P. falciparum in tribal villages in central India (1987-1995). Ann. Trop. Med.
Parasitol. 94:101-112.

Smith T, Beck HP, Kitua A, Mwankusye S, Felger I, Fraser-Hurt N, Irion A, Alonso P,


Teuscher T, Tanner M. 1999 Age dependence of the multiplicity of Plasmodium
falciparum infections and of other malariological indices in an area of high
endemicity. Trans R Soc Trop Med Hyg 93:15–20.

Snounou G, Viriyakosol S, Zhu XP, Jarra W, Pinheiro L, do Rosario VE, Thaithong S, Brown
KN, 1993.High sensitivity of detection of human malaria parasites by use of
nested polymerase chain reaction amplification. Mol Biochem Parasitol, 61:315-
320.

Snounou G, Zhu X, Siripoon N, Jarra W, Thaithong S, Brown KN, Viriyakosol S. 1999


Biased distribution of msp1 and msp2 allelic variants in Plasmodium falciparum
populations in Thailand. Trans R Soc Trop Med Hyg 93:369–374.

Snounou G. and B. Singh Nested PCR analysis of Plasmodium parasites. Methods Mol Med,
2002. 72: p. 189-203.

Snow RW, Guerra CA, Noor AM, Myint HY, Hay SI. 2005 The global distribution of clinical
episodes of Plasmodium falciparum malaria. Nature 434: 214–7

Snow R.W. et Marsh K., 1995, Will reducing Plasmodium falciparum transmission alter
malaria mortality among African children? : Parasitology Today, v. 11, p. 188-
190.

121
Soulama I, Nébié I, Ouédraogo A, Gansane A, Diarra A, Tiono AB, Bougouma EC, Konaté
AT, Kabré GB, Taylor WRJ, Sirima S.2009 Plasmodium falciparum genotypes
diversity in symptomatic malaria of children living in an urban and a rural setting
in Burkina Faso. Malar J 8:135.

Southwell. B., Brown. G. V., Forsyth. K. P., Smith. T., Philip. G & Anders. R. F. 1989. Field
applications of agglutination and cytoadherence assays with Plasmodium
falciparum from Papua New Guinea. Transaction Research Society Tropical
Medicine Hygiene; 83: 464-469.

Stephen C. Smith, Uday B. Joshi, Mark Grabowsky, ET Col. 2000 Evaluation of Bednets
After 38 Months of Household Use in Northwest Ghana Am. J. Trop. Med. Hyg.,
77(Suppl 6), 2007, pp. 243–248.

Su X, Hayton K et Wellems TE. 2007 Genetic linkage and association analyses for trait
mapping in Plasmodium falciparum. Nat Rev Genet 8(7): 497-506.

Tanabe. K., Mackay. M., Goman. M. & Scaife J. G. 1987. Allelic Dimophism in a Surface
Antigen of the Malaria Parasite Plasmodium falciparum. Journal of Molecular
Biology; 195: 273-287.

Vafa M, Troye-Blomberg M, Anchang J, Garcia A, Migot-Nabias F. 2008 Multiplicity of


Plasmodium falciparum infection in asymptomatic children in Senegal: relation to
transmission, age and erythrocyte variants. Malar J 7:17.

Verhaeghen K, Van Bortel W, Roelants P, Backeljau T, Coosemans M. 2006 Detection of the


East and West African kdr mutation in Anopheles gambiae and Anopheles
arabiensis from Uganda using a new assay based on FRET/Melt Curve analysis.
Malar J 5 :16.

Washington, Thomas Say Foundation 611 p.

Weber. J., Leininger. W. & Lyon. J. 1986. Variation in the gene encoding a major merozoite
surface antigen of the human malaria parasite Plasmodium falciparum. Nucleic
Acids Res ; 14 : 3311-3323.

Weill M, Malcolm C, Chandre F, Mogensen K, Berthomieu A, Marquine M, et al. 2004 The


unique mutation in ace-1 giving high insecticide resistance is easily detectable in
mosquito vectors. Insect Mol Biol 13 : 1-7.

Wirtz R, Zavala F, Charoenvit Y, Campbell GH, Burkot TR, Schneider I, Esser KM,
Beaudouin RL and Andre RG: Comparative testing monoclonal antibodies against
Plasmodium falciparum sporozoïtes for ELISA development. Bulletin of the
World Health Organization 1987, 65: 39-45.

World Health Organisation : World malaria report 1974, Geneva 1974, 375.

122
World Health Organisation : World malaria report 2003, Geneva 2003, 193.

World Health Organisation. Guidelines for testing mosquito adulticides for indoor residual
spraying and treatment of mosquito nets. WHO/CDS/NTD/WHOPES/ GCDPP/2006.3

World Health Organisation : World malaria report 2008, Geneva 2008, 190.

World Health Organisation: World malaria report 2009. Geneva 2009, 66.

World Health Organisation: World malaria report 2011. Geneva 2011, 91.

Wurtz N, Lekweiry KM, Bogreau H, Pradines B, Rogier C, Boukhary AOMS, Hafid JE,
Salem MSOA, Trape J-F, Basco LK, Briolant S.2011 Vivax malaria in Mauritania
includes infection of a Duffy- negative individual. Malar J,

Zaim M., Aito A AND Nakashima N., et Col. 2000 Safety use of pyrethroid treated nets. Med
Vet Entomol. 14: 1-5.

Zhong. D., Afrane. Y., Githeko. A., Yang. Z., Cui. L., Menge. D.M., Temu. E. A & Yang. G.
2007. Plasmodium falciparum genetic diversity in western Kenya highlands. Am J
Trop Med Hyg; 77 (6): 1043-1050.

Zwetyenga. S. J. 1998. Analyse moléculaire de la diversité de Plasmodium falciparum chez


l’Homme. Doctorat des sciences de la vie et de la santé de l’université de Lille II.

123
ANNEXES
Annexe 1 : Matériels, réactifs et mélange réactionnel pour l’amplification
de MSP1.

I -Matériel et réactifs

1- Amorces pour MSP1

2- dNTPs

3- Taq polymérase

4- 5XBuffer, 7,5mM MgCl2

5- Eau pour PCR,

6- Gants,

7- Pipettes de 2, 10, 100 et 1000 µl,

8- Embouts de 10, 100 et 1000 µl,

9- Tubes de 200 ou de 500 µl,

10- Tubes de 1500 µl,

11- Marqueurs à bout fin indélébile,

12- Portoirs (tubes et pipettes),

13- Thermocycleur

14- Blouses

15- Poubelle
II : Mélange réactionnel pour un volume final de 25 µL (MSP1) pour la première
amplification

Concentration Concentration Volume


Réactifs
initiale finale (µL)

Buffer/MgCl2 5X/7,5 mM 1X/1,5 mM 5

dNTPs 10X/2 mM 1X/200µM 2.5

Amorces (O1et O2) 100X/100 µM 1X/1µM 0.25

Taq Polymerase 5U/µL 0.025U 0.125

Eau pour PCR - - 16.125

Total 24

Ajouter dans chaque tube 1µL de l’ADN extrait au méthanol

III: Mélange réactionnel pour un volume final de 25 µL (MSP1) pour la deuxième


amplification

Concentration Concentration Volume


Réactifs
initiale finale (µL)

Buffer/MgCl2 5X/17,5 mM 1X/3,5 mM 5

dNTPs 2 mM 200µM 2.5

Couple d’amorces
100 µM 1µM 0.25
N1N2

Taq Polymerase 5U/µL 0.05U 0.125

Eau pour PCR 16.625

Total 24.5

Ajouter 0.5 µL des produits PCR de la 1ère amplification


Annexe 2:Préparation des solutions utilisées pour l’Elisa sporozoïte

1. Préparation du Phosphate Buffered Saline (PBS)


La solution de travail de concentration 1X est obtenue en préparant une dilution au
1/10 de la solution mère de PBS à 10X.
2. Préparation du Blocking Buffer (BB): 250 ml.
- 250 ml de PBS (sigma, D 5773)
- 1,25 g de caséine (sigma, C 5890)
- 0,025 g de Thiomérosal (sigma, T 5125)
- 0,01 g de rouge Phénol (sigma, P 4758)
- 10 g de BSA (sigma, A 7906)
Agiter pendant 2H et conserver à 4° C.
3. Préparation du Tween 20
Mettre 500 μl de Tween 20 (Sigma P 1379) dans 1 litre PBS puis agiter.
4. Reconstitution des anticorps monoclonaux
Milieu de reconstitution : 1/2 volume H2O + 1/2 volume Glycérol (Sigma G 9012).
4. 1. Les Anticorps de P.falciparum (PF2A10-CDC-01)
- Anticorps de capture: 1mg d’anticprps + 2ml de milieu de reconstitution;
- Anticorps conjugués (Peroxidase labeled PF2A10 Protein A): 0,25 mg + 0,5 ml de
milieu de reconstitution.
4. 2. Les anticorps de P. vivax 210
- Anticorps de capture (PV-210-CDC): 0,25 mg + 0,5 ml de milieu de reconstitution;
- Anticorps conjugués (Peroxidase label PV-210-CDC): 0,5 mg + 1ml de milieu de
reconstitution.
4. 3. Les anticorps pour P. vivax 247
- Anticorps de capture (PV-247-CDC): ajouter 0,5 ml de milieu de reconstitution;
- Anticorps conjugués (Peroxidase labeled PV-247-CDC): ajouter 0,5 ml de
reconstitution.
5. Dilution des témoins positifs
- Témoins positifs de P. falciparum:
- Solution I: ajouter 500 μl de tampon BB pour avoir une concentration de 10
ng/μl;
- Solution II: 1μl de solution I + 990 μl de tampon BB (0,1 ng/μl);
- Solution III (utilize pour les manips): 20 μl de solution II + 980 μl de tapon BB
(2 pg /μl).
- Témoins positifs de P vivax 210:
- Solution I: ajouter 1000μl de tampon BB pour voir une concentration de
9,1ng/μl;
- Solution II (utiliser pour les manips): 20μl de la solution I + 980μl de tampon
BB (182 pg/μl).
- Témoins positifs de P. vivax 247:
- Solution I: ajouter 1000μl de tampon BB pour avoir une concentration de
4,55pg/μl;
- Solution II (utiliser pour les manips): 20μl de la solution I + 980μl de tampon
BB.
6. Préparation des anticorps de capture
- P.falciparum : pour 1 plaque, on prend 15μl de la solution d’anticorps de capture + 5
ml de PBS;
- P.vivax 210 et 247: 5μl de la solution d’anticorps de capture dans 5 ml de PBS pour
une plaque.
7. Préparation des anticorps conjugués
- P. falciparum: 7,5μl de la solution d’anticorps conjugués + 5ml de BB (pour une
plaque);
- P. vivax: 10μl de la solution d’anticorps conjugués + 5ml de BB (pour 1 plaque).
8. Préparation de solution peroxydase (ELVETEC, 300451)
Mélanger volume à volume le substrat solution B et substrat de la peroxydase TMB
(5 ml de chaque solution pour une plaque).
PUBLICATIONS
J Vector Borne Dis 50, December 2013, pp. 302–306

Characterization of anopheline (Diptera: Culicidae) larval habitats in


Nouakchott, Mauritania

O. Ahmedou Salem Mohamed Salem1, 2, M. Lekweiry Khadijetou1, M. Hasni Moina1,


Konate Lassana2, Briolant Sébastien3, Faye Ousmane2 & O. Mohamed Salem Boukhary Ali1
1Laboratoire de Biotechnologies, Faculté des Sciences et Techniques, Université des Sciences, de Technologie et de Médecine, Nouakchott,

Mauritanie; 2Laboratoire d’Ecologie Vectorielle et Parasitaire, Faculté des Sciences et Techniques, Université Cheikh Anta Diop, Dakar,
Sénégal; 3Institut de Recherche Biomédicale des Armées, Direction Interarmées du Service de Santé, Laboratoire de Parasitologie, CNR du
Paludisme région Antilles-Guyane, Institut Pasteur de la Guyane, Cayenne cedex, France

ABSTRACT

Background & objectives: Despite the increasing number of reported autochthonous malaria cases in Nouakchott
and the identification of Anopheles arabiensis as the major malaria vector in this Saharan city, anopheline larval
habitats have never been identified so far. The objective of this study was to identify and characterize anopheline
larval habitats in Nouakchott.
Methods: During September and October 2012, samples from pools of rainwater, water discharged from standpipes
and household drinking water tanks in the districts of Dar Naim, Teyarett and Arafat were analyzed for the presence/
absence of anopheline larvae and physicochemical characterization of breeding habitats.
Results: Of the 51 prospected water bodies, eight consisting of seven water discharged from standpipes and one
household drinking water tank were productive for Anopheles sp. All emerged anopheline mosquitoes from the
positive dipping were morphologically identified as members of the An. gambiae complex. Multivariate regression
analyses showed that a salinity up to 0.1 g/l and a shaded situation were respectively protective factors against
high larval density in breeding sites (adjusted odds ratio = 0.62, 95% CI [0.44–0.87], p = 0.0052 and adjusted
odds ratio = 0.56, 95% CI [0.44–0.71, p <0.0001] and a pH up to 7.61 was a risk factor for high larval density in
breeding sites (adjusted odds ratio = 1.56, 95% CI [1.25–1.95], p = 0.0001).
Interpretation & conclusion: The study demonstrated in Nouakchott that despite an arid and dry climate, human
practices have contributed to the establishment of favourable environmental conditions for the development of
anopheline mosquitoes and, therefore, maintaining malaria transmission in this Saharan city. The core malaria
vector control intervention as the use of long-lasting insecicidal nets (LLINs) could be complemented in Nouakchott
by larval source control. In this area, appropriate larval control measures may be recommended in line with an
integrated vector management (IVM) approach.

Key words Anopheles gambiae s.l.; habitats; larvae; Nouakchott; standpipes

INTRODUCTION malarial control programme2. Despite its importance, little


is known about the Anopheles mosquito species respon-
Malaria accounts for over 22% of the total outpatient sible for transmission of malaria in Mauritania. The only
morbidity in Mauritania, and about 51% of deaths in health published entomological study dates back to 40 years6–7.
facilities are due to malaria1. Almost 90% of the resident More recently, Dia et al8 studied the distribution, host
population of Mauritania is exposed to the risk of ma- preference and infection rates of three malaria vectors—
laria. The endemic foci of the disease are located mainly An. arabiensis, An. pharoensis and An. funestus in five
in south and southeast parts of the country, especially in regions of Mauritania, namely Trarza, Brakna, Assaba,
eight provinces of Hodh Elgharbi, Hodh Echarghi, Hodh Elgharbi and Tagant. In Nouakchott, the capital city
Assaba, Brakna, Trarza (including Nouakchott), Gorgol, of Mauritania, despite the increasing number of reported
Tagant and Guidimagha2. Malaria cases in these areas autochthonous malaria cases3–5 and the identification of
are mainly caused by Plasmodium falciparum2–3 except An. arabiensis as the major malaria vector in this city9,
in Nouakchott where reported malaria infections are pre- anopheline larval habitats have never been identified so
dominantly due to P. vivax4–5. Based on the WHO report far. Identification and characterization of anopheline
of 2011, Mauritania is classified in the control phase of mosquito breeding habitats have a critical role in malaria
Salem et al: Habitats of anopheline larvae in Nouakchott 303

control programme. Usually urbanization has a great im- household drinking water tanks in Teyarett district, and
pact on the composition of the vector system and malaria eight tanks of discharged water from public standpipes
transmission dynamics. In regard to breeding require- spread over the three districts. To determine the occur-
ments, every Anopheles species has its preferred water rence of anopheline mosquito larvae at each site, a dip
bodies for oviposition. These preferences depend on the was made with a 350 ml of standard dipper and exam-
physical geography and human activities. Breeding sites ined for the presence or absence of mosquito larvae. From
can be natural or man-made, of various sizes, shaded or each positive dipping, up to five anopheline larvae were
sunny and permanent or temporary. This study reports, collected and preserved in 95% ethanol for morphologi-
for the first time, the existence of An. gambiae s.l. larval cal identification. Furthermore, water samples of 350
habitats in Nouakchott and describes some of their eco- ml were obtained from each site for adult anopheline
logical and physicochemical characteristics. mosquitoes’ collection. Water samples were placed in
crystallizers at room temperature and covered with a
MATERIAL & METHODS bednet. Emerged adult mosquitoes were then collected
every two days. Larval (III and IV instars) and adult mos-
Study area quitoes identification were performed with a stereo mi-
Nouakchott (18°11' N–16°16' W) is situated in the croscope (Optika, Italy) using the keys of Gilles and
Sahara zone, near the Atlantic coast, at an altitude of seven Coetzee11.
meters above sea level as measured at the centre of the
city. It comprises of nine districts and houses 743,511 Physicochemical characteristics of larval habitats
inhabitants corresponding to one fourth of the whole popu- Simultaneously with larval sampling, the environmen-
lation of the country4. The wet season is short, extending tal characteristics of each larval habitat were measured.
from August to September, with little annual variation in Habitat length, width and depth were measured using a
the amount of rainfall (50 to 80 mm). The average annual metal ruler. Water pH and temperature were determined
temperature ranges from 20.7 to 33.3°C, and the average using hand-held pH meter HM-20P (DKK-TOA Corpo-
relative humidity from 33.4 to 79.1%. The vegetation ration, Japan), and turbidity was measured using a TB-
consists of intra- and peri-urban orchards with multiple 25A portable turbidity meter (DKK-TOA Corporation,
crops (date palm, Prosopis, legumes, mint and alfalfa). Japan). Salinity and conductivity were determined using
Due to the extension of informal urbanization and the the EC-21P conductivity meter (DKK-TOA Corporation,
lack of efficient drinking water network, most houses are Japan). Dissolved oxygen was determined using the hand-
supplied with drinking water either through public held DO meter DO-24P (DKK-TOA Corporation, Japan).
standpipes or building water tanks at home and only 21% Light/shadow of the sampled water from natural and arti-
of households are connected to the drinking water net- ficial collections and the presence or absence of vegeta-
work10. The study sites were in Teyarett, Dar Naim and tion was also noted. All samples and measurements were
Arafat districts. Teyraett and Dar Naim districts were cho- taken between 1200 and 1400 hours.
sen due to the high incidence of malaria infections among
their inhabitants and the presence of An. arabiensis as Statistical analysis
malaria vector compared to other Nouakchott districts4,10 Data were recorded using Excel and were checked
while report from Arafat district revealed little or no ma- for consistency before statistical analysis by using R-soft-
laria infection and malaria vector has never been found. ware (version 2.10.1). All qualitative variables were con-
structed to have equilibrated effectives in the groups. The
Larval sampling and identification larval positivity of water collections was analyzed as a
Larval collections (once every two weeks) were con- dependent variable according to individual water collec-
ducted in September and October of 2012, correspond- tions characteristics using a logistic regression model.
ing to the end of the rainy season and the peak of malaria First, a descriptive analysis of the independent variables
transmission. Three types of water bodies within the study was performed and bivariate analysis was conducted by
sites were prospected in the following order: first, 40 pools entering each independent variable in a logistic regres-
of water collection from rainfalls were sampled and ex- sion model. The larval density of breeding site was ana-
amined for the presence/absence of mosquito larvae. Then lyzed as a dependent variable according to individual
after two surveys, the absence of mosquito larvae in this breeding site characteristics using a Poisson regression.
natural water collections was observed, we became inter- First, a descriptive analysis of the independent variables
ested with the artificial water collections including three was performed, and bivariate analysis was conducted by
304 J Vector Borne Dis 50, December 2013

entering each independent variable in a Poisson regres- (mean of five samples per breeding site). III and IV instar
sion model. In both logistic and Poisson regression mod- larvae were found in all the positive habitats except the
els, variables were retained for the multivariate analysis EI mechrou breeding site where only I and II instar lar-
when their effect had a p-value <0.25. A backward vae were isolated. All the sampled anopheline larvae and
stepwise selection procedure with a minimization of 132 adult mosquitoes emerged from positive water col-
Akaike Information Criterion was applied to retain the lections were morphologically identified as members of
significant (p <0.05) independent variables and their in- An. gambiae s.l. Table 2 summarizes the characteristics
teractions in the final model. of positive anopheline larval habitats in Nouakchott. Habi-
tat depth, width and length ranged from 25–150, 60–170
RESULTS and 30–250 cm respectively. Temperature of breeding
sites during the larval collection ranged from 25–29°C.
During the study period, in September and October Chemical analysis showed that anopheline larvae toler-
2012, 51 water collections (40 rainfall water and 11 man- ate wide range of conditions. The pH varied little between
made) were prospected in Teyarett, Dar Naim and Arafat habitats (7.41–8.22). Water salinity ranged from 0.07 g/l
districts. None of the 40 rainfall water collections were for El mechrou samples to 0.2 g/l for samples from Lycée
found positive for mosquito larvae, while eight out of the Teyarett 1 and 2. The conductivity of tested water samples
11 man-made water collections consisting of seven wa- is generally low with Ould Badou breeding site from Dar
ter discharged from standpipes and one household drink- Naim district showed the highest conductivity level (1949
ing water tank were productive for Anopheles sp. Table 1 μs/cm) compared to other positive anopheline larval habi-
presents the names, habitat type, geographical position, tats. Water sample from EI mechrou (household drinking
larvae abundance and instar stages of the artificial habi- water tank) was clear (turbidity = 0.98 NTU), Hay Saken
tats in Nouakchott. The altitude of these sites ranged be- and Mgueizira samples (water discharged from public
tween one and six meters above the sea level. Only one standpipes) were slightly turbid (24 and 25 NTU respec-
surveyed water collection discharged from standpipes in tively) and the remaining samples, all water discharged
Arafat district was found positive for anopheline larvae. from public stand-pipes, were trouble with a turbidity
Larval abundance ranged from 20 to 80 collected larvae ranging from 70 to 157 NTU. The lowest dissolved oxy-

Table 1. Geographical location and larval abundance and instar stages of anopheline breeding sites in three districts of Nouakchott

District Sites Habitat type Longitude Latitude Altitude Larval Larvae


(m) abundance instar
stages

Dar Naim Ould Badou Water discharged from standpipes 18°06′60″N 15°55′20″W 2 50 III, IV
Hay Saken Water discharged from standpipes 18°07′27″N 15°55′60″W 6 80 III, IV
Teyarett Mgueizira Water discharged from standpipes 18°06′59″N 15°56′21″W 4 30 III, IV
Lycée Teyarett (1) Water discharged from standpipes 18°07′37″N 15°56′13″W 2 20 III, IV
Lycée Teyarett (2) Water discharged from standpipes 18°07′36″N 15°56′12″W 1 25 III, IV
Dar el Barka Water discharged from standpipes 18°08′22″N 15°55′29″W 3 40 III, IV
EI Mechrou Household drinking water tanks 18°08′05″N 15°55′58″W 3 50 I, II
Arafat Mallah Water discharged from standpipes 18°04′08″N 15°56′50″W 5 25 III, IV

Table 2. Physicochemical characteristics of positive anopheline larval habitats in Nouakchott

Sites Depth Width Length Conductivity Turbidity Temp. Salinity pH Dissolved Sunlight
(cm) (cm) (cm) (μsec/cm) (NTU) (°C) (g/l) oxygen (mg/l) situation

Ould Badou 45 80 170 1949 88 26 0.10 7.41 7.87 Full sunlight


Hay Saken 110 170 30 252 24 25 0.10 7.61 7.10 Full sunlight
Mgueizira 30 60 60 275 25 27 0.10 7.50 8.01 Partial sunlight
Lycée Teyarett (1) 130 150 150 437 70 29 0.20 7.60 7.20 Partial sunlight
Lycée Teyarett (2) 65 150 250 378 157 28 0.20 7.69 7.50 Partial sunlight
Dar el Barka 80 150 150 182 80 25 0.10 8.04 7.05 Partial sunlight
El Mechrou 150 150 200 135 0.95 26 0.07 8.22 0.90 Shaded
Mallah 25 100 200 131 92 25 0.10 7.52 7.04 Partial sunlight
Salem et al: Habitats of anopheline larvae in Nouakchott 305

Table 3. Multivariate logistic regression analysis of larval density in Nouakchott city. A salinity up to 0.1 g/l and a
positivity in water collections in Nouakchott city shaded situation were respectively protective factors
Characteristics N P OR 95% CI p-value against high larval density in breeding sites (OR = 0.62,
95% CI [0.44–0.87], p = 0.0052 and OR = 0.56, 95% CI
Depth [0.44–0.71, p <0.0001] and a pH up to 7.61 was a risk
≤ 25 cm 32 1 1 1.39–354.42 0.0282
factor for high larval density in breeding sites (OR= 1.56,
> 25 cm 19 7 22.22
pH 95% CI [1.25–1.95], p = 0.0001).
< 7.7 24 6 1 0.0–1.11 0.0587
≥ 7.7 27 2 0.06 DISCUSSION
Sunlight
Full sunlight 42 2 1 1.71–346.47 0.0185
Shaded 9 6 24.34 This study was undertaken to identify and char-
acterize larval habitats of anopheline mosquitoes in
N = Total; P = Larvae positive water collections; OR = Adjusted odds Nouakchott. As a Saharan city with arid and dry climate,
ratio; 95% CI= Confidence interval 95% of OR.
Nouakchott has been regarded malaria-free for many
years. Results revealed the presence of anopheline larvae
gen concentration (0.9 mg/l) was observed in El mechrou
in all prospected water collections except those created
water sample originated from a house-hold drinking wa-
from rains. The absence of anopheline larvae in such water
ter tank and the highest oxygen content (8.01 mg/l) was
pools could be explained by the sandy texture of the soil
scored in Mgueizira sample. All sampled water collec-
of prospected sites which are not able to preserve the pre-
tions, except that of El mechrou, were with partial or full
cipitation as surface water. In contrast, all sampled hu-
sunlight and free from vegetation. In order to determine
man made water pools were productive for anopheline
key factors governing larvae positivity of prospected water
larvae and emerged adult mosquitoes were morphologi-
bodies from one hand and larvae density of breeding sites
cally identified as An. gambiae s.l. Their specific identi-
from another hand, obtained data were subjected to re-
fication will be done using the polymerase chain reaction
gression analyses. The multivariate logistic regression
method. Malarial vectors in the An. gambiae complex are
analysis (Table 3) has shown that the depth and the sun-
known to use diverse water bodies as larval habitats. These
light situation of the water collections in Nouakchott city
habitats differ in physical as well as chemical and bio-
were independently associated with the larvae positivity.
logical characteristics, which directly influence the dis-
A water collection pH ≥ 7.61 showed a tendency to be a
tribution and abundance of mosquito larval populations
protective factor (adjusted odds ratio—OR = 0.06, 95%
in nature. Physicochemical characteristics of the evi-
CI [0.0–1.11], p = 0.0587) and the shaded situation of the
denced anopheline breeding sites generally agree with es-
water collection and a depth >25 cm were risk factors
tablished habitat description for Anopheles larvae. Lar-
(OR = 24.34, 95% CI [1.71–346.47], p = 0.0185 and OR
vae of An. gambiae complex, particularly An. arabiensis
= 22.22, 95% CI [1.39–354.42], p = 0.0282). The multi-
and An. gambiae s.s. are usually associated with small
variate Poisson regression analysis (Table 4) has shown
and shallow freshwater pools11. They are known to pre-
that the salinity, pH and the sunlight situation of the breed-
fer open sunlit habitats without vegetation for oviposi-
ing sites were independently associated with the larval
tion and often with turbid and low conductive water12–13.
Table 4. Multivariate Poisson regression analysis of larval Their presence in water collections resulting from human
density in breeding sites in Nouakchott city activities has also been reported14–15.
It is, therefore, clear that in Nouakchott, the develop-
Characteristics N OR 95% CI p-value ment of public standpipes and the households’ use of water
Salinity storage tanks have generated favourable conditions for
≤ 0.1 g/l 6 1 0.44–0.87 0.0052 the development of aquatic stages of anopheline mosqui-
> 0.1 g/l 2 0.62 toes in this Saharan city. Further investigations are nec-
Sunlight essary to better understand how females select habitats
Full sunlight 2 1 0.44–0.71 < 0.0001
Shaded 6 0.56 for oviposition and what environmental factors influence
pH 2 the production of adults from those habitats. In summary,
< 7.61 4 1 1.25–1.95 0.0001 this study has established for the first time, habitat char-
≥ 7.61 4 1.56 acteristics of An. gambiae s.l. in the city of Nouakchott.
N = Total; OR = Adjusted odds ratio; 95% CI = Confidence interval It demonstrates that in Nouakchott, despite an arid and
95% of OR. dry climate unfavourable for the development of mos-
306 J Vector Borne Dis 50, December 2013

quitoes, human practices consisting of the construction 4. Lekweiry KM, Abdallahi MO, Ba H, Arnathau C, Durand P,
of tanks to retain water discharged from public stand- Trape JF, et al. Preliminary study of malaria incidence in
Nouakchott, Mauritania. Malar J 2009; 8: 92.
pipes or to store drinking water in households have con- 5. Lekweiry KM, Basco LK, Salem MS, Hafid JE, Marin-Jauffre
tributed to the establishment of environmental conditions A, Weddih A, et al. Malaria prevalence and morbidity among
favourable for anopheline mosquitoes breeding and, there- children reporting at health facilities in Nouakchott, Mauritania.
fore, maintaining malaria transmission in this Saharan city. Trans R Soc Trop Med Hyg 2011; 105: 727–33.
6. Hamon J, Maffi M, Ouedraogo CS, Djime D. Notes
Results provide useful information that can be used as a
sur les moustiques de la République Islamique de Mauritanie
guide for selection and implementation of adequate lar- (Diptera: Culicidae) (1ère partie). Bull Soc Entomol 1964; 69:
val control interventions with regard to these unexpected 233–53.
artificial anopheline habitats. The core malaria vector 7. Hamon J, Maffi M, Grenier P, Ouedraogo CS, Djime D. Notes
control intervention like use of LLINs could be comple- sur les moustiques de la République Islamique de Mauritanie
(Diptera: Culicidae) (2ème partie). Ann Soc Entomol 1966;
mented in Nouakchott by larval source control. In this 2: 371–83.
area, appropriate larval control measures may be recom- 8. Dia I, Ba H, Mohamed SAO, Diallo D, Lo B, Diallo M. Distri-
mended in line with an IVM approach. Finally, future bution, host preference and infection rates of malaria vectors in
research in this field should focus on mapping the ma- Mauritania. Parasit Vectors 2009; 2: 61.
9. Lekweiry KM, Basco L, Ould Ahmedou Salem MS, Hafid JE,
laria risk in order to spatially focus malaria control in the
Marin-Jauffre A, Bouchiba H, et al. Malaria prevalence, mor-
areas that are at greater risk levels. bidity and drug resistance in Nouakchott, Mauritania. Trop Med
Int Health 2011; 16 (Suppl 1): 136–7.
ACKNOWLEDGEMENTS 10. Chateau B, Perrin N, Samba D, Diarra T. The distribution of
drinking water in Nouakchott, Mauritania. Analysis of water sale
Authors thank the owners of standpipes and house- outlets [in French] CUN, IDF, GRET 2007; p. 1–26.
holds in the districts of Teyarett, Dar Naim and Arafat 11. Gilles MT, Coetzee MA. A supplement to the Anophelinae of
Africa south of the Sahara (Afro Tropical Region). Publication
for their excellent cooperation. Special thanks are ex- of the South African Institute of Medical Research 1987; 55:
tended to Doctors Hansi O. Tfeil from ONISPA and 1–143.
Mohamed el Kory O. Cheikh from INRSP for their help 12. Edillo FE, Toure YT, Lanzaro GC, Dolo G, Taylor CE. Spatial
in physicochemical analysis. and habitat distribution of Anopheles gambiae and Anopheles
arabiensis (Diptera: Culicidae) in Banambani village, Mali. J
REFERENCES Med Entomol 2002; 39: 70–7.
13. Shililu J, Tewolde G, Fessahaye S, Mengistu S, Fekadu H, Mehari
1. National policy and strategies for malaria control (2006–10) [in Z, et al. Larval habitat diversity and ecology of anopheline lar-
French]. Mauritania: National Malaria Control Programme, vae in Eritrea. J Med Entomol 2003; 40: 921–9.
Ministry of Health 2005; p. 1–31. 14. Gimning JE. Characteristics of larval anopheline (Diptera: Culi-
2. World malaria report 2011. Geneva: World Health Organiza- cidae) habitats in western Kenya. J Med Entomol 2001; 38: 282–
tion 2011. 8.
3. Cortes H, Morillas-Marquez F, Valero A. Malaria in Mauritania: 15. Fillinger U, Sombroek H, Majambere S, Loon Ev, Takken W,
The first cases of malaria endemic to Nouakchott. Trop Med Int Lindsay SW. Identifying the most productive breeding sites for
Health 2003; 8: 297–300. malaria mosquitoes in the Gambia. Malar J 2009; 8: 62

Correspondence to: O. Mohamed Salem Boukhary Ali, Department of Biology, Faculty of Sciences and Techniques, University of Sciences,
Technology and Medicine, Nouakchott, Mauritania.
E-mail: alimedsalem@gmail.com

Received: 27 February 2013 Accepted in revised form: 6 May 2013


Ahmedou Salem et al. Malaria Journal 2014, 13:26
http://www.malariajournal.com/content/13/1/26

RESEARCH Open Access

Polymorphism of the merozoite surface protein-1


block 2 region in Plasmodium falciparum isolates
from Mauritania
Mohamed Salem O Ahmedou Salem1,2, Magatte Ndiaye3, Mohamed OuldAbdallahi4, Khadijetou M Lekweiry1,
Hervé Bogreau5,6,7, Lassana Konaté2, Babacar Faye3, Oumar Gaye3, Ousmane Faye2
and Ali O Mohamed Salem O Boukhary1*

Abstract
Background: The genetic diversity of Plasmodium falciparum has been extensively studied in various parts of the
world. However, limited data are available from Mauritania. The present study examined and compared the genetic
diversity of P. falciparum isolates in Mauritania.
Methods: Plasmodium falciparum isolates blood samples were collected from 113 patients attending health
facilities in Nouakchott and Hodh El Gharbi regions. K1, Mad20 and RO33 allelic family of msp-1 gene were
determined by nested PCR amplification.
Results: K1 family was the predominant allelic type carried alone or in association with Ro33 and Mad20 types
(90%; 102/113). Out of the 113 P. falciparum samples, 93(82.3%) harboured more than one parasite genotype. The
overall multiplicity of infection was 3.2 genotypes per infection. There was no significant correlation between
multiplicity of infection and age of patients. A significant increase of multiplicity of infection was correlated with
parasite densities.
Conclusions: The polymorphism of P. falciparum populations from Mauritania was high. Infection with multiple
P. falciparum clones was observed, as well as a high multiplicity of infection reflecting both the high endemicity
level and malaria transmission in Mauritania.
Keywords: Plasmodium falciparum, Malaria, Genetic diversity, Multiplicity of infection, msp-1 gene, Mauritania

Background in the most Sahelian countries [1,8]. The country can be


Malaria remains a public health problem in Mauritania divided into three epidemiological strata: the Saharan
with an estimated of 250,000 clinical cases reported an- region in the north, representing 80% of the country’s
nually [1]. Data reported during the two last decades area with annual rainfall less than 100 mm, where mal-
shown an increase in malaria cases from 26.933 in 1990 aria transmission is rare. A sero-epidemiological study
to 188.025 in 2006 [2]. The majority of infection is due conducted in 1980s showed prevalence between 8 and
to Plasmodium falciparum, which is responsible for more 15% of history of infection with P. falciparum in this
than 80% of malaria cases and entomological studies zone [9]. In the Sahelian zone, located in the southern
show that the main vector is Anopheles gambiae [1,3-7]. part, between Nouakchott and Nema (annual rainfall
Throughout the country malaria is endemic with a sea- 100-300 mm), malaria is unstable and seasonal trans-
sonal transmission from July to October, as is the case mission during rainy season can cause deadly epidemics
[3,4]. The Sudanian region in the South, bordering with
the Senegal River Valley (annual rainfall 300-600 mm),
* Correspondence: alimedsalem@gmail.com
1
Laboratoire de Biotechnologie, Faculté des Sciences et Techniques, an agricultural area, including rice, where malaria trans-
Université des Sciences, de Technologie et de Médecine, Nouakchott, PO mission is stable, but with a significant difference in
Box 5026, Nouakchott, Mauritanie prevalence between the rainy season and the dry season
Full list of author information is available at the end of the article

© 2014 Ahmedou Salem et al.; licensee BioMed Central Ltd. This is an open access article distributed under the terms of the
Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use,
distribution, and reproduction in any medium, provided the original work is properly cited.
Ahmedou Salem et al. Malaria Journal 2014, 13:26 Page 2 of 8
http://www.malariajournal.com/content/13/1/26

[1]. Despite the enormous efforts that have been directed the N-terminal of MSP-1, is the most polymorphic part
toward malaria control and prevention [10], multiple fac- of the antigen and appears to be under the strongest
tors including insecticide resistance in anopheline vectors, diversifying selection within natural populations [21].
the lack of effective vaccines, and the emergence and rapid The genetic diversity of P. falciparum has been exten-
spread of drug-resistant strains are the major problems for sively studied in various parts of the world, but limited
controlling and preventing malaria. data are available from Mauritania. The only study on
Therefore, the development of an effective malaria vac- P. falciparum population genetic structure using msp-1,
cine continues to be urgently needed. However, extensive msp-2 and glurp markers date back 15 years [4]. The
genetic diversity in natural malaria parasite populations present study examined and compared the genetic di-
is a major obstacle for the development of an effective versity of P. falciparum isolates among febrile patients
vaccine against these parasites, because antigenic diversity attending health facilities in Nouakchott and Hodh El
limits the efficiency of acquired protective immunity to Gharbi region in Mauritania, during the peak of malaria
malaria [11,12]. Many P. falciparum proteins have been transmission, using the polymorphic gene encoding for
proposed for use as vaccine candidate antigens, but the the merozoite surface protein-1 (MSP-1).
merozoite surface protein-1 (MSP-1) has been most
studied [13,14]. Extensive genetic polymorphism of the Methods
msp-1 gene has been identified in P. falciparum isolates Study sites
worldwide [15-17]. It is important to investigate the The study was conducted in Hodh El Gharbi (HG),
diversity of msp-1 gene, in different geographic areas for south-east Mauritania, and in Nouakchott, the capital
the further development of effective malaria vaccine. The city of Mauritania during the rainy season in September–
gene coding the merozoite surface protein 1 (msp-1) has October 2010 (Figure 1). HG region (latitude 16° 13′
been widely used as a marker for genotyping parasite 02″ N, longitude 9° 54′ 44″ W) covers a surface area of
populations [18-20]. In P. falciparum, the surface protein 53,000 km2 with four departments, (Aïon, Kobeni, Tintane
MSP-1 (around 190 kDa) plays an important role in and Tamchekett). The population of HG is approximately
erythrocyte invasion by the merozoite [21]. The protein 212,156 inhabitants [25]. Most residents are subsistence
is a principal target of human immune responses [22] animal breeders and farmers. The climate in HG region is
and is a promising candidate for a blood stage subunit Sahelian characterized by a long dry season, lasting from
vaccine [14,23]. The msp-1 gene occurs as one of three October to June, and a rainy season extending from July
distinct allelic families: K1, MAD20 and Ro33 [24]. It to September. It receives between 200-300 mm of annual
has 7 variable blocks that are separated either by con- rainfall. The monthly mean temperature ranges from 24
served or semi-conserved regions. Block 2, a region near to 37°C. A transmauritanian highway of 1,200 km from

Figure 1 Map of Mauritania showing the study sites.


Ahmedou Salem et al. Malaria Journal 2014, 13:26 Page 3 of 8
http://www.malariajournal.com/content/13/1/26

Nouakchott to Nema in the far south-eastern region of cell count of 8,000 cells per μl [26]. Absence of malaria
the country passes through HG from west to east. HG parasites in 200 high power ocular fields of the thick
region can also be reached on a paved road from Nioro du film was considered as negative. Obtained data were
Sahel in Mali. The region is poorly served by health ser- graded according to parasitaemia: 1, patients with 50-499
vice facilities. There is only one hospital in Aïoun and one parasites/μl; 2, patients with 500-4,999 parasites/μl; 3,
health centre in each department. Nouakchott (18°.11′N; patients with more than 5,000 parasites/μl.
16°.16′W), is situated in a Saharan zone, near the Atlantic
coast at an average altitude of 7 m. It comprises nine Plasmodium falciparum DNA extraction
districts and houses 743,511 inhabitants corresponding to Parasite DNA was extracted, from blood samples blotted
one fourth of the whole population of the country [25]. The on filter paper by methanol method described by Djimde
wet season is short, extending from July to September, with et al. [27]. Briefly, 500 μl of methanol was added to a
little annual variation in the amount of rainfall (50-80 mm). 1.5 ml microcentrifuge tube containing three or four
The monthly mean temperatures in Nouakchott varied pieces of filter paper and incubated at 15 min at room
from 21°C to 30.5°C. Nouakchott is served by five hospi- temperature. The methanol was poured off and the papers
tals and nine health centres spread across the city. HG heated at 95-100°C in 50-70 μl of sterile distilled water
and Nouakchott exhibit every year high level of human for 15 minutes of incubation, during which the tube was
migration with Nouakchott residents traveling and staying gently vortexed every five minutes. The samples were
in Hodh El Gharbi during the months of July, August, centrifuged twice and the final supernatant was stored
September corresponding to the school vacations, and at −20°C until used for the amplification reaction. All PCR
returning to Nouakchott in October and November. analyses were conducted in the ‘Service de Parasitologie’
at the Faculty of Medicine, Université Cheikh Anta Diop,
Patients and blood samples collection Dakar.
The samples of this study were collected from 676 febrile
patients attending Kobeni, Tintane and Aïoun health facil- PCR amplification of the P. falciparum msp-1 gene
tities in HG region and the ‘Centre Hospitalier National’, The highly polymorphic locus, msp-1 block 2, was used
‘Centre Hospitalier Cheikh Zayed’ and ‘Centre de Santé de for the genotyping of the P. falciparum population using
Teyarett’ in Nouakchott. Before blood sample collection, the nested polymerase chain reactions (PCR) technique.
informed consent was obtained from all participants or The msp −1 primers sequences used in this study are
in case of children from their parents/legal guardians shown in Table 1 [28]. For the primary amplifications
prior to their enrolment. The study was approved by (outer PCR), primer pairs corresponding to the flanking
‘the Direction Régionale de l’Action Sanitaire, DRAS, under sequence of the conserved regions of msp −1 was used
the authority of the Mauritanian Ministry of Health. (Table 1). The second amplification reactions (nested
During the study, if patient presented to health facilities
with symptoms consistent with mild malaria, including Table 1 Sequences of oligonucleotide primers used to
fever, chills, headache, and a positive slide, they were of- genotype msp-1 block 2 allelic types of Plasmodium
fered standard ACT as first-line treatment. Among the pa- falciparum isolates from Mauritania
tients enrolled, 276 (40.8%) were microscopically confirmed Amplification/ Sequence Polymorphism
Primer
as P. falciparum infection. Out of these 114 (40.7%) pa-
Outer PCR
tients were from Kobeni, 89(31.7%) from Tintane and
55(19.6%) from Aïoun in HG region and 18(6.5%) pa- Msp1F 5′AAGCCTTAGAAGATGCAGTATTGAC3′ Conserved
tients from Nouakchott. A total of 113 patients were Msp1R 5′ATTCATTAATTTCTTCATATCCATTATC3′
randomly selected from the 276 P. falciparum positives Nested PCR
patients by microscopy. A finger prick blood sample K1F 5′AAGAAATTACTACAAAAGGTG3′ K1 family
was taken from each consenting patient for thick and specific
thin blood film and 2-3 drops were collected on What- K1R 5′TGCATCAGCTGGAGGGCTTGCACCAC3′ K1 family
man® No. 3 filter paper, dried and stored in individual specific
plastic bag until used for DNA extraction. Ro33F 5′AGGATTTGCAGCACCTGGAGATCT3′ Ro33 family
specific
Malaria parasite identification Ro33R 5′GAGCAAATACTCAAGTTGTTGCA3′ Ro33 family
Thick and thin smears were stained with Giemsa. Parasite specific
density was determined by counting the number of Mad20F 5′TGAATTATCTGAAGGATTTGTACGTC3′ Mad20 family
specific
asexual parasites per 200 white blood cells, and calcu-
lated per microlitre using the following formula: num- Mad20R 5′GAACAAGTCGAACAGCTGTTA3′ Mad20 family
specific
ber of parasites x 8,000/200, assuming a white blood
Ahmedou Salem et al. Malaria Journal 2014, 13:26 Page 4 of 8
http://www.malariajournal.com/content/13/1/26

PCR) were based on the primary products using allelic- Table 2 Population characteristics of P. falciparum
specific primers sets corresponding to K1, RO33 and infected patients from different study sites in Mauritania
Mad20 families of msp-1. The primers for msp −1 used Characteristics Kobeni Tintane Aïoun Nouakchott Total
in this study are shown in Table 1. All outer and nested n (%) n (%) n (%) n (%) n (%)
PCR reactions were done in 25 μl final volume. For each Gender
reaction, 200 μM each of deoxyribonucleoside triphos- Male 20(55.6) 27(69.2) 12(6) 11(61.1) 70(61.9)
phate (dNTP), 1 μM of each primer, 0.5U of Taq DNA
Female 16(44.4) 12(30.8) 8(4) 7(38.9) 43(38.1)
polymerase and PCR Buffer 10X containing 100 mM
Tris–HCl, pH 8.3, 500 mM KCl, 15 mM MgCl2 and Age group
0.01% gelatin were used. The outer and the nested amp- <5 1(2.8) 1(2.56) 2(10.0) 0 4(3.5)
lification were performed on an Applied Biosystem 2720 5-19 21(58.3) 23(59.0) 13(65.0) 6(33.3) 63(55.8)
and PTC-100 Peltier Thermal Cycler respectively using 20-39 13(36.1) 7(17.95) 4(20.0) 8(44.5) 32(28.3)
the following conditions: initial denaturation for 3 min ≥ 40 1(2.8) 8(20.5) 1(5.0) 4(22.2) 14(12.4)
at 94°C, followed by 30 cycles of 25 s denaturation at
Total 36(31.8) 39(34.5) 20(17.7) 18(16.0) 113(100)
94°C, 35 s annealing at 50°C, and 2 min 30 extension at
n: number of individuals.
68°C. Final extension was carried out at 72°C for 3 min.
Nested PCR products were visualized by electrophoresis
on 2% agarose gel (Gibco-BRL) for various lengths of time Allelic polymorphism of msp-1
depending of the predicted size of the PCR products and Allele typing revealed highly polymorphic nature of
visualized under UV trans-illumination. Mauritanian P. falciparum isolates with respect to msp-1
gene. K1, Mad20 and Ro33 MSP1 allele’s types were
identified. The total number of different sized alleles de-
Allelic distribution and multiplicity of infection tected in this sample was 27. Among them, nine for K1
The msp-1 alleles were categorized by their molecular (160-400 bp), 12 for Mad20 (140-400 bp) and six for
weights and considered the same if their molecular weights Ro33 (160-360 bp) allele families were noted. Frequen-
were approximately within 10 bp [29]. The multiplicity of cies of different msp-1 alleles and their combinations
infection (MOI), or complexity of infection, was estimated and multiplicity of infection are shown in Table 3. The
by the average number of PCR fragments per infected frequency of samples with only K1, Mad20 and Ro33
individual, as described by Zwetyenga et al. [30]. were 10.6% (12/113), 2.6% (3/113) and 4,4% (5/113) re-
spectively. K1/Mad20, K1/Ro33 and Mad20/Ro33 com-
Statistical analyses binations were found in 21.2% (24/113), 16.8% (19/113)
Statistical analyses were performed using MedCalc for and 2.6% (3/113) of samples respectively and 41.6% (47/
Windows, version 12.3.0.0 (MedCalc Software, Mariakerke, 113) of them harbored all three allelic types. Prevalence
Belgium). Proportions were compared for significance of K1, Mad20 and Ro33 allelic types was 90.0% (102/113),
using the χ2-test. Spearman’s rank correlation coeffi- 68.1% (76/113) and 65.5% (74/252) respectively. Multiple
cients were calculated to assess associations between clones infections over all study sites was 82.3% (93/113)
multiplicity of infection, parasite densities and age groups with a minimum of 72.2% (13/18) in Nouakchott and a
of patients under study. A P value of ≤ 0.05 was considered maximum of 90.0% (18/20) in Aïoun. Multiplicity of infec-
indicative of a statistically significant difference. tion (MOI) was highest in P. falciparum infected patients
enrolled in Aïoun health facility (4.3 genotypes per infec-
tion) and lowest in those from Nouakchott health facilities
Results (2.3; mean of three health facilities). However, obtained
Characteristics of the study population MOI values were not statistically different from each other
Out of the 113 randomly selected P. falciparum patients (p = 0.56). The estimated MOI of all studied area was 3.2
attending health facilities in study sites, 31.8% (36/113) genotypes per infection.
were from Kobeni, 34.5% (39/113) from Tintane, 17.7%
(20/113) from Aïoun and 16% (18/113) from Nouakchott Relationship between multiplicity of infection, age groups
(Table 2). Males (70/113; 61.9%) were significantly and parasite densities
higher (χ2 = 6.4; p = 0.01) than females (43/113; 38.1%). Age group distribution of P. falciparum-infected patients
Patients belonging to the age group 5-19 years were the and msp-1 block 2 allelic types is shown in Table 4. The
most represented with 55.8% (63/113) followed by those prevalence of K1, Mad20, Ro33 and their different combi-
of 20-39 years of ages with 28.3% (32/113), patients nations was significantly higher among patient aged 5-
whose ages ≥ 40 years with 12.4% (14/113) and children 19 years compared to other age groups (p < 0.05) (Table 4).
under five years representing 3.5% (4/113). However, no significant correlation between multiplicity
Ahmedou Salem et al. Malaria Journal 2014, 13:26 Page 5 of 8
http://www.malariajournal.com/content/13/1/26

Table 3 Msp-1 block 2 allelic type frequencies and multiplicity of infection of P. falciparum isolates from different
study sites in Mauritania
Allelic type Kobeni Tintane Aïoun Nouakchott Total
n (%) n (%) n (%) n (%) n (%)
K1 4(11.1) 6(15.4) 1(5.0) 1(5.5) 12(10.6)
Mad20 1(2.8) 0 1(5.0) 1(5.5) 3(2.6)
Ro33 0 2(5.1) 0 3(16.7) 5(4.4)
K1/Mad20 7(19.4) 10(25.6) 6(30.0) 1(5.5) 24(21.2)
K1/Ro33 9(25.0) 4(10.2) 0 6(32.3) 19(16.8)
Mad20/Ro33 2(5.5) 0 0 1(5.5) 3(2.6)
K1/Mad20/Ro33 13(36.1) 17(43.6) 12(60.0) 5(27.8) 47(41.6)
Total 36(100.0) 39(100.0) 20(100.0) 18(100.0) 113(100.0)
Total K1 33(91.6) 37(94.9) 19(90.0) 13(72.2) 102(90.0)
Total Mad20 23(63.8) 27(69.2) 19(90.0) 7(38.8) 77(68.1)
Total Ro33 24(66.6) 23(58.9) 12(60.0) 15(83.3) 74(65.5)
Multiclonal isolates 31(86.1) 31(79.5) 18(90.0) 13(72.2) 93(82.3)
MOI 3.1 3.2 4.3 2.3 3.2
n: number of individuals; MOI: multiplicity of infection.

of infections and age groups of patients (Spearman and multiplicity of P. falciparum infection was signifi-
rank coefficient = 0.2; p = 0.8) was noted. The distribu- cantly correlated (Spearman rank coefficient = 1; p < 0.01).
tion of K1, Mad20 and Ro33 according to parasitaemia
is shown in Table 5. This study found that the individ- Discussion
ual distribution of K1, Mad20, Ro33 was not signifi- This study was undertaken to assess the polymorphism
cantly different among parasitaemic groups (p = 0.94). of the merozoite surface protein-1 block 2 allelic types
Multiclonal isolates was not significantly different nei- in P. falciparum isolates from different study sites in
ther between 50-499 parasites/μl and ≥ 5000 parasites/μl Mauritania. Plasmodium falciparum is thought to be
(p = 0.09), or between 50-499 parasites/μl and 500-4999 responsible of nearly 80% of diagnosed malaria cases in
parasites/μl (p = 0.08). However, estimated parasitaemia the country [1]. A better understanding of population
structure of P. falciparum genotypes may be an important
Table 4 Distribution of P. falciparum msp-1 block 2 allelic element for implementing malaria control strategies in the
type among age groups of P. falciparum infected patients
country. Data showed a relatively high polymorphic nature
from Mauritania
of K1, Mad20 and Ro33 msp-1 allelic types according to
Age group (years)
the number of band sizes (27 different PCR products: 9 K1,
Allelic type <5 5-19 20-39 ≥40 Total 12 Mad20 and 6 Ro33) among Mauritanian P. falciparum
n (%) n (%) n (%) n (%) n (%) isolates. Comparable results were found by Jordan et al.
K1 1(0.9) 8(7.1) 1(0.9) 2(1.8) 12(10.6) [4]; authors noted 11, 8 and 2 different sized alleles re-
Mad20 0 1(0.9) 2(1.8) 0 3(2.6) spectively for K1, Mad20 and Ro33 in P. faliparum isolates
Ro33 0 2(1.8) 2(1.8) 1(0.9) 5(4.4) from malaria patients in Aïoun and Kobeni area located in
K1/Mad20 1(0.9) 17(15.0) 6(5.3) 0 24(23.0)
southern Mauritania. The number of different msp-1
alleles observed among P. falciparum isolates is also
K1/Ro33 1(0.9) 10(8.8) 6(5.3) 2(1.8) 19(16.8)
comparable to that founded by Konate et al. [31] in the
Mad20/Ro33 0 2(1.8) 1(0.9) 0 3(2.6) holoendemic area of Dielmo (Senegal) where 33 msp-1
K1/Mad20/Ro33 1(0.9) 23(20.3) 14(12.4) 9(7.9) 47(41.6) alleles were evidenced, but less than that reported by
Total 4(3.5) 63(55.7) 32(28.4) 14(12.4) 113(100.0) Soulama et al. [29] who founded 41 different sized al-
Total K1 4(100.0) 58(92.1) 27(84.3) 13(92.8) 102(90.3) leles for msp-1 block 2 region in P. falciparum isolates
Total Mad20 2(50.0) 43(68.2) 23(71.8) 9(64.3) 77(68.1)
collected from children with uncomplicated malaria
infection living in Burkina Faso. The study also re-
Total Ro33 2(50.0) 37(58.7) 23(71.8) 12(85.7) 74(65.5)
vealed the predominance of K1 type alleles either at
Multiclonal isolates 3(2.6) 52(46.0) 27(23.9) 11(9.7) 93(82.3) study site level or throughout the parasite population
MOI 3.25 3.21 3.03 3.37 3.2 compared to Mad20 and Ro33. Similar finding have
n: number of individuals; MOI: multiplicity of infection. previously reported among P. falciparum isolates from
Ahmedou Salem et al. Malaria Journal 2014, 13:26 Page 6 of 8
http://www.malariajournal.com/content/13/1/26

Table 5 Distribution of Msp-1 block 2 allelic types among parasitaemic groups of P. falciparum infected patients from
Mauritania
Allelic type Parasitaemia*
50-499 n (%) 500-4999 n (%) ≥5000 n (%) Total
K1 1(0.9) 6(5.3) 5(4.4) 12(10.6)
Mad20 1(0.9) 2(1.8) 0 3(3.5)
Ro33 0 2(1.8) 3(2.6) 5(4.4)
K1/Mad20 1(0.9) 10(8.8) 13(11.5) 24(21.2)
K1/Ro33 6(5.3) 9(7.9) 4(3.5) 19(16.8)
Mad20/Ro33 0 1(0.9) 2(1.8) 3(2.6)
K1/Mad20/Ro33 2(1.8) 22(19.5) 23(20.3) 47(41.6)
Total 11(9.7) 52(46.0) 50(44.3) 113(100.0)
Total K1 10(90.9) 47(90.4) 45(90.0) 102(90.3)
Total Mad20 4(36.4) 35(67.3) 38(76.0) 77(68.1)
Total Ro33 8(72.7) 34(65.4) 42(84.0) 74(65.5)
Multiclonal isolates 9(7.9) 42(37.2) 42(37.2) 93(82.3)
MOI 2.6 3.4 3.6 3.2
(*) parasite/μl of blood; n: number of individuals; MOI: multiplicity of infection.

Aïoun and Kobeni [4]. In Dakar, P. falciparum isolates have suggested that the influence of age on the multiplicity
from 48 Senegalese patients hospitalized for malaria of infection is highly affected by endemicity of malaria
showed a prevalence of 68% for K1 alleles [32]. Most of which is probably a reflection of the development of
the isolates were mixed infections (82.3%) which har- anti-parasite specific immunity [36]. However, this finding
bored more than one allele type. However, prevalence contrasting with reports from other locations [29,31,37]. A
of patients with multiclonal infection was similar in all positive correlation between multiplicity of infection and
study sites. A relatively high multiplicity of infections parasite densities was observed in this study (MOI = 2.6-
(MOI) was observed among P. falciparum patients ei- 3.6). This is consistent with many reports demonstrating
ther at study site level (2.33-4.25) or over all the study that higher parasite densities increase the probability of
sites (3.22) reflecting the high intensity level of malaria detecting concurrent clones in an individual [18,38]. This
transmission during the study period. When they com- study used P. falciparum isolates from patients with clin-
pared 63 P. falciparum positve samples taken from fe- ical symptoms, so that the MOI may be lower than that
brile patients in Aïoun and 110 positive samples from reported in asymptomatic patients [39]. Many reports
Kobeni, Jordan et al. [4] reported a multiple infections showed that MOI would reflect that infected individual
of 1.57 and 2.34, respectively. It is reported that the has immunity against malaria [31]. Thus, the MOI should
multiplicity of infection in an infected patient may be be studied in asymptomatic P. falciparum-infected popu-
due to an important entomological inoculation rate as lation in Mauritania further, particularly in children. The
shown in the Senegal village of Dielmo where patients similarity between P. falciparum strains could be ex-
receive a large number of infective bites [31], or by a plained by population migration between study sites that
single mosquito carrying several parasitic clones in his may allow for exchanges of parasite population. Similar re-
inoculums [33]. In the context of the present study, it sults were noted in many malaria endemic areas [40-42].
is difficult to speculate on the influence of mosquito The present study is the second report based on molecular
inoculum on the multiplicity of infection because no epidemiology of P. falciparum following the work con-
such data is available for the study sites in Mauritania. ducted by Jordan et al. [4] in Aïoun and Kobeni Depart-
The MOI values reported in this study are consistent ment of HG region and the first with respect to Tintane
with those reported from regions with high malaria en- department in the same region and Nouakchott, the cap-
demicities [34]. Furthermore, there was no association ital city of Mauritania. It demonstrates that P. falciparum
between MOI and age of patients. Investigations con- populations, at leat in Kobeni and Aïon, had maintained
ducted in Senegal (Ndiop village where malaria is mesoen- a high level of polymorphism in the msp-1 block 2 re-
demic and seasonal) and Benin (Cotonou), founded that gion. Studies using a larger number of blood samples
MOI was not affected by age of malaria patients [31,35]. collected from different geographic areas in Mauritania
Previous studies regarding the variation of MOI over age are required not only to determine the nationwide
Ahmedou Salem et al. Malaria Journal 2014, 13:26 Page 7 of 8
http://www.malariajournal.com/content/13/1/26

parasite heterogeneity and detailed malaria epidemiology 7. Lekweiry KM, Basco LK, Salem MS, Hafid JE, Marin-Jauffre A, Weddih AO,
but also to implement malarial control programmes in this Briolant S, Bogreau H, Pradines B, Rogier C, Trape JF, Boukhary AO: Malaria
prevalence and morbidity among children reporting at health facilities
neglected malaria country. in Nouakchott, Mauritania. Trans R Soc Trop Med Hyg 2011, 105:727–733.
8. Gasquet M, Delmont J, Le Bras J: Chloroquine-resistant falciparum malaria
in Mauritania. Lancet 1995, 346:1556.
Conclusions
9. Monjour L, Richard-Lenoble D, Palminteri R, Daniel Ribeiro C, Alfred C,
Plasmodium falciparum isolates from Mauritania exhib- Gentilini M: A seroepidemiological survey of malaria in desert and
ited a high degree of genetic polymorphism in msp-1 gene semi-desert regions of Mauritania. Ann Trop Med Parasitol 1984, 78:71–73.
and most of the infected patients carried multiple clones 10. World Health Organization: http://www.who.int/malaria/publications/
country-profiles/2011/profile_mrt_en.pdf.
of parasites reflecting the high level of malaria endemicity 11. Genton B, Betuela I, Felger I, Al-Yaman F, Anders RF, Saul A, Rare L, Baisor M,
in study sites during malaria transmission season. Lorry K, Brown GV, Pye D, Irving DO, Smith TA, Beck HP, Alpers MP: A
recombinant blood-stage malaria vaccine reduces Plasmodium
Competing interests falciparum density and exerts selective pressure on parasite populations
The authors declare that they have no competing interests. in a phase 1-2b trial in Papua New Guinea. J Infect Dis 2002, 185:820–827.
12. Takala SL, Escalante AA, Branch OH, Kariuki S, Biswas S, Chaiyaroj SC, Lal AA:
Authors’ contributions Genetic diversity in the block 2 region of the merozoite surface protein1
MSOAS conceived of the study, carried out molecular study and performed (MSP-1) of Plasmodium falciparum: additional complexity and selection
statistical analysis; MN, BF, OG conceived and supervised molecular analyses and convergence in fragment size polymorphism. Infect Genet Evol 2006,
and participated in the paper drafting; KML, OAM, carried out the 6:417–424.
microscopic analysis and participated in statistical analyses; HB, LK, OF, 13. Genton B, Al-Yaman F, Betuela I, Anders RF, Saul A, Baea K, Mellombo M,
AOMSB conceived of the study, participated in its design and helped to draft Taraika J, Brown GV, Pye D, Irving DO, Felger I, Beck HP, Smith TA, Alpers
and critically analysed the manuscript. All authors read and approved the MP: Safety and immunogenicity of a three-component blood-stage
final manuscript. malaria vaccine (MSP1, MSP2, RESA) against Plasmodium falciparum in
Papua New Guinean children. Vaccine 2003, 22:30–41.
Acknowledgements 14. Reed ZH, Kieny MP, Engers H, Friede M, Chang S, Longacre S, Malhotra P,
This study was supported by the national malaria control program (PNLP) of Pan W, Long C: Comparison of immunogenicity of five MSP1-based
Mauritania. MSOAS also received a scholarship from the ‘Service de la malaria vaccine candidate antigens in rabbits. Vaccine 2009, 27:1651–1660.
Coopération et de l’Action Culturelle, SCAC’ of the France embassy in 15. Kang JM, Moon SU, Kim JY, Cho SH, Lin K, Sohn WM, Kim TS, Na BK:
Nouakchott. Authors thank all health staffs in Tintane, Aioun, Kobeni and Genetic polymorphism of merozoite surface protein-1 and merozoite
Nouakchott for the appreciated efforts to facilitate the field work. Many surface protein-2 in Plasmodium falciparum field isolates from Myanmar.
thanks for all malaria patients for their help and cooperation. Malar J 2010, 9:131.
16. Joshi H, Valecha N, Verma A, Kaul A, Mallick PK, Shalini S, Prajapati SK,
Author details Sharma SK, Dev V, Biswas S, Nanda N, Malhotra MS, Subbarao SK, Dash AP:
1
Laboratoire de Biotechnologie, Faculté des Sciences et Techniques, Genetic structure of Plasmodium falciparum field isolates in eastern and
Université des Sciences, de Technologie et de Médecine, Nouakchott, PO north-eastern India. Malar J 2007, 6:60.
Box 5026, Nouakchott, Mauritanie. 2Laboratoire d’Ecologie Vectorielle et 17. Noranate N, Prugnolle F, Jouin H, Tall A, Marrama L, Sokhna C, Ekala MT,
Parasitaire, Faculté des sciences et techniques, Université Cheikh Anta Diop, Guillotte M, Bischoff E, Bouchier C, Patarapotikul J, Ohashi J, Trape JF, Rogier C,
Dakar, Sénégal. 3Service de Parasitologie-Mycologie, Faculté de Médecine, Mercereau-Puijalon O: Population diversity and antibody selective pressure
Université Cheikh Anta Diop, Dakar, Sénégal. 4Service de Parasitologie et de to Plasmodium falciparum MSP1 block2 locus in an African malaria-endemic
Mycologie, Institut National de Recherches en Santé Publique, BP 695, setting. BMC Microbiol 2009, 15:219.
Nouakchott, Mauritanie. 5Unité de Parasitologie, Département d’Infectiologie 18. Peyerl-Hoffmann G, Jelinek T, Kilian A, Kabagambe G, Metzger WG,
de Terrain, Institut de Recherche Biomédicale des Armées, BP 7391 223 Von Sonnenburg F: Genetic diversity of Plasmodium falciparum and its
Brétigny-sur-Orge cedex, France. 6Aix Marseille Université, Unité de relationship to parasite density in an area with differ-ent malaria
Recherche sur les Maladies Infectieuses et Tropicales Emergentes, UM 63, endemicities in West Uganda. Trop Med Int Health 2001, 6:607–613.
CNRS 7278, IRD 198, INSERM 1095, Faculté de Médecine La Timone, 27 19. Terrientes ZI, Vergara J, Kramer KJ, Herrera S, Chang SP: Restricted genetic
boulevard Jean Moulin, 13385 Marseille cedex 5 Marseille, France. 7Unité de diversity of Plasmodium falciparum major merozoite surface protein 1 in
Parasitologie Institut Pasteur, 23 Avenue Pasteur, BP 6010, 97306 Cayenne isolates from Colombia. Am J Trop Med Hyg 2005, 73:55–61.
cedex Guyane, France. 20. Khaminsou N, Kritpetcharat O, Daduang J, Charerntanyarak L, Kritpetcharat P:
Genetic analysis of the merozoite surface protein-1 block 2 allelic types in
Received: 13 July 2013 Accepted: 21 January 2014 Plasmodium falciparum clinical isolates from Lao PDR. Malar J 2011, 10:371.
Published: 23 January 2014 21. Holder AA, Blackman MJ: What is the function of MSP-1 on the malaria
merozoite? Parasitol Today 1994, 10:182–184.
References 22. Woehlbier U, Epp C, Kauth CW, Lutz R, Long CA, Coulibaly B, Kouyaté B,
1. National Malaria Control Programme: National policy and strategies for Arevalo-Herrera M, Herrera S, Bujard H: Analysis of antibodies directed against
malaria control (2006-2010) [in French]. Mauritania: Ministry of Health; 2005. merozoite surface protein 1 of the human malaria parasite Plasmodium
2. WHO: World malaria report 2008. Geneva: World Health Organization; 2008. falciparum. Infect Immun 2006, 74:1313–1322.
3. Eberl KJ, Jelinek T, Aida AO, Peyerl-Hoffmann G, Heuschkel C, El Valy AO, 23. Pichyangkul S, Gettayacamin M, Miller RS, Lyon JA, Angov E, Tongtawe P,
Christophel EM: Prevalence of polymorphisms in the dihydrofolate Ruble DL, Heppner DG Jr, Kester KE, Ballou WR, Diggs CL, Voss G, Cohen JD,
reductase and dihydropteroate synthetase genes of Plasmodium falciparum Walsh DS: Pre-clinical evaluation of the malaria vaccine candidate P.
isolates from southern Mauritania. Trop Med Int Health 2001, 6:756–760. falciparum MSP1(42) formulated with novel adjuvants or with alum.
4. Jordan S, Jelinek T, Aida AO, Peyerl-Hoffmann G, Heuschkel C, El Valy AO, Vaccine 2004, 22:3831–3840.
Christophel EM: Population structure of Plasmodium falciparum isolates 24. Tanabe K, Sakihama N, Kaneko O, Saito-ito A, Kimura M: A PCR method for
during a epidemic in southern Mauritania. Trop Med Int Health 2001, molecular epidemiology of Plasmodium falciparum msp-1. Tokai J Exp Clin
6:761–766. Med 1999, 23:375–381.
5. Cortes H, Morillas-Marquez F, Valero A: Malaria in Mauritania: the first cases 25. National Statistics Office: Statistical yearbooks (1995–2005) [in French].
of malaria endemic to Nouakchott. Trop Med Int Health 2003, 8:297–300. Mauritania: Ministry of Economic affairs and development; 2006.
6. Lekweiry KM, Abdallahi MO, Ba H, Arnathau C, Durand P, Trape JF, Salem AO: 26. Shute GT: The microscopic diagnosis of malaria. In Malaria. Edited by
Preliminary study of malaria incidence in Nouakchott, Mauritania. Malar J Wernsdorfer WH, McGregor I. Churchill Livingstone, Edinburgh: Churchill
2009, 8:92. Livingstone; 1988:805.
Ahmedou Salem et al. Malaria Journal 2014, 13:26 Page 8 of 8
http://www.malariajournal.com/content/13/1/26

27. Djimde A, Doumbo OK, Cortese JF, Kayentao K, Doumbo S, Diourte Y, Dicko A,
Su XZ, Nomura T, Fidock DA, Wellems TE, Plowe CV, Coulibaly D: A molecular
marker for chloroquine-resistant falciparum malaria. N Engl J Med 2001,
344:257–263.
28. Malaria Research and Reference Reagent Resource Center (MR4): www.mr4.org.
29. Soulama I, Nébié I, Ouédraogo A, Gansane A, Diarra A, Tiono AB, Bougouma
EC, Konaté AT, Kabré GB, Taylor WRJ, Sirima S: Plasmodium falciparum
genotypes diversity in symptomatic malaria of children living in an
urban and a rural setting in Burkina Faso. Malar J 2009, 8:135.
30. Zwetyenga J, Rogier C, Tall A, Fontenille D, Snounou G, Trape JF,
Mercereau-Puijalon O: No influence of age on infection complexity and
allelic distribution in Plasmodium falciparum infections in Ndiop, a
Senegalese village with seasonal, mesoendemic malaria. Am J Trop Med
Hyg 1998, 59:726–735.
31. Konate L, Zwetyenga J, Rogier C, Bischoff E, Fontenille D, Tall A, Spiegel A,
Trape JF, Mercereau-Puijalon O: Variation of Plasmodium falciparum msp1
block 2 and msp2 allele prevalence and of infection complexity in two
neighbouring Senegalese villages with different transmission conditions.
Trans R Soc Trop Med Hyg 1999, 93(Suppl 1):21–28.
32. Henry M, Diallo I, Bordesj KAS, Pradines B, Diatta B, M’ Baye PS, Sane M,
Thiam M, Gueye MP, Wade B, Touze JE, Debonne JM, Rogier C, Fusai T:
Urban malaria in Dakar, Senegal: chemosusceptibility and genetic
diversity of Plasmodium falciparum isolates. Am J Trop Med Hyg 2006,
75:146–151.
33. Druilhe P, Daubersies P, Patarapotikul J, Gentil C, Chene L,
Chongsuphajaisiddhi T, Mellouk S, Langsley G: A primary malaria infection
is composed of avery wide range of genetically diverse but related
parasites. Am J Clin Invest 1998, 101:2008–2020.
34. Babiker HA, Lines J, Hill WG, Walliker D: Population structure of
Plasmodium falciparum in villages with different malaria endemicity in
east Africa. Am J Trop Med Hyg 1997, 56:141–147.
35. Issifou S, Djikou S, Sanni A, Lekoulou F, Ntoumi F: Pas d’influence de la
saison de transmission ni de l’âge des patients sur la complexité et la
diversité génétique des infections dues à Plasmodium falciparum à
Cotonou (Bénin). Bull Soc Pathol Exot 2001, 94:195–198.
36. Vafa M, Troye-Blomberg M, Anchang J, Garcia A, Migot-Nabias F: Multiplicity
of Plasmodium falciparum infection in asymptomatic children in Senegal:
relation to transmission, age and erythrocyte variants. Malar J 2008, 7:17.
37. Smith T, Beck HP, Kitua A, Mwankusye S, Felger I, Fraser-Hurt N, Irion A,
Alonso P, Teuscher T, Tanner M: Age dependence of the multiplicity of
Plasmodium falciparum infections and of other malariological indices in
an area of high endemicity. Trans R Soc Trop Med Hyg 1999, 93:15–20.
38. Farnert A, Arez AP, Babiker HA, Beck HP, Benito A, Bjorkman A, Bruce MC,
Conway DJ, Day KP, Henning L, Mercereau-Puijalon O, Ranford-Cartwright LC,
Rubio JM, Snounou G, Walliker D, Zwetyenga J, Do Rosario VE: Genotyping of
Plasmodium falciparum infections by PCR: a comparative multicentre study.
Trans R Soc Trop Med Hyg 2001, 95:225–232.
39. Magesa SM, Mdira KY, Babiker HA, Alifrangis M, Farnert A, Simonsen PE,
Bygbjerg IC, Walliker D, Jakobsen PH: Diversity of Plasmodium falciparum
clones infecting children living in a holoendemic area in north-eastern
Tanzania. Acta Trop 2002, 84:83–92.
40. Snounou G, Zhu X, Siripoon N, Jarra W, Thaithong S, Brown KN, Viriyakosol S:
Biased distribution of msp1 and msp2 allelic variants in Plasmodium
falciparum populations in Thailand. Trans R Soc Trop Med Hyg 1999,
93:369–374.
41. Gómez D, Chaparro J, Rubiano C, Rojas MO, Wasserman M: Genetic
diversity of Plasmodium falciparum field samples from an isolated
Colombian village. Am J Trop Med Hyg 2002, 67:611–616.
42. Basco LK, Ringwald P: Molecular epidemiology of malaria in Yaounde, Submit your next manuscript to BioMed Central
Cameroon. VIII. Multiple Plasmodium falciparum infections in and take full advantage of:
symptomatic patients. Am J Trop Med Hyg 2001, 65:798–803.
• Convenient online submission
doi:10.1186/1475-2875-13-26 • Thorough peer review
Cite this article as: Ahmedou Salem et al.: Polymorphism of the
merozoite surface protein-1 block 2 region in Plasmodium falciparum • No space constraints or color figure charges
isolates from Mauritania. Malaria Journal 2014 13:26. • Immediate publication on acceptance
• Inclusion in PubMed, CAS, Scopus and Google Scholar
• Research which is freely available for redistribution

Submit your manuscript at


www.biomedcentral.com/submit