Vous êtes sur la page 1sur 281

Rsum

T
T
H
H
E
E
S
S
E
E

En cotutelle prsente lENS de Kouba, Algrie

P Po ou ur r l l o ob bt te en nt ti io on n d du u g gr ra ad de e d de e

D Do oc ct te eu ur r
d de e l l E Ec co ol le e N No or rm ma al le e S Su up p r ri ie eu ur re e d de e K Ko ou ub ba a- -A Al lg ge er r, , A Al lg g r ri ie e
e et t
d de e l l U Un ni iv ve er rs si it t J Je ea an n- -M Mo on nn ne et t d de e S Sa ai in nt t- -E Et ti ie en nn ne e, , F Fr ra an nc ce e


D Di is sc ci ip pl li in ne e : : B Bi io ol lo og gi ie e e et t E Ec co op ph hy ys si io ol lo og gi ie e V V g g t ta al le e

p pa ar r




B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s
d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e
d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e


Thse codirige par les Professeurs Abdelkrim KAMELI et Laurent LEGENDRE


Soutenue le octobre 2012 devant le jury compos de :

M. Nasserdine SABAOU, Professeur, Ecole Normale Suprieure de Kouba-Algrie Prsident
M. Chabane CHELGHOUM, Professeur, USTHB dAlger-Algrie Rapporteur
M. Benoit ST-PIERRE, Professeur, Universit Franois Rabelais de Tours-France Rapporteur
M. Mohamed YOUSFI, Professeur, Universit Amar Tlidji de Laghouat-Algrie Examinateur
M. Abdelkrim KAMELI, Professeur, Ecole Normale Suprieure de Kouba-Algrie Directeur de thse
M. Laurent LEGENDRE, Professeur, Universit Jean Monnet de Saint Etienne-France Directeur de thse
M. Frdric JULLIEN, Matre de confrences, Universit Jean Monnet de Saint Etienne-France Invit






Thse ralise conjointement au laboratoire de Biotechnologies Vgtales appliques aux Plantes Aromatiques et Mdicinales (BVPAM-EA3061), Facult des Sciences et
Techniques, Universit Jean Monnet de Saint Etienne, au laboratoire de Recherche sur les Produits Bioactifs et Valorisation de la Biomasse (LRPBVB) et au laboratoire de
Biologie des Systmes Microbiens (LBSM), Ecole Normale Suprieure de Kouba, Algrie







ECOLE NORMALE SUPERIEURE, KOUBA-ALGER
DEPARTEMENT DE BIOLOGIE
UNIVERSITE JEAN MONNET-SAINT ETIENNE
FACULTE DES SCIENCES ET TECHNIQUES
Ecole Doctorale : Sciences, Ingnierie et Sant
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4




Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e



























B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s
d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e
d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Introduction gnrale




Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e




Thse cofinance par une bourse de coopration Algro-Franaise (PROFAS ex. BAF) et
par une bourse CMIRA de la rgion Rhne Alpe-France








Adresse des Laboratoires :


Laboratoire de Biotechnologies Vgtales appliques aux Plantes Aromatiques et
Mdicinales
Facult des Sciences et Techniques
23 rue du Docteur Paul Michelon
42023 Saint-Etienne Cedex 2
France


Laboratoire de Recherche sur les Produits Bioactifs et Valorisation de la Biomasse
Laboratoire de Biologie des Systmes Microbiens
Ecole Normale Suprieure
BP 92 Kouba
16000 Alger
Algrie

t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4




Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e
































A la mmoire de ma mre qui ma quitte dlaisse au milieu de la route,
A mon pre,
A ma femme Hayet,
A mon fils Mohamed Ishak qui est venu au milieu de cette thse,
A mes frres et surs,
A tous ceux qui me sont chers,...







t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Introduction gnrale




Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

R
RE EM ME ER RC CI IE EM ME EN NT TS S



En premier lieu et avant tout je tiens remercier DI EU le tous puissant qui ma donn le
courage, la patience et la force de terminer ce travail.

La majorit de cette thse a t ralise au laboratoire de Biotechnologies Vgtale
applique aux plantes aromatiques et mdicinales (BVpam) de la Facult des Sciences et
Techniques de Saint Etienne, dirig par le Pr. Laurent LEGENDRE puis par le Pr. Sylvie
Baudino-Caissard et une petite partie aux laboratoires de Recherche sur les Produits
Bioactifs et Valorisation de la Biomasse (RPBVB) et sur la Biologie des Systmes
Microbiens de lENS dAlger, dirigs par le Pr. Nasserdine SABAOU. Je souhaite tous les
remercier ici pour laccueil et les facilits quils mont rservs au sein des laboratoires.

Je tiens tout d'abord remercier mon co-directeur de thse Mr. L. LEGENDRE, qui a
bien voulu m'encadrer et m'accueillir dans son labo et dans son quipe pendant ce projet
et de m'avoir donn la chance de raliser un projet dans un domaine qui ne m'tait pas
vraiment familier et dans lequel j'ai beaucoup appris. Sans sa confiance et ses
encouragements, le projet n'aurait jamais pu s'acheminer. Il s'est d'autant plus investit, en
me permettant d'acqurir une exprience unique de recherche en biologie molculaire. De
plus, L. LEGENDRE m'a soutenu durant tout ce projet par ses conseils et son optimisme.
L'ambiance qu'il fait rgner dans son laboratoire a de plus grandement contribu au
maintien de ma motivation et au plaisir de travailler avec lui.

Dans un deuxime temps, je remercie d'une faon toute particulire, mon directeur de
recherche, Mr. Abdelkrim KAMELI , professeur chercheur l'Ecole Normale Suprieure
de Kouba. Je ne serais pas arriv jusque l sans laide de M. KAMELI . Je le remercie
pour la qualit de ses conseils, pour sa disponibilit et pour son investissement constant.

Je remercie Mr. N. SABAOU de mavoir honor en acceptant la prsidence de ce jury de
thse.

Je tiens exprimer ma reconnaissance aux membres du jury, Mr. Chabane
CHELGHOUM, Professeur, USTHB dAlger-Algrie, Mr. Benoit ST-PI ERRE,
Professeur, Universit Franois Rabelais de Tours-France et Mr. Mohamed YOUSFI ,
Professeur, Universit Amar Telidji de Laghouat-Algrie, qui ont accepts dvaluer ce
travail.

Je tiens galement dire un merci bien spcial Mr. Frdric J ULLI EN et Mr. J ean-
Louis MAGNARD, Matres de confrences chercheurs au BVpam pour leur soutien,
d'orientation, de l'enthousiasme et les critiques constructives au cours de cette tude.

Le travail n'aurait jamais pu tre complt sans l'utilisation du GC/MS du CNRS de
Solaize-Lyon avec la participation de M. Herv CASABIANCA et Dany MAI TRE et le
GC/MS de lIUT de Saint Etienne avec la participation de Mr. Alain PI OT.

Mes recherches nauraient pas t possibles sans les facilits octroyes par Mr. Bernard
PASQUI ER (Directeur du Conservatoire National des Plantes Parfum, Mdicinales,
Aromatiques et Industrielles de Milly la Fort), merci vous Mr. Bernard de nous avoir
ouvert laccs ton jardin et tes serres de la collection unique de lavandes.
Remerciements
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Introduction gnrale




Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

Cette recherche de longue dure n'aurait pu se faire sans l'appui financier de la rgion
Rhne Alpe, France, ni sans la bourse de coopration Algro-Franaise. Tous ces
donateurs m'ont permis d'acheminer cette recherche l'abri des inquitudes montaires.

Jadresse de sincres remerciements lensemble de mes collgues et amis du BVpam que
ce soit pour les conseils, les services et plus particulirement pour lamiti quils mont
tmoigns. En l'occurrence, Romain, Janna, Nadine, Nicolas, Jean-Claude, Sandrine,
Florence N, Yann, Sylvain, Karine, Alison, Florence G et Audrey. Merci vous tous. Je
vous souhaite tous bonheur, russite et tout le bien que vous mritez.

Enfin, je voudrais remercier ma femme, HAYAT et mon fils, MOHAMED ISHAK qui ont
survcu aux alas d'un mari et dun pre proccup et souvent absent surtout en phase
finale. Lachvement de cette tude n'aurait pas t possible sans leur amour
inconditionnel, le soutien et la patience.

En terminant, je souhaite dmontrer ma plus sincre gratitude toutes les personnes ayant
particip de prs ou de loin la ralisation de ce projet, savoir, Leila, Ahmed, Tayeb,
Cherif, Abdeghani, Farida.

Merci tous !






T. Benabdelkader





















Remerciements
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Introduction gnrale




Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e







Ce travail de thse a donn lieu prsentation des rsultats sous forme de :


Publications

Article1 (Annexe I): Tarek Benabdelkader, Abdelghani Zitouni, Yann Guitton, Frdric
Jullien, Dany Maitre, Hrve Casabianca, Laurent Legendre and Abdelkrim Kameli. 2011.
Essential
oils from wild populations of algerian Lavandula stoechas L.: composition,
chemical variability and in vitro biological properties. Chemistry & Biodiversity, 8(5),
937-953.


Communication en congrs internationales

Poster1 (Annexe II): Tarek Benabdelkader, Abdelghani Zitouni, Yann Guitton, Frdric
Jullien, Laurent Legendre, Abdelkrim Kameli. Variability in yield, chemical composition,
antimicrobial and antioxidant properties of essential oils of lavandula stoechas from
Algeria. 12
me
Symposium international daromathrapie et plantes mdicinales, Grasse les
26, 27 & 28 mars 2010.

Poster2 (Annexe II): Tarek Benabdelkader, Jean-Louis Magnard, Yann Guitton, Karine
Fattarsi, Nicolas Boyer, Bernard Pasquier, Frdric Jullien, Abdelkrim Kameli and Laurent
Legendre. Lavandula terpenoids biosynthesis : clonning, sequencing and functional
characterization of three terpene synthases from a leaf cDNA library of Lavandula
pedunculata subsp. lusitanica. 13
me
Symposium international daromathrapie et plantes
mdicinales, Grasse les 01, 02 & 03 avril 2011.


Une publication est galement en prparation


Article2 : Tarek Benabdelkader, Abdelkrim Kameli and Laurent Legendre. Isoprenoid
biosynthesis in Lavender: Molecular cloning and functional characterization of three
terpene synthases from leaves of Lavandula stoechas Sensu Lato.










t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Introduction gnrale




Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

R
RE ES SU UM ME E


B BI IO OD DI IV VE ER RS SI IT TE E, , B BI IO OA AC CT TI IV VI IT TE E E ET T B BI IO OS SY YN NT TH HE ES SE E D DE ES S C CO OM MP PO OS SE ES S T TE ER RP PE EN NI IQ QU UE ES S V VO OL LA AT TI IL LS S D DE ES S
L LA AV VA AN ND DE ES S A AI IL LE EE ES S, , L LA AV VA AN ND DU UL LA A S ST TO OE EC CH HA AS S S SE EN NS SU U L LA AT TO O, , U UN N C CO OM MP PL LE EX XE E D D E ES SP PE EC CE ES S
M ME ED DI IT TE ER RR RA AN NE EE EN NN NE ES S D D I IN NT TE ER RE ET T P PH HA AR RM MA AC CO OL LO OG GI IQ QU UE E


Les terpnodes sont parmi les composs naturels les plus varis structurellement et
fonctionnellement. Ils jouent plusieurs rles critiques dans l'cologie chimique d'une large gamme
d'organismes. Les terpnes synthases (TPS) sont les enzymes cls impliques dans la biosynthse des
terpnodes, qui aboutit la production d'huile essentielle (HE) de nombreuses plantes aromatiques comme
les espces du genre Lavandula. Dans le but de dvelopper les productions locales de plantes aromatiques et
mdicinales, nous avons ralis une valuation de la composition et des activits biologiques des HEs
extraites des parties ariennes fleuries de L. stoechas sauvages rcoltes sur 11 sites diffrents dans le nord de
l'Algrie. Les huiles ont t analyses par GC/FID et GC/MS, o un total de 121 composs ont t identifis,
reprsentant de 69.88 91.2% du contenu total de l'huile. Nos 11 huiles diffraient considrablement de par
leur composition avec seulement 66 substances communes toutes les huiles. Les principaux constituants
taient le fenchone (11.27-37.48%), le camphre (1.94-21.8%), le 1,8-cinol (0.16-8.71%) et le viridiflorol
(2.89-7.38%). Les activits biologiques in vitro ont dmontr que les activits de pigeage du radical DPPH
et loxydation des lipides du couple -carotne/acide linolique diffraient dun facteur 8 et taient lies
diffrents ensembles de molcules. Nos onze HEs ont prsent de bonnes activits antimicrobiennes envers la
plupart des 16 souches pathognes testes de bactries, de champignons filamenteux et de levures des
valeurs de concentration minimale inhibitrice (CMI) allant de 0.16 3.5 mg/ml.
Les analyses par GC/MS dextraits hexane des composs organiques volatils (COV) de feuilles de
pieds individuels de lavandes Stoechas (L. pedunculata, L. stoechas et L. viridis) ont permis didentifier 124
composs dont la majorit taient des monoterpnes oxygns. Nous avons mis en vidence une variation de
la teneur des principaux COVs en accord avec les variations chmotypiques inter-spcifiques connues entre
les trois lavandes. Les trois pieds que nous avons slectionns correspondaient un chmotype fenchone (L.
pedunculata), un chmotype camphre (L. stoechas) et un chmotype 1,8-cinol (L. viridis). A laide
damorces dgnres nous avons isol trois ADNc en pleine longueur, LpFENS, LpPINS et LpGEAS, de
feuilles de L. pedunculata. Six ADNc homologues en pleine longueur, LsFENS, LsPINS, LsGEAS, LvFENS,
LvPINS et LvGEAS, ont t galement isols des feuilles de L. stoechas et L. viridis en utilisant des amorces
spcifiques aux trois premiers ADNc clons. Tous les clones d'ADNc ont t identifis en tant
quhomologues de TPSs par comparaison de squences prsentes dans la base de donnes GenBank.
Lexpression htrologue dans E. coli et lanalyse de lactivit catalytique par GC/MS des enzymes natives
recombinantes purifies de ces TPSs ont permis leur caractrisation fonctionnelle en tant que, -fenchol
synthases (LpFENS, LsFENS et LvFENS), -pinne synthases (LpPINS, LsPINS et LvPINS) et germacrne A
synthase (LpGEAS, LsGEAS et LvGEAS). Au meilleur de notre connaissance, nous rapportons ici pour la
premire fois trois squences de TPSs jamais publies pour le genre Lavandula. Il sagit aussi de la seconde
description dune activit -fenchol synthase chez les plantes et d-pinne synthase et germacrne A
synthase chez les Lamiaces. Tous les gnes clons sont exprims dans les feuilles des trois lavandes
Stoechas diffrents niveaux en corrlation avec la teneur en composs associs dans la source vgtale.
Cela nous a permis de conclure que les activits de ces TPSs sont principalement rgules au stade
transcriptionnel. Larbre phylogntique reconstruit place nos TPSs dans deux sous-familles de TPSs. Les -
fenchol synthases et les -pinne synthases sont intgres dans la sous-famille TPS-b et les germacrne A
synthases dans la sous-famille TPS-a. Leurs plus proches homologues taient d'autres TPSs de Lavandula ou
de Lamiaces.




Mots cls : Lavandula stoechas ; L. pedunculata subsp. lusitanica ; L. viridis ; Lamiaces ; Terpnes ;
GC/MS ; Activit antioxydante ; Activit antimicrobienne ; -Fenchol synthase ; -Pinene synthase ;
Germacrene A synthase.

Rsum
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Introduction gnrale




Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e





Lavandula stoechas


.
Lavandula .

L. stoechas 11 .
121
88.66 % 81.2 .
88 . : ( 11.21 -
81.76 ) ( 1.87 - % 21.6 ) 1.6 - ( 6.18 - % 6.11 ) ( 2.68 - % 1.86 ) .
DPPH 6
. 18
6.18 8.3 / .

Stoechas (L. pedunculata, L. stoechas, L. viridis)
127 .

(L. pedunculata) (L. stoechas)
1.6 - (L. viridis) . LpFENS, LpPINS
LpGEAS L. pedunculata .
LsGEAS, LvFENS, LvPINS, LvGEAS LsPINS, LsFENS L. stoechas L.
viridis .
GenBank . E. coli
/ : - (LpFENS, LsFENS, LvFENS)
- (LpPINS, LsPINS, LvPINS) (LpGEAS, LsGEAS, LvGEAS) .
Lavandula .
- - .

. .
-
- .
Lavandula .


: Lavandula stoechas L. pedunculata subsp. lusitanica L. viridis
/ - -
.


t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Introduction gnrale




Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

A
AB BS ST TR RA AC CT T

English title
B BI IO OD DI IV VE ER RS SI IT TY Y, , B BI IO OA AC CT TI IV VI IT TY Y A AN ND D B BI IO OS SY YN NT TH HE ES SI IS S O OF F V VO OL LA AT TI IL LE E T TE ER RP PE EN NE E C CO OM MP PO OU UN ND DS S O OF F
W WI IN NG GE ED D L LA AV VE EN ND DE ER RS S, , L LA AV VA AN ND DU UL LA A S ST TO OE EC CH HA AS S S SE EN NS SU U L LA AT TO O, , M ME ED DI IT TE ER RR RA AN NE EA AN N S SP PE EC CI IE ES S
C CO OM MP PL LE EX X O OF F P PH HA AR RM MA AC CO OL LO OG GI IC CA AL L I IN NT TE ER RE ES ST T

Terpenoids are the most structurally and functionally diverse natural compounds that play a critical role
in the chemical ecology of a wide range of organisms. The terpene synthases (TPS) are key enzymes
involved in the biosynthesis of terpenoids which make the bulk of the essential oil (EO) of many aromatic
plants like Lavandula species. In an effort to develop local productions of aromatic and medicinal plants, we
have assessed the composition and the biological activities of EOs extracted from the aerial flowering parts
of wild-grown L. stoechas collected from 11 different locations in northern Algeria. The oils were analyzed
by GC/FID and GC/MS. A total of 121 compounds were identified that accounted for 69.88-91.2 % of the
total oil contents. Our 11 oils differed greatly in their composition and only 66 substances were common to
all oils. Major components were fenchone (11.27-37.48 %), camphor (1.94-21.8 %), 1,8-cineol (0.16-8.71 %)
and viridiflorol (2.89-7.38 %). In vitro biological activities demonstrated that the DPPH-based radical
scavenging and the -carotene/linoleic acid-based lipid anti-oxidation activities differed by an 8 fold factor
and were linked to different sets of molecules in different EOs. Our 11 EOs exhibited good antimicrobial
activities against most of the 16 tested strains of pathogenic bacteria, filamentous fungi and yeast at
minimum inhibition concentration (MIC) values of 0.16 to 3.5 mg/ml.
GC/MS analyses of hexane extracts of volatile organic compounds (VOC) from leaves of individual
plants of Stoechas lavenders (L. pedunculata, L. stoechas and L. viridis) have identified 124 compounds,
most of them being oxygenated monoterpenes. We observed a variation in the content of the main VOCs in
agreement with the known inter-specific chemotypic variations between these lavenders. The three plants we
selected had a fenchone chemotype (L. pedunculata), a camphor chemotype (L. stoechas) and a 1,8-cineol
chemotype (L. viridis). The use of degenerate primers allowed us to isolate three full-length cDNAs,
LpFENS, LpPINS and LpGEAS, from the leaves of L. pedunculata. Six full-length homologous cDNAs,
LsFENS, LsFENS, LsPINS, LsGEAS, LvFENS, LvPINS and LvGEAS were also isolated from the leaves of L.
stoechas and L. viridis with specific primers designed on the cDNAs previously cloned. All cDNA clones
were identified as TPSs homologues by sequence comparison with sequences present in the GenBank
database. Heterologous expression in E. coli and GC/MS analysis of the catalytic activity of native
recombinant enzymes of these TPSs have led to their functional characterization as -fenchol synthases
(LpFENS, LsFENS and LvFENS), -pinene synthases (LpPINS, LsPINS and LvPINS) and germacrne A
synthases (LpGEAS, LsGEAS and LvGEAS). To the best of our knowledge, we report here for the first time
three TPSs sequences never reported before for the genus Lavandula. It is also the second description of an
-fenchol synthase activity in plants and of -pinene synthase and germacrene A synthase in Lamiaceae. All
cloned genes are expressed in leaves of the three Stoechas lavenders at different levels in correlation with the
content of associated products in the plant source. This allowed us to conclude that the activities of these
TPSs are principally regulated at the transcriptional level. A phylogenetic reconstruction placed our cloned
TPSs in two separate TPSs sub-families. The -fenchol synthases and the -pinene synthases clustered in the
TPS-b subfamily and the germacrene A synthases in the TPS-a subfamily. Their closest homologues were
other TPS genes from Lavandula or Lamiaceae.




Key words : Lavandula stoechas ; L. pedunculata subsp. Lusitanica ; L. viridis ; Lamiaceae ; Terpenes;
GC/MS; Antioxidant activity; Antimicrobial activity; -Fenchol synthase ; -Pinene synthase ; Germacrene
A synthase.





Abstract
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Introduction gnrale




Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

L
LI IS ST TE E D DE ES S A AB BR RE EV VI IA AT TI IO ON NS S


A Adnosine
ADN Acide dsoxyribonuclique
ADNc ADN complmentaire
ADNg ADN gnomique
ARN Acide ribonuclique
ARNm ARN messager
BET Bromure dthidium
BLAST Basic Local Alignment Search Tool
BSA Srum albumine de buf
BVpam
Laboratoire de Biotechnologies Vgtales appliques aux Plantes Aromatiques
et Mdicinales
C Cytidine
CCM Chromatographie sur couche mince
CDPS Copalyl diphosphate synthase
CDPS Copalyl diphosphate synthase
CFU Colony-forming unit
CMI Concentration minimale inhibitrice
COV Composs organiques volatils
CPP Copalyl diphosphate
CTAB Bromure dhexadodcyltrimthylammonium
CTP Peptide de transit chloroplastidial
Da Dalton
DMAPP Dimthylallyl diphosphate
dNTP dsoxyribonuclotide triphosphate
DO Densit optique
DPPH 2,2-diphenyl-1-picrylhydrazyl
DTT DiThioThritol
DXR 1-deoxy-D-xylulose-5-phosphate reductoisomerase
EDTA Ethylne Diamine TtraActate
EST Expressed sequence tag
FENS Fenchol synthase
FID Dtecteur ionisation de flamme
FPP Farnsyl diphosphate
G Guanosine
GC Chromatographie en phase gazeuse
GC/MS Chromatographie en phase gazeuse couple la spectromtrie de masse
GEAS Germacrne A synthase
GGPP Granylgranyl diphosphate
GPP Granyl diphosphate
GST glutathione-S-transferase
HE Huile essentielle
IPP Isopentenyl diphosphate
IPTG Isopropyl thio -D-galactoside
KS ent-Kaurene synthase
Liste des abrviations
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Introduction gnrale




Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e
LB Milieu de Luria Bertani
LpFENS Lavandula pedunculata -fenchol synthase (GenBank: JX501511)
LpPINS Lavandula pedunculata -pinne synthase (GenBank: JX501512)
LpGEAS Lavandula pedunculata germacrne A synthase (GenBank: JX501513)
LsFENS Lavandula stoechas -fenchol synthase (GenBank: JX501514)
LsPINS Lavandula stoechas -pinne synthase (GenBank: JX501514)
LsGEAS Lavandula stoechas germacrne A synthase (GenBank: JX501514)
LvFENS Lavandula viridis -fenchol synthase (GenBank: JX501517)
LvPINS Lavandula viridis -pinne synthase (GenBank: JX501518)
LvGEAS Lavandula viridis germacrne A synthase (GenBank: JX501519)
LPP Linalyl diphosphate
MBP maltose binding protein
MEP Voie du 2-C-methyl-D-erythritol 4-phosphate
MS Spectromtrie de masse
MVA Voie du mvalonate
NCBI National Center for Biotechnology Information
NJ Neighbor-Joining
NusA N-utilization substance protein A
PAGE Polyacrilamide gel electrophoresis
PAM Plantes aromatiques et mdicinales
pb paire de bases
PCR Polymerase Chaine Reaction
pI Point isolectrique
PINS Pinne synthase
PM Poids molculaire
PS Poids sec
PT Prnyl transfrases
RACE Amplifications rapides des extrmits des ADNc
RI Indice de rtention
ROS Les drivs actifs de l'oxygne
rpm rotation par minute
RT Temps de rtention
RT Transcription inverse
RT-PCR Reverse Transcription PCR
SD Erreur standard
SDS Sodium Dodecyl Sulfate
T Thymidine
TAE Tris Actate EDTA
TB Milieu Turbo Broth
TEMED Ttramthylthylne Diamine
TPS Terpnes synthases
Tris Tris (hydroxymthyl)-aminomthane
TRX Thioredoxine
UPGMA Unweighted Pair Group Method with Arithmetic mean
UTR rgion non traduite (untranslated region)
X-Gal X-Galactoside

Liste des abrviations
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Introduction gnrale




Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e










Nomenclature et abrviation des aminoacides

Aminoacide Code 3 lettres Code 1 lettre
Alanine Ala A
Arginine Arg R
Asparagine Asn N
Aspartique Asp D
Cyctine Cys C
Glutamine Gln Q
Glutamique Glu E
Glycine Gly G
Histidine His H
Isoleucine Ile I
Leucine Leu L
Lysine Lys K
Mthionine Met M
Phnylalanine Phe F
Proline Pro P
Serine Ser S
Thronine Thr T
Tryptophane Trp W
Tyrosine Tyr Y
Valine Val V

















Nomenclature et abrviation des aminoacides
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Introduction gnrale




Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

T
TA AB BL LE E D DE ES S M
MA AT TI IE ER RE ES S


INTRODUCTION GENERALE 1

C CH HA AP PI IT TR RE E I I. . R RE EV VU UE E D DE E L LI IT TT TE ER RA AT TU UR RE E 3

I.1. LES TERPENOIDES 4
I.1.1. Terme et signification 4
I.1.2. Structure gnrale et classification 5
I.1.3. Fonction 6
I .1.3.1. Fonctions mtaboliques primaires 7
I .1.3.2. Fonctions mtaboliques secondaires 7
I.1.4. Importance 10
I.1.5. Biosynthse 11
I .1.5.1. La formation des blocs de construction, IPP et DMAPP 12
I .1.5.2. La formation des prnyl diphosphates, GPP, FPP et GGPP 15
I .1.5.3. Compartimentation sub-cellulaire 16
I .1.5.4. Produits finaux 17
I.1.6. Site de biosynthse, accumulation et scrtion 20
I.1.7. Huiles essentielles 23
I .1.7.1. Dfinition et rpartition dans le rgne vgtal 23
I .1.7.2. Historique et importance 24
I .1.7.3. Mthode dextraction 24
I .1.7.4. Mthodes danalyses 26
I .1.7.5. Variation ecophysiologique de la composition dune HE 27
I.2. LES TERPENE SYNTHASES 28
I.2.1. Dfinition 28
I.2.2. Structures 30
I .2.2.1. Structures primaires 30
I .2.2.2. Structures tridimensionnelles 32
I.2.3. Classification 34
I .2.3.1. Sous-familles (sous-groupes) 34
I .2.3.2. Classes 36
I.2.4. Mcanismes ractionnels 37
I.2.5. Expression et rgulation 42
I .2.5.1. Rgulation spatiale 43
I .2.5.2. Rgulation temporelle 43
I.2.6. Evolution 45
I.2.7. Expression htrologue 46
I.3. LE GENRE LAVANDULA L. 46
I.3.1. Taxonomie 47
I.3.2. Diversit morphologique 50
I.3.2.1. Section Stoechas Ging. (L. stoechas Sensu Lato) 57
I.3.2.1.1. Lespce L. stoechas L. 58
I.3.2.1.2. Lespce L. pedunculata (Mill) Cav. 62
I.3.2.1.3. Lespce L. viridis L'Hr. 64
I.3.3. Rpartition gographique 66
I.3.4. Intrt commercial, nutritionnel et pharmacologique 67
I.3.5. Phytochimie 70
Table des matires
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Introduction gnrale




Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e
I.3.5.1. Huiles essentielles 70
I .3.5.1.1. Variation inter-spcifique 70
I .3.5.1.2. Variation intra-spcifique 70
I.3.5.2. Flavonodes 74
I.3.6. Les gnes de TPSs de Lavandes 74
I.4. LES OBJECTIFS DE LA THESE 75

C CH HA AP PI IT TR RE E I II I. . M MA AT TE ER RI IE EL LS S E ET T M ME ET TH HO OD DE ES S 78

II.1. Materiel vgtal 79
II.2. Souches de microorganismes 81
II.3. Produits chimiques et vecteurs gntiques 82
II.4. Conditions de culture 84
II.5. Extraction et caractrisation des huiles essentielles 86
II.5.1. Hydrodistillation 86
II.5.2. Calcul de rendement en huile essentielle 86
II.5.3. Extraction des volatils par macration dans lhexane 87
II.5.4. Analyse en GC/FID 87
II.5.5. Analyse en GC/MS 87
II.5.6. Identification des composes volatils 88
II.5.7. Quantification des composs volatils 89
II.6. Evaluation de lactivit antioxydante des huiles essentielles des populations de L.
stoechas 89
II.6.1. Criblage rapide de lactivit antioxydante par chromatographie sur couche
mince (CCM) 89
II.6.2. Evaluation de lactivit de pigeage du radical libre par la mthode de
DPPH 89
II.6.3. Evaluation de lactivit antioxydante par la mthode -carotne/acide
linolique 90
II.7. Evaluation de lactivit antimicrobienne des huiles essentielles des populations de
L. stoechas 91
II.8. Obtention des extraits dADN, ARN et ADNc 91
II.8.1. Extraction de lADN gnomique des feuilles de lavandes 91
II.8.2. Extraction d'ADN plasmidique bactrien 92
II.8.3. Extraction des ARN totaux 93
II.8.4. Synthse dADN complmentaire 93
II.8.5. Dosage et contrles de la qualit des acides nucliques 94
II.9. Amplifications par PCR 95
II.9.1. Dfinition des amorces 95
II.9.2. Conditions ractionnelles 97
II.9.3. Stratgie RACE et marche gnomique 97
II.9.4. Dtermination de l'expression des gnes de TPSs 98
II.6.4. Electrophorse sur gel dagarose 99
II.6.5. Purification des fragments dADN 99
II.10. Techniques de clonage 100
II.10.1. Clonage de routine pour squenage 100
II.10.2. Clonages par technologie Gateway 100
II.10.3. Transformation bactrienne 102
II.10.4. Squenage dADN 103
II.11. Expression htrologue de TPSs de lavandes Stoechas et mesure dactivit 103
Table des matires
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Introduction gnrale




Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e
II.11.1. Expression htrologue de TPSs 103
II.11.2. Extraction de protines de TPSs recombinantes 104
II.11.3. Purification partielle de protines de TPSs recombinantes par
chromatographie daffinit sur rsine de nickel 104
II.11.4. Dosage colorimtrique des protines 105
II.11.5. Electrophorse sur gel dnaturant (SDS-PAGE) 105
II.11.6. Mesure in vitro de lactivit de terpne synthases de lavandes Stoechas 107
II.12. Analyses bioinformatiques et statistiques de donnees 107
II.12.1. Alignement de squences 107
II.12.2. Analyses BLAST 107
II.12.3. Prdiction de peptide de transit chloroplastique (CTP) 108
II.12.4. Autres prdictions 108
II.12.5. Analyses phylogntiques 108
II.12.6. Analyses statistiques 109

C CH HA AP PI IT TR RE E I II II I. . R RE ES SU UL LT TA AT TS S E ET T D DI IS SC CU US SS SI IO ON N 110

III.1. Variation et biodiversit des HEs accumules par des populations algriennes
de L. stoechas 112
III.1.1. Introduction 112
III.1.2. Rsultats 114
III.1.2.1. Rendements en huile essentielle de 11 populations algriennes de L.
stoechas 114
III.1.2.2. Composition chimique des huiles essentielles de 11 populations
algriennes de L. stoechas 115
III.1.2.3. Variabilit et biodiversit des huiles essentielles des 11 populations
algriennes de L. stoechas 122
III.1.3. Discussion 123

III.2. Activits biologiques in vitro des HEs accumules par des populations de L.
stoechas 128
III.2.1. Introduction 128
III.2.2. Rsultats 129
III.2.2.1. Activit antioxydante des huiles essentielles de 11 populations de L.
stoechas 129
III.2.2.1.1. Evaluation de lactivit antioxydante par la mthode du DPPH 129
III.2.2.1.2. Evaluation de lactivit antioxydante par la mthode du -
carotne/acide linolique 130
III.2.2.2. Activit antimicrobienne des huiles essentielles de populations de L.
stoechas 132
III.2.3. Discussion 135

III.3. Biodiversit des COVs et variation chmotypique chez L. stoechas Sensu
Lato 141
III.3.1. Introduction 141
III.3.2. Rsultats 142
III.3.3. Discussion 150

III.4. Biosynthse des terpnes chez L. stoechas Sensu Lato 154
III.4.1. Introduction 154
III.4.2. Rsultats 158
Table des matires
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Introduction gnrale




Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e
III.4.2.1. Isolement de gnes de TPSs impliqus dans la biosynthse des terpnes
chez L. stoechas Sensu Lato 158
III.4.2.1.1. Amplification de fragments de TPSs avec des amorces dgnres sur
lADNg de L. pedunculata 158
III.4.2.1.2. Amplification de fragments de TPSs sur ADNc de L. pedunculata 162
III.4.2.1.3. Obtention de squences compltes de TPS de L. pedunculata par
RACE-PCR 163
III.4.2.1.4. Obtention de gnes homologues de LpFENS, LpPI NS et LpGEAS
chez L. stoechas et L. viridis 164
III.4.2.2. Analyse des squences de TPS putatives de L. stoechas Sensu Lato 167
III.4.2.3. Expression htrologue et purification des TPSs recombinantes 171
III.4.2.4. Caractrisation fonctionnelle de nouvelles TPSs de lavandes 174
III.4.2.4.1. Identification des clones d'ADNc LpFENS, LsFENS et LvFENS en
tant que -fenchol synthases 175
III.4.2.4.2. Identification des clones d'ADNc LpPI NS, LsPI NS et LvPI NS en tant
que -pinne synthases 176
III.4.2.4.3. Identification des clones d'ADNc LpGEAS, LsGEAS et LvGEAS en
tant que germacrne A synthases 178
III.4.2.5. Analyse par RT-PCR semi-quantitative de l'expression des gnes de
TPSs de L. stoechas Sensu Lato 179
III.4.2.6. Analyse phylogntique 181
III.4.3. Discussion 184

C CH HA AP PI IT TR RE E I IV V. . C CO ON NC CL LU US SI IO ON NS S E ET T P PE ER RS SP PE EC CT TI IV VE ES S 198

B BI IB BL LI IO OG GR RA AP PH HI IE E 205

A AN NN NE EX XE ES S 239












Table des matires
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Introduction gnrale




Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e
L
LI IS ST TE ES S D DE ES S F
FI IG GU UR RE ES S

Figure Titre Page
1 Rles des terpnodes chez les plantes (daprs Owen & Penuelas, 2005) 7

2 Etapes enzymatiques des voies MEP et MVA dans la synthse dIPP et de
DMAPP (modifie daprs Goto et al., 2010)
14

3 Schma gnral de la biosynthse des terpnodes (modifie daprs
Bohlmann & Keeling, 2008)
15

4 Vue gnrale sur la compartimentation sub-cellulaire des voies
biosynthtiques des terpnodes chez les plantes (modifie daprs Chapell,
2002 ; Bouvier et al., 2005 ; Bouwmeester, 2006 ; Cheng et al., 2007)
17

5 Formation de terpnodes catalyse par divers types de TPSs (daprs Chen
et al., 2011)
18

6 Schma dune coupe radiale anatomique dun trichome glandulaire pelt de
menthe poivre (Mentha x piperita) (dprs Turner et al., 1999)
21

7 Diagramme en ruban de la linalool synthase cristallise illustrant le
domaine N-terminal (orange) et le domaine C-terminal du site actif (vert)
(daprs Hyatt et al., 2007)
33

8 Phylognie gnrale des TPSs (daprs Chen et al., 2011) 35

9 Mcanismes ractionnels des monoTPSs cycliques (A) et des monoTPSs
acycliques (B) initis par lionisation du substrat GPP (daprs Degenhardt
et al., 2009)
39

10 Mcanismes ractionnels des sesquiTPSs initis par lionisation du substrat
FPP (daprs Degenhardt et al., 2009)
41

11 Biosynthse des diterpnes implique l'ionisation et la cyclisation de GGPP
directement, et la cyclisation prliminaire au CPP par protonation de la
double liaison terminale (daprs Bohlmann et al., 1998)
42

12 Taxonomie du genre Lavandula (daprs Upson & Andrews, 2004) 49

13 Arbre de classification des espces du genre Lavandula bas sur les
squences nuclaire ITS (daprs Upson & Andrews, 2004)
50

14 Diversit de trichomes de L. pedunculata (daprs Zuzarte et al., 2010) 52

15 Diversit de formes et de contours des feuilles de certaines espces du
genre Lavandula (Collection BVpam)
52

16 Photographies des inflorescences (thyrses) reprsentatives de 8 sections du
genre Lavandula (Collection BVpam sauf pour la section Sabaudia dont la
photo est de Tim Upson (Upson, 2009))
53

17 Variation de la morphologie des corolles (fleurs) de certaines espces du
genre Lavandula (daprs Upson, 2002)
54

18 Variation des calices (lobes) de certaines espces du genre Lavandula
(daprs Upson, 2002)
55

19 Exemples illustrant la diversit des formes des bractes de certaines
espces du genre Lavandula (aprs Upson, 2002)
56

20 Exemples illustrant la diversit des formes des aknes (nucules) de
certaines espces du genre Lavandula (aprs Upson & Adrews, 2004)
57

21 Distribution gographique de L. stoechas (daprs Upson & Andrews,
2004)
59

22 Lavandula stoechas, tige fleurie x 1 et cyme agrandie x 4 (daprs Upson
& Andrews, 2004)
60

23 Distribution gographique de L. pedunculata (daprs Upson & Andrews,
2004)
62

Liste des figures
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Introduction gnrale




Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e
24 Lavandula pedunculata, tige fleurie x 1 et cyme agrandie x 4 (daprs
Upson & Andrews, 2004)
63

25 Distribution gographique de L. viridis dans la Pninsule Ibrienne
(daprs Upson & Andrews, 2004)
65

26 Lavandula viridis, tige fleurie x 1 et cyme agrandie x 4 (daprs Upson &
Andrews, 2004)
65

27 Schmatisation de laire de rpartition des sections du genre Lavandula
(daprs Guitton, 2011)
66

28 Origine gographique des 11 populations algriennes de L. stoechas
utilises dans cette tude
80

29 Vecteur pGEM-T easy (Promega) avec un site de clonage multiple ouvert
comportant les deux thymidines (T) libres
83

30 Vecteur donneur pENTR/D-TOPO (Invitrogen) avec deux sites de clonage
directionnel
83

31 Sries de vecteurs de destination (dexpression) avec une cassette
attR1/attR2 de recombinaison Gateway
84

32 Reprsentation schmatique du systme Gateway 101

33 Variation des rendements dextractions par hydrodistillation des HEs de
populations algriennes de L. stoechas
114

34 Structures chimique des composs majoritaires et de certains composs
dtects pour la premire fois dans des HEs de L. stoechas dAlgrie
121

35 Dendrogramme de lanalyse hirarchique de onze populations algriennes
de L. stoechas
123

36 Activit antioxydante des HEs des populations de L. stoechas (LS1 - LS11)
et des standards contrle (BHT et -tocophrol)
131

37 CMI cumules de chaque HE des 11 populations de L. stoechas envers les
seize souches cibles
133

38 CMI cumules des 11 HEs de L. stoechas sur chaque souche de
microorganisme cible
134

39 Screening semi-quantitatif sur plaque de CCM de lactivit antioxydante au
test DPPH des 11 HEs de L. stoechas en parallle avec le fenchone, le
camphre, le 1,8-cinol, leugnol, le carvacrol, le BHT et l-tocophrol
136

40 Teneurs et variation des classes chimiques des COVs de feuilles des
lavandes Stoechas
147

41 Teneurs et variation des constituants majoritaires des COVs de feuilles des
lavandes Stoechas
148

42 Composs en formules dveloppes identifis dans les COVs de feuilles
des lavandes Stoechas
149

43 Biosynthse d-fenchol, -pinne, 1,8-cinol, bornol et du camphre
partir du granyl diphosphate via le -terpinyl cation
155

44 Arbre de regroupement de 62 TPSs de Lamiaces 160

45 Dfinition dune amorce dgnre sur une zone conserve 161

46 Reprsentation schmatique de la position et les motifs cibles des amorces
dgnres (TPS1dF, TPS2dF, TPS3dF, TPS4dF, TPS5dF, TPS6dR,
TPS7dR et TPS8dR) utilises pour lamplification des gnes partiels de
TPS de L. pedunculata
161

47 Alignement des squences d'ADNc des TPSs putatives de L. pedunculata, L.
stoechas et L. viridis
165

48 Alignement des squences d'acides amins prdites des clones d'ADNc des
TPSs putatives des groupes FENS, PINS et GEAS de L. pedunculata, L.
stoechas et L. viridis
169

Liste des figures
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Introduction gnrale




Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e
49 Analyse par SDS-PAGE des TPSs recombinantes putatives de lavandes
exprimes dans E. coli, souche Rosetta et purifies par chromatographie
daffinit au Ni
2+

173

50 Analyses par GC/MS des produits terpniques forms in vitro par les
enzymes recombinantes de TPSs des lavandes Stoechas avec le GPP ou le
FPP en tant que substrats
177

51 Analyse des niveaux relatifs des transcrits des gnes de TPSs par RT-PCR
dans les feuilles des trois lavandes
180

52 Relations phylogntiques des TPSs des lavandes Stoechas avec dautres
TPSs connues
182

53 Proposition de fonctionnement des TPSs de lavandes Stoechas dcouvertes
dans cette tude
194

54 Rsidus d'acides amins impliqus dans la formation de l'intermdiaire
germacrne A et sa cyclisation additionnelle par la TEAS
196

































Liste des figures
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Introduction gnrale




Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e
L
LI IS ST TE E D DE ES S T
TA AB BL LE EA AU UX X

Tableau Titre Page
1 Classification des terpnodes 6

2 Distribution fonctionnelle et taxonomique des sous-familles de TPSs des
plantes (daprs Chen et al., 2011)
35

3 Variations inter-spcifiques et intra-spcifiques des principaux constituants des
HEs des espces du genre Lavandula dans la littrature
72

4 Tableau 4 : Distribution de diffrentes classes de flavonodes dans le genre
Lavandula (daprs Upson & Andrews 2004)
74

5 Sites de collecte (avec les abrviations) et principales caractristiques
cologiques des biotopes de 11 populations algriennes de L. stoechas qui ont
servi de source d'HE dans la prsente tude
79

6 Gnotypes et origines de souches dE. coli de clonage et dexpression utilises 82

7 Conditions opratoires GC/FID utilises pour lanalyse des COVs des
populations de L. stoechas
87

8 Conditions opratoires des analyses GC/MS 88

9 Liste des amorces utilises pour les amplifications dADN 96

10 Elments des ractions damplification par PCR 97

11 Conditions des ractions damplification par PCR classique 97

12 Conditions des ractions damplification par RACE-PCR "Touchdown" 98

13 Recette du tampon de Laemmli, gels de SDS-PAGE et tampon de migration 106

14 Compositions chimiques des huiles essentielles des parties ariennes fleuries
de onze populations algriennes sauvages de L. stoechas
116

15 Activit antimicrobienne (CMI) des huiles essentielles des populations
algriennes de L. stoechas
133

16 Composition chimique des COVs de feuilles des lavandes Stoechas (L.
pedunculata, L. stoechas et L. viridis)
143

17 Rcapitulatif de terpne synthases de lavandes 158

18 Caractristiques des squences des gnes clons de TPSs putatives de L.
pedunculata, L. stoechas et L. viridis
168

19 Scores didentit de gnes clons de TPSs putatives de L. pedunculata, L.
stoechas et L. viridis
170

20 Identification et caractristiques des produits volatils synthtiss in vitro par les
TPSs putatives recombinantes de L. stoechas Sensu Lato
175

21 Produits forms in vitro par les TPSs de L. stoechas Sensu Lato 176











Liste des tableaux
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Introduction gnrale




Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

L
LI IS ST TE E D DE ES S A
AN NN NE EX XE ES S


Annexe I : Article huiles essentielles de populations algriennes de L. stoechas publi en
Chemistry & Biodiversity

Annexe II : Poster huiles essentielles de populations algriennes de L. stoechas prsent lors du
12
me
Symposium International dAromathrapie et plantes mdicinales, Grasse
mars 2010

Annexe III : Poster terpne synthases de L. pedunculta prsent lors du 13
me
Symposium
International dAromathrapie et plantes mdicinales, Grasse avril 2011


































Liste des annexes
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Introduction gnrale



1
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

I
IN NT TR RO OD DU UC CT TI IO ON N G
GE EN NE ER RA AL LE E

Les plantes sont une source immense de molcules chimiques complexes exploites
par lhomme dans plusieurs industries telles que lindustrie cosmtique, lindustrie agro-
alimentaire et lindustrie pharmaceutique. La diversit de ces molcules naturelles qui ne
sont pas essentielles la viabilit des plantes reste une nigme pour les biologistes qui
essayent de dcrypter leur rle dans la nature. De mme, l'lucidation des voies de
biosynthse conduisant des produits naturels originaux est un champ d'investigation
inpuisable pour les scientifiques. L'homme prhistorique, qui avait trs peu de moyens,
devait se nourrir des produits de cueillette et de chasse. En assimilant la flore locale, il a
dcouvert les plantes utiles et indispensables pour survivre. Ce rgime, essentiellement
vgtarien, a constitu le berceau de l'utilisation des produits naturels. A cette poque, bien
que les huiles essentielles ne soient pas signales nommment, les plantes aromatiques
taient largement employes.
Actuellement, une augmentation de l'utilisation de composs d'origine naturelle est
observe, justifiant laccroissement de la production de certaines plantes aromatiques et
mdicinales (PAM). Parmi ces PAM de nombreuses Lamiaces mditerranennes sont
utilises pour leurs proprits de leurs huiles essentielles (HE). Ces HE sont le rsultat de
la synthse et de l'accumulation des composs organiques volatils (COVs) qui, in planta,
agissent dans les interactions de la plante avec son environnement biotique (attraction de
pollinisateurs, dfense contre des pathognes) et abiotique (protection contre les UV). Les
HE des Lamiaces sont composes principalement de terpnes de bas poids molculaire,
de phnylpropanodes et de drivs dacides gras.
La valorisation des terpnes a conduit des recherches interdisciplinaires impliquant
la chimie, la biologie et la mdecine. Un des meilleurs exemples a t l'tude de la voie de
biosynthse du taxol, conduisant la production de diffrents anticancreux usage
humain. Par ailleurs, dautres tudes envisagent dans un futur proche la production de
terpnes comme biocarburants. Les approches gnomiques, le squenage complet
dorganismes modles mais aussi le dveloppement de mthodes de squenage haut
dbit ont permis une progression significative dans la caractrisation des gnes et enzymes
impliqus dans la biosynthse des terpnes. Laccumulation de connaissance dans la
biosynthse des terpnes, leur localisation cellulaire et leur rgulation devraient terme
faciliter la manipulation de leurs voies biosynthtiques afin damliorer certains caractres
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Introduction gnrale



2
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

agronomiques tels que les armes de fruits, le parfum floral, la dfense et la rsistance des
plantes envers les insectes et les microorganismes.

Au cours des dernires annes, l'exploitation conomique des espces du genre
Lavandula a augmente en raison de l'utilisation de leurs HEs. Ces huiles peuvent tre
obtenues de plantes sauvages ou cultives. Plusieurs travaux ont tudis la composition
chimique et lactivit biologique des huiles de lavande, mais trs peu de travaux ont port
sur les terpne synthases (TPS) du genre Lavandula et aucun travaux sur les TPSs des
lavandes Stoechas.
Depuis plusieurs annes, les lavandes, et plus exactement les espces de la section
Stoechas, constituent laxe de mes recherches. Les objectifs de ce travail de thse sont :
Une contribution une meilleure connaissance de la nature chimique des terpnes et
des variations chmotypique au sein des espces de la section Stoechas (L. stoechas,
L. pedunculata et L. viridis),
Une valuation des activits antioxydantes et antimicrobiennes des HEs des
populations algriennes de L. stoechas.
Une caractrisation des chmotypes de pieds individuels du complexe despces de
L. stoechas Sensu Lato (L. stoechas, L. pedunculata et L. viridis).
Une caractrisation fonctionnelle de trois terpnes synthase chez L. stoechas, L.
pedunculata et L. viridis.
Ces quatre axes de recherches sinscrivent dans une participation scientifique
lamlioration et la valorisation des huiles essentielles de Lavandula stoechas. Ils ont
donn lieu 2 prsentations crites sous forme de posters dans des congrs internationaux
et la soumission de 2 manuscrits dans des journaux internationaux comit de lecture.
Le prsent manuscrit est organis en 04 chapitres. Un premier chapitre est consacr
ltude bibliographique descriptive de la diversit structurelle et fonctionnelle et des voies
de biosynthse des terpnes, ainsi quun aperu gnral sur les TPSs, enzymes cls de la
synthse des terpnes. Enfin, il est termin par la prsentation du genre Lavandula, en
insistant sur la diversit morphologique des diffrentes espces, leur rpartition
gographique, et surtout leur intrt conomique. Le chapitre II sintresse aux
mthodologies utilises lors de la ralisation de cette thse. Le troisime chapitre,
subdivis en 4 sections, prsente les rsultats obtenus sur nos 4 objectifs de recherche.
Finalement, le dernier chapitre reprendra les conclusions et discutera des perspectives de
ce travail.
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre I. Revue de Littrature



J
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e




















R
RE EV VU UE E
D DE E L
LI IT TT TE ER RA AT TU UR RE E



















t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre I. Revue de Littrature



4
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

I.1. LES TERPENOIDES
I.1.1. Terme et signification
Les terpnodes reprsentent la plus ancienne famille de produits naturels. Les drivs
hopanodes taient prsent sur terre il y a 2.5 milliards annes (Brocks et al., 1999 ;
Summons et al., 1999). Les termes terpnodes, terpnes et isoprnodes sont souvent
utiliss de faon interchangeable et proviennent de trbenthine (lat. balsamum
terebinthinae), une huile essentielle (HE) dont les composs majeurs sont des terpnodes
et qui est obtenue par distillation de la rsine de conifres (Phillips & Croteau, 1999).
Cependant, le mot terpne dsigne au sens stricte des hydrocarbones insaturs drivant de
lisoprne (sufixe "ne") tandis que, terpnode est un terme plus gnrique utilis pour
indiquer quune substance possde le squelette carbon des terpnes, mais pas
ncessairement leur degr dinsaturation, tout en ayant ventuellement un, ou plusieurs,
groupes fonctionnels contenant de l'oxygne (alcool, aldhyde, ctone, acide, lactone etc.).
Dans toute la thse nous rfrerons ces composs par les deux termes "terpnes" ou
"terpnodes" sans diffrence. Nous nous concentrerons galement plus sur le rgne
vgtal.
Les terpnodes constituent la famille de produits naturels la plus diverse
structurellement, strochimiquement et fonctionnellement avec plus de 55 000 molcules
identifies ce jour dans toutes les formes de vie (Christianson, 2008). Des centaines de
nouvelles structures sont reportes chaque anne (Sacchettini & Poulter, 1997 ; Withers &
Keasling, 2007; Penuelas & Munne-Bosch, 2005). Leurs structures varient dune simple
chane linaire dhydrocarbones jusqu' des agencements complexes de cycles carbons
(Connolly & Hill, 1991). Alors que certains terpnodes exercent des fonctions
mtaboliques primaires essentielles pour la croissance et la reproduction chez de nombreux
organismes, la majorit fonctionne comme des mtabolites secondaires et contribue
ladaptation des espces leur niche cologique (Harborne, 1991).
Tous les terpnodes proviennent des prcurseurs simples 5 atomes de carbone,
lisopentnyl diphosphate (IPP) et son isomre le dimethylallyl diphosphate (DMAPP)
assembls et modifis de milliers de faons (Dewick, 1999). La remarquable diversit de la
chimiothque "terpenome" contredit ainsi ses racines simples avec des prcurseurs
universels 5 carbones, lIPP et le DMAPP (Christianson, 2007).
La majorit des terpnodes connus ont t isols partir de plantes o ils jouent le
rle de mtabolites primaires et secondaires. Chez les vgtaux, les terpnodes sont
produits par tous les tissus vgtatifs dont les racines mais aussi par les diverses pices
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre I. Revue de Littrature



-
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

florales (Dudareva et al., 2004). En raison de leurs nombreuses structures, les terpnodes
constituent un groupe htrogne de molcules avec diffrentes proprits physiques et
chimiques. Ils peuvent tre volatiles, semi-volatiles ou non-volatiles, satures et insatures,
chane droite, chane ramifie, cycliques ou acycliques, chiraux ou achiraux, portant
ventuellement divers groupes fonctionnels oxygns (ex. alcools, aldhydes, ctones,
esters et thers) ou contenant de l'azote ou du soufre et sont solubles ou insolubles dans
l'eau (Bohlmann & Keeling, 2008 ; Schwab et al., 2008). Certains terpnodes vgtaux
tels que les strols et les carotnes font partie du mtabolisme primaire et sont prsents
dans toutes les plantes. Cependant, la majorit des terpnodes vgtaux sont des
mtabolites secondaires (Chen et al., 2011). Les terpnodes volatils constituent une partie
importante des composs organique volatils biogniques (COVB) mis par les vgtaux
conjointement avec les oxylipines (drivs dacides gras) et les drivs aromatiques
(benznodes et phnylpropanodes issus de la phnylalanine) (Dudareva & Pichersky,
2000). Enfin, les terpnodes sont les constituants principaux des huiles essentielles, des
rsines et des cires de nombreuses plantes.

I.1.2. Structure gnrale et classification
La structure carbone de base des terpnodes est constitue dun assemblage dun
nombre variable dunits 2-mthylbutane (aussi appeles units isoprne - C5). Ces
assemblages peuvent tre modifis par ajout/soustraction de groupes mthyles ou ajout
datomes d'oxygne. La diversit chimique des terpnodes vgtaux provient alors de la
complexit de leurs voies biosynthtiques (Bohlmann & Keeling, 2008).
Les terpnodes sont classs selon le nombre dunits isoprne dans leur structure de
base comme illustr par le Tableau 1 (McGarvey & Croteau, 1995).
Les terpnodes peuvent galement tre classs selon le nombre de structures cycliques
qu'ils contiennent (cyclique, monocyclique, bicyclique) et larrangement des cycles (labdanes
par exemple).







t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre I. Revue de Littrature



6
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e



Tableau 1 : Classification des terpnodes
Formules brutes correspondant aux formes hydrocarbons linaires possdant un nombre dinsaturation gal au
nombre dunits isoprnes plus 1

Classe Formule brute n disoprne Exemples
Hmiterpnes C
5
H
8
1



Monoterpnes C
10
H
16
2




Sesquiterpnes C
15
H
24
3



Diterpnes C
20
H
32
4




Triterpnes C
30
H
48
6




Ttraterpnes C
40
H
64
8





Polyterpnes (C
5
H
8
)
n
45-30000



le caoutchouc (cis-1,4-polyisoprne)



I.1.3. Fonction
Les terpnodes sont la plus large famille de produits naturels, et sont prsents et
souvent abondants dans tous les phylums du vivant. Comme rsum sur la Figure 1, un
nombre relativement faible mais quantitativement important des terpnodes sont
impliqus dans le mtabolisme primaire. Cependant, la grande majorit des terpnodes
sont classs comme des mtabolites secondaires, composs non-requis pour la croissance
et le dveloppement cellulaire, mais prsums avoir une fonction cologique (Harborne,
1991).



t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre I. Revue de Littrature




Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e




















Figure 1 : Rles des terpnodes chez les plantes (daprs Owen & Penuelas, 2005)
Les points dinterrogations indiquent que ces fonctions nont pas t dmontres systmatiquement chez toutes les
espces mettrices de ces terpnodes. ABA : acide absiscique.


I .1.3.1. Fonctions mtaboliques primaires
Beaucoup des terpnodes communs presque toutes les espces vgtales sont
essentiels la croissance, le dveloppement et le mtabolisme gnral (Croteau et al.,
2000). Leurs rles physiologiques, mtaboliques et structurels se situent, entre autre, au
niveau des pigments photosynthtiques (le phytol forme la chane latrale de la
chlorophylle et les carotnodes participent la fixation de la lumire), de plusieurs
phytohormones (e.g., l'acide abscissique, les brassinostrodes, les cytokinines et les
gibbrellines), des quinones transporteurs d'lectrons (e.g., plastoquinone et ubiquinone),
des composants structuraux membranaires (e.g., les phytostrols qui maintiennent
l'intgrit des membranes comme le campestrol, sitostrol et stigmastrol) et des
dolichols qui facilitent l'assemblage glycoprotine-polysaccharide. Certains terpnodes
remplissent, par des mcanismes inconnus, des fonctions purement dveloppementales
pour la plante. A forte concentration, lisoprne acclre, par exemple, la floraison chez
Arabidopsis thalinana (Terry et al., 1995).

I .1.3.2. Fonctions mtaboliques secondaires
La majorit des terpnodes sont classs comme des mtabolites secondaires non-
essentiels la croissance et au dveloppement cellulaire. Cette classe de composs
organiques inclut des hmiterpnes, monoterpnes, sesquiterpnes et diterpnes, qui
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre I. Revue de Littrature



8
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

prsentent la plus grande diversit structurelle et fonctionnelle parmi les produits naturels
terpnodiques. Ces mtabolites secondaires sont connus, ou prsupposs, avoir des
fonctions spcialises associes des interactions des plantes avec d'autres organismes
vivants dans le contexte de la reproduction, la dfense ou la symbiose (Dudareva et al.,
2004 ; Paschold et al., 2006 ; Gershenzon & Dudareva, 2007).
Les terpnodes forment une partie essentielle des systmes de dfense directs et
indirects contre les herbivores et les pathognes. Les terpnodes peuvent agir dans la
dfense directe envers les bactries, les champignons, les insectes ou les herbivores comme
des toxines, des antibiotiques ou des rpulsifs (Bohlmann & Keeling, 2008). Ils peuvent
galement constituer, des obstacles chimiques et physiques l'alimentation ou
l'oviposition dinsectes (Keeling & Bohlmann, 2006 ; Heiling et al., 2010), ou agir comme
des analogues des hormones d'insectes. Plusieurs tudes ont montr que l'alimentation des
insectes affecte lmission et la synthse des terpnes chez le mas (Turlings et al., 1990),
le coton (Rose et al., 1996), le tabac (Kessler & Baldwin, 2002) et les conifres
(Lewinsohn et al., 1991 ; Martin et al., 2002 ; Martin et al., 2003 ; Miller et al., 2005). Les
monoterpnes et les diterpnes fournissent la majorit des mtabolites constitutifs et
induits de lolorsine pour la protection des conifres (Bohlmann & Croteau, 1999 ;
Phillips & Croteau, 1999 ; Seybold et al., 2000 ; Trapp & Croteau, 2001a ; Martin et al.,
2002). Chez les conifres, ces terpnes participent au scellage des blessures suite un
dommage mcanique (olorsine chez le grand sapin, Abies grandis et l'pinette de Sitka,
Picea sitchensis). Les phytoalexines sont des composs de faible poids molculaire (PM)
produits dans le cadre du systme de dfense. Dans de nombreuses espces vgtales les
diterpnes et les sesquiterpnes agissent comme phytoalexines. Chez le riz (Oryza sativa),
par exemple, quatorze diterpnodes phytoalexines ont t identifis (Cheng et al., 2007).
Les terpnodes vgtaux peuvent influencer la communication entre insectes par des
actions de type phromone (Crock et al., 1997) ou comme des prcurseurs de phromones
(Pickett, 1991). Ils peuvent interfrer dans le dveloppement des insectes comme
analogues d'hormones (Bowers et al., 1976 ; Bowers, 1991). D'autres espces vgtales
sont connues pour leur capacit synthtiser des terpnes antimicrobiens comme une
dfense contre les bactries et les champignons pathognes (Stoessl et al., 1976).
Par des phnomnes de dfense indirecte, les plantes ont la capacit de se dfendre
contre les herbivores via le renforcement de l'efficacit des ennemis naturels des
herbivores. Ces caractristiques constitutives ou inductibles comprennent galement des
terpnodes de faible PM qui sont souvent librs en tant que substances volatiles de
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre I. Revue de Littrature



?
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

plantes avant ou pendant l'attaque par les herbivores. Un des exemples les plus tonnants
de la dfense indirecte des plantes est la libration d'un mlange de composs volatils qui
attirent spcifiquement les prdateurs et parasites des herbivores, aprs lattaque par des
herbivores (Kessler & Baldwin, 2002 ; Unsicker et al., 2009). La recherche effectue sur le
mas a ainsi rvl que le caryophyllne mis par les racines tait un signal souterrain qui
attire fortement les nmatodes entomopathophages (Rasmann et al., 2005). Il a t
dmontr prcdemment que les pousses de Lotus japonicus infestes par des acariens
(Tetranychus urticae) dgagent un mlange de composs volatils qui attire le Phytoseiulus
persimilis connu comme prdateur dacariens (Ozawa et al., 2000).
Le terme alllopathie regroupe tous les processus impliquant des mtabolites
secondaires dans linhibition de la croissance et/ou le dveloppement dun organisme
biologique (Gniazdowska & Bogatek, 2005). Lmission de terpnodes participerait
notamment linhibition de la germination des graines (Fischer et al., 1994 ; Tarayre et al.,
1995) et/ou de la croissance de certaines espces voisines (Stevens, 1984). De ce fait, il a
t rcemment propos que les monoterpnes oxygns puissent tre utiliss comme bio-
herbicides (Kordali et al., 2007). Les terpnes peuvent galement influencer les
interactions plante-plante (Singh et al., 2006 ; Ens et al., 2009 ; OReilly-Wapstra et al.,
2011), les associations plantes-microbes/champignons (Bednarek & Osbourn 2009 ;
Ludley et al., 2009 ; OReilly-Wapstra et al., 2011) et la phnologie despces d'arbres
(Becerra, 2007; Dungey et al., 2000 ; Iason et al., 2005 ; OReilly-Wapstra et al., 2011)
par des effets alllopathiques souterrains. Ces effets ont le potentiel d'affecter la
biodiversit et l'volution des cosystmes terrestres.
Bien que leur aptitude intoxiquer ou repousser les herbivores soit un point central
de la majorit des tudes, les terpnodes peuvent aussi jouer dautres rles cologiques
tels que l'attraction de pollinisateurs (Pichersky & Gershenzon, 2002). Les parfums floraux
sont des mlanges complexes et diversifis de composs volatils odorants de faible poids
molculaire. Ils sont de nature lipophile et ont un haut point de tension de vapeur. Ils
appartiennent plusieurs classes de composs incluant majoritairement des terpnes, des
drivs dacides gras et des drivs des phnylpropanodes (Knudsen & Gershenzon,
2006). Le parfum floral est utilis par de nombreuses plantes pour attirer les insectes
pollinisateurs. Il constitue ainsi un lment cl de la reproduction des plantes (Pellmyr,
1986). La volatilit des composs du parfum floral leur permet d'agir en tant que messagers
chimiques longue distance pour fournir des informations sur la localisation et l'identit de
la fleur. Cependant, dans certains cas, des terpnodes dattraction sont utiliss par des
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre I. Revue de Littrature



1u
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

tricheurs. Par exemple, des parasites peuvent reconnatre leur plante-hte par son odeur,
une odeur utilise la base pour attirer le pollinisateur (Mattiacci et al., 2000).
Les isoprnes et les monoterpnes, via leur capacit de thermoprotection, pourraient
jouer un rle diffrent en protgeant les plantes contre un stress de chaleur suite une
augmentation brusque de la temprature (heat flecks) des feuilles cause par le soleil
(Delfine et al., 2000; Penuelas & Llusia, 2002; Copolovici et al., 2005 ; Sharkey et al.,
2008). Il a en effet t suggr que ces deux classes de terpnodes aident l'appareil
photosynthtique survivre de brefs pisodes ou les tempratures ont t suprieures
40C (Penuelas & Llusia, 2002). En plus, les isoprnes et les monoterpnes peuvent
stabiliser physiquement les membranes des thylacodes haute temprature (Sharkey et al.,
2001) ou dtoxifier des drivs ractifs de loxygne, comme l'ozone, qui peuvent
endommager les membranes (Loreto & Velikova, 2001).

I.1.4. Importance
Les terpnodes disponibles en quantits relativement importantes sous forme dhuiles
essentielles, de rsines ou de cires constituent des ressources renouvelables importantes. Ils
fournissent une gamme de produits commercialement utiles pour lhomme comme, par
exemple, des armes ou saveurs (e.g., menthol extrait de la menthe ou produit par
hmisynthse partir du limonne extrait de peau dagrume, McConkey et al., 2000),
parfums (e.g., santalols), matires industrielles (e.g., acides rsiniques diterpniques),
complments alimentaires sous forme de vitamines (e.g., linalol, Mercier & Chabardes,
1994) ou dulcorants, pesticides (Bohlmann & Keeling, 2008), solvants, adhsifs,
intermdiaires de synthse (McGarvey & Croteau, 1995). Certains sont l'tude en tant
que prcurseurs de biocarburant (e.g., farnesne, Bohlmann & Keeling, 2008).
La grande diversit des structures et des fonctions des terpnodes a provoqu un
intrt pour leur utilisation en mdicine traditionnelle et moderne. Lutilit des terpnodes
a t dmontre pour la chimioprvention et la chimiothrapie de plusieurs maladies (e.g.,
taxol et artmisinine, Jennewein & Croteau, 2001 ; Rodriguez-Concepcion, 2004) et aussi
pour des proprits antimicrobiennes, antifongiques, antiparasitaires, antivirales,
antioxydantes, antiallergnes, antispasmodiques, antihyperglycmiques,
antiinflammatoires, antinoplastiques et immunomodulatrices (Paduch et al., 2007). Ils
jouent galement plusieurs rles dans les remdes en herboristerie traditionnelle et font
l'objet de nombreuses tudes pour en comprendre les effets thrapeutiques. Par consquent,
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre I. Revue de Littrature



11
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

ce groupe de substances mriterait dtre davantage utilis dans les thrapies modernes
(Paduch et al., 2007).
Les membres du groupe terpnode incluent galement des polymres utiles pour
l'industrie (e.g., caoutchouc et chicle) et lagronomie (e.g., pyrthrines et azadirachtine)
(McGarvey & Croteau, 1995). Ils agissent aussi comme des insecticides naturels et peuvent
tre utiliss en tant que substances de protection dans le stockage de produits agricoles
(Paduch et al., 2007). En plus, les terpnodes sont des facteurs caractristiques de la
qualit des produits agricoles et horticoles car ils contribuent grandement la saveur des
fruits et au parfum des fleurs commerciales (Pichersky et al., 1994 ; Aharoni et al., 2004a).
La plupart des terpnes bioactifs peuvent tre synthtiss chimiquement partir de
drivs ptrolifres. Ils conservent alors les mmes proprits organoleptiques et
thrapeutiques et de nombreux composs commerciaux sont issus de la synthse chimique.
La difficult, et donc le cot, de la synthse de terpnodes augmente cependant avec la
taille de la molcule (des monoterpnes aux sesquiterpnes puis aux diterterpnes). Ceci
combin un regain des consommateurs pour des produits naturels, et la rarfaction des
nergies fossiles, pousse les groupes industriels dvelopper des mthodologies
conomiquement rentables dextraction partir de plantes agronomiques ou de
microorganismes bio-ingnis pour les produire. Les efforts des recherches actuelles se
concentrent ainsi sur l'lucidation des mcanismes enzymatiques de biosynthse et de leur
rgulation in planta. Spcifiquement, la biosynthse des terpnodes a t un point focal
des recherches scientifiques pendant la dernire dcennie (Huang et al., 1998 ; Williams et
al., 2000) et plusieurs enzymes ont dj t caractrises et ont t transfres avec succs
dans des plantes et microorganismes (Escherichia coli et levure) htes par transgnse.

I.1.5. Biosynthse
Beaucoup de recherches durant les deux dernires dcennies se sont concentres sur la
biochimie molculaire et la gntique de la biosynthse des terpnodes. Les voies de base
de la biosynthse de terpnodes ont t lucides dans plusieurs systmes biologiques. Les
voies mtaboliques des terpnodes vgtaux sont toutes attaches la formation de
seulement deux prcurseurs isomres 5-carbones, vritables "blocs de construction" que
sont lisopentenyl diphosphate (IPP) et le dimethylallyl diphosphate (DMAPP) (Cane,
1999). Deux voies distinctes sont actuellement connues chez les organismes vivants pour
la biosynthse de lIPP et du DMAPP : la voie classique du mvalonate (MVA) et la voie
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre I. Revue de Littrature



12
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

indpendante rcemment dcouverte du 2-C-mthyl-D-rythritol phosphate (MEP)
(Lichtenthaler, 1999 ; Lange et al., 2000 ; Sapir-Mir et al., 2008).

I .1.5.1. La formation des blocs de construction, IPP et DMAPP
La voie MVA (Figure 2), est connue depuis longtemps (Agranoff, 1960), et sa
biochimie a t exhaustivement tudie chez les plantes (Goodwin, 1977 ; Qureshi, 1981 ;
Gershenzon & Croteau, 1993). Cette voie est initie par la condensation de deux molcules
dactyl-CoA en actoactyl-CoA par lactoactyl-CoA thiolase (AACT), aprs quoi un
supplment d'actyl-CoA est ajout pour former le (S)-3-hydroxy-3-mthylglutaryl-CoA
(HMG-CoA) via une action de condensation de type aldol catalyse par la HMG-CoA
synthase (HMGS). La rduction de HMG-CoA en MVA est ralise par la HMG-CoA
rductase (Bochar et al., 1999). Les dernires tapes de la synthse de lIPP, qui est ensuite
isomris en DMAPP, ncessitent une srie de phosphorylations du MVA par les actions
conscutives de la mvalonate kinase (MK), la mvalonate-5-phosphate kinase (PCM) puis
une dcarboxylation par la mvalonate-5-diphosphate dcarboxylase (Newman &
Chappell, 1999).
Avant 1993, la voie MVA tait la seule origine biosynthtique connue des terpnodes.
Aprs les tudes de marquage isotopique de Rohmer et al. (1993), il a t dmontr qu'il
existe, chez certains organismes, une voie alternative qui ne dcoule pas de l'actyl-CoA.
La voie complte a t dfinitivement lucide en 2002 (Rohdich et al., 2002). La voie
MEP (Figure 2), connue aussi sous le nom de voie des 1-deoxy-D-xylulose-5-phosphate/2-
C-methyl-D-erythritol-4-phosphate (DXP/MEP), est initie par une raction de
condensation de type transctolase des deux prcurseurs, le pyruvate et le glycraldhyde-
3-phosphate, catalyse par la 1-dsoxy-D-xylulose-5-phosphate synthase (DXS)
conduisant la synthse du 1-dsoxy-D-xylulose-5-phosphate (DXP). La seconde tape
consiste en la formation de lintermdiaire cl, le 2-C-mthyl-D-rythritol-4-phosphate
(MEP), suite des ractions disomrisation et de rduction effectues par l'enzyme 1-
dsoxy-D-xylulose-5-phosphate reductoisomerase (DXR). Un groupe cytidyl est ensuite
additionn au MEP par la 2-C-mthyl-D-rythritol-4-phosphate cytidylyl transfrase
(MCT) pour produire le 4-(cytidine 5'-diphospho)-2-C-mthyl-D-rythritol. Ce dernier,
aprs une srie de ractions : phosphorylation catalyse par la 4-(cytidine-5'-diphospho)-2-
C-mthyl-D-rythritol kinase (CMK), perte du groupe cytidyl catalyse par la 2-C-mthyl-
D-erythritol-2,4-cyclodiphosphate synthase (MDS) et cyclisation, est transform en 2-C-
mthyl-D-rythritol-2,4-cyclodiphosphate. Vraisemblablement, le 2-C-mthyl-D-
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre I. Revue de Littrature



1J
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

rythritol-2,4-cyclodiphosphate subit des sries de ractions catalyses par la (E)-4-
hydroxy-3-mthyl-2-nyle diphosphate synthase (HDS) et rductase (HDR) pour produire
lIPP (Lichtenthaler, 1999 ; Lichtenthaler, 1997). LIPP est finalement isomris en
DMAPP par lIPP isomerase (IPI), une enzyme prsente chez tous les organismes vivants
(Gershenzon & Kreis, 1999)
La voie MVA prend ses racines dans la glycolyse pour son prcurseur lactyl-CoA.
Cependant, la voie MEP est troitement lie aux ractions de fixation du CO
2
lors de la
photosynthse comme le tmoigne les deux prcurseurs immdiats de cette voie, le
pyruvate et le glycraldhyde-3-phosphate. Les organismes utilisent une seule, ou les deux,
voies pour synthtiser leur propre IPP. Chez les animaux, les champignons et les arches
seule la voie MVA est utilise (Chappell, 1995a ; Goodwin, 1977 ; Lichtenthaler, 1997 ;
Spurgeon & Porter, 1981). Inversement, seule la voie MEP existe chez dautres phylla
bactriens, les eubactries, les algues vertes, les cyanobactries, les diatomes et le
Plasmodium falciparum (Lichtenthaler, 1999 ; Rohmer, 1999 ; Eisenreich et al., 2001 ;
Rohdich et al., 2001 ; Cassera et al., 2004 ; Masse et al., 2004 ; Okada & Hase, 2005 ; Eoh
et al., 2007 ; Grauvogel & Petersen, 2007). Chez les plantes suprieures, les deux voies
sont actives (Eisenreich et al., 1998 ; Lichtenthaler, 1998 ; Rohmer, 1999). Elles y sont
lorigine de groupes de terpnes diffrents. Pour permettre une rgulation diffrentielle de
ces deux voies, elles sont actives dans des compartiments diffrents dans les cellules
vgtales. La voie MVA est active dans le cytoplasme et la voie MEP dans le chloroplaste.
Un transporteur permet un change de lIPP entre ces deux compartiments mais il nest pas
suffisamment actif pour rendre inutile une de ces deux voies.




















t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre I. Revue de Littrature



14
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e














































Figure 2 : Etapes enzymatiques des voies MEP et MVA dans la synthse dIPP et de DMAPP
(modifie daprs Goto et al., 2010)
Dxs: 1-deoxy-d-xylulose-5-phosphate synthase ; IspC: 1-deoxy-d-xylulose-5-phosphate reductoisomerase ; IspD: 4-
diphosphocytidyl-2-C-methyl-d-erythritol synthase ; IspE: 4-diphosphocytidyl-2-C-methyl-d-erythritol kinase ;
IspF: 2-C-methyl-d-erythritol2,4-cyclodiphosphate synthase ; IspG: 1-hydroxy-2-methyl-2-(E)-butenyl 4-
diphosphate synthase ; IspH: 1-hydroxy-2-methyl-2-(E)-butenyl 4-diphosphate reductase ; AtoB, acetyl-CoA
Cacetyltransferase ; HMGS: hydroxymethylglutaryl-CoA synthase ; HMGR: hydroxymethylglutaryl-CoA
reductase ; MK: mevalonate kinase ; PMK: phosphomevalonate kinase ; MPD:mevalonate pyrophosphate
decarboxylase ; Idi: isopentenyl pyrophosphate isomerase.



t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre I. Revue de Littrature



1-
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

I .1.5.2. La formation des prnyl diphosphates, GPP, FPP et GGPP
La premire tape de diversification des squelettes carbons des terpnes consiste en la
condensation tte-queue (attachement du carbone fixant le groupement pyrophosphate
dun des substrats avec le carbone oppos celui fixant le groupement pyrophosphate de
lautre substrat) de quantits variables dIPP et de DMAPP pour produire les prnyl
diphosphates suivants, le granyl diphosphate (GPP), le farnsyl diphosphate (FPP) et le
granyl granyl diphosphate (GGPP) (Bohlmann et al., 1998a ; Wise & Croteau, 1999 ;
Christianson, 2006 ; Tholl, 2006 ;). Ces ractions de condensation sont catalyses par des
prnyltransfrases (PT) ayant comme substrat des prnyl-PP courte chane, la GPP
synthase, la FPP synthase et la GGPP synthase (Goodwin, 1977 ; Spurgeon & Porter, 1981
; Gershenzon & Croteau, 1993). La GPP synthase catalyse la raction de la condensation
de lIPP avec le DMAPP pour former le GPP, prcurseur diphosphate C10 des
monoterpnes (Figure 3). La FPP synthase ajoute deux molcules d'IPP au DMAPP pour
former le FPP, prcurseur diphosphate C15 des sesquiterpnes et des triterpnes (Figure 3).
Finalement, la GGPP synthase condense trois molcules d'IPP au DMAPP pour former le
prcurseur diphosphate C20 des diterpnes et ttraterpnes (Figure 3) (Ramos-Valdivia et
al., 1997 ; Ogura & Koyama, 1998 ; Koyama & Ogura 1999 ; Takahashi & Koyama,
2006).
Mme si les doubles liaisons formes au cours de ces ractions de condensation sont
gnralement de configuration trans, il est important de signaler que deux produits de
configuration cis ont t observs, le nryl diphosphate (NPP) (Takahashi & Koyama,
2006 ; Schilmiller et al., 2009) et le Z,Z-FPP (Sallaud et al., 2009). Tous deux sont
galement des prcurseurs biosynthtiques de monoterpnes et de sesquiterpnes
respectivement.















Figure 3 : Schma gnral de la biosynthse des terpnodes (modifie daprs
Bohlmann & Keeling, 2008)
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre I. Revue de Littrature



16
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

I .1.5.3. Compartimentation sub-cellulaire
Les voies de biosynthse des terpnodes sont probablement parmi les voies les plus
complexes connues. Les plantes utilisent les deux voies, MEP et MVA, en parallle pour la
synthse de lIPP. Pour permettre leur rgulation diffrentielle, elles fonctionnent presque
indpendamment lune de lautre dans deux compartiments sub-cellulaires diffrents
(Eisenreich et al., 1998 ; Lichtenthaler, 1998 ; Rohmer, 1999 ; Croteau et al., 2000). Les
voies MVA et MEP sont en effet respectivement localises dans le cytosol et dans les
plastes (Figure 4). Les prnyl synthases (PT) et terpnes synthases (TPS) ncessaires aux
voies centrales de la synthse des terpnodes sont galement prsents dans le cytosol et
dans les plastes. Cependant, un point dinter-croisements (cross-talk) entre ces deux voies
(compartiments) existe du fait dune possibilit de transport de lIPP travers lenveloppe
chloroplastique (Hemmerlin et al., 2003a ; Laule et al., 2003 ; Dudareva et al., 2005). Il est
plus important dans le sens plastes vers cytosol (Laule et al., 2003 ; Lichtenthaler, 2007).
Les voies MVA et MEP ne sont donc pas totalement indpendantes (Laule et al., 2003).
Un travail rcent dans les fleurs de muflier a montr que la voie plastidiale MEP fournit les
prcurseurs IPP pour la biosynthse des monoterpnes plastidiaux et des sesquiterpnes
cytosoliques (Dudareva et al., 2005). Des changes de lIPP, du DMAPP, du GPP et/ou du
FPP entre le cytoplasme et les chloroplastes ont t galement observes (Adam & Zapp,
1998 ; Arigoni et al., 1999 ; Hemmerlin et al., 2003a). Une dficience totale dune des
deux voies induite par mutagnse dirige ou par ajout dinhibiteurs spcifiques ne peut
cependant pas tre totalement compense par le fonctionnement de lautre voie comme en
tmoignent les phnotypes de telles plantes.
Dans la majorit des cas, les hmi-, les mono- et les diterpnodes sont
prfrentiellement forms dans les plastes en utilisant les prcurseurs de la voie MEP via la
synthse des GPP et GGPP. Les sesquiterpnes, les strols et les triterpnes sont
synthtiss dans le cytosol par la voie MVA et lintermdiaires cl, le FPP (Bohlmann et
al., 1998a). Exceptionnellement, chez la tomate, des TPSs localises dans les plastes
produisent galement des sesquiterpnes issus de Z,Z-FPP (Sallaud et al., 2009). Les
enzymes cytochrome P450 impliques dans des modifications oxydatives des terpnodes
sont associes au rticulum endoplasmique (Bohlmann & Keeling, 2008). Les terpnodes
mitochondriaux sont synthtiss partir de lIPP cytosolique form par la voie MVA suite
son importation dans la mitochondrie (Lichtenthaler, 1999).


t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre I. Revue de Littrature



1
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e



Figure 4 : Vue gnrale sur la compartimentation sub-cellulaire des voies biosynthtiques des
terpnodes chez les plantes (modifie daprs Chappell, 2002 ; Bouvier et al., 2005 ; Bouwmeester,
2006 ; Cheng et al., 2007)
HMG-CoA, 3-hydroxy-3-methylglutaryl-CoA; GA-3P, glyceraldehyde-3-phosphate; MVA, acide mvalonique ;
MEP, 2-C-methyl-D-erythritol-4-phosphate ; DXP, 1-deoxy-D-xylulose-5-phosphate; IPP, isopentenyl diphosphate ;
DMAPP, dimethylallyl diphosphate ; GPP, geranyl diphosphate ; FPP, farnesyl diphosphate; GGPP, granyl granyl
diphosphate ; MTS, monoterpnes synthase ; STS, sesquiterpnes synthase ; DTS, diterpnes synthase ; CYT-P
450
,
cytochrome P450.



La connaissance de la localisation cellulaire et subcellulaire de l'ensemble des
enzymes des voies spcifiques des terpnodes est importante pour orienter les efforts en
ingnierie des voies et stratgiquement rediriger les flux mtaboliques (e.g. Wu et al.,
2006).

I .1.5.4. Produits finaux
La deuxime tape de diversification des squelettes carbons des terpnes implique
laction de terpnes synthases (TPSs) sur les prnyl-PP (Wise & Croteau, 1999 ; Bohlmann
et al., 1998a ; Christianson, 2006 ; Tholl, 2006). Les prnyl-PP, GPP, FPP et GGPP sont
modifis par les TPSs pour former les monoterpnes (monoTPS), les sesquiterpnes
(sesquiTPS), et les diterpne (diTPS), respectivement (Figure 5) (Bohlmann et al., 1998a ;
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre I. Revue de Littrature



18
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

Davis & Croteau, 2000). Bien que ces prnyl-PP en configuration trans aient t
considrs comme les substrats universels des TPSs. Des tudes rcentes ont montr que
deux prnyl-PP en configuration cis, le nryl diphosphate (NPP) (Takahashi & Koyama,
2006 ; Schilmiller et al., 2009) et le Z,Z-FPP (Sallaud et al., 2009), sont aussi des substrats
naturels de certaines TPSs. En consquence, les isoprne synthases, les monoterpnes
synthases, les sesquiterpne synthases et les diterpne synthases transforment le DMAPP,
le GPP (ou NPP), le FPP (ou Z,Z-FPP) et le GGPP en isoprnes, monoterpnes,
sesquiterpnes et diterpnes, respectivement (Figure 5).
Les terpnodes vgtaux les plus courts, les hemiterpenodes (e.g., isoprne, C5),
peuvent tre forms directement partir du DMAPP par l'action des isoprnes synthases
qui catalysent son ionisation (perte du groupement pyrophosphate) suivie par une
dprotonation (Figure 5) (Miller et al., 2001 ; Bohlmann & Keeling, 2008). Le linalyl
diphosphate (LPP), issu de lisomrisation du GPP, est lintermdiaire catalytique cl
permettant la formation du cation -terpinyle en vue de la formation des monoterpnes
cycliques (Wise & Croteau, 1999). Cependant, la formation des monoterpnes acycliques,
comme le myrcne et locimne, nexige pas l'isomrisation du GPP en LPP. Ils pourront
tre forms directement partir du GPP aprs clivage du groupement pyrophosphate
(Bohlmann et al., 1999). Le mcanisme de fonctionnement des TPSs est dcrit en dtail
dans la section I-2 ci-dessous.























Figure 5 : Formation de terpnodes catalyse par divers types de TPSs (daprs
Chen et al., 2011)
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre I. Revue de Littrature



1?
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

Tous les sesquiterpnes (acyclique, mono-, bi- et tricyclique) drivent similairement
du FPP (Dudareva et al., 2006 ; Fraga, 2007). La condensation tte-tte de deux
molcules de FPP conduit la production de squalne prcurseur des strols (part perte de
deux groupes de diphosphate (Yamaguchi, 2008). La condensation par paire de FPP donne
lieu diffrentes classes de triterpnodes (Bohlmann & Keeling, 2008).
Le GGPP est, pareillement, le prcurseur de tous les diterpnes dont les gibbrellines.
Ces dernires sont formes par laction successive de deux diTPSs, la copalyl diphosphate
synthase (CDPS) et la kaurene synthase (KS), qui transforment le GGPP en copalyl
diphosphate (CPP) puis en ent-kaurne, le prcurseur de toutes les gibbrellines chez les
plantes (Yamaguchi, 2008). La condensation tte-tte par paire de deux GGPP donne lieu
la formation des diffrentes classes de ttraterpnodes (C40), dont le phytone,
prcurseur des carotnodes (Yamaguchi, 2008).
L'assemblage d'un nombre indfini de prcurseurs C5 produit les polyterpnodes
comme, par exemple, le caoutchouc qui contient de 400 plus de 100,000 units isoprenes
(Cornish, 1993).
En plus des terpnodes dcrits ci-dessus et qui sont dits rguliers, un grand nombre
dautres terpnodes, dits irrguliers, sont forms dans les plantes comme des terpnodes
ne rpondant pas la formule Cnx5 (e.g., norterpnes), des terpnodes conjugus (e.g.,
alkalodes indoliques monoterpniques, Facchini & DeLuca, 2008) et des terpnes au
squelette carbon branch ou comportant un cycle pentane ou butane. Deux familles
vgtales (Astraces et Lamiaces) produisent des HEs caractrises par la prsence dun
groupe de monoterpnes irrguliers dont la structure ne correspond pas lenchanement
tte-tte isoprnique classique (Waller et al., 1968 ; Epstein & Poulter, 1973).
En gnral, la diversit des milliers de structures de terpnodes vgtaux a pour
origine la combinaison daction de diffrentes isoformes de TPSs et denzymes de
modification de terpnodes. Les transformations catalyses par les TPSs peuvent tre
suivies par une varit de modifications des squelettes carbons dorigine afin de produire
des milliers de mtabolites terpniques. Aprs la formation de nombreuses structures de
base d'hmi-, mono-, sesqui- et diterpnes, sous la forme d'olfines ou de simples
terpnodes mono-oxygns par les TPSs, ces mtabolites peuvent tre encore
fonctionnaliss par diffrentes cytochrome P450 mono-oxygnases (P450), rductases,
dshydrognases ou transfrases (Bohlmann & Keeling, 2008). Les modifications des
produits des TPSs par oxydation, peroxydation, mthylation, acylation, ou par rupture de
liaison C-C modifient leurs proprits physiques et, par voie de consquence, leurs
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre I. Revue de Littrature



2u
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

activits biologiques (Chen et al., 2011). A linstar du fraisier des bois dEurope, l-
pinne est modifi chez le fraisier domestique par un cytochrome P450 hydroxylase en
myrtnol, lui-mme transform en actate de myrtnyle par une alcool actyl transfrase
(Aharoni et al., 2004). Ces diffrences sont, en partie, responsables des diffrences
organoleptiques entre ces deux types de fraises.

I.1.6. Site de biosynthse, accumulation et scrtion
Toutes les plantes, et dans une plus grande mesure celles nommes aromatiques,
mettent des terpnes volatils de faon constitutive ou induite. Ceux-ci sont synthtiss de
novo ou mobiliss partir de sites de stockage internes ou externe (Miller et al., 2005 ;
Yang et al., 2009).
Beaucoup de plantes produisent et accumulent des mono-, sesqui- et/ou diterpnes en
quantits dpassant de loin les capacits de stockage des cellules vivantes productrices.
Ces plantes ont typiquement des structures anatomiques spcialises pour la squestration
et la scrtion des terpnodes (Fahn, 1979 ; Bernard-Dagan, 1988a ; Hallahan, 2000 ;
Gershenzon et al., 2000). Ces structures anatomiques spcialises sont trs diverses :
cellules d'huile, idioblastes, cavits de stockage, glandes coniques sous-cuticulaires,
trichomes glandulaires, laticifres, poches et canaux de rsine. Plusieurs catgories de
tissus producteurs et scrteurs peuvent coexister simultanment chez une mme espce,
voire dans un mme organe (Fahn, 1979). La forte densit des structures anatomiques
spcialises pour l'accumulation des terpnodes est un critre agronomique important pour
la production d'HE (Bohlmann & Keeling, 2008). Les menthes, titre dexemple, portent
deux types de trichomes glandulaires non-photosynthtiques, un type capit avec une
capacit de stockage limite, et un type pelt contenant une cellule basale, une cellule
colonne et huit cellules scrtrices disposes en disque (Figure 6) (Amelunxen, 1965 ;
Amelunxen et al., 1969 ; Fahn, 1979). Le dernier type dveloppe un grand espace de
stockage sous-cuticulaire au sommet o la cuticule paisse est spare des parois
cellulaires des cellules scrtrices pour former une poche (Amelunxen et al., 1969). La
squestration des terpnodes dans lespace sous-cuticulaire sexplique en partie par le fait
que certains terpnes sont phytotoxiques et doivent donc tre accumuls dans des espaces
externes spcialiss (Brown et al., 1987 ; Wagner, 1991).



t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre I. Revue de Littrature



21
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e
















Figure 6 : Schma dune coupe radiale anatomique dun trichome
glandulaire pelt de menthe poivre (Mentha x piperita) (dprs
Turner & Croteau, 1999)


La biosynthse des terpnodes a lieu dans tous les types cellulaires vgtaux.
Cependant, certains types cellulaires peuvent se spcialiser dans la production des terpnes
volatils. Les parfums des ptales des fleurs sont ainsi souvent produits par les cellules
pidermiques et/ou parenchymateuses (Dudareva & Pichersky, 2000 ; Caissard et al.,
2004). Chez les conifres, les terpnodes rsinifres sont forms par les cellules
pithliales des canaux scrteurs (Bernard-Degan, 1988b). Spatialement, lexpression
constitutive et induite des gnes, et laccumulation des protines, de TPS chez lpica est
localise, au moins en partie, aux cellules pithliales des canaux de rsine dans les tissus
des feuilles-aiguilles tels que dtermins par localisation immunofluorescente (Zulak et al.,
2010) et microdissection au laser (Abbott et al., 2010). Typiquement, les cellules
adjacentes aux sites de stockage des terpnodes volatils sont considres comme site de
production pour la scrtion dans des sites extracellulaire tels que l'espace sous-cuticulaire
de trichomes glandulaires ou le lumen des canaux de rsine (Fahn, 1979). Des tudes
biochimiques sur des trichomes glandulaires pelts isols de la menthe poivre ont rvl
que les cellules scrtrices sont non-seulement responsables de la scrtion de
monoterpnes dans l'espace de stockage, mais aussi l'emplacement rel de la biosynthse
de monoterpnes (Gershenzon et al., 1992 ; McCaskill et al., 1992). La production des
terpnes en leur sein est lie au dveloppement souvent hypertrophique de deux
compartiments privilgis : le plaste et le rticulum endoplasmique (Carde, 1979 ;
Bosabalidis & Tsekos, 1982a ; Bosabalidis & Tsekos, 1982b ; Heinrich et al., 1983 ;
Sevinate-Pinto & Antunes, 1991). Des recherches ont montr que plusieurs organites
cellulaires participent la production et au stockage de l'HE dont les plastes (Amelunxen,
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre I. Revue de Littrature



22
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

1965 ; Wooding & Northcote, 1965 ; Akers et al., 1978), le rticulum endoplasmique
(Schnepf, 1974 ; Bourett et al., 1994 ; Ascensao et al., 1997 ; Turner et al., 2000a) et les
vacuoles (Amelunxen, 1965). Cependant, il existe une corrlation troite entre la prsence
de monoterpnes dans les extraits volatils et la prsence de leucoplastes dans les cellules
scrtrices (Cheniclet & Carde, 1985). Dans toutes les cellules vgtales, des relations de
proximit, voire de continuit mtabolique, existent entre le rticulum endoplasmique et
les plastes (Douce & Joyard, 1981 ; Douce & Joyard, 1984 ; Whatley et al., 1991).
Toutefois, la frquence de telles associations est particulirement leve dans les cellules
scrtrices contenant des leucoplastes (Cheniclet, 1984 ; Carde, 1987).
Il peut arriver que des cellules scrtrices inactives puissent retrouver leur potentialit
de synthse terpnique. C'est ce qui se passe lors d'une blessure (accident, compression,
piqre d'insecte, attaque de champignons). La synthse est initie multiples reprises aprs
la blessure, suggrant des rles diversifis pour les monoterpnes, sesquiterpnes et
diterpnes (Bohlmann et al., 1998b). Dans ce cas, la reprise d'activit scrtrice
s'accompagne d'une rgnration limite des structures fonctionnelles leucoplastes
(Croteau et al., 1987 ; Cheniclet et al., 1988). Marpeau et al. (1989) ont observ que la
ractivation des cellules scrtrices par des excisions de tissus corticaux primaires de
jeunes pousses de pin maritime (Pinus pinaster) induit un fonctionnement scrtoire de
type secondaire caractris par la synthse quasi-exclusive d'- et de -pinne.
Etant donn que les terpnodes s'accumulent avec un fort gradient de concentration
entre l'intrieur et l'extrieur de la cellule, une certaine forme de transport actif et
directionnel travers la membrane cellulaire lipophilique est ncessaire. Cependant, les
mcanismes de transport de terpnodes partir des cellules biosynthtiquement actives
vers l'espace de stockage extracellulaire ne sont pas connus. L'exocytose est le mcanisme
le plus probable pour le dplacement de l'HE de la cellule vers l'espace sous-cuticulaire
(Ascensao & Pais 1998 ; Gersbach, 2002). Ce transport peut impliquer aussi lactivit dun
transporteur cassette fixatrice dATP (ATP-binding cassette transporter, Jasinski et al.,
2001).
La compartimentation et l'accumulation terpniques dcrites ci-dessus sont ralises
dans plusieurs familles de Gymnospermes et dAngiospermes. Cependant, dans de
nombreuses espces vgtales, des formes de stockage des HEs sont absentes et les
terpnes sont rapidement, et massivement, librs dans l'atmosphre. En gnral, les
hmiterpnodes trs volatils comme lisoprne schappent dans latmosphre
immdiatement aprs leur synthse. Mais ils peuvent aussi tre stocks de manire non-
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre I. Revue de Littrature



2J
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

spcifique lintrieur des feuilles (Niinemets & Reichstein, 2002). De part leur nature
lipophile, les terpnodes volatils les moins polaires peuvent traverser librement la cuticule
avant dtre mis vers latmosphre (Schmid & Ziegler, 1992). Il semble cependant que les
composs prsentant un certain niveau de polarit soient mis prfrentiellement par les
stomates car ils ne peuvent pas diffuser au travers de la cuticule (Fall & Monson, 1992).

I.1.7. Huiles essentielles
Les terpnodes disponibles en quantits relativement importantes chez les vgtaux
comme huile essentielle, rsine ou cire sont des ressources renouvelables importantes qui
fournissent une large gamme de produits dimportance commerciale (Zinkel & Russell,
1989 ; Dawson, 1994). Etant donn que les lavandes, sujet principale de cette thse, sont
des plantes productrices dHE, nous limiterons cette introduction aux HEs.

I .1.7.1. Dfinition et rpartition dans le rgne vgtal
Les HEs, appeles communment essences vgtales, sont des mlanges variables et
complexes de substances volatiles aromatiques et parfumantes contenant principalement
des terpnodes (principalement des mono- et sesquiterpnes bien que des diterpnes
puissent tre galement prsents), et des drivs des acides gras (hydrocarbures
aliphatiques de faible PM linaires, ramifis, saturs et insaturs, acides, alcools,
aldhydes, esters, lactones). Exceptionnellement, des composs azots, soufrs, et
phnoliques (drivant de la voie de synthse des phnylpropanodes) peuvent tre
galement prsents (Lis-Balchin, 2002). La norme franaise, AFNOR NF T 75-006
(AFNOR, 1996), donne une dfinition aux HEs base sur leur mthode dobtention
"produit obtenu partir dune matire premire vgtale, soit par entranement la vapeur,
soit par des procds mcaniques partir de lpicarpe des Citrus, soit par distillation
sche".
De trs nombreuses espces vgtales produisent les HEs. Il en existe plus de 2000
espces appartenant environ 60 familles. Citons, titre dexemple, les Lamiaces,
Astraces, Rutaces, Myrtaces, Apocynaces, Apiaces, Graniaces, Myrtaces,
Rosaces, Rutaces, Pinaces, Cupressaces. Les HEs se retrouvent dans toutes les parties
de la plante comme les fleurs (lavande, bergamote, jasmin, rose), les feuilles (lavande,
citronnelle, laurel, romarin, sauge, sapin), les tiges (citronnelle, lemongrass), les racines
(vtiver, anglique), les rhizomes (gingembre, acorus), le bois (santal), lcorce (cannelier),
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre I. Revue de Littrature



24
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

les fruits (bleuet, citron) et les graines (muscade, aneth). Les espces productrices dHE
sont prsentes dans toutes les rgions climatiques du globe (Guenther, 1948).

I .1.7.2. Historique et importance
Lutilisation de substances odorantes de plantes est connu depuis l'antiquit et a t
dcrit par les plus anciennes civilisations : tout dabord dans lOrient et le Moyen Orient
puis le nord de lAfrique suivi de lEurope (Franchomme & Pnol, 1990). Dans lhistoire
moderne, les vertus thrapeutiques des HEs occupent une place de plus en plus importante.
En 1928 le chimiste franais Ren-Maurice Gattefosse a utilis le terme aromathrapie
pour dcrire les proprits curatives des HEs lorsquil a dcouvert par accident que la
lavande a guri une brlure sa main. En 1964, le docteur franais Jean Valunet a connu
un certain succs en traitant des patients en mdecine et en psychiatrie avec des HEs.
Aujourdhui, nous reconnaissons que les HEs ont des effets thrapeutiques, psycho-actifs
et physiologiques sur lhomme (Garneau, 2002).
L'homopathie et l'aromathrapie sont des exemples courants d'usage des HEs en
mdecine douce. Leur popularit s'est accrue d'une faon considrable ces dernires annes
(International Trade Centre, 1993) et les industries de la parfumerie, des armes et de la
cosmtique consomment des dizaines de milliers de tonnes par an de plantes HEs
(Bruneton, 1993).
En gnral, et tant donn que les HEs sont principalement des terpnodes, presque tout
ce qui a t crit sur limportance commerciale et mdicinale des terpnodes sapplique aux
HEs. Les HEs tant des mlanges complexes de substances, elles sont doues deffets
biologiques varis comme, par exemple, des effets antiseptiques (antibiotiques), anti-
inflammatoires, antihistaminiques, antioxydants, analgsiques, calmants, anti-anxiolytiques,
sdatifs, antispasmodiques, diurtiques, laxatifs, antihypertenseurs, vasopresseurs,
antipyrtiques. Certaines HEs sont dermocaustiques (agressive pour la peau) comme l'origan.
D'autres sont photo-sensibilisantes comme celles des agrumes, et peuvent tre irritantes,
contenir des allergnes voire tre toxiques. Par consquent, il faut les utiliser avec grande
prcaution en respectant les rgles de traitements.

I .1.7.3. Mthode dextraction
L'HE reprsente de 0,1 3 % du poids sec des plantes aromatiques (Hassiotis, 2010).
Une grande varit de mthodes dextraction sont utilises commercialement pour isoler
les HEs partir du matriel vgtal. Les mthodes traditionnelles et commerciales utilises
pour extraire les HEs sont :
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre I. Revue de Littrature



2-
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

LHydrodistillation (la distillation par l'eau) lors de laquelle le matriel vgtal
(feuilles ou inflorescences dans le cas des espces de lavande) est immerg
dans l'eau, le mlange htrogne bouilli et l'HE volatilise puis condense.
Les principaux composs volatils ne se dissolvent pas dans leau et lHE peut
tre spare par dcantation aprs refroidissement dans un sparateur de phases
(Bruneton, 1993 ; Paris & Moyse, 1976).
Lentranement par la vapeur deau (distillation la vapeur deau) lors de
laquelle l'eau est bouillie dans un rcipient situ en dessous, et une certaine
distance, du matriel vgtal distiller. A son passage, la vapeur d'eau
saturante entrane l'HE des plantes vers un condenseur o elle est liqufie et
spare de leau comme lors de lhydrodistillation (Bruneton, 1993 ; Paris &
Moyse, 1976).
LHydrodiffusion (percolation) est une modification du processus de
lentranement par la vapeur deau au cours duquel la vapeur deau arrive par le
haut d'un conteneur d'herbe, permettant ainsi la vapeur de percoler travers
la matire vgtale par gravit (Franchomme & Pnol, 1990 ; Richard, 1992).
Vapeurs d'huile et vapeurs deau sont ensuite condenses et spares comme
dcrit ci-dessus.
Lexpression froid au cours duquel des tissus vgtaux trs riches en HE sont
compresss pour en extraire lHE. Ce procd est principalement utilis pour
isoler les HEs partir des picarpes (zeste frais) des fruits de Citrus. Cette
opration peut se faire la main ou aprs scarifications mcaniques (Boucard
& Serth, 1991).
Lextraction directe des plantes par des solvants organiques volatils. Les
solvants organiques sont ensuite retirs par distillation pour ne laisser que les
substances vgtales, un mlange alors appel "concrte" et des essences dites
"absolues". Ces extraits sont trs utiliss en parfumerie (Boucard & Serth,
1991).
lenfleurage qui est prfr sur les organes, ou composs, fragiles. Lors de ce
processus, les tissus vgtaux sont mis en contact avec un corps gras (axonge)
pour le saturer en essences vgtales. Le corps gras est ensuite puis par
lalcool absolu et ce solvant vapor sous vide pour ne laisser que les
substances vgtales (Guillemain et al., 1990).

t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre I. Revue de Littrature



26
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

Pour obtenir une HE naturelle et authentique, elle doit tre isole uniquement partir
de plante entire, ou partie de plante, d'origine taxonomique et gographique bien connues
par des moyens physiques bass sur la volatilit des HEs. Les pharmacopes nadmettent
que les deux premiers procds de la liste tablie ci-dessus (Paris & Moyse, 1976). La
distillation la vapeur et lextraction par solvant sont par contre des mthodes trs utilises
pour isoler les HEs commercialement. Les essences extraites dune mme plante par ces
diffrentes mthodes nont pas exactement la mme composition. Pendant
l'hydrodistillation, l'eau, l'acidit des tissus vgtaux et la temprature peuvent provoquer
la formation de produits indsirables, la destruction des produits labiles et des
rarrangements chimiques (Lawrence, 1976). En dpit d'avantages apparents (efficacit
d'extraction et pas de contact prolong de la matire vgtale avec l'eau en bullition),
l'entranement la vapeur d'eau pression atmosphrique est une mthode susceptible
d'introduire de nombreuses modifications des substances volatiles (Bruneton, 1993)
notamment du fait de la surpression qui parfois rgne l'intrieur du systme dextraction
(Richard & Multon, 1992). Par consquent, le dveloppement de mthodes d'extraction
alternative avec une meilleure slectivit et efficacit sont fortement souhaitables.
Rcemment, dautres mthodes d'extraction ont t dveloppes, telles que les headspace
dynamique et statique, l'extraction par fluide supercritique et la micro-extraction en phase
solide (SPME) (Ravid et al., 1996 ; Milner et al., 1997 ; An et al., 2001 ; Kovacevic &
Kac, 2001 ; Kim & Lee, 2002 ; Cavalli et al., 2003 ; Sonboli et al., 2004). Le fluide
supercritique le plus largement utilis est le CO
2
en raison de sa capacit solubiliser les
essences vgtales, sa faible toxicit et son inertie chimique (Hawthorne et al., 1993 ;
Reverchon & Senatore, 1994 ; Fernandez-Perez et al., 2000). Cependant, le CO
2
ne permet
pas de dissoudre certains composs moyennement polaires comme les alcools, les esters,
les aldhydes et les ctones. Par contre, la technique de la micro-extraction en phase solide
a t accepte parce qu'elle est simple et peu coteuse (An et al., 2001 ; Kovacevic & Kac,
2001 ; Kim & Lee, 2002). Elle nest cependant utilise que pour analyser la composition
chimique de lHE. Tellez et al., (2004) ont dvelopp une nouvelle mthode impliquant
simultanment la micro-extraction en phase solide combine avec lhydrodistillation
continue de l'HE pour un suivi en continu du processus de distillation.

I .1.7.4. Mthodes danalyses
Vu l'importance industrielle des HEs, une analyse de leurs proprits physiques et
composition chimique est ncessaire pour les caractriser et les dcrire. Les HEs sont
gnralement liquides temprature ambiante et ont une odeur aromatique souvent due
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre I. Revue de Littrature



2
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

un ou plusieurs composs. Ceux-ci ont souvent un carbone asymtrique. Les deux
nantiomres ont alors des odeurs diffrentes (Bauer et al., 1990 : Boelens & van Gemert,
1993 ;). Les HEs sont rarement colores quand elles sont fraches. Leur densit est le plus
souvent infrieure celle de leau ( lexception de quelques essences comme celles du
sassafras, du girofle et de la cannelle). Elles ont un indice de rfraction lev et sont
gnralement doues de pouvoir rotatoire. Les HEs sont trs peu solubles dans leau mais
solubles dans lalcool, lther, la plupart des solvants organiques et les huiles fixes (Paris &
Moyse, 1976 ; Brunton, 1993).
La dtermination de la composition chimique des HEs est gnralement ralise par la
combinaison de la chromatographie en phase gazeuse avec la spectromtrie de masse ou
linfrarouge (GC/MS ou GC/IRFT) sur deux colonnes de polarit diffrente (Hedges &
Wilkins, 1991). Les composs sont alors identifis daprs leur indice de rtention et leur
spectre de masse. Suite aux travaux innovants de Formcek et Kubeczka (1982), une
troisime mthode consiste identifier les composants individuels d'une HE sur la base
dun spectre RMN
13
C de lHE, sans sparation pralable de ses constituants.
Pour permettre la sparation de deux nantiomres, la GC chirale est la mthode
gnralement utilise. Diffrentes approches peuvent tre distingues: (a) l'injection directe
du mlange dans la colonne chirale (l'identification ncessite souvent un systme MS pour
confirmer l'identit des pics), (b) la sparation sur colonne chirale des deux composs
nantiomres purifis au pralable par une technique chromatographique achirale
(Casabianca & Graff, 1994) et (c) l'utilisation de la chromatographie gazeuse
multidimensionnelle (MDGC) qui permet l'injection directe de l'chantillon dans le
chromatographe; la premire colonne achirale conduit une pr-sparation des composs,
qui sont transfrs vers la deuxime colonne chirale en utilisant la technique coupe-cur
(heart-cutting, Bicchi & Pisciotta, 1990).
Les proprits physiques et la composition chimique d'une HE sont dtermines ds
leur obtention. Ces donnes seront utilises pour authentifier une HE en vue de son
exploitation industrielle.

I .1.7.5. Variation ecophysiologique de la composition dune HE
La quantit et la qualit des constituants dune HE peuvent varier fortement selon un
grand nombre de facteurs. Ceux-ci peuvent avoir une origine extrinsque (cologique ou
environnementale) ou intrinsque (diffrentiation tissulaire, ontogntique ou gntique) et
peuvent jouer un rle primordial sur la qualit et la quantit de lHE (Yamaura et al.,
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre I. Revue de Littrature



28
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

1989 ; Figueiredo et al., 1997). La composition chimique de l'HE peut varier au sein d'une
mme espce (polymorphisme chimique). Cette variation peut tre quantitative ou
qualitative et des variants chimiques sont dits avoir des chmotypes diffrents sils
diffrent par des constituants majeurs. Le mot chmotype est synonyme de chimiotype ou
chimiovarit. Deux chmotypes peuvent diffrentier deux populations diffrentes ou bien
deux individus au sein dune mme population. Le polymorphisme chimique des HEs est
omniprsent chez plusieurs espces de plusieurs familles. Citons titre exemple, Artemisia
herba-alba (Salido et al., 2004a), Pinus halepensis (Schiller & Grunwald, 1987), Juniperus
phoenicea (Cavaleiro et al., 2001), Piper lanceaefolium (Mundina et al., 2001),
Chrysanthemum balsamita (Marculescu et al., 2001) et Lychnophora ericoides (Curado et
al., 2006). Les cas de "polychmisme" sont particulirement abondants dans la famille des
Lamiaces, caractrises par des plantes productrices dHEs (Lawrence, 1980). Citons,
Mentha citrata (Murray & Lincoln, 1970), Mentha spicata (Kokkini & Vokou, 1989),
Origanum vulgare (Vokou et al., 1993), Rosmarinus officinalis (Granger et al., 1973),
Salvia fruticosa (Karousou et al., 1998) ainsi que de nombreuses espces du genre
Lavandula (Garca-Vallejo et al., 1992) et du genre Thymus (Granger & Passet, 1973 ;
Adzet et al., 1977 ; Sez & Stahl-Biskup, 2002 ; Stahl-Biskup, 2002 ; Thompson, 2002). Il
semble donc que les cas de polymorphismes chimiques intra-spcifiques soient assez
courants dans le rgne vgtal. La certification botanique de lespce vgtale doit
prcder toute exploitation industrielle ou traditionnelle.
La rgulation de la biosynthse des HEs seffectue principalement au niveau de
lactivit des enzymes soit en en contrlant le nombre ou le fonctionnement catalytique,
soit en modulant la quantit de substrat disponible. Cette rgulation peut tre spatiale dans
le sens o tous les organes ne vont pas produire les mmes composs dans les mmes
quantits. Elle peut aussi tre temporelle puisque la production des composs peut tre
affecte par le dveloppement des organes. La production est gnralement abondante lors
des stades prcoces de dveloppement dun organe, reste relativement constante puis
diminue durant sa snescence (Harley et al., 1998 ; Dudareva & Pichersky, 2000 ;
Gershenzon et al., 2000).


I.2. LES TERPENE SYNTHASES
I.2.1. Dfinition
La diversit des squelettes carbons des terpnes est principalement lie laction
dune famille d'enzymes connue sous le nom de terpne synthases (TPS). Ces catalyseurs
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre I. Revue de Littrature



2?
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

convertissent des prnyles diphosphates acyclique et le squalne en une multitude de
formes cycliques et acycliques (Degenhardt et al., 2009). De nombreux gnes de TPS ont
t isols de vgtaux et microorganismes. Les trois premiers gnes isols de TPS
vgtales sont lpi-aristolochne synthase (sesquiTPS, Facchini & Chappell, 1992), la
limonne synthase (monoTPS, Colby et al., 1993) et la casbne synthase (diTPS, Mau &
West, 1994). De nombreuses TPSs de plantes ont t clones, squences et caractrises
dans diffrents organes dAngiospermes et Gymnospermes. Rcemment, Degenhardt et al.
(2009) ont prsent une liste exhaustive de toutes les monoTPSs et sesquiTPSs clones de
diffrents organes dAngiospermes et Gymnospermes jusqu' 2008 inclus. Ces TPSs
catalysent des ractions complexes en plusieurs tapes et sont capables de gnrer des
centaines d'hydrocarbures et diverses structures oxygns d'importance biologique et
commerciale.
Bien que les TPSs gnrent des composs terpniques trs diffrents, elles partagent
des proprits catalytiques assez semblables (Alonso & Croteau, 1993), en exigeant un ion
mtallique comme seul cofacteur pour la catalyse et en fonctionnant par un mcanisme
dattaque lectrophile comme le font les prnyltransfrases, un groupe denzymes qui leur
est reli mtaboliquement et volutivement (Poulter & Rilling, 1978 ; Poulter & Rilling,
1981). La plupart des TPSs catalysent des ractions de cyclisation et sont donc aussi
appeles terpne cyclases (Christianson, 2008). tonnamment, la spcificit enzymatique
de produit des TPSs peut varier considrablement. Des enzymes haute fidlit telles que
laristolochne synthase d'Aspergillus terreus gnrent un seul et unique produit,
laristolochne (Felicetti & Cane, 2004). Dautres enzymes (et cest gnralement le cas)
sont moins spcifiques et gnrent de multiples produits partir dun seul substrat. Cest,
par exemple, le cas de la -humulne synthase qui gnre 52 produits distincts parmi
lesquels le -humulne est le produit majoritaire (28.6%) (Steele et al., 1998).
Gnralement, les TPSs sont nommes sur la base du produit majoritairement form. Etant
donn que la plupart des TPSs forment de multiples produits partir d'un seul substrat, et
que ces produits sont souvent modifis par l'action dautres enzymes telles que les
Cytochrome P450 (Schuler, 1996), le nombre de terpnodes existant dans un organisme
donn est susceptible de dpasser le nombre de gnes de TPS en activit (Bohlmann &
Keeling, 2008). Beaucoup de TPSs sont codes par des familles multi-gniques rsultant
de la duplication, et des fois la neofonctionnalisation, dun gne ancestral (Facchini &
Chappell, 1992 ; Back & Chappell, 1995 ; Chen et al., 1995 ; Bohlmann et al., 1998a). La
Bryophyte, Physcomitrella patens possde un seul gne de TPS, la copalyl diphosphate
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre I. Revue de Littrature



Ju
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

synthase/kaurene synthase (CDPS/KS), codant pour une enzyme bifonctionnelle
produisant lent-kaurene, un prcurseur biosynthtique des gibbrellines (Hayashi et al.,
2006). Le gnome du Lycophyte, Selaginella moellendorffii contient par contre 18 gnes
de TPS, et les gnomes de certaines Angiospermes et Gymnospermes contiennent de 40
(Arabidopsis (Aubourg et al., 2002) 152 (Vitis vinifera (Martin et al., 2010) gnes de
TPS. Touts ces gnes ne sont pas fonctionnels et la plupart de ceux qui le sont prsentent
une activit trs rduite (Chen et al., 2011). Etant donn que cette thse traite des
monoTPSs et sesquiTPSs, ces deux classes de TPS sont dcrites plus en dtail.

I.2.2. Structures
I .2.2.1. Structures primaires
Les TPSs vgtales sont en gnral dune longueur de 600 900 rsidus d'acides
amins (aa) (Chen et al., 2011) et incluent un domaine C-terminal hbergeant le site actif
et un domaine N-terminal sans activit connue (Cheng et al., 2007). En gnral, les
monoTPSs sont constitues de 600 et 650 aa et se diffrentient des sesquiTPSs par la
prsence dun peptide N-terminal dadressage au plaste (Bohlmann et al., 1997 ; Bohlmann
et al., 1998a ; Turner et al., 1999 ; Fischbach, 2001 ; Martin et al., 2004). Ce peptide de
transit, de 50 70 aa, riche en srine et thronine et pauvre en rsidus acides, est
vraisemblablement cliv juste en amont dun motif "RRx8W" aprs entre des TPSs dans
le plaste. Ce dernier motif est essentiel pour catalyser la cyclisation des monoterpnes. Il
est galement prsent, avec quelques variations, dans la plupart des sesqui- et des diTPSs
(Whittington et al., 2002 ; Hyatt et al., 2007). Contrairement aux monoTPSs, les
sequiTPSs cytosoliques sont moins longues (550 580 aa) par manque du peptide de
transit (Facchini & Chappell, 1992 ; Back & Chappell, 1995 ; Chen et al., 1995 ; Crock et
al., 1997 ; Steele, 1998). Par contre, la plupart des diTPSs sont environ 210 aa plus longues
que les monoTPSs en raison de la prsence dun lment interne supplmentaire qui est
conserv en squence et en position entre toutes les diTPSs (Sun & Kamiya, 1994 ;
Bensen et al., 1995 ; Stofer Vogel et al., 1996 ; Wildung & Croteau, 1996 ; Yamaguchi et
al., 1996 ; Ait-Ali et al., 1997) l'exception de la casbne synthase (Mau & West, 1994 ;
Prisic et al., 2004 ; Bohlmann et al., 1998a). Exceptionnellement, cette squence interne
est prsente dans la (E)--bisabolne synthase et la linalol synthase, sesquiTPS du sapin
grandissime et monoTPS de Clarkia, respectivement (Dudareva et al., 1996). Aucune
fonction n'est encore dcrite pour cet lment et il peut constituer une caractristique
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre I. Revue de Littrature



J1
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

ancestrale des TPSs de plantes et pointer vers l'origine commune de cette famille
d'enzymes (Bohlmann et al., 1998a).
Presque toutes les monoTPSs sont caractriss par la prsence dun motif riche en
arginine "RRx8W" qui est plac prs de la partie N-terminale de la chane polypeptidique
et se situe juste aprs le peptide de transit prsum (Bohlmann et al., 1998a). Le motif
RRx8W est en fait caractristique des monoterpnes synthases des sous-familles TPSb
(voir plus bas classification TPSs) dAngiospermes et TPSd des Gymnospermes
(Bohlmann et al., 1998a, 1999 ; Aubourg et al., 2002). Pendant la formation du
monoterpne cyclique, (-)-4S-limonne, catalyse par la limonne synthase de Mentha
spicata, l'lment double-Arg du motif RRx8W est impliqu dans l'tape de la migration
du diphosphate pour donner le 3S-LPP, un intermdiaire ractionnel cl pour former des
monoterpnes cycliques (Williams et al., 1998). La caractristique commune des
monoTPSs de la sous-famille TPSg est l'absence du motif RRx8W, et, effectivement, se
sont des monoTPSs qui produisent des monoterpnes acycliques.
Le motif structurel des TPSs le plus tudi est la rgion C-terminale riche en aspartate
"DDxxD" trouve pratiquement dans toutes les mono- et sesquiTPSs vgtales ainsi que
dans les isoprnyl diphosphate synthases et les TPSs microbiennes. Des expriences de
mutagense dirige, ainsi que lanalyse structurelle par les rayon X, ont rvl que cette
rgion est implique dans la fixation des cations mtalliques divalents (Mg
2+
, Mn
2+
) qui
leur tour interagissent avec le groupement diphosphate du substrat (Ashby & Edwards,
1990 ; Tarshis et al., 1994, 1996 ; Cane et al., 1996a, 1996b ; Lesburg et al., 1997 ; Stark
et al., 1997). La mutagense de l'un des trois aspartates de ce motif en Ala ou Glu a rduit
l'activit catalytique dau moins 1000 fois (Bohlmann et al., 1998a). L'emplacement du
motif DDxxD l'entre du site catalytique semble tre critique dans le positionnement du
substrat pour la catalyse. Le motif DDxxD est absent dans la (-)-copalyl diphosphate
synthase (At-Ali et al., 1997) qui contient la place un autre motif riche en aspartate,
DxDD. Certaines diTPSs telles que labietadine synthase bifonctionnelle du sapin
grandissime (Vogel et al., 1996) et lent-copalyl diphosphate synthase du riz (Prisic et al.,
2004) contiennent les deux motifs DxDD et DDxxD. Un autre motif riche en acides amins
acides "NSE/DTE" (Cane & Kang, 2000 ; Rynkiewicz et al., 2001) caractrise les TPSs de
la classe I (voir plus bas classification TPSs) o il est galement essentiel pour la fixation
des cations mtalliques divalents. Le motif "NSE/DTE" est labrviation de la squence
consensus (N,D)D(L,I,V)x(S,T)xxxE dans laquelle les rsidus en gras sont souvent
directement responsables de la fixation du cation divalent (Starks et al., 1997 ; Cane &
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre I. Revue de Littrature



J2
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

Kang, 2000 ; Rynkiewicz et al., 2001 ; Whittington et al., 2002 ; Hyatt et al., 2007 ;
Shishova et al., 2007 ). La formation de plusieurs produits pourrait galement tre
renforce par la prsence du motif NSE/DTE (Degenhardt et al., 2009). Alors que le motif
DDxxD est hautement conserv dans presque toutes les TPSs des plantes, le motif
NSE/DTE semble tre moins bien conserv (Degenhardt et al., 2009). Dans certaines
sesquiTPSs, le motif NSE/DTE est remplac par un second motif DDxxD (Steele et al.,
1998) qui a galement t montr pour tre impliqu dans la catalyse (Little & Croteau,
2002).
A Environ 35 acides amins en amont du motif DDxxD on trouve un autre motif trs
conserv "RxR". Selon Stark et al. (1997), ce motif aide diriger l'anion diphosphate loin
du carbocation ractif aprs lionisation du substrat pour empcher l'attaque nuclophile
sur l'un des intermdiaires carbocationiques.
Un autre lment prsent dans certaines TPSs est le motif LQLYEASFLL. Ce motif
est suppos faire partie du site actif (McGeady & Croteau 1995 ; Wise et al., 1998).

I .2.2.2. Structures tridimensionnelles
Les structures cristallises dune sesquiTPS, lepi-aristolochne synthase de Nicotiana
tabacum (Starks et al., 1997) et de trois monoTPSs, la bornyl diphosphate synthase de
Salvia officinalis (Whittington et al., 2002), la (4S)-limonene synthase de Mentha spicata
(Hyatt et al., 2007) et la 1,8-cinol synthase de Salvia fruticosa (Kampranis et al., 2007)
sont disponibles et ont suggr lexistence de deux domaines N- et C-terminaux. Elles
rvlent que ces protines ont toutes une structure tertiaire entirement compose
dhlices- relies par de courtes boucles et coudes de connexion (Figure 7). Le domaine
C-terminal possde une structure similaire celles des TPSs fongiques et bactriennes
(Lesburg et al., 1997 ; Caruthers et al., 2000 ; Rynkiewicz et al., 2001 ; Christianson,
2006 ; Shishova et al., 2007) et celle des FPP synthases (Tarshis et al., 1994) malgr
l'absence de similarit de squence, ce qui suggre l'existence dun repliement commun des
structures secondaires des TPSs et prnyle transfrases appel terpene synthase fold
(Denghardt et al., 2009). Cette conservation du repliement du domaine C-terminal dans
ces enzymes accompagne d'autres caractristiques communes comme le motif DDxxD et
une fixation topologiquement identique des cations divalents, a conduit la suggestion que
ces deux familles d'enzymes ont volu partir d'un gne ancestral commun (Chen et al.,
1994 ; Christianson, 2006). Cependant, en dehors de la prsence d'un court motif conserv
li la fixation des cations mtalliques (DDxxD), les similitudes de squence entre les
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre I. Revue de Littrature



JJ
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

TPSs sont domines par les relations botanique des espces indpendamment du substrat
ou de la spcificit du produit (Bohlmann et al., 1998a).



















Figure 7 : Diagramme en ruban de la limonne synthase
cristallise illustrant le domaine N-terminal (orange) et le
domaine C-terminal du site actif (vert) (daprs Hyatt et al.,
2007)


Le site actif des TPSs est une poche hydrophobe du domaine C-terminal. Il est form
par six hlices- et est ferm vers l'extrieur par deux boucles qui sont situes la surface
de la protine (Denghardt et al., 2009). Ce site est organis de manire laisser la partie
diphosphate du substrat lentre du site catalytique o elle sera en contact avec le cation
mtallique (Mg
2+
, Mn
2+
pour les enzymes dAngiospermes et K
+
, Mn
2+
, Fe
2+
pour certaines
enzymes de Gymnospermes) catalysant la rupture de la liaison C-OP (Boeckelmann,
2008). Le domaine C-terminal catalyse la cyclisation du substrat ainsi que l'orientation et la
stabilisation des multiples intermdiaires carbocationiques (Whittington et al., 2002).
Le domaine N-terminal a une structure similaire aux noyaux catalytiques de certaines
glycosyle hydrolases (Starks et al., 1997). Peu dlments fonctionnels ont cependant t
identifis et ce domaine na pas de fonction clairement dfinie, bien que son extrmit N-
terminale recouvre le site actif du domaine C-terminal au cours de la catalyse (Whittington
et al., 2002). Les rsultats des analyses de mutations indiquent que ce domaine agit comme
un chafaudage (scaffold) qui facilite le repliement correct du domaine C-terminal en
configuration active (Kllner et al., 2004).

t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre I. Revue de Littrature



J4
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

I.2.3. Classification
Plusieurs groupes de chercheurs ont suggr que les TPSs vgtales partagent une
origine volutive commune du fait de leur mcanisme ractionnel similaire, leurs
caractristiques structurales conserves, leurs similarits de squences, la prsence de
motifs conservs et des nombres d'introns, et de tailles d'exons, similaires (Mau & West,
1994 ; Back & Chappell, 1995 ; Bohlmann et al., 1998a ; Cseke et al., 1998). En
consquence, plusieurs patrons de classifications des TPSs vgtales ont t dfinis sur la
base de ces critres.

I .2.3.1. Sous-familles (sous-groupes)
La comparaison des niveaux de similarit entre les squences en aa a permis la
subdivision de la famille des TPSs vgtales en sous-familles, chaque sous-famille tant
caractrise par le partage d'un minimum de 40% de similarit entre ses membres.
Initialement, cette classification fut compose de six sous-familles dsignes TPSa TPSf
(Bohlmann et al., 1998a).
Plus tard, Dudareva et al. (2003) ont isol et caractris deux myrcne synthases et
une (E)--ocimne synthase des ptales du muflier (Antirrhinum majus). Ces monoTPSs
du muflier ont t les membres fondateurs, avec lenzyme AtTPS14 dArabidopsis (Chen
et al., 2003), dune nouvelle sous-famille, TPSg. Les membres de cette sous-famille ne
possdent pas le motif RRx8W, qui est un motif caractristique et essentiel pour lactivit
cyclase des monoTPSs, TPSd1 et TPSb (Savage et al., 1994 ; Bohlmann et al., 1998a,
1999 ; Aubourg et al., 2002).
Trs rcemment, une nouvelle analyse cladistique reconnat galement sept sous-
familles de TPSs, les anciennes, TPSa, b, c, d et g, une sous-famille e/f issue de la fusion
des deux sous-familles originales TPSe et f, et une nouvelle sous-famille TPSh (Figure 8,
Chen et al., 2011). Lanalyse phylogntique des squences suggre en effet que TPSf
drive volutivement de TPSe. Ce sont les huit TPSs de Selaginella moellendorffii qui ont
conduit la cration de la nouvelle sous-famille, TPSh car elles n'appartiennent pas aux
sous-familles dfinies prcdemment. A lexception dune seule de ces TPS, toutes
contiennent lun ou lautre de ces deux motifs, "DxDD" et "DDxxD". La distribution
fonctionnelle et taxonomique des sous-familles de TPSs vgtales est rsume dans le
Tableau 2.


t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre I. Revue de Littrature



J-
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e



























Figure 8 : Phylognie gnrale des TPSs (daprs Chen et al., 2011)
Cette classification phylogntique inclue les TPSs putatives en pleines longueurs de sept gnomes squencs
de plantes (Physcomitrella patens, Selaginella moellendorffii, Vitis vinifera, Populus trichocarpa,
Arabidopsis thaliana, Oryza sativa et Sorghum bicolor) et des TPSs caractrises de Gymnospermes
proviennent de plusieurs gnomes.


Tableau 2 : Distribution fonctionnelle et taxonomique des sous-familles de TPSs des plantes
(daprs Chen et al., 2011)

Sous-famille Groupe Fonction* Distribution
TPSa TPSa1 SesquiTPS Dicotyldones
TPSa2 SesquiTPS Monocotyldones
TPSb MonoTPS, IspS Angiospermes
TPSc CDPS/KS, CDPS et autres DiTPS Plantes terrestres
TPSd TPSd1 surtout MonoTPS, SesquiTPS Gymnospermes
TPSd2 SesquiTPS Gymnospermes
TPSd3 surtout DiTPS, SesquiTPS Gymnospermes
TPSe/f KS, autres DiTPS, MonoTPS, SesquiTPS Plantes vasculaires
TPSg MonoTPS, SesquiTPS, DiTPS Angiospermes
TPSh DiTPS putative bifonctionnelle Selaginella moellendorffii
* CDPS, copalyle diphosphate synthase ; DiTPS, diterpne synthase ; IspS, isoprne synthase ; KS, kaurene
synthase ; MonoTPS, monotepne synthase ; SesquiTPS, sesquiterpne synthase.

En se basant sur les connaissances actuelles, les trois sous-familles, TPSa, TPSb et
TPSg sont composes entirement de gnes spcialiss pour la biosynthse des mono-,
sesqui- ou diterpnes exerants des rles dans les interactions cologiques des vgtaux,
plutt que des rles dans le mtabolisme primaire vgtal. La plupart des TPSs
caractrises de la sous-famille TPSa sont des sesquiterpne synthases (Chen et al., 2011).
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre I. Revue de Littrature



J6
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

Cette sous-famille peut tre divise en deux groupes, TPSa1 et TPSa2, le premier tant
spcifique des monocotyldones et le deuxime des dicotyldones. La sous-famille TPSb
est aussi spcifique des plantes fleurs (majoritairement des dicotyldones) et inclut des
monoterpnes synthases et des isoprne synthases (Bohlmann et al., 1998a ; Dudareva et
al., 2003). La sous-famille TPSg contient, comme mentionn ci-dessus, les monoterpnes
synthases du muflier (Dudareva et al., 2003), et la S-(+)-linalol synthase dArabidopsis
(Chen et al., 2003). La sous-famille TPSd est compose de monoterpnes synthases de
Gymnospermes (Bohlmann et al., 1999 ; Martin et al., 2004). Cette sous-famille est divise
son tour en trois groupes, TPSd1, TPSd2 et TPSd3 sur la base de leurs similarits de
squences et de leur valuation fonctionnelle (Martin et al., 2004). Les membres de la
sous-famille TPSf (linalool synthase de Clarkia et lAtTPS04 [At1g61120 ; fonction
inconnue] dArabidopsis) et les membres des sous-familles TPSe et TPSc (KS et CDPS,
respectivement) ainsi que ceux de TPSd3 et TPSh contiennent un motif supplmentaire de
200 aa de fonction inconnue qui est absent des membres d'autres sous-familles (Bohlmann
et al., 1998a ; Trapp & Croteau, 2001b ; Aubourg et al., 2002 ; Chen et al., 2011). Les
TPSs du mtabolisme primaire, la CDPS (TPSc, Sun & Kamiya, 1994 ; Bensen et al.,
1995 ; Ait-Ali et al., 1997) et la KS (TPSe, Yamaguchi et al., 1996), ne sont que
lointainement lies aux TPSs du mtabolisme secondaire comme celles des sous-familles
TPSa, TPSb et TPSd (Bohlmann et al., 1998a). Jusqu prsent tous les 8 membres de la
sous-famille TPSh sont des diTPSs appartenant lespce S. moellendorffii (Chen et al.,
2011).

I .2.3.2. Classes
Lorganisation gnomique (le nombre, la taille, le positionnement des introns, et le
nombre et la taille des exons) des gnes de TPSs des Gymnospermes et dAngiospermes a
permis de les rpartir en trois classes distinctes (Trapp & Croteau, 2001b). La classe I
comprend les gnes des di- et sesquiTPSs des conifres et les gnes des diTPSs des
Angiospermes spcifiquement impliqus dans le mtabolisme primaire. Les gnes de TPSs
de cette classe possdent 11-14 introns et 12-15 exons de taille caractristique. La classe II
comporte les mono- et les sesquiTPSs des conifres. Ceux-ci contiennent 9 introns et 10
exons. La classe III comporte les mono-, sesqui-, et diTPSs des Angiospermes impliques
dans le mtabolisme secondaire. Leurs gnes contiennent 6 introns et 7 exons.
Les Gnes des TPSs de la classe I possdent galement le domaine N-terminal
conserv de 200 aa de fonction inconnue (Bohlmann et al., 1998a,b) cod par les exons 4,
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre I. Revue de Littrature



J
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

5 et 6, tandis que les autres gnes des deux autres classes sont dpourvus de ce domaine (et
des exons 4, 5 et 6). Certains introns des gnes de TPS de la classe III (introns 3, 8, 11-14)
sont conservs chez tous les gnes de TPS de plantes. Cependant, les gnes de cette classe
et ceux de la classe II ont respectivement perdu les introns 1, 2, 7, 9 et 10 et les introns 1 et
2. Ces vnements de perte squentielle d'introns et dexons internes suggrent que le gne
de TPS ancestral ressemblait un gne actuel de diTPS de conifre et contenait au moins
12 introns et 13 exons (Trapp & Croteau, 2001).
Bas sur leurs mcanismes ractionnels et les produits forms, les TPSs de plantes
peuvent tre rparties aussi en deux classes : classe I et classe II, la CDPS tant la
reprsentante de la classe II des TPSs. Cette dernire catalyse la formation du copalyl
diphosphate (CPP) travers la cyclisation induite par la protonation du GGPP. Cependant,
les TPSs de plantes les plus courantes sont des TPSs de la classe I (Chen et al., 2011).
Dans l'tape initiale de la raction enzymatique catalyse par les TPSs de la classe I, le
prnyl diphosphate est ionis (formations dun carbocation intermdiaire) par dpart du
groupement pyrophosphate. Une caractristique tonnante des TPSs de cette classe est
quune seule enzyme gnre souvent de multiples produits partir dun seul substrat
(Steele et al., 1998 ; Christianson, 2006 ; Degenhardt et al., 2009). Lactivit des TPS de la
classe I rside dans le domaine C-terminal et inclut les motifs "DDxxD" et "NSE/DTE"
pour l'ionisation mtal-dpendante du substrat prnyl diphosphate. Cependant, l'activit des
TPSs de classe II rside dans des domaines spars et utilise le motif "DxDD" pour la
cyclisation initie par protonation du GGPP en CPP (Chen et al., 2011).

I.2.4. Mcanismes ractionnels
Toutes les TPSs ont des proprits assez semblables (Alonso & Croteau, 1993), et
toutes fonctionnent par des mcanismes de raction lectrophile similaires celui des
prnyltransfrases (Poulter & Rilling, 1978 ; Poulter & Rilling, 1981). Mcanistiquement,
les TPSs librent le groupe diphosphate du substrat isoprnyle diphosphate (TPS classe I),
ou dans certains cas protonent le GGPP (TPS classe II), pour gnrer un intermdiaire
carbocationique trs ractif au sein du site catalytique de lenzyme (Starks et al., 1997 ;
Wise & Croteau, 1999 ; Christianson, 2006). Une telle activit est dpendante dun cation
mtallique divalent qui dclenche le dpart du groupe diphosphate du substrat,
gnralement le GPP, le FPP, ou le GGPP (Cane, 1999 ; Wise & Croteau, 1999 ; Davis &
Croteau, 2000). Du fait de la forte ractivit des carbocations intermdiaires, les TPSs
catalysent des isomrisations spcifiques, des rarrangements divers, des cyclisations (et
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre I. Revue de Littrature



J8
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

ventuellement des cyclisations secondaires) et enfin llimination dun proton ou lajout
dune molcule d'eau pour stabiliser lintermdiaire carbocationique et donner la large
gamme de squelettes carbons de terpnodes trouvs chez les plantes (Lesburg et al., 1997
; Starks et al., 1997 ; Cane, 1999 ; Wise & Croteau, 1999 ; Davis & Croteau, 2000 ;
Whittington et al., 2002). La fonction la plus critique d'une TPS est de fournir la surface
physicochimique ncessaire pour orienter le(s) substrat(s) souple(s) isoprnodique(s) dans
le bon sens et avec la bonne conformation pour que, lors de la gnration du premier
intermdiaire carbocationique, une trajectoire spcifique de formation de liaison(s)
carbone-carbone intermolculaire(s), ou intramolculaire(s), soit applique (Christianson,
2008). Dans ces ractions, cependant, la trajectoire initiale de formation de liaison
carbone-carbone intramolculaire est favorise (Christianson, 2008). Il y a des enzymes de
TPSs qui catalysent la formation d'un seul compos terpnique, "TPS un produit". Mais
la plupart des TPSs ont la capacit tonnante de synthtiser des mlanges de produits
complexes haute rgio- et strospcificit "TPS multiples produits" (Croteau, 1987 ;
Cane, 1990). Dans ce qui suit, nous nous concentrerons principalement sur les mono- et
sesquiTPSs, mais avec quelques mentions sur les diTPSs. Le fonctionnement des enzymes
impliques dans la production de triterpnes, ttraterpnes et polyterpnes n'est pas dcrite.
Presque toutes les monoTPSs sont capables de catalyser les ractions d'isomrisation
et de cyclisation du substrat, tapes qui ncessitent des interactions avec les cations
divalents prsents sur le mme site actif (Croteau, 1987). Le linalyl diphosphate (LPP) est
lintermdiaire catalytique propos pour la cyclisation des monoterpnes (Wise & Croteau,
1999). Dans ce cas, une ionisation (mtal-dpendante) et une isomrisation prliminaire du
prcurseur GPP au (3R)- ou (3S)-LPP (selon le repliement (folding) initial du substrat) est
ncessaire pour surmonter l'obstacle gomtrique de cyclisation impos par la double
liaison 2,3-trans du GPP (Figure 9A). Aprs la formation de lLPP, une rotation autour de
la liaison C2-C3 pour fournir la configuration cis et une ionisation en C1 sont capitales
pour initier la cyclisation C6-C1 pour produire le cation -terpinyle (intermdiaire
universel initial critique dans la formation de tous les monoterpnes cycliques). Les
squelettes bicycliques des monoterpnes sont gnrs partir de cet intermdiaire par
attaque nuclophile interne de la double liaison restante sur le carbocation (Figure 9A)
(Hyatt, 2007). La formation du limonne et du terpinolne suit le chemin catalytique
cyclisant le plus court car la raction de cyclisation est directement suivie dune raction de
dprotonation du cation -terpinyle (Rajaonarivony et al., 1992 ; Colby et al., 1993 ; Yuba
et al., 1996 ; Bohlmann et al., 1997, 1999). Cependant, la formation des monoterpnes
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre I. Revue de Littrature



J?
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

acycliques (Figure 9B) nexige pas ncessairement l'isomrisation du GPP en LPP, mais
peut se produire directement par stabilisation du cation granyle. Le cation granyle subit
alors une dprotonation pour donner, par exemple, le (E)--ocimne (Chen et al., 2003 ;
Dudareva et al., 2003 ; Fldt et al., 2003 ; Arimura et al., 2004b) ou le myrcne (Fischbach
et al., 2001 ; Chen et al., 2003 ; Dudareva et al., 2003 ; Martin et al., 2004 ; Bohlmann et
al., 1997, 2000). Le granyl cation peut galement subir une addition dune molcule deau
pour former le graniol (Iijima et al., 2004 ; Yang et al., 2005) ou le linalol (Dudareva et
al., 1996 ; Jia et al., 1999 ; Crowell et al., 2002 ; Chen et al., 2003 ; Aharoni et al., 2004 ;
Martin et al., 2004). Cependant, il est galement concevable que le linalol, le myrcne et le
(E)--ocimne proviennent aussi du cation linalyle (Figure 9B) (Degenhardt et al., 2009).




























Figure 9 : Mcanismes ractionnels des monoTPSs cycliques (A) et des monoTPSs acycliques (B)
initis par lionisation du substrat GPP (daprs Degenhardt et al., 2009)
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre I. Revue de Littrature



4u
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

Les sesquiTPSs catalysent la formation des sesquiterpnes partir du FPP (Figure 10).
Leurs mcanismes ractionnels sont similaires ceux des monoTPSs et sont bass sur la
formation dintermdiaires carbocationiques. Cependant, le large squelette carbon du FPP
(5 carbones de plus) et la prsence de trois, et non deux, doubles liaisons augmente
considrablement le nombre de cyclisations possibles et donc la diversit structurelle des
sesquiterpnes. Les ractions initiales de cyclisation peuvent tre divises en deux types
(Figure 10A). Un type implique une cyclisation du farnsyl cation initialement form en
cation (E,E)-germacradinyle (cycle 10 carbone) ou en cation (E)-humulyle (cycle 11
carbone). tant donn la grande taille de ces cycles, la (E)-gomtrie de la double liaison
C2-C3 n'est plus un obstacle pour la cyclisation. Le deuxime type de cyclisation se
produit aprs lisomrisation prliminaire de la double liaison C2-C3 pour donner le cation
nrolidyle, en analogie directe avec l'isomrisation du GPP au cation linalyle dans le
mcanisme ractionnel des monoTPSs (Cane & Iyengar, 1979 ; Cane et al., 1981 ; Cane &
Yang, 1994 ; Cane & Tandon, 1995 ; Alchanati et al., 1998). Sous sa configuration cis, le
cation nrolidyle peut subir une attaque cyclisante par la double liaison centrale ou distale
pour former les intermdiaires, cation 1,6-bisabolyle, cation 1,7-cyclohptanyle, cation
1,10-(Z,E)-germacradinyle ou cation 1,11-(Z,E)-humulyle (Figure 10A). La diversit des
sesquiterpnes s'appuie galement sur des cyclisations supplmentaires qui peuvent
impliquer l'attaque lectrophile du carbocation sur l'une des deux autres doubles liaisons
donnant une large gamme de squelettes carbons. En plus du phnomne de cyclisation, les
sesquiTPSs peuvent catalyser plusieurs types de rarrangements de lintermdiaire
carbocationique similaires ceux observs avec les monoTPSs, y compris des contractions
de cycles (Back & Chappell, 1995 ; Martin et al., 2004), des dplacements dhydrure, des
migrations de mthyle (Tholl et al., 2005) et/ou des rarrangements de Wagner-Meerwein.
Lintermdiaire carbocationique est finalement aussi stabilis soit par une dprotonation
soit par une fixation (capture nuclophile) dune molcule deau (Degenhardt et al., 2009).
La production de sesquiterpnes acycliques tels que l-farnsne se produit par
dprotonation du FPP directement aprs sa premire ionisation.






t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre I. Revue de Littrature



41
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e






































Figure 10 : Mcanismes ractionnels des sesquiTPSs initis par lionisation du substrat FPP
(daprs Degenhardt et al., 2009)
Le carbocation rsultant de la perte du groupement pyrophosphate peut suivre plusieurs chemins ractionnels et
potentiellement subir une gamme de cyclisations, dont certaines sont prcdes par lisomrisation dun
intermdiaire, le nerolidyl cation (A). Le mcanisme de raction de la 5-epi-aristolochne synthase seffectue via un
intermdiaire neutre, le germacrne A, qui est re-proton pour former des produits de raction bicycliques (B). La
numrotation des atomes de carbone des produits et intermdiaires se rfre celle du FPP.


Les diTPSs catalysent la formation d'une varit de produits linaires, mono- et
polycycliques depuis le prcurseur GGPP 20-carbones (West, 1981). Les ractions de
biosynthse des diterpnes, comme celles des mono- et des sesquiterpnes, peuvent tre
inities par le dpart du groupement diphosphate suivi de la formation dun carbocation et
de ses ventuels rarrangements (attaque lectrophile de doubles liaisons, dplacements
dhydrures, migrations de mthyles, rarrangements de Wagner-Meerwein). Les diterpnes
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre I. Revue de Littrature



42
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

macrocycliques, comme le casbne (Dueber et al., 1978), le cembrne (Guo & Wagner,
1995) et le taxadine (Koepp et al., 1995 ; Lin et al., 1996) sont formes par des
cyclisations analogues celles des mono- et sesquiterpnes (Figure 11). Cependant, le
fonctionnement catalytique des diTPS peut tre galement initi par un mcanisme de
protonation du GGPP suivi de mcanismes de rarrangement et de stabilisation du
carbocation similaires ceux des mono- et sesquiTPSs. Le groupement pyrophosphate
ntant pas affect lors de ce type de catalyse, les produits forms le possdent toujours.
Lors de la biosynthse du (-)-kaurne (Figure 11), prcurseur des hormones vgtales de la
classe des gibbrellines, la (-)-CDPS catalyse la cyclisation du GGPP en (-)-CPP par un
mcanisme de protonation-dprotonation (Sun & Kamiya 1994 ; Ait-Ali et al., 1997). Lors
dune deuxime tape, une autre enzyme, la KS (Yamaguchi et al., 1996) transforme cet
intermdiaire ((-)-CPP) en (-)-kaurne via un mcanisme dionisation par perte du
groupement pyrophosphate puis de cyclisation (Figure 11) (Duncan & West 1981 ; Railton
et al., 1984).


















Figure 11 : Biosynthse des diterpnes impliquant l'ionisation et la cyclisation direct du
GGPP, et la cyclisation prliminaire en CPP par protonation de la double liaison
terminale (modifier daprs Bohlmann et al., 1998)


I.2.5. Expression et rgulation
Les terpnodes sont impliqus dans plusieurs fonctions cologiques et
physiologiques. Leur profil daccumulation est ainsi modifi au cours du dveloppement
des plantes et en rponse aux stress biotiques et abiotiques de l'environnement pour
rpondre aux besoins de la plante. Dans la majorit des cas, les variations des profils
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre I. Revue de Littrature



4J
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

daccumulation sont directement la rsultante de variations des profils d'expression des
gnes de TPSs (Tholl, 2006). La rgulation de la biosynthse des terpnodes des plantes
est complexe et sinscrit en gnral sous deux grandes catgories, un contrle spatial,
tissulaire, et un contrle temporel, ontognique ou suite un stress (McGarvey & Croteau,
1995).

I .2.5.1. Rgulation spatiale
La biosynthse des terpnes chez les plantes est communment plus abondante au
niveau de structures histologique spcifiques o de grandes quantits de terpnodes
hydrophobes sont produites, accumules et ventuellement scrts ou missent (voir
section sites de biosynthse). Les terpnes volatils sont souvent mis depuis un des tissus
floraux au moment le plus opportun pour attirer les pollinisateurs. Par exemple, Dudareva
et al. (2003) ont dmontr que la biosynthse et l'mission du (E)--myrcne et de
locimne depuis les fleurs du muflier (Antirrhinum majus) sont en corrlation avec les
expressions spcifiques des gnes des monoTPSs correspondantes dans les lobes
suprieurs et infrieurs des ptales durant le grossissement du bouton floral. Le linalol,
impliqu dans lattraction des pollinisateurs chez Clarkia breweri, est produit
principalement dans les ptales de la fleur (Pichersky et al., 1994). Les carotnodes sont
produits dans les chromoplastes des fruits de poivrons rouges (Capsicum anuum) lors de la
maturation (Camara & Brangeon, 1981 ; Bartley & Scolnik, 1995).

I .2.5.2. Rgulation temporelle
Les rgulations circadienne et dveloppementale de lmission des terpnodes volatils
ont t rapportes chez diffrentes espces (Lu et al., 2002 ; Aharoni et al., 2003 ;
Dudareva et al., 2003). La composition et le taux dmission des composs volatils mis
par les fleurs et les feuilles (dont ceux dont la production est induite par des herbivores)
varient sensiblement en fonction de la photopriode (Par & Tumlinson, 1997a, b ; de
Moraes et al., 2001 ; Aharoni et al., 2003 ; Dudareva et al., 2003 ; Arimura et al., 2004a).
Ils prsentent un rythme journalier avec des maxima concidant avec lactivit des
pollinisateurs potentiels (Jakobsen et al., 1994 ; Helsper et al., 1998 ; Kolosova et al.,
2001) ou lactivit alimentaire des ravageurs (Dudareva et al., 2004). Chez Artemisia
annua, l'mission du -pinne fluctue en fonction du rythme jour-nuit et est gnralement
plus leve dans la journe que dans la nuit (Lu et al., 2002). L'expression des gnes de
monoTPSs du muflier cits ci-dessus suit galement un cycle journalier contrl par une
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre I. Revue de Littrature



44
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

horloge circadienne ou rgule par la lumire (Kolosova et al., 2001 ; Dudareva et al.,
2004). Outre cette rgulation rythmique, la production des terpnodes des taux levs est
aussi dclenche par les dommages provoqus sur les membranes comme les blessures
mcaniques ou la prsence de pathognes. Huber et al. (2004) proposent que lherbivorie
puisse provoquer des changements biochimiques permanents dans la voie de biosynthse
des terpnodes et dans lexpression des gnes des TPSs. Les monoterpnes et les
sesquiterpnes mis en tant que volatils contribuent aux dfenses indirectes contre les
herbivores, alors que les diterpnes et quelques sesquiterpnes fournissent une protection
directe travers la formation de phytoalexines (Phillips & Croteau, 1999). Quelques gnes
de TPSs responsables de lmission des terpnes induits par les herbivores sont connus
chez plusieurs espces dAngiospermes (Shen et al., 2000 ; Schnee et al., 2002 ; Fldt et
al., 2003 ; Arimura et al., 2004a, b).
Dans presque tous les aspects du dveloppement et de la physiologie des tissus
vgtaux, des facteurs de transcription jouent un rle majeur dans la rgulation de la
biosynthse des terpnodes (van der Fits & Memelink, 2000 ; Xu et al., 2004). Il a t
dmontr que la rgulation de lexpression des TPSs tait principalement transcriptionnelle
(Tholl, 2006). De bonnes corrlations ont galement t mesures entre la composition des
HEs et les concentrations relatives, et absolues, des transcrits des TPSs chez diffrentes
lignes dOriganum vulgare (Crocoll et al., 2010). Les facteurs de transcription "WRKY"
sont impliqus dans de nombreux processus dont les rponses des plantes aux stress
biotiques et abiotiques (Eulgem et al., 2000 ; Zhang & Wang, 2005). Chez le coton,
llment boite-W (W-box) de la fixation du facteur de transcription "WRKY" est prsent
dans le promoteur du gne de la (+)--cadinne synthase-A (CAD1-A). Le facteur WRKY
du coton, GaWRKY1 a t repr comme rgulateur de l'expression de CAD1-A. Il
participe galement la rgulation de biosynthse des sesquiterpnes aldhydes comme le
gossypol (Xu et al., 2004). Les lments boite-W, ont galement t identifis dans les
promoteurs des gnes de TPSs chez dautres plantes, y compris la 5-pi-aristolochne
synthase du tabac (Yin et al., 1997) et des gnes putatifs des TPSs d'Arabidopsis et le riz
(Xu et al., 2004). Les analyses d'expression des gnes de TPSs d'autres plantes en
combinaison avec leurs analyses fonctionnelles ont indiqu que ces TPSs sont rgules
aussi par des mcanismes post-transcriptionnel et/ou post-traductionnel. Dans les feuilles
de peuplier, la rgulation saisonnire des missions d'isoprne semble, en partie, tre
contrle au niveau post-traductionnel car les taux de protines sont levs tout au long de
l'anne bien que l'activit enzymatique diminue significativement au cours de l'automne
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre I. Revue de Littrature



4-
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

(Mayrhofer et al., 2005). La biosynthse de terpnes semble donc tre complexe et rgule
diffrents niveaux selon les espces et les synthases concernes.

I.2.6. Evolution
Les informations disponibles ce jour suggrent que l'volution des TPSs est rapide et
conduit une modification du nombre de copies de gnes et une modification des
produits forms (Trapp & Croteau, 2001b ; Aubourg et al., 2002 ; Sharkey et al., 2005). La
comparaison des squences et des mcanismes ractionnels des trois premires TPSs
clones et caractrises chez les plantes, la limonne synthase (monoTPS, Colby et al.,
1993), lepi-aristolochne synthase (sesquiTPS, Facchini & Chappell, 1992), et la casbne
synthase (diTPS, Mau & West, 1994) a rapidement rvl que ces gnes sont lis bien
quoriginaires despces vgtales phylogntiquement loignes. Cette conclusion a t
soutenue par l'analyse gnomique trs limite portant sur le nombre et lemplacement des
introns (Mau & West 1994 ; Back & Chappell 1995 ; Chappell, 1995a, 1995b).
L'hypothse actuelle base sur l'arbre phylogntique prcdent (voir sous-familles des
TPSs) suggre que les TPSs vgtales impliques dans le mtabolisme secondaire ont une
origine ancestrale commune partir d'une TPS implique dans le mtabolisme primaire.
Ce modle actuel de l'volution de TPSs a t soutenu par Trapp et Croteau, (2001b) suite
leur analyse de l'organisation gnomique de TPSs. En accord avec leur origine commune,
toutes les TPSs des Gymnospermes et des Angiospermes qui partagent une structure
d'ensemble commune sont drives d'une TPS ancestrale trois domaines qui ressemble
labietadine synthase des Gymnospermes (qui son tour ressemble la CDPS/KS de P.
patens, Chen et al., 2011). Cette volution a eu lieu avant la sparation des Angiospermes
et des Gymnospermes (Bohlmann et al., 1998a ; Trapp & Croteau, 2001b), il y a environ
300 millions d'annes (Doyle, 1998).
L'analyse phylogntique des squences de TPSs suggre que la diTPS associe la
biosynthse des gibbrellines, ainsi que celles lies la biosynthse des diterpnodes
antibiotiques, chez les plantes, les champignons et les bactries partagent probablement
une origine volutive commune (Morrone et al., 2009). Cette analyse indique en effet que
la CDPS et la KS des Gymnospermes et Angiospermes sont issues de la duplication d'un
gne CDPS/KS ancestral suivi dune nofonctionalisation qui a impliqu la perte d'activit
d'un de ces domaines dans un gne et la perte de l'autre domaine dans l'autre copie de gne
(Keeling et al., 2010). Les variations de la structure trois domaines dans les nombreuses
enzymes bien caractrises de la famille des TPSs vgtales peuvent tre expliques par la
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre I. Revue de Littrature



46
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

perte d'un domaine particulier comme pour la KS ou la CDPS ou par la perte d'activit
associe un domaine particulier dans les diffrentes lignes volutives de TPSs. Ces
variations expliquent galement la longueur variable des TPSs vgtales denviron 600
900 acides amins.
Il est probable galement que les TPSs ancestrales taient moins spcialises
fonctionnellement que les enzymes modernes et quelles taient capables d'utiliser
plusieurs prnyl diphosphate comme substrat pour la production de terpnes multiples. La
transformation dune diTPS en sesquiTPS implique non-seulement un changement de
spcificit de substrat, mais aussi un changement de localisation subcellulaire par la perte
du peptide de transit chloroplastique. Lvolution de certaines FPP synthases semble par
contre avoir conduit la formation denzymes capables de former des terpnes irrguliers
(Hemmerlin et al., 2003b ; Rivera et al., 2001).

I.2.7. Expression htrologue
En raison du manque apparent de corrlation entre la structure primaire et la fonction
des TPS, il n'est pas possible de prdire laptitude catalytique d'une TPS uniquement sur la
base de la parent de squence. Ainsi, par exemple, les monoTPSs qui partagent 70-90 %
didentit en aa peuvent gnrer des produits trs distincts, alors que des synthases ne
partageant que 30 % d'identit en aa peuvent catalyser la mmes raction de cyclisation
(Bohlmann et al., 1997). La simple comparaison des squences avec les TPSs existantes
sur les banques de gnes permet uniquement le placement d'une nouvelle squence dans
l'une des sept sous-familles de gnes de TPSs vgtales mais ne permet pas la prdiction
des produits quelle forme, et des fois mme le substrat quelle utilise. L'analyse du
polypeptide produit de manire htrologue dans Escherichia coli ou Saccharomyces
cerevisiae en prsence des divers substrats prnyl diphosphate possibles (GPP, FPP ou
GGPP) est pour linstant le moyen le plus sr de dterminer les spcificits de substrat et
produit d'une TPS.


I.3. LE GENRE LAVANDULA L.
Le genre Lavandula est l'un des plus importants genres de la famille des Lamiaces
(Labies, qui signifie "labi" en rfrence la forme des lvres des fleurs). Les Lamiaces
constituent une large famille de plantes dicotyldones qui comprend environ 7200 espces et
prs de 236 genres rpartis en 7 ou 8 sous-familles. Ce sont le plus souvent des plantes
herbaces, des arbustes et trs rarement des arbres ou des lianes, largement rpandus autour du
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre I. Revue de Littrature



4
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

monde mais particulirement dans les rgions tempres et mditerranennes. Pour la plupart
des genres, la section carre de la tige, les feuilles opposes, et dcusses, et les fleurs
hermaphrodites avec calices persistants entourant, maturit, un ttrakne sont une
combinaison de caractres diffrentiant par rapport aux autres Angiospermes. De nombreuses
espces de cette famille (sous-famille des Nepetoideae) sont des plantes aromatiques source
d'HEs trs utiles pour l'aromathrapie, la parfumerie et l'industrie des cosmtiques. On y
rencontre aussi beaucoup d'espces mellifres et galement des espces cultives comme
plantes condimentaires et ornementales. Parmi les nombreux genres de Lamiaceae on peut
citer : Ajuga, Origanum, Lamium, Lavandula, Mentha, Rosmarinus, Salvia, Satureja, Melissa,
Ocimum, Teucrium, Stachys, Thymus, etc.

Synonymes
Les synonymes de Lavandula L., daprs Upson (2002), sont Stoechas Mill., Fabricia
Adans., Chaetostachys Benth., Sabaudia Buscal. et Muschl. et Isinia Rech. f. Le genre
Lavandula L., est compos d'environ 39 espces, de nombreux hybrides, et prs de 400
cultivars enregistrs (Upson & Andrews, 2004). Comme beaucoup de Lamiaces, les
lavandes sont connues pour leurs HEs riches en terpnes. Les espces les plus connues et
valorises conomiquement sont sans conteste L. angustifolia, L. stoechas, L. latifolia et
lhybride L. x intermedia.

Etymologie
Le mot lavande drive du verbe laver. Il est peut tre issu de l'italien lavando (action
de laver) mais peut remonter au latin lavare qui signifie laver et aussi se baigner, les
Romains ayant utilis des lavandes pour parfumer leurs bains (Ryley, 1998). Cette
tymologie laisse penser que trs tt la lavande a t utilise pour parfumer le linge
frachement lav. Des sachets de fleurs sches sont traditionnellement placs dans les
armoires pour loigner les mites et parfumer la garde-robe. Mais il est galement possible
que Lavandula et lavande soient tirs du latin livere (qui signifie "pour tre livide ou
bleutre") qui en latin mdival a donn le terme lavindula. La relation entre la lavande et
le lavage qui nest clairement explicite quen 1568 serait alors une supposition secondaire
(Murray et al., 1933).

I.3.1. Taxonomie
Le genre Lavandula appartient la sous-famille des Nepetoideae sur la base du
caractre hexapertur des grains de pollen. Dans cette sous-famille, plusieurs tribus sont
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre I. Revue de Littrature



48
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

reconnues et Lavandula tait autrefois considr comme un groupe distinct et isol class
dans la tribu Lavanduleae (Endl.) Boiss contenant le seul genre Lavandula (Cantino et al.,
1992). Le genre Lavandula a rcemment t inclus dans la tribu Ocimeae suite une tude
phylogntique bas sur le polymorphisme de squences dADN chloroplastique (Paton et
al., 2004). Comme pour les autres genres de cette tribu, lorigine de diversification des
lavandes serait localise en Asie.
La classification du genre Lavandula a subi de nombreuses modifications depuis Pline 76
avant J.C. et le nombre despces dcrites na cess daugmenter au fil des travaux botaniques.
Historiquement, L. stoechas, L. pedunculata et L. dentata ont t dcrites l'poque romaine
(Lis-Balchin, 2002). Au moyen ge, les espces europennes ont t considres comme deux
groupes, ou deux genres, distincts, Stoechas (stoechas, pedunculata, dentata) et Lavandula
(spica et latifolia), jusqu' ce que Linn les combine. Il a seulement reconnu quatre espces
dans son "Species Plantarum" (1753), L. multifida et L. dentata en Espagne et L. stoechas et L.
spica en Europe du Sud. L. pedunculata tait inclue dans L. stoechas. Le genre est
frquemment mentionn dans de nombreux livres sur les plantes mdicinales et de botanique,
bien que la premire monographie du genre "De Lavandula" ait t publie en 1780
(Lundmark, 1780). Ce travail a reconnu cinq espces et huit varits. En 1790, L. pinnata et L.
carnosa ont t reconnues. Cette dernire a t ensuite transfre au genre Anisochilus. La
deuxime monographie du genre "Histoire Naturelle des Lavandes" crite par Gingins (1826),
a t d'une grande importance car cest dans celle-ci que Gingins a recens douze espces et a
propos une classification infra-gnrique de trois sections (Stoechas, Spica (Lavandula) et
Pterostoechas). Entre 1832 et 1836 le genre Lavandula a t enrichi dune nouvelle section,
Chaetostachys par Benthame. En 1848 dix-huit espces taient connues.
Une des premires classifications modernes majeures du genre Lavandula se trouve dans
"A Taxonomic Study of the Genus Lavandula" de Chaytor (1937). Sa rvision reconnat vingt-
huit espces ainsi que de nombreux taxons infra-spcifiques rpartis en cinq sections,
Stoechas, Spica, Subnudae, Pterostoechas et Chaetostachys. Une nouvelle espce, L.
somaliensis, est dcrite, de nombreuses nouvelles combinaisons ont t faites et une nouvelle
section Subnudae a t installe. Cependant, toutes les principales formes cultives et
commercialises rsident dans les sections Stoechas et Spica. En 1949 Rozeira (1949) a rvis
et modifi la section Stoechas en crant deux sous-sections, Stoechas et Dentatae.
Rcemment, la classification phylogntique du genre Lavandula a t rexamine par
Upson et Andrews (2004) (Figure 12). Cette tude a conduit reconnatre 39 espces
diffrentes rparties en trois sous-genres Fabricia, Sabaudia et Lavandula et huit sections
(les 5 d'origine de Chaytor, (1937), et trois nouvelles sections). En outre, de nombreux
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre I. Revue de Littrature



4?
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

hybrides et cultivars dutilisation commerciale et horticole ont t formellement dcrits.
Cette organisation taxonomique a t ralise sur la base de plus de 40 critres
anatomiques mais aussi par une analyse phylogntique bas sur la comparaison de
squences nuclaires (Internal Transcribed Spacer - squence interne traduite) (Figure 13).
Le premier grand groupe gntique interne au genre Lavandula correspond au sous-genre
Lavandula, et le second Fabricia. Le groupe Sabaudia est moins clairement isol
(statistiquement soutenu) ainsi que la section Hasikenses au sein du sous-genre Fabricia.
Au sein du sous-genre Lavandula, les sous-clades correspondent aux sections existantes
sauf la section Dentatae qui est devenue une section part, indpendante de la section
Stoechas. Au sein du sous-genre Fabricia, les sous-clades correspondent aux sections
Pterostoechas, Subnudae et Chaetostachys.
























Figure 12 : Taxonomie du genre Lavandula (daprs Upson & Andrews, 2004)












t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre I. Revue de Littrature



-u
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e


































Figure 13 : Arbre de classification des espces du genre Lavandula bas sur les squences
nuclaire ITS (daprs Upson & Andrews, 2004)


I.3.2. Diversit morphologique
Le genre Lavandula est un groupe plutt mitig et divergent en termes de morphologie
anatomique. Les morphologies des espces sont probablement le rsultat dune rpartition
gographique trs large et dadaptations anatomiques des milieux et des pollinisateurs
diffrents. Ce genre se diffrencie des autres genres des Lamiaces par des tamines et un
style totalement inclus dans le tube de la corolle et, spcifiquement pour les lavandes
europennes, lappendice obovale qui recouvre la pointe du calice (Tutin et al., 1972 ;
Coste & Flahault, 1998). Ce dernier caractre est absent chez de nombreuses espces
africaines ou asiatiques (Lis-Balchin, 2002). En plus des caractristiques morphologiques
macroscopiques, dautres caractres moins visibles lil entrent aussi en compte dans la
dtermination des espces comme le nombre de chromosomes, la forme des grains de
pollen (Suarez-Cervera & Seoane-Camba, 1986) ou encore celle des graines. La diversit
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre I. Revue de Littrature



-1
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

morphologique des lavandes a t entirement revue et dtaille par Upson (2002) et
Upson et Andrews (2004). L'aperu de la description botanique des espces de lavandes
donn ci-dessous est entirement bas sur ce qui est rapport dans ces deux rfrences sauf
indication contraire. Il se concentre plus particulirement sur la section Stoechas qui est le
sujet de cette thse, mais fait mention des autres sections.

Port et trichomes
Les lavandes sont des sous-arbrisseaux ou parfois des arbustes vivaces atteignant
jusqu 1.5 m de hauteur. Elles sont annuelles ou pluriannuelles. Beaucoup d'espces sont
caractrises par un feuillage et des fleurs trs aromatiques du fait de la prsence d'HEs qui
sont labores dans des glandes (trichomes) couvrant une grande partie de la plante. La
caractrisation de ces trichomes a fait lobjet de plusieurs tudes chez de nombreuses
espces de Lamiaces y compris les lavandes. Ces tudes ont rvl une grande diversit
de patron de distribution, de morphologie et de densit, qui constituent autant de caractres
taxonomiques importants (Schnepf, 1968 ; El-Gazzar & Watson 1970 ; Heinrich et al.,
1983). Une observation en microscopie lectronique balayage des trichomes de feuilles a
montr quil existe chez L. pedunculata 5 types de trichomes scrteurs (Figure 14,
Zuzarte et al., 2010). Ce sont les trichomes pelts 8 cellules de tte scrtrices, les
trichomes capits de type I avec une tte bicellulaires, les trichomes capits de type II avec
une tte unicellulaires, les trichomes bifurqus et les trichomes ramifis mixte (trichomes
non-glandulaire et glandulaire). Une autre tude a montr que lespce L. angustifolia est
caractrise par 5 types de trichomes tecteurs et 4 types de trichomes scrteurs (Couderc-
Le-Vaillant et al., 1990).

Feuilles
La forme des feuilles est trs varie (Figure 15). Elles sont persistantes, opposes,
sessiles ou ptioles, simples ou composes, poilues et le plus souvent gristres ou
argentes et parfois vert sombre. Elles sont longues et troites chez la plupart des espces
mais, chez certaines espces, elles sont pennes ou pennes dentes et parfois pennes
multiples et entirement ou profondment dcoupes. Dans certaines des espces d'Arabie
les feuilles sont souvent absentes. Alors que les feuilles du sous-genre Lavandula et
Sabaudia sont simples et allonges, celles du sous-genre Fabricia sont trs diversement
lobes et dentes.

t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre I. Revue de Littrature



-2
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e


















Figure 14 : Diversit de trichomes de L. pedunculata (daprs Zuzarte et al., 2010)
(A) Trichome pelt entirement dvelopp avec une tte enfle. (B) Stade scrteur d'un trichome
pelt montrant l'espace sous-cuticulaire sur les huit cellules scrtrices. (C) Trichome capit de type
I avec une tige courte (petite flche) sous-tendant une tte bicellulaire (flche). (D) Trichome capit
de type II avec une cellule basale (flche fine) sous-tendant une longue tige (grande flche), une
cellule du cou (flche double) et une tte unicellulaire (petite flche). (E) Trichome bifurqu. (F)
Trichome ramifi mixte montrant les caractristiques de trichomes non glandulaires (flche longue)
et glandulaire (petite flche). Bars = 10 m.

























Figure 15 : Diversit de formes et de contours des feuilles de certaines espces du genre
Lavandula (Collection BVpam)
Toutes les feuilles sont prsentes en tail naturelle. 1. L. mairei, 2. L. multifida, 3. L. canariensis, 4. L. rejdalii, 5.
L. pinnata, 6. L. dentata, 7. L. viridis, 8. L. latifolia, 9. L. angustifolia, 10. L. lanata, 11. L. pedunculata subsp.
lusitanica, 12. L. stoechas, 13. L. rotundifolia, 14. L. aristibracteata, 15. L. minutolii, 16. L. antinea, 17. L.
buchii, 18. L. maroccana, 19. L. citriodora, 20. L. subnuda, 21. L. pubescens, 22. L. samhanensis, 23. L.
dhofarensis, 24. L. coronopifolia.

t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre I. Revue de Littrature



-J
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

Inflorescences
Contrairement aux feuilles, linflorescence constitue un point commun lensemble
des lavandes. Les fleurs, avec pdicelle, sont disposes en verticilles, tenues en grappes de
cymes cylindriques ou quadrangulaires, l'extrmit de tiges rarement feuilles. Elles
peuvent tre le plus souvent mauves, bleues, violettes pourpres, roses ou lilas et parfois
blanches, probablement suite une mutation. Enfin, les fleurs des espces du sous-genre
Sabaudia sont jaunes-marrons. Beaucoup despces ne fleurissent quune seule fois dans
lanne, dautres deux fois comme L. stoechas et L. pedunculata (printemps et automne).
Dautres fleurissent toute lanne comme L. dentata. Linflorescence principale compose
ressemblant un pi est plus ou moins lche (thyrse spiciforme). Linflorescence
secondaire est une cyme bipare et scorpiode dans le sous-genre Lavandula ou uniflore
dans les sous-genres Sabaudia et Fabricia (Figure 16) (Upson, 1997 ; Lis-Balchin, 2002).
Linflorescence est parfois surmonte par des bractes florales striles colores (les
sections Stoechas et Dentatae, Figure 16). La majorit des espces de lavandes ont des
bractes et des cymes opposes dcusses, ce qui donne leurs pis une forme
quadrangulaire, particulirement bien visible dans la section Pterostoechas. Dans le sous-
genre Lavandula les cymes plusieurs fleurs donnent un aspect cylindrique aux thyrses
(Figure 16). Dans les autres sections du sous-genre Fabricia ainsi que dans le sous-genre
Sabaudia les bractes et les cymes sont organises en spirale le long de laxe floral (Figure
16).












Figure 16 : Photographies des inflorescences (thyrses) reprsentatives de 8 sections du genre
Lavandula (Collection BVpam sauf pour la section Sabaudia dont la photo est de Tim Upson
(Upson, 2009))

t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre I. Revue de Littrature



-4
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

Corolle
La corolle est constitue de 5 ptales souds. Elle est souvent asymtrique, tubuleuse
la base et bilabie au sommet. Elle est soude avec les 4 tamines. La lvre suprieure est
deux lobes, l'infrieure trois lobes et les lobes sont de taille variable (Figure 17). Seules
exceptions cette rgle, les espces du sous-genre Sabaudia prsentent des corolles
constitues de 5 ptales souds en toile. Le tube de la corolle est plus ou moins long. Dans
la section Stoechas le tube est presque totalement insr dans le calice. Dans les sections
Lavandula et Dentatae la longueur du tube visible est gale celle du calice. Enfin, dans
toutes les sections du sous-genre Fabricia la partie visible du tube est trois fois plus longue
que le calice, faiblement ou fortement deux lvres. Les quatre tamines sont inclines
(courbant vers le bas), gnralement didynamous (deux paires d'tamines ingales en
longueur), la paire antrieure tant plus longue et inclue dans le tube. Le stigmate est
unique, bilob ou capit. Les lobes nectarifres sont positionns en face des ovaires. Les
glandes scrtrices dHE ne sont prsentes que sur la face infrieure de la corolle.























Figure 17 : Variation de la morphologie des corolles (fleurs) de certaines espces du genre
Lavandula (daprs Upson, 2002)
Toutes les corolles sont prsentes x 100 sauf pour 1, 2, 3 et 14 sont x 160. 1. L. dentata var. dentata, 2. L.
viridis, 3. L. latifolia, 4. L. lanata, 5. L. multifida, 6. L. bipinnata, 7. L. atriplicifolia, 8. L. canariensis, 9. L.
pubescens, 10. L. tenuisecta, 11. L. coronopifolia, 12. L. maroccana, 13. L. aristibracteata, 14. L. subnuda.




t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre I. Revue de Littrature



--
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

Calice
Le calice est tubulaire court et cinq lobes qui se terminent par 5 dents ingales. Il est
persistant, rgulier ou avec deux lvres (bilabie), la lvre suprieure ayant alors trois lobes
et la lvre infrieure deux lobes. Les deux lvres sont plus ou moins gales en taille ou la
lvre postrieure est plus large ou modifie en un appendice huit, treize ou quinze
nervures. Les nervures des spales infrieurs sont toutes portes l'apex. La variation de
forme des calices offre de nombreux indices importants pour diagnostiquer les sections et
espces (Figure 18). Dans le sous-genre Lavandula le lobe mdian de la lvre suprieure
forme une extension qui recouvre louverture du calice avant lpanouissement de la fleur
ainsi quaprs la tombe de la corolle. Le sous-genre Sabaudia fait exception avec un
calice rgulier. Chez quelques lavandes comme L. angustifolia le calice est le site
prfrentiel de la production de lHE du fait de la trs forte densit de trichomes scrteurs
(Couderc-Le-Vaillant et al., 1990).



















Figure 18 : Variation des calices (lobes) de certaines espces du genre Lavandula (daprs
Upson, 2002)
Tous les calices sont prsents x 250 sauf pour 3 et 4 qui sont x 160 et pour 9 qui est x 75. 1. L. stoechas subsp.
stoechas, 2. L. angustifolia, 3. dentata var. dentata, 4. L. multifida, 5. L. mairei var. mairei, 6. L. pubescens, 7. L.
subnuda, 8. L. bipinnata, 9. L. hasikensis.


Bractoles et bractes
Les bractoles sont petites, souvent ngligeables. Les bractes sont portes au niveau
des points de ramification, la base de chaque cyme de fleurs. Chez les espces L.
stoechas et L. dentata, des bractes trs dveloppes sont galement prsentes l'apex de
linflorescence (Figure 16). Ces dernires sont allonges, colores, striles et trs
attractives pour les pollinisateurs (Herrera, 1997). Les cymes sont sous-tendues par des
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre I. Revue de Littrature



-6
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

bractes qui varient en taille, forme et nervation selon les taxons et qui peuvent avoir une
valeur taxonomique au sein du genre Lavandula (Figure 19). Dans les sections Dentatae et
Stoechas, les bractes sont trapzodales avec une pointe courte alors quelles sont
triangulaires dans la section Subnudae avec une pointe trs allonge. Les nervures des
bractes sont parallles dans le sous-genre Fabricia alors quelles sont rticules dans les
deux autres sous-genres.























Figure 19 : Exemples illustrant la diversit des formes des bractes de certaines espces du
genre Lavandula (aprs Upson, 2002)
Les bractes sont prsentes x 60 pour 2, x 100 pour 1, 8, 13 et 14, x 160 pour 3, 4, 9, 10, 11 et 12 et x 250 pour
le reste. 1. L. dentata var. dentata, 2. L.viridis (bracte suprieure), 3. L. latifolia, 4. L. multifida, 5. L.
canariensis, 6. L. maroccana, 7. L. coronopifolia, 8. L. mairei var. mairei, 9. L. aristibracteata, 10. L. subnuda,
11. L. somaliensis, 12. L. bipinnata, 13. L. hasikensis, 14. L. atriplicifolia.


Fruits (graines)
Le fruit des Lamiaces est un fruit sec indhiscent de type akne et plus exactement
appel nucule. Certains types dakne peuvent tre facilement identifis et ont une valeur
taxonomique au sein du genre Lavandula au niveau sectionnel. Les aknes des lavandes
sont secs, une seule graine et pricarpe ligneux. La macro- et la micromorphologie des
aknes (Figure 20) sont souvent une source riche de donnes taxonomiques. La forme, la
couleur, le type de la cicatrice dabscission, la prsence ou l'absence des cicatrices latrales
et leurs longueurs, la taille et la production du mucilage ont longtemps t utiliss dans le
genre Lavandula, principalement comme caractres permettant de diffrentier les sections
(Chaytor, 1937). La Microscopie lectronique balayage a t utilise galement pour
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre I. Revue de Littrature



-
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

tudier l'ornementation de surface. Un caractre dintrt prsent sur beaucoup daknes de
lavandes, notamment dans les sections Pterostoechas, Chaetostachys et Subnudae, est
port par les petits corps globuleux blancs qui couvrent la surface de lakne et qui sont
particulirement denses sur la cicatrice.
















Figure 20 : Exemples illustrant la diversit des formes des aknes (nucules) de certaines
espces du genre Lavandula (daprs Upson & Adrews, 2004)
A. L. canariensis subsp. canariensis x30, B. L. bipinnata x8, C. L. atriplicifolia x18, D. L. subnuda x24, E. L.
dhofarensis subsp. dhofarensis x18.5 vu du cot, vu de dessus, x27, F. L. angustifolia subsp. angustifolia x
11, G. L. latifolia x6.5, H. L. dentata var. dentata x13.5, J. L. stoechas subsp. stoechas x18, K. L.viridis
x12.5, L. L. multifida x12, M. L. aristibracteata vu de fin x27, vu de face x14, N. L. mairei var. mairei x16,
P. L. mairei var. antiatlantica x17.5, Q. L. bipinnata x7.5.
A-D. vu de dessus, E. vu de face et de dessus, F-H. vu de face et de ct, J-M. vu de face et de fin. N, P et
Q., nucules sur le disque de nectar illustrant la disposition inverse des lobes du nectar.


I.3.2.1. Section Stoechas Ging. (L. stoechas Sensu Lato)
Les taxons de la section Stoechas reprsentent un groupe distinct de petits arbustes
aromatiques ligneux arborant des feuilles linaires lancoles. Ce groupe comprend
certaines des plus spectaculaires lavandes. Parfois connues sous le nom de lavande
franaise ou espagnole, elles se distinguent par de longues bractes ressemblant des
oreilles de lapin au sommet de linflorescence. Ce sont en fait de grandes bractes florales
colores striles trs attractives pour les abeilles et autres insectes pollinisateurs. Ces
grandes bractes apicales diffrent de celles de L. dentata (section Dentatae), le seul taxon
de lavande portant galement des bractes apicales, en tant compltement striles et en
prsentant une diffrenciation nette entre les bractes fertiles et les bractes striles.
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre I. Revue de Littrature



-8
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

Les taxons de la section Stoechas possdent dautres caractristiques diffrentiantes.
Les lobes de la corolle sont tous similaires en taille. Le tube de la corolle dpasse peine
du calice. Les bractes sont ovales, larges, lgrement obovales, et les stigmates sont
capits. Les aknes brun-rouge sont largement elliptiques ou circulaires, ne portent qu'une
petite cicatrice basale et produisent tous du mucilage. Le nombre de chromosomes dans
tous les taxons tudis est de 2n = 30.
L. stoechas appartient la section Stoechas du sous-genre Lavandula du genre
Lavandula, ainsi que L. pedunculata et L. viridis. Les caractristiques morphologiques de
ces trois espces sont troitement lies les unes aux autres et une personne inexprimente
peut facilement confondre ces espces. Les lavandes de la section Stoechas ont
probablement t les premires tre utilises pour leurs HEs. Les Romains, les Grecs et
les Arabes ont tous reconnu ses proprits mdicinales, antiseptiques et nettoyantes. La
composition de cette section en espces, sous-espces, formes et hybrides est comme suit :
L. stoechas L.
subsp. stoechas
f. leucantha (Ging.) Upson & S. Andrews
f. rosea Maire
subsp. luisieri (Rozeira) Rozeira
L. pedunculata (Mill) Cav.
subsp. pedunculata
subsp. cariensis (Boiss.) Upson & S. Andrews
subsp. atlantica (Braun-Blanq.) Romo
subsp. lusitanica (Chaytor) Franco
subsp. sampaiana (Rozeira) Franco
L. viridis L'Hr.

Hybrides
L. x cadevallii Sennen (L. pedunculata subsp. pedunculata x L. stoechas subsp. stoechas)
L. x alportelensis P. Silva, Fontes & Myre (L. stoecha subsp. luisieri x L. viridis )
L. x limae Rozeira (L. pedunculata subsp. lusitanica x L. viridis )
L. x maderensis Benth. (L. pedunculata subsp. pedunculata x L. viridis )
L. pedunculata subsp. atlantica x L. pedunculata subsp. pedunculata
L. stoechas x L. viridis

Au vue des fortes similitudes entre les taxons de la section Stoechas et des difficults
historiques les diffrentier, nous les considrerons dans ce manuscrit comme L. stoechas
Sensu Lato par opposition au seul taxon L. stoechas actuellement reconnu sous ce nom et
alors dnomm, L. stoechas Sensu Stricto.

I.3.2.1.1. Lespce L. stoechas L.
L. stoechas (syn. Stoechas officinarium Moench) est communment appele lavande
franaise, lavande italienne, lavande espagnole, lavande des stoechades, lavande
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre I. Revue de Littrature



-?
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

maritime, lavande papillon ou lavande toupet. Elle a t historiquement la premire
lavande tre formellement dcrite et elle est aussi la lavande dont le territoire
gographique est le plus vaste. Elle est rpandue dans tout le bassin mditerranen (Europe
mridionale, lAfrique du Nord et le Moyen Orient) avec une petite disjonction sur la
frontire Lybie-Egypte (Figure 21). Actuellement, elle a t introduite et est cultive en
Bretagne, Nouvelle Zlande et en Australie.












Figure 21 : Distribution gographique de L. stoechas (daprs Upson & Andrews,
2004)

L. stoechas (Figure 22) se prsente sous la forme dun arbrisseau ou dun buisson trs
aromatique et trs ramifi pouvant atteindre un mtre de haut avec une lourde odeur
semblable celle du pin. Les feuilles opposes de 2-4 cm de long sont sessiles,
tomenteuses, oblongues, lancoles, linaires, troites et recourbes sur les bords et sont
souvent grises. Les inflorescences de coupe carre sont sessiles, compactes et surmontes
dune couronne de bractes florales violettes, largies, striles, obovales ou spatules de 1
2 cm de longueur. Les bractes fertiles sont largement ovales obovales-subtrilobes,
brivement acumines, membraneuses, veines et plus courtes que le calice. Le Calice est
sessile, treize nervures avec des lobes moyens modifis en un appendice. La Corolle est
de couleur violet fonce ou mauve. Les varits blanches sont nommes forme leucantha
Ging. et les varits de fleurs rose-rouge ou rose sont appeles forme rosea Maire. Les
fruits sont sans intrt conomique comme tous ceux de la famille. Ils permettent
cependant la production de graines. Les taxons de la section Stoechas s'hybrident
facilement pour donner de nombreux taxons variant. Contrairement beaucoup dautres
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre I. Revue de Littrature



6u
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

lavandes, cette lavande prfre les sols siliceux et les terrains acides. Elle supporte la mi-
ombre et tolre le froid jusqu -5C. La floraison, plus prcoce que chez les autres
lavandes, se droule davril mai puis en automne.

























Figure 22 : Lavandula stoechas, tige fleurie x 1 et cyme agrandie x 4 (daprs Upson &
Andrews, 2004)


L. stoechas est une espce vgtale bien connue et utilise travers toute la rgion
mditerranenne pour ses vertus mdicinales principalement attribus sa teneur en HE.
Elle tait utilise par les mdecins musulmans qui la considraient comme cphalique
(tonique), rsolvante, dsobstruante, et carminative. Ils la prescrivent pour lutter contre des
infections pulmonaires et pour lexpulsion des humeurs bilieuses et flegmatiques (Said,
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre I. Revue de Littrature



61
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

1996). En Crte, l'HE et l'infusion des feuilles sont utilises par des thrapeutes
traditionnels comme spasmolytiques, contre le diabte, les douleurs menstruelles
fminines, les calculs rnaux, lanthrax, l'otite, l'hypertension et la matire vgtale brute
est galement utilise comme insectifuge (Skoula et al., 1996). La plante est galement
utilise dans la mdecine populaire comme antispasmodique dans les douleurs des coliques
(Usmanghani et al., 1997 ; Nadkarni, 1982), expectorant, stimulant, (Giray et al., 2008) et
pour les diffrentes maladies du systme nerveux central, comme l'pilepsie et la migraine.
Elle est appele le balai du cerveau (Nadkarni, 1982). Elle est dailleurs utilise sous
forme de fumigation pour soigner "le mal des sinus" (Simonpoli et al., 1993). Cette
lavande a aussi des effets positifs sur les plaies, les infections urinaires, les maladies
cardiaques et l'eczma (Baytop, 1999). Finalement, elle possde galement des vertus
analgsiques, sdatives, antiseptiques (Baytop, 1999) et antimicrobiennes (Asimgil, 1997).
La composition chimique de lHE de L. stoechas a t largement tudie sur une
grande partie de son aire de rpartition dj trs large (voir section HE des lavandes ci-
dessous). LHE est obtenue par entrainement la vapeur deau ou par hydrodistillation des
inflorescences ou de lensemble des parties ariennes de la plante. Des vertus
antiseptiques, antiinflammatoires, cicatrisantes et antivirales lui sont gnralement
attribues (Baldovini et al., 1998). L'HE obtenue partir des sommits fleuries a t
utilise comme remde contre les affections coliques et pulmonaires, pour soulager les
maux nerveux de tte, les affections hpatiques et pour le nettoyage des plaies (Glin et
al., 2004). Bien que L. stoechas ft la premire lavande tre utilise en parfumerie, son
HE est aujourdhui dlaisse en raison de son odeur fortement camphre et de la
concurrence importante des autres lavandes qui se pretent mieux la culture intensive et
dont lodeur est plus agrable. La forte teneur en camphre gnralement observe limite
ses applications en cosmtologie.
En Algrie, L. stoechas est trs connue sous le nom local "Helhal" et est largement
distribue travers toute la priphrie nord du pays. Dans la mdecine populaire
algrienne, les parties ariennes, surtout les inflorescences, sont utilises comme un agent
antiseptique et stimulant (Mahmoudi, 1982). Dans la cuisine, elles sont galement utilises
comme herbe culinaire pour prparer un type particulier de couscous.
En France, elle est commune dans le Prigord, la Dordogne, sur le littoral
mditerranen et en Corse. Seule la sous-espce stoechas est prsente (Gamisans &
Jeanmonod, 1993).


t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre I. Revue de Littrature



62
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

I.3.2.1.2. Lespce L. pedunculata (Mill) Cav.
Du fait des fortes ressemblances morphologiques entre L. stoechas et L. pedunculata,
ces deux taxons ont t autrefois considrs comme une mme espce. L. pedunculata a t
lev au rang despce par Miller en 1768 sous le patronyme Stoechas pedunculata puis
par le botaniste espagnol Cavanilles en 1802 sous son patronyme actuel, L. pedunculata.
La rpartition gographique de ses sous-espces est intrigante (Figure 23). La subsp.
pedunculata est localise en Espagne et au nord-est du Portugal, la subsp. lusitanica et la
subsp. sampaiana sont localises dans le sud-ouest de l'Espagne et du Portugal, la subsp.
atlantica au Maroc et la subsp. cariensis en Turquie.
Les pdoncules longs et glabres des inflorescences font de L. pedunculata une lavande
trs attractive et distincte de L. stoechas. L'pithte "pedunculata", fait rfrence aux longs
pdoncules. La forme de la corolle permet galement de distinguer L. stoechas de L.
pedunculata. L. stoechas possde des ptales de taille gale alors que ceux de L.
pedunculata et de ses sous-espces sont de tailles diffrentes (Figure 24). La forme des
bractes fertiles diffre galement. Les sommets de ceux de L. pedunculata sont arrondis
ou sont parfois apiculs au moins sur la partie infrieure de la hampe florale, tandis que
ceux de L. stoechas ont un apex aigu distinct.
L. Pedunculata tolre des froids allant jusqu -10C. Elle pousse 700-1500 m
daltitude sur sols acides lgrement calcaires. Au Portugal, elle est trs populaire en
mdecine traditionnelle, lors de crmonies religieuses, ainsi qu des fins mellifres et
ornementales (Zuzarte et al., 2010). Une tude rcente a montr que les HEs ont une
importante activit antifongique, en particulier le chmotype haute teneur en 1,8-cinol et
camphre (Zuzarte et al., 2009).

















Figure 23 : Distribution gographique de L. pedunculata (daprs Upson & Andrews,
2004)
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre I. Revue de Littrature



6J
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e
























Figure 24 : Lavandula pedunculata, tige fleurie x 1 et cyme agrandie x 4 (daprs
Upson & Andrews, 2004)


Sous-espce L. pedunculata subsp. lusitanica (Chaytor) Franco
L. pedunculata subsp lusitanica est originaire de lIbrie occidentale, dans le sud du
Portugal et le sud-ouest de l'Espagne. Elle est commune sur les sols sablonneux dans les
zones ctires, mais se trouve aussi l'intrieur des terres. L'pithte lusitanica drive de
Lusitania, l'ancien nom de la partie ouest de la pninsule ibrique. Elle est souvent
nomme la lavande espagnole feuilles troites. Cest un arbuste ayant des tiges dresses
ou ascendantes 50 cm. Les feuilles sont troitement elliptiques et gris-vertes. Les
inflorescences sont compactes, subcylindriques ovales. Les bractes fertiles sont larges,
rotondes, rniformes, parfois obovales apex obtus, ou apicules ptioles et
distinctement obovales forme de losange au sommet. La priode de la floraison se situe
de mars mai (juin) l'tat sauvage.
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre I. Revue de Littrature



64
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

La pubescence longue et laineuse des calices et des bractes fertiles, la distingue
immdiatement de la subsp. pedunculata qui se caractrise par des poils courts et ramifis.
Linflorescence est gnralement courte et subcylindrique ovale (seulement 2-3 x plus
long que large). Ceci permet de la distinguer de la subsp. sampaiana qui a des
inflorescences longues. Les bractes apicales de la subsp. lusitanica sont galement
diffrentiantes car elles sont bleu-violtes tandis quelles sont violet-pourpre chez la subsp.
sampaiana.

I.3.2.1.3. Lespce L. viridis L'Hr.
L. viridis, communment appele lavande verte ou lavande blanche se caractrise
par dtonnantes fleurs blanches qui rendent cette lavande nettement diffrente. La couleur
blanche des fleurs fait partie d'un syndrome gnralement associ aux insectes
pollinisateurs volant la nuit comme les papillons de nuit mme si cela na jamais t
dmontr pour cette espce. Les fleurs blanches fanent pour rapidement prendre une teinte
brune.
Cest une espce endmique du sud-ouest de l'Espagne et du sud du Portugal. Elle vit
dans un maquis ouvert assez basse altitude et Madre (Figure 25). Cette espce pousse
dans des conditions sches sur les sols pauvres, acides et dgrads de l'Algarve et
l'Alentejo (Amaral Franco, 1983). Elle est intermdiaire, dun point de vue anatomique,
entre L. stoechas et L. pedunculata. Elle forme typiquement un petit arbuste, de 60-80 cm
de hauteur, avec des pis floraux robustes brivement ptiols portant des bractes vertes
striles au sommet (Figure 26). Les feuilles sont largement linaires, lancoles, trs vertes
avec une haute densit glandulaire qui lui confre une sensation collante et une forte odeur
citronne. Linflorescence mesure jusqu' 8 cm de long. Les bractes striles sont
largement ovales, assez courtes et longues de 2-3 cm. Les bractes fertiles sont obovales
largement ovales et de couleur vert-blanche. La floraison a lieu au printemps et en
automne. Les aknes circulaires sont plus larges que ceux des autres espces, constituant
un caractre spcifique de lespce. Cette espce de lavande supporte la mi-ombre et elle
ne tolre le gel que jusqu -5C. Elle est cultive comme plante ornementale. Tout, ou
partie de la plante peut tre utilis comme herbe culinaire (Kourikn, 1998) et les feuilles
sches sont utilises des fins mdicinales Madre.



t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre I. Revue de Littrature



6-
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e
















Figure 25 : Distribution gographique de L. viridis dans la Pninsule Ibrienne
(daprs Upson & Andrews, 2004)

























Figure 26 : Lavandula viridis, tige fleurie x 1 et cyme agrandie x 4 (daprs Upson &
Andrews, 2004)
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre I. Revue de Littrature



66
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

I.3.3. Rpartition gographique
En gnral, les lavandes poussent et s'panouissent mieux dans des terrains secs, bien
drains, lgers, sablonneux et pierreux en plein soleil (Grieve, 1971). Les lavandes
poussent surtout sur des sols calcaires l'exception des espces des sections Stoechas et
Dentatae qui prfrent les sols siliceux. Toutes les espces de lavande ont besoin de peu,
voire pas d'engrais, et dune bonne circulation d'air dans les zones de forte humidit.
Lexcs dhumidit est leur pire ennemi.
Le genre Lavandula appartient l'ancien monde, avec une aire de rpartition naturelle
qui s'tend de la Macaronsie (les du Cap Vert, Canaries et Madre) travers l'Afrique du
Nord et tropicale, lEurope Mditerranenne, le moyen orient, la pninsule Arabique, l'Iran
occidental jusquau Sud-est de l'Inde (Figure 27) (Lis-Balchin, 2002). Les 39 espces du
genre Lavandula sont donc rparties sur trois continents, lAfrique, lEurope et lAsie.
Parce que des formes cultives ont t plantes dans des jardins du monde entier, plusieurs
espces se rencontrent l'tat sauvage bien au-del de leur aire naturelle de rpartition. Ce
sont des chappes de culture. Comme plusieurs espces sont sympatriques et peuvent
gnrer des hybrides fertiles, il est possible que la grande diversit des espces de certaines
espces de lavande soit issue dhybridations inter-spcifiques.





















Figure 27 : Schmatisation de laire de rpartition des sections du genre Lavandula (daprs
Guitton, 2011)
Les pays sont de la couleur de la section majoritairement prsente. Pour certaines sections dont la rpartition est
plus restreinte, une zone de couleur indique les principales zones de prsence. Jaune : Section Pterostoechas, Bleu
fonc : Sections Lavandula et Stoechas, Noire : Section Chaetostachys, Bleu claire : Section Subnudae. Vert :
Section Dentatae, Rouge : Section Sabaudia et Orange : Section Hasikenses.
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre I. Revue de Littrature



6
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

La palogographie suggre des liens possibles entre lensemble des zones de laire de
rpartition actuelle du genre Lavandula (Meulenkamp & Sissingh, 2003). Davis et Hedge
(1971) remarquent que le genre Lavandula est un exemple de lien floristique entre le sud-
ouest de lAsie et le nord-ouest de lAfrique au mme titre que les genres Helianthemum,
Cuminum et Salvia. Actuellement, le plus grand nombre despces de lavandes (44 %) est
dans la zone ouest de laire de rpartition et reprsente certainement une diversification
plus rcente.
La distribution actuelle des lavandes est probablement en lien avec les changements
climatiques et/ou la tectonique des plaques, mais ceci nexplique pas la prsence de
lavandes sur les les volcaniques de locan atlantique qui nont jamais t en relation avec
le continent. Les lavandes ont donc colonis ces les via une dispersion longue distance
probablement par des pinsons ou dautres espces doiseaux granivores (Upson &
Andrews, 2004) ou par le transport des graines facilit par les Alizs ou les forts courants
marins (Juan et al., 2000).
En Algrie, ce genre est reprsent par sept espces spontanes, L. stoechas, L.
multifida, L. coronopifolia, L. pubescens, L. dentata, et les plus rcemment dcrites L.
antineae et L. sahariensis (Quezel & Santa, 1963 ; Upson & Andrews, 2004). Certaines
sont rares et dissmines en haute montagne ou cantonnes dans le grand Sahara. D'autres
sont au contraire particulirement abondantes et rpandues sur de grandes tendues. L.
stoechas est la seule de ces espces qui pousse galement en France ltat sauvage.

I.3.4. Intrt commercial, nutritionnel et pharmacologique
La plupart des espces du genre Lavandula sont trs odorantes. Certaines sont mme
cultives pour leurs HEs qui sont extraites par distillation la vapeur partir de tissus
floraux ou foliaires. Commercialement, plus de 462 tonnes dHEs sont produites
annuellement partir d'espces du genre Lavandula (Morhy et al., 1970 ; Lawrence, 1992).
La popularit persistante et la valeur commerciale de la lavande a t confirme quand elle
a t nomme "lherbe de l'anne 1999" par le rseau de la culture et la commercialisation
dherbes mdicinales, aromatiques et parfum aux Etats-Unis d'Amrique (Evelegh,
1996). Leurs HEs sont de haut intrt conomique dans les industries des parfums, des
cosmtiques, des armes agro-alimentaires, pharmaceutiques et de nos jours galement
dans l'aromathrapie (Boelens, 1995 ; Lis-Balchin, 2002 ; Upson & Andrews, 2004). Les
proprits mdicinales et parfumantes des HEs de lavande sont essentiellement attribues
aux terpnodes volatils quelles contiennent. Ce sont les monoterpnes et les
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre I. Revue de Littrature



68
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

sesquiterpnes qui donnent en effet aux HEs des lavandes leurs parfums et proprits
caractristiques (Flores et al., 2005). La proportion des principaux terpnes dans lHE est
un critre dvaluation de la qualit de lHE (AFNOR, 1996). Les teneurs relatives de ces
substances jouent un rle important dans le choix de telle ou telle varit par lherboriste
ou lindustriel (Grayer et al., 1996). Les espces les plus couramment utilises, et ayant
une valeur industrielle et mdicinale, sont L. angustifolia, L. latifolia, L. stoechas, L. x
intermedia, L. dentata, L. dhofarensis, L. fragrans et L. multifida (Gmez et al., 1987 ;
Cavanagh & Wilkinson, 2002 ; Upson & Andrews, 2004). La plus couramment cultive est
la lavande vraie ou anglaise, L. angustifolia. Une large gamme de cultivars a t
dveloppe (Grieve, 1971). Les lavandins, L. x intermedia (L. angustifolia x L. latifolia)
sont galement trs cultivs des fins commerciales, car leurs inflorescences ont tendance
tre plus grandes que celles de la lavande anglaise et les plantes ont tendance tre plus
faciles cultiver et rcolter, mais lHE de lavandin est cependant considre comme ayant
une qualit infrieure celle de la lavande anglaise, avec un parfum moins doux (Lis-
Balchin, 2002). Aujourdhui, des multi-tonnes de quantits de lavande, lavandin et lavande
aspic sont produites en France, Bulgarie, Chine, Espagne, Russie, Ukraine, Moldova, lex
Yougoslavie, Australie, Argentine et Bretagne (Upson & Andrews, 2004). En 2009, les
surfaces cultives en France taient de prs de 15 000 ha pour le lavandin et 4000 ha pour
la lavande. En Algrie, un moment donn, des quantits limites des HEs de lavandes ont
t produites. Selon Peyton (1983) la production tait d'environ 10 tonnes pendant le dbut
des annes 1980. L. stoechas, est de moindre importance comme source dHEs, mais, avec
ses hybrides, cette espce est de plus en plus populaire en tant que plante ornementale
(Upson & Andrews, 2004). Des quantits limites (moins de 1 tonne) de L. stoechas sont
produites en Espagne partir de plantes sauvages. LHE, qui est riche en fenchone, est
principalement utilise en aromathrapie (Upson & Andrews, 2004). La majorit des
travaux de dveloppement varital et de recherche sur la composition et la biosynthse des
HEs de lavandes ont t conduits sur la lavande vraie et le lavandin (Cavanagh &
Wilkinson, 2002).
Les lavandes sont parmi les plantes mdicinales les plus utilises. Des preuves
documentes de l'utilisation des lavandes comme agent thrapeutique remontent jusqu'aux
anciens Romains, Grecs et Arabes (Evelegh, 1996). Les lavandes taient utilises par les
Romains pour conserver le linge et parfumer les bains. Les diffrentes lavandes ont
certains usages en mdecine traditionnelle et certains constituants chimiques similaires.
Cependant, il y a quelques diffrences dans les usages thrapeutiques rapports pour les
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre I. Revue de Littrature



6?
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

diffrentes espces. Par exemple, la plupart des lavandes semblent avoir des actions
carminatives mais L. stoechas est traditionnellement utilise contre les maux de tte, L.
latifolia comme abortive et L. angustifolia comme diurtique. (Agricultural Research
Service, 2000). Par ailleurs, les infusions des parties ariennes d'un certain nombre
d'espces de lavande sont utilises comme antiseptiques ou pour des actions carminatives,
sdatives, spasmolytiques, antidouleurs ainsi que comme des agents de cicatrisation
(Gamez et al., 1990 ; Buchbauer, et al., 1991 ; Schulz, 2005). Certaines espces ont un
effet acaricide (Lis-Balchin, 2002). Les Lavandes ont une faible toxicit et des HEs non-
dilues peuvent tre utilises pour traiter certaines brlures et avoir des effets bnfiques
sur la cicatrisation. Cependant, des cas de dermatite allergique aprs contact direct avec la
peau ont t rapports (Lis-Balchin, 2002)
On peut faire infuser des fleurs de lavande dans du lait et lutiliser ensuite pour la
prparation de glaces ou de crmes la lavande. Les brins sont aussi utiliss dans les
valles, notamment celle de l'esteron, prs de Nice, pour confectionner une liqueur
particulirement forte en bouche, et aux vertus antiseptiques, digestives et calmantes. Dans
lindustrie agro-alimentaire, les HEs de lavande sont employes dans les boissons
aromatiques, les crmes glaces, les bonbons, les ptisseries, et les gommes mcher (Kim
& Lee, 2002).
Rcemment, l'aromathrapie est devenue de plus en plus populaire. La lavande y est
utilise comme relaxant (Ghelardini et al., 1999 ; Lis-Balchin & Hart, 1999). Les
aromathrapeutes considrent l'HE de L. angustifolia comme la plus bnfique, avec des
cultivars sauvages cultivs haute altitude. La preuve scientifique est encore manquante
pour un possible effet de dtente gnrale aprs une inhalation (Lis-Balchin, 2002).
Les espces du genre Lavandula sont aussi des plantes mellifres qui gnrent des
miels de couleurs et odeurs propres chaque espce. Les fleurs de la lavande fine (L.
angustifolia), la lavande aspic (L. latifolia), le lavandin (L. x intermedia) et la lavande
stchas (L. stoechas) constituent des sources majeures de nectar pour les abeilles (Guyot-
Declerck, 2002). De nombreuses plantes de lavande sont galement vendues comme
plantes ornementales pour les jardins populaires dont L. latifolia, L. pinnata, L. lanata, L.
multifida, L. dentata L. stoechas et L. pedunculata avec leurs nombreux cultivars (Grieve,
1971 ; Lis-Balchin, 2002). Enfin, il a t mentionn que certaines lavandes sont aussi utiles
dans l'agriculture biologique comme bioinsecticides. Elles constituent des cultures de choix
dans les terres arides (Gonzlez-Coloma et al., 2006).

t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre I. Revue de Littrature



u
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

I.3.5. Phytochimie
I.3.5.1. Huiles essentielles
Toutes les espces et les hybrides du genre Lavandula sont des plantes trs
aromatiques qui produisent des mlanges complexes d'HEs produites et stockes dans des
glandes sur la surface des fleurs et des feuilles (Lis-Balchin, 2002). Les HEs de ces espces
sont parmi les 20 HE les plus importes par les Etats-Unis depuis 1985 (Boelens, 1995 ;
Weiss, 1997). Il n'est donc pas surprenant que les connaissances phytochimiques sur les
lavandes soient centres sur leurs HEs.

I.3.5.1.1. Variation inter-spcifique
Les tudes sur la composition chimique des HEs des espces du genre Lavandula
montrent quelles sont plus riches en monoterpnes quen sesquiterpnes et que ces deux
groupes de molcules constituent la majeure partie des HEs. Parmi les 39 espces de
lavande connues, seulement 13 espces ont fait lobjet danalyses de la composition
chimique de lHE (Tableau 3). Les Etudes des constituants volatils des espces de lavande
ont rvl la prsence de plus de 200 constituants chimiques, beaucoup d'entre eux tant
prsents sous forme de trace. Certaines espces telles que L. stoechas synthtisent plus de
100 terpnes diffrents alors que dautres espces telle que L. canariensis expriment une
diversit terpnique beaucoup plus faible. L. stoechas a t plus particulirement tudie
du fait de son aire de rpartition large et de son utilisation traditionnelle trs ancienne.
Globalement, les espces du sous-genre Lavandula sont les plus tudies cause de
lintrt commercial de leurs HEs. En ce qui concerne les sous-genres Fabricia et
Sabaudia, seules les compositions des HEs de L. multifida, L. canariensis, L. pinnata, L.
coronopifolia et L. bipinnata ont t rapportes dans la littrature (Tableau 3) et ce bien
que certaines espces des sous-genres Fabricia et Sabaudia dont la composition de lHEs
est inconnue soient utilises depuis longtemps en mdecine traditionnelle (El-Hilaly et al.,
2003 ; Upson & Andrews, 2004).

I.3.5.1.2. Variation intra-spcifique
La composition chimique des HEs de diffrentes espces, hybrides et cultivars de
lavande montrent non-seulement des diffrences interspcifiques, mais aussi des
diffrences intra-spcifiques o diffrentes populations expriment des chmotypes
diffrents. Par exemple, L. stoechas a t tudie dans diffrents pays mditerranens
(Crte, Espagne, Corse, Chypre, Grce, Turquie, Maroc, Algrie et Tunisie) avec des
rsultats variables (Tableau 3) (Kokkalou, 1988 ; Garcia-Vallejo 1992 ; Valentini et al.,
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre I. Revue de Littrature



1
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

1993 ; Skoula et al., 1996 ; Baldovini et al., 1998 ; Gren et al., 2002 ; Zrira & Benjilali,
2003 ; Bouzouita et al., 2005 ; Dob et al., 2006a). En 1992, une importante tude mene
par Garca-Vallejo a montr une variation chez certaines espces de lavandes sauvages de
diffrentes rgions de l'Espagne. Ainsi, des variations intra-spcifiques chez L. dentata
rcoltes dans diffrents endroits en Algrie (Bousmaha et al., 2006) et chez L. multifida
de diffrents sites du Maroc (Bellakhdar et al., 1985) ont t rapportes (Tableau 3). Ces
variations sont soit qualitatives (composs diffrents) soit quantitatives (proportions
diffrentes de certains composs). En plus, ces variations sont gnralement dordre
individuel ou dordre populationnel. Ces variations peuvent parfois tre dues des
diffrences climatiques, gographiques ou saisonnires ou simplement la quantit
d'arrosage ou la fertilisation utilise. Elles peuvent galement avoir une origine gntique,
ce qui est observ quand des plantes dorigines gographiques diffrentes sont cultives
proximit lune de lautre. Finalement, ces variations peuvent tre galement attribues
aux mthodes d'extraction des HEs et dans le cas des HEs commerciales, au degr de
mlange et de falsification.
Les composs terpniques sont caractristiques des espces de lavande et constituent
des marqueurs chmotaxonomiques utiles pour distinguer des espces et mme des sous-
espces. Par exemple, L. stoechas subsp. luisieri est le seul taxon de lavande produisant les
monotepnes irrguliers, le cis- et le trans--ncrodol et lactate de trans--ncrodol
(Garcia-Vallejo et al., 1994 ; Lavoine-Hanneguelle & Casabianca, 2004 ; Sanz et al.,
2004 ; Baldovini et al., 2005 ). Ces monotepnes nont, t dtects que chez certains
insectes (Millar et al., 2005). Dans le genre Lavandula, aucune tude na encore mis en
parallle des variations chmotypiques avec des variations gntiques. Ainsi, bien que des
tudes sur la variabilit gntique des populations de L. stoechas, L. multifida (Chograni et
al., 2008), L. angustifolia (Segur-Fantino et al., 1988) et L. latifolia (Herrera & Bazaga,
2007) existent, elles nont pas dcrites la composition terpnique des HEs des plantes
tudies.









t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre I. Revue de Littrature



2
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

Tableau 3 : Variations inter-spcifiques et intra-spcifiques des principaux constituants des HEs des
espces du genre Lavandula dans la littrature

Sous-
genre
Section Espce Origine Organe Principaux constituants (%) Rfrences
L
a
v
a
n
d
u
l
a

L
a
v
a
n
d
u
l
a

L. angustifolia Australie - linalol (8-41)
actate de linalyle (6-20)
terpinne-4-ol (4-12)
An et al. (2001)
Core Feuilles
et fleurs
linalol (18-43)
actate de linalyle (2-35)
Kim & Lee (2002)
Isfahane
(Iran)
Feuilles 1,8-cinol (65.4)
bornol (11.5)
camphre (9.5)
Hajhashemi et al.
(2003)
Tegrane
(Iran)
Partie
arienne
fleurie
linalol (32-35)
actate de linalyle (13-14)
actate de lavandulyle (10-15)
Fakhari et al.
(2005)
Xinjiang
(China)
- linalol (44.54)
graniol (11.02)
actate de lavandulyle (10.78)
Cong et al. (2008)
Lituanie - actate de linalyle (26.5)
linalol (20.9)
Venskutonis et al.
(1997)
Australie - actate de linalyle (40-41)
linalol (29-36)
Moon et al. (2007)
L .lanata Mainz
(Allemagne)
- camphre (50.4)
1,8-cinol (36)
Yassaa & Williams
(2005)
Comunidad
Valenciana
(Espagne)
Feuilles 1,8-cinol (20-54)
camphre (11-43)
linalol (0-54)
Munoz-Bertomeu et
al. (2007)
Jan province
(Espagne)
Fleurs linalo (27-41)
1,8-cinol (28-34)
camphre (10-23)
Salido et al.
(2004b)
D
e
n
t
a
t
a
e

L. dentata - Culture
in vitro
1,8-cinol (25.6)
fenchol (18.5)
camphre (15.2)
bornol (13.2)
Sudri et al. (1999)
Cherchel
(Algrie)
Partie
arienne
fleurie
1,8-cineole (38.4)
cis-verbenol (4.3)
Dob et al. (2006b)
Beni-Saf
(Algrie)
Fleurs,
feuilles et
tiges
-pinene (6-26)
1,8-cinol (0.9-36)
trans-pinocrvol (3-9)
Bousmaha et al.
(2006)
Talazart
(Maroc)
Partie
arienne
1,8-cinol (41.28)
sabinene (13.89)
Imelouane et al.
(2009)
S
t
o
e
c
h
a
s

L. stoechas Corse
(France)
- fenchone (14-75)
camphre (2-56)
1,8-cinol (3-14)
actate de myrtnyle (1-4)
Ristorcelli et al.
(1998)
Crte Feuilles
et fleurs
fenchone (44-48)
1,8-cinol (5-16)
camphre (4-6)
actate de myrtnyle (2-9)
Skoula et al. (1996)
Cherchel
(Algrie)
Feuilles
et fleurs
fenchone (31)
camphre (22)
p-cymne (6)
Dob et al. (2006a)
Cagliari
(Italie)
Fleurs,
feuilles et
tiges
fenchone (59-72)
camphre (9-15)
actate de myrtnyle (3-5)
Angioni et al.
(2006)
Australie - camphre (48)
fenchone (21)
1,8-cinol (9)
Moon et al. (2007)
Kairouane
(Tunisie)
Feuilles fenchone (68.2)
camphre (11.2)
1,8-cinol + limonne (4.9)
Bouzouita et al.
(2005)
Suite du tableau la page suivante
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre I. Revue de Littrature



J
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

Tableau 3 : (Suite)
Sous-
genre
Section Espce Origine Organe Principaux constituants (%) Rfrences
L
a
v
a
n
d
u
l
a

S
t
o
e
c
h
a
s

L. stoechas
ssp. atlantica
Rabat
(Maroc)
Partie
arienne
fleurie
camphre (39.2)
fenchone (9.2)
camphne (6.7)
-pinne (6.5)
Zrira & Benjilali
(2003)
L. stoechas
ssp. stoechas
Rabat
(Maroc)
Partie
arienne
fleurie
fenchone (30.5)
camphre (18.2)
1,8-cinol (8.6)
Chypre Partie
arienne
fleurie
fenchone (28-51)
camphre (4-39)
Valentini et al.
(1993)
L. stoechas
ssp.luisieri
Seville
(Espagne)
Partie
arienne
fleurie
actate -necrodyle (17-27)
1,8-cinol (6-16)
actate de lavandulyle (4-5)
Lavoine-
Hanneguelle &
Casabianca (2004)
Toledo et
Seville
(Espagne)
Feuilles
et fleurs
camphre (1-53)
5-Methylene-2,3,4,4-
tetramethylcyclopent-
2-enone (5-38)
fenchone (1-22)
1,8-cinol (0.4-20)
Gonzlez-Coloma,
et al. (2006)
L. pedunculata Portugal Partie
arienne
fleurie
fenchone (6-44)
camphre (8-34)
1,8-cinol (5-34)
Zuzarte et al.
(2009)
L. viridis - Culture
in vitro
1,8-cinol (18-25)
camphre (9-15)
-pinne (8-14)
Nogueira &
Romano (2002)
Barranco do
Velho et Salir
(Portugal)
Partie
arienne
fleurie
1,8-cineole (34- 42)
camphor (13)
-pinne (9)
linalol (7-6)
Zuzarte et al.
(2011)
F
a
b
r
i
c
i
a

P
t
e
r
o
s
t
o
e
c
h
a
s

L. multifida Tunisie Partie
arienne
fleurie
carvacrol (31.81)
-bisabolene (14.89)
acrylic acid dodecyl ester
(11.43)
Chograni et al.
(2010)
L. canariensis Sydney
(Australie)
Partie
arienne
carvacrol (23.6)
-bisabolene (20.8)
(E,E)--farnesene (11.3)
Pala-Paul et al.
(2004)
L. pinnata Madre
(Portugal)
Fleurs,
feuilles et
tiges
-Phellandrene (12-32)
-phellandrene (6-l6)
-caryophyllene (11)
Figueiredo et al.
(1995)
L. coronopifolia Ammane
(Jordanie)
Feuilles
et fleurs
linalol (20-41)
1,8-cinol (7-25)
camphre (11-19)
terpinne-4-ol (10-11)
Aburjai et al.
(2005)
C
h
a
e
t
o
s
t
a
c
h
y
s

L. bipinnata Dharwad
(Inde)
Feuilles trans-carvol (18.93)
menthol (8.89)
pulgone (8.45)
camphre (7.09)
(Hanamanthagouda
et al. (2009)








t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre I. Revue de Littrature



4
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

I.3.5.2. Flavonodes
Parmi les nombreux composs chimiques connus chez les lamiaces, les flavonodes
se sont rvls avoir une valeur taxonomique particulire aussi bien au sein du genre que
de la famille des Lamiaces (Ferreres et al., 1986 ; Tomas-Barberan et al., 1988 ; Xavier &
Andary, 1988 ; El-Garf et al., 1999). La premire tude exhaustive sur les flavonodes des
feuilles de lavande a t entreprise par Upson et al. (2000). Cette tude a montr que
l'accumulation de certains flavonodes soutenait sur le regroupement infra-spcifique et les
liens lintrieur du genre. Les glycosides de flavone 8-O-hydroxyls, rares dans la famille
Lamiaces et dans la sous-famille des Nepetoideae, ont t trouvs uniquement dans le
genre Lavandula (El-Garf et al., 1999). Ils sont exclusifs des sections du sous-genre
Fabricia et du sous-genre Sabaudia. La prsence de certains flavonodes a apport un
soutien fort lexistence de trois sous-genres.
Les principaux constituants des flavonodes des feuilles des espces Lavandula sont
des flavone glycosides. Six sous-classes diffrentes sont reprsentes (Tableau 4). Ce sont
des flavones glycosides simples, les flavones C-glycosides, les 6-hydroxyflavone 7-
glycosides et les 8-hydroxyflavone 7- et 8-glycosides. Leur rpartition entre les taxons
montre une certaine valeur taxonomique. Ce profil flavonodique complexe est typique des
membres de la famille des Lamiaceae avec notamment la prsence frquente de flavones
avec hydroxylation supplmentaire aux positions 6- et 8-.

Tableau 4 : Distribution de diffrentes classes de flavonodes dans le genre Lavandula (daprs
Upson & Andrews 2004)
Section
flavone
7-O-
monoglycosides
flavone
di-O-
glycosides
6-hydroxy-
flavone 7-O-
glycosides
flavone
C-
glycosides
8-hydroxy-
flavone 8-O-
glycosides
8-hydroxy-
flavone 7-O-
glycosides
Lavandula + - - + - -
Dentata + - + + - -
Stoechas + + - - - -
Pterostoechas - - - - + +
Subnudae - - - - + +
Chaetostachys - - - - + +
Sabaudia + - - - - +


I.3.6. Les gnes de TPSs de Lavandes
Trs peu de donnes molculaires existent pour les lavandes. Seulement 6 TPSs ont
t clones et caractrises chez les lavandes. En utilisant la stratgie de PCR base sur des
homologies de squence avec les TPSs dautres espces vgtales, deux monoTPSs, la
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre I. Revue de Littrature



-
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

limonne synthase (LaLIMs) et la linalol synthase (LaLINS) et une sesquiTPS, la
bergamotne synthase (LaBERS) ont t clones depuis les feuilles et les fleurs de L.
angustifolia (Landmann et al., 2007, accessions GeneBank DQ263740, DQ263741 et
DQ263742, respectivement). En plus, une squence non-publie de linalol synthase
(accession GeneBank ABD77417.1) a t clone chez L. latifolia et dpose dans
GenBank. Trs rcemment, et toujours partir des fleurs de L. angustifolia, une -
phllandrne synthase, LaPHLS, et une TPS inactive, LaTPS-I dpourvue du motif
"DDxxD" essentiel la catalyse ont t clones (Demissie et al., 2011). Toutes ces TPSs
sont capables de synthtiser plusieurs terpnes lexception de la LaLINS qui ne fait que
du linalol. LaLINS et LaLIMS nacceptent que le GPP comme substrat alors que LaBERS
accepte le GPP et le FPP et LaPHLS accepte le GPP et le NPP. On retrouve un lien
volutif possible entre LaLIMS et LaBERS par perte du peptide dadressage
chloroplastique prsent sur la partie N-terminale et par largissement du nombre de
substrats possibles (Landmann et al., 2007). En plus, Lane et al. (2010) ont construit une
banque d'ADNc de 14213 squences exprimes dans les feuilles et fleurs de L.
angustifolia. Bas sur l'homologie avec des squences prsentes dans GenBank, cette
collection dADNc contient des orthologues de gnes impliqus dans les voies de
biosynthse des terpnodes, MEP et MVA ainsi que 25 squences de gnes de TPSs
potentielles et 4 squences de prnyl transfrases potentielles. Juste avant de dposer cette
thse, Demissie et al. (2012) ont clon et caractris une 1,8-cinol synthase (LiCINS)
chez L. x intermedia ainsi que ces orthologues chez L. angustifolia et L. latifolia.

I.4. LES OBJECTIFS DE LA THESE
Les herbes aromatiques ont une longue histoire dusage en mdecine traditionnelle.
Les terpnodes sont des produits importants, non-seulement en raison de leur importance
cologique, mais aussi du fait de leur importance conomique dans les industries
cosmtique, agroalimentaire, pharmaceutique et aromathrapeutique sous forme dHEs.
Les plantes HE montrent habituellement une composition chimique variable pour des
raisons la fois gntiques et environnementales (Figueiredo et al., 1997). Cette variabilit
qui affecte la qualit et les proportions des constituants affecte par voie de consquence
lactivit biologique des HEs. Par consquent, lingnierie mtabolique ayant pour but
daugmenter la teneur des composs dsirs a reu une attention particulire ces dernires
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre I. Revue de Littrature



6
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

annes (Ye et al., 2000 ; Lewinsohn et al., 2001 ; Munoz-Bertomeu et al., 2006). Des
efforts ont t entrepris pour dchiffrer les voies de biosynthse des terpnes et analyser le
rle spcifiquement jou par chaque enzyme (Rodriguez-Concepcion & Boronat, 2002). La
combinaison des donnes de chimie, biochimie et gnomique offre une approche trs
puissante pour la dcouverte des ensembles complets de gnes et denzymes des voies de
la biosynthse des terpnodes (Bohlmann et al., 2008a). Les TPSs catalysent la premire
tape de la biosynthse des mono et sesquiterpnes partir de substrats simples, GPP et
FPP respectivement. Ces enzymes sont responsables de la grande diversit des squelettes
carbons des mono et sesquiterpnes, ces derniers pouvant ventuellement subir des
modifications additionnelles par actylation, hydroxylation, oxydation ou rduction. Les
gnes de TPSs ont t isols et caractriss partir de plusieurs espces de Lamiaces, y
compris des genres Mentha (Colby et al., 1993 ; Crock et al., 1997 ; Crowell et al.,
2002 ; Prosser et al., 2006), Perilla (Yuba et al., 1996 ; Hosoi et al., 2004 ; Ito & Honda,
2007), Salvia (Wise et al., 1998 ; Hoelscher et al., 2003 ; Kampranis et al., 2007) et
Ocimum (Iijima et al., 2004). Beaucoup de questions restent ouvertes sur les TPSs
vgtales et notamment les relations qui unissent leur fonction et leur structure. Peu
dexemples dvnements volutifs ayant conduit une modification du chmotype dune
espce vgtale ont galement t caractriss. Au moment o cette tude a dbut, peu de
facteurs molculaires dterminant la biosynthse et la composition des HEs des espces de
lavandes taient connus. Mme lheure actuelle, seulement 5 TPSs ont t clones et
caractrises chez L. angustifolia (Landmann et al., 2007 ; Demissie et al., 2011 ;
Demissie et al., 2012) et une squence de TPS de L. latifolia a t dpose sur GenBank.
Aucune information fonctionnelle na encore t apporte sur les gnes de TPSs des
espces de la section Stoechas comme pour beaucoup dautres lavandes. Des expriences
ont t conues pour tudier la diversit des terpnodes volatils produits par L. stoechas
Sensu Lato dun point de vue de leurs structures chimiques, leurs activits biologiques et
leur origine biosynthtique. Les Objectifs de la prsente tude ont t :

de mieux caractriser la diversit et la variabilit chimique lHE de L. stoechas par
lanalyse dun nombre important dchantillons issus dune mme zone
gographique en Algrie.

t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre I. Revue de Littrature




Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

d'valuer l'activit biologique des HEs des populations Algriennes de L. stoechas
tudies ci-dessus : (i) activit antioxydante l'aide de deux tests, le test DPPH et le
test -carotne/acide linolique ; (ii) activit antibactrienne et antifongique envers
16 microorganismes pathognes de lhomme et phytopathognes afin de valider son
utilisation traditionnelle ; (iii) certains corrlations entre la composition chimique
des HEs et leurs activits biologiques ont finalement t tablies.

didentifier la composition chimique des COVs de L. stoechas Sensu Lato (L.
pedunculata, L. stoechas et L. viridis) afin de dterminer la biodiversit
chmotypique au sein de la section Stoechas du Lavandula.

d'isoler, de cloner, de squencer et dexprimer fonctionnellement chez Escherichia
coli des gnes encore inconnus de TPSs de ces trois Stoechas afin de suggrer
lorigine molculaire de leurs diffrences chmotypiques. Ceux-ci ont t raliss
en utilisant des amorces dgnres dsignes sur des motifs conservs de TPSs.
























t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre II. Matriels et Mthodes



8
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e




















M
MA AT TE ER RI IE EL LS S
E ET T M
ME ET TH HO OD DE ES S

















t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre II. Matriels et Mthodes



?
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

II.1. Materiel vgtal
Les parties ariennes de L. stoechas L. (feuilles + inflorescences) ont t collectes au
maximum de la floraison (printemps 2007) partir de populations sauvages pour ltude
comparative des populations algriennes de L. stoechas. En Algrie, les populations
naturelles de L. stoechas sont situes au nord du pays, le long de la cte mditerranenne.
Au total, onze populations ont t collectes au hasard dans cette zone de distribution
(Tableau 5, Figure 28). L'ensemble du matriel vgtal pour analyse chromatographique a
t rcolt en mars 2007 pour viter dventuelles variations saisonnires de la
composition chimique de lHE. L'authentification botanique de l'espce a t ralise
l'herbier du Dpartement de botanique, l'Ecole Nationale d'Agronomie (ENA), d'Alger,
o des spcimens ont t dposs. Lidentit des espces a t galement confirme selon
les cls botaniques dans la "Flore de l'Algrie" (Quezel & Santa, 1963).



Tableau 5 : Sites de collecte (avec les abrviations) et principales caractristiques cologiques des
biotopes de 11 populations algriennes de L. stoechas qui ont servi de source d'HE dans la prsente
tude

Code de
population
Localit
Site de
collection
Zone
bioclimatique
a

Pluviomtrie
(mm/an)
Coordonnes gographiques
Latitude N Longitude E Altitude (m)
LS1 Skikada An-Chraa MH 905 365121 64312 478
LS2 Jijel Iragheune MH 1200 364922 54545 66
LS3 Boumerdes Boumerdes MH 900 364549 32859 88
LS4 Bouira Lakhdaria CH 660 363412 33411 128
LS5 Bouira Ain Bessam CH 660 361753 33938 685
LS6 Bouira Guerrouma CH 660 362344 32623 481
LS7 Bouira Taguedit CSA 400 360901 34121 200
LS8 Blida
Hammam
Melouane
MH 600 362816 24946 346
LS9 Mda Benchicao CH 615 361153 25055 1122
LS10 Ain Defla Ain Defla MSA 470 360914 20359 383
LS11 Chlef Chlef MSH 420 360954 11925 162
a
Zone bioclimatique : HM = humide mditerranenne, HC = humide continentale, SAC = semi-aride continentale, SAM =
semi-aride mditerranenne, SHM = subhumide mditerranenne














t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre II. Matriels et Mthodes



8u
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e































Figure 28 : Origine gographique des 11 populations algriennes de L. stoechas utilises dans
cette tude
Les codes des populations sont les mmes que ceux du Tableau 5.



Les graines de la lavande espagnole (L. pedunculata, Sous-espce lusitanica) ont t
aimablement fournies au BVpam en 2006 par Mr. B. Pasquier (directeur du Conservatoire
National des Plantes Parfum, Mdicinales, Aromatiques et Industrielles "CNPMAI",
Milly la Fort, Paris, France). Les graines de cette espce ont t collectes par lui-mme
en 2003 dans des populations sauvages situes basse altitude dans l'ouest du Portugal
(3916526N, 0833117WO, 54 m d'altitude, prs de Alpiara 78 km de Lisbonne).
Les graines de la lavande verte (L. viridis) ont t aimablement aussi fournies au
BVpam en 2006 par Mr. B. Pasquier. Les graines de cette espce ont t collectes en 2003
par lui-mme dans des populations sauvages situes dans le sud ouest du Portugal
(3719279N, 0832062WO, 440 m d'altitude, entre Monchique et Alferce, 255 km de
Lisbonne).
Les graines de la lavande papillon (L. stoechas) ont t aimablement fournies en 2006
par le Dr. A. Saadi (doyen de la Facult des Sciences, Universit de Chlef, Algrie). Les
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre II. Matriels et Mthodes



81
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

graines de cette espce ont t rcoltes en 2006 depuis une population sauvage situe dans
le nord de l'Algrie (362406N, 11816E, 40 m d'altitude, prs de Tns 200 km d'Alger).

II.2. Souches de microorganismes
Bactries pathognes cibles
Une slection de bactries pathognes a t utilise pour valuer l'activit
antibactrienne des HEs des populations de L. stoechas. Il s'agit notamment des bactries
Gram ngatif, Escherichia coli (E13), Escherichia coli (E195), Escherichia coli (ATCC
25925), Escherichia coli (K12), Klebsiella pneumoniae (E40), Klebsiella pneumoniae
(KP19), Salmonella enterica (E32), Acinetobacter baumannii (E16) et Pseudomonas
aeruginosa (CIP A22) et dune bactrie Gram positif, Bacillus subtilis (ATCC 6633).
Toutes ces souches bactriennes appartiennent la collection du Laboratoire de Biologie
des Systmes Microbiens de l'Ecole Normale Suprieure de Kouba-Alger (Algrie).

Champignons filamenteux cibles
Les champignons filamenteux utiliss lors de lvaluation de lactivit antifongique
des HEs des populations de L. stoechas sont Aspergillus Niger, Aspergillus flavus,
Fusarium oxysporum f. sp lini (n Foln 3-5) et Mucor ramannianus (NRRL 1829). Toutes
les cultures pures de champignons appartiennent la collection du Laboratoire de Biologie
des Systmes Microbiens de l'Ecole Normale Suprieure de Kouba-Alger (Algrie).

Levures cibles
Nous avons galement utilis la levure Candida albicans (souche A et B) lors de tests
dactivit antifongique. Toutes les cultures pures de ces deux souches de levure drivent de
lisolat clinique de patients humains l'hpital Zmirli d'Alger.

Bactries de clonage
Diffrentes souches dEscherichia coli ont t utilises dans des expriences de
clonage. Pour le clonage de routine dans le vecteur pGEM-T easy, les bactries
chimiocomptentes dE. coli, souches DH5 et JM109 (Tableau 6) ont t utilises. La
souche TOP10 (Tableau 6) chimiocomptente a t utilise pendant le clonage des TPSs en
pleine longueur ou des TPSs pseudomatures comme une phase transitoire lors de la
prparation des vecteurs dexpressions par la technique Gateway.
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre II. Matriels et Mthodes



82
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

Tableau 6 : Gnotypes et origines de souches dE. coli de clonage et dexpression utilises

Souche E. coli Gnotype Origine
DH5
[F
-
80lacZM15 (lacZYA-argF)U169 deoR recA1
endA1 hsdR17(r
k
-
, m
k
+
) phoA supE44 thi-1 gyrA96
relA1
-
]
Promega
JM109
[endA1, recA1, gyrA96, thi, hsdR17 (r
k
, m
k
+), relA1,
supE44, (lac-proAB), (F, traD36, proAB,
laqI
q
ZM15)]
Promega
TOP10
[F
-
mcrA (mrr-hsdRMS-mcrBC) 80lacZM15
lacX74 recA1 araD139 (ara-leu)7697 galU galK
rpsL (Str
R
) endA1 nupG]
Invitrogen
Rosetta (DE3) pLysS
[F
-
ompT hsdS
B
(r
B
-
m
B
-
) gal dcm (DE3) pLysSRARE,
Cam
R
]
Novagen


Bactries dexpression
La bactrie E. coli souche Rosetta (DE3) pLysS (Tableau 6) a t utilise comme
systme dexpression permettant la synthse de lARN-polymrase T7 par induction avec
lisopropylthio--D-galactoside (IPTG) afin de produire la protine recombinante. Elle
comporte une rsistance chromosomique au chloramphnicol. Cette souche Rosetta a t
conue pour augmenter l'expression de protines recombinantes d'origine eucaryote dont
les gnes correspondant contiennent des codons rarement utiliss chez E. coli. Cette souche
contient ainsi un plasmide fournissant les ARNt correspondant 6 codons rares (AUA,
AGG, AGA, CUA, CCC, GGA). La souche pLysS exprime le lysozyme T7, qui inhibe
l'activit basale de l'ARN polymrase T7, optimisant de ce fait la rgulation du niveau
d'expression.

II.3. Produits chimiques et vecteurs gntiques
Tous les produits chimiques et les solvants sont de qualit biologie molculaire,
gnralement achets auprs de Sigma-Aldrich ou Fluka (Allemagne). Les standards purs
utiliss lors de lidentification par GC des composs volatils ont t obtenus chez Sigma-
Aldrich (Allemagne), Pyrant Bertrand (France) ou Roth (Allemagne). L'huile essentielle
pure de Pogostemon cablin utilise comme standard pour le -lmne et le germacrne A,
a t achete dans une pharmacie locale, saint Etienne (France). La synthse
doligonuclotides (amorces) a t ralise par la socit Eurofins MWG Operon
(Ebersberg, Allemagne).
Le plasmide pGEM-T easy (Promega, Figure 29) est un vecteur de clonage haut
nombre de copies avec une rsistance l'ampicilline disponible sous forme linaire. Ce
plasmide permet une insertion directe et rapide (sans recours des enzymes de restriction)
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre II. Matriels et Mthodes



8J
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

des produits de PCR ayant une base dsoxyadnosine aux extrmits 3 grce la
dsoxythymidine aux extrmits 3 du plasmide lui mme. En plus, ce plasmide possde
un gne lacZ sous le contrle du promoteur Plac.
Le plasmide pENTR/D-TOPO (Invitrogen, Figure 30) est un vecteur donneur
compatible la technologie Gateway pour lobtention du clone dentre avec une
rsistance la kanamycine. Ce plasmide permet un clonage rapide et directionnel du
produit PCR dintrt avec la topoisomrase I lie au plasmide.

Figure 29 : Vecteur pGEM-T easy (Promega) avec un site de
clonage multiple ouvert comportant les deux thymidines (T)
libres
T7, promoteur ARN polymrase T7. SP6, promoteur ARN polymrase
SP6. Ampr, gne de rsistance lampicilline. Ori f1, origine de
rplication du phage f1. lacZ, promoteur + gne lacZ.













Figure 30 : Vecteur donneur pENTR/D-TOPO (Invitrogen)
avec deux sites de clonage directionnel
attL1 et attL2, sites du site spcifique de recombinaison avec le vecteur de
destination Gateway. TOPO, deux sites de clonage directionnel. pUC ori,
origine de rplication pour grand nombre de copie de plasmide. T1 et T2,
squences de terminaison de la transcription. Kanamycin, gne de
rsistance la kanamycine.
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre II. Matriels et Mthodes



84
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

Les plasmides dexpression utiliss lors de cette recherche sont : pHGWA, pHGGWA,
pHMGWA, pHNGWA et pHXGWA (Figure 31). Ces plasmides ont t construits par
Busso et al., (2005) drivant du vecteur pET22b (Merck) pour lexpression des protines
recombinantes dans des cellules procaryotes. Ces plasmides possdent un oprateur lac
pour la rpression de l'expression des gnes jusqu' linduction par lIPTG. Ces vecteurs
d'expression ont t utiliss pour lexpression htrologue des TPSs de lavandes.



Figure 31 : Sries de vecteurs de destination (dexpression) avec une cassette
attR1/attR2 de recombinaison Gateway
T7, Promoteur ARN polymrase T7. 6xHis, Squence codante du tag hexa-histidine. Cm
R
et
Amp
R
, Gnes de rsistance au chloramphnicol et lampicilline, respectivement. RBS, site
de liaison au ribosome. ATG : codon dinitiation de la traduction. lac Op, oprateur lac.
attR1 et attR2, sites de recombinaison. Stop, Codon stop. ccdB, Gne codant pour une
protine toxique pour la plupart des souches bactriennes. T7 term, terminaison T7. lacI,
squence encodante pour lacI. bla pro, promoteur bla. pBR322 ori, origine de rplication
pBR322. Dans cette sries de plasmides les protines de fusion sont : GST ; glutathione S-
transferase, MBP; maltose binding protein, NusA; N-utilizing substance A, TRX; thioredoxin.


II.4. Conditions de culture
L. stoechas Sensu Lato
Afin de disposer de matriel biologique frais, les diffrentes espces de Lavandes
prcites ont t semes et cultives dans les serres du laboratoire. Les graines sont
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre II. Matriels et Mthodes



8-
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

plantes sur des plaques alvoles d'un diamtre de 2 cm dans un substrat dit "de bruyre"
(matire sche 60 % du produit brut -sable, corce de pin-, matire organique 25 % du
produit brut -humus forestier-, pH 5.0 ; conductivit 28 mS/m, capacit de rtention 600
ml/l) avec une granulomtrie faible pour faciliter l'enracinement ainsi que la rtention
d'eau. Ce substrat de bruyre sera utilis tout au long des phases de culture. Aprs environ
1 mois, lorsque les jeunes plants sont suffisamment racins, ils sont rempots dans des
godets (7 cm) pour augmenter le volume de racines et favoriser le dveloppement des
parties ariennes. Lorsque les plants ont atteint un volume racinaire trop consquent pour
le volume du conteneur nous procdons un ultime rempotage dans des conteneurs d'un
volume de 10 litres. Cette phase de production permet d'obtenir des pieds adultes trs
florifres et une croissance vgtative continue pendant 2 ans. Durant cette phase les
plantes sont cultives en chambre de culture avec un cycle jour/nuit de 16 h de jour 25C
sous une luminosit de 68 mol. m
-2
. s
-1
, soit environ 5000 Lux, et de 8 h dobscurit
22C. Larrosage tait fait pot pot en laissant au moins une priode sche par semaine.
Paralllement, des plantes de L. pedunculata ont t cultives en systme
hydroponique sous les mmes conditions de temprature et d'clairage dcrites
prcdemment. Le pH de la solution nutritive (Hogland & Arnon, 1950) a t maintenu
6,5 par l'ajout de H
2
SO
4
ou de KOH. Ce systme hydroponique a t utilis pour
l'obtention rapide de jeunes feuilles saines utilises dans l'tude molculaire.

Bactries
Les bactries de clonage ont t cultives 37C sous agitation 250 rpm en milieu
Luria Bertani (LB) ou sur milieu glifi LB agar (10 g/l chlorure de sodium, 10 g/l
tryptone, 5 g/l extrait de levure, 15g/l agar, pH 7). La bactrie E. coli Rosetta (DE3) pLysS
a t cultive dans un milieu Turbo Broth (TB) modifi (1.2 % tryptone, 2.4 % extrait de
levure, 0.4 % glycrol, 17 mM KH
2
PO
4
, 72 mM K
2
HPO
4
) pour lexpression des TPSs de
lavandes. Les bactries cibles ont t cultives sur milieu Glose Nutritive (GN) (5 g/l
Chlorure de sodium, 10 g/l peptone, 3 g/l extrait de viande, 3 g/l extrait de levure, 18 g/l
agar, pH 7.3). Tous les milieux ont t autoclavs 121 C pendant 15 min 2,1 bars. Des
antibiotiques appropris pour chaque souche, ou pour chaque plasmide, ont t ajouts aux
concentrations suivantes : ampicilline, 100 g/ml; chloramphnicol, 34 g/ml;
kanamycine, 50 g/ml.
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre II. Matriels et Mthodes



86
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

Le stockage court terme de bactries ( savoir pour quatre semaines au maximum) a
t obtenu en plaant des boites de Ptri contenant des colonies bactriennes 4 C. Pour
le stockage long terme, les stocks de glycrol ont t prpars par ajout de glycrol
directement aux cultures liquides bactriennes, une concentration finale de 50 % (v/v)
avant d'tre conservs -80 C.

II.5. Extraction et caractrisation des huiles essentielles
II.5.1. Hydrodistillation
Le matriel vgtal (parties ariennes fleuries) des populations de L. stoechas Sensu
Lato utilis pour lextraction des HEs est sch l'ombre temprature ambiante, puis
rendu en poudre par broyeur et conserv dans des boites bien fermes. Dans le montage
hydrodistillation (Clevenger modifi), utilis lchelle du laboratoire sous pression
atmosphrique, une quantit de 500 g du matriel vgtal est dpose dans un ballon
demi rempli d'eau (500 ml), reli un rfrigrant. Le mlange eau distille/plante est port
bullition par un chauffe-ballon pour gnrer une vapeur deau sature en composs
volatils. Le rfrigrant sert condenser la vapeur en distillat (hydrolat) et l'extraction
dbute lorsque les premires gouttes tombent dans le collecteur et se poursuit pendant 3
heures. Le distillat est recueilli dans une ampoule de dcantation et mis en mlange avec de
lther dithylique. L'HE se concentre alors dans la phase organique. La solution organique
d'HE ainsi obtenue est sche par du sulfate de sodium anhydre (Na
2
SO
4
) puis l'ther
dithylique est compltement vapor sous vide. Les HEs obtenues ont t peses et
conserves 4 C dans des flacons en verre brun avant dtre analyses.

II.5.2. Calcul de rendement en huile essentielle
Le rendement (Rdt) des extractions d'HEs de L. stoechas a t dfini comme tant le
rapport entre la masse dHE obtenue et la masse de matire vgtale utilise selon la
formule suivante :
Rdt
HE
= [M/M
0
] x 100
O :
Rdt
HE
: rendement de lextraction dHE en % ;
M : masse dHE en gramme ;
M
0
: masse de la matire vgtale sche utilise en gramme.

t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre II. Matriels et Mthodes



8
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

II.5.3. Extraction des volatils par macration dans lhexane
Une masse de 2 g de feuilles fraches ou sches partiellement broyes de chaque
lavande ont t mises en macration dans 3 ml d'hexane pendant une nuit au rfrigrateur
4 C. La phase suprieure dhexane contenant les composs volatils est prleve avec une
pipette Pasteur puis passe travers le sulfate de sodium anhydre (Na
2
SO
4
) afin dliminer
les traces deau. L'extrait hexane rcupr est concentr sous un courant d'azote puis
conserv 4 C jusqu' l'analyse par GC/MS.

II.5.4. Analyse en GC/FID
Les composs volatils ont t analyss par chromatographie en phase gazeuse grce
un chromatographe Agilent dot dun injecteur automatique et quip dun dtecteur
ionisation de flamme (FID) permettant la dtection des composs. Les conditions
opratoires de ces analyses sont rpertories dans le Tableau 7.

Tableau 7 : Conditions opratoires GC/FID utilises
pour lanalyse des COVs des populations de L. stoechas

Composant Particularit et temprature
Agilent HP modle 6890
FID 250 C
Injecteur 250 C
Volume inject 1 l dans lhexane
Mode Split 1:20
Colonne 1 Capillaire, HP-1
Dimension de la Colonne 50 m, 0.32 mm, 0.25 m
Gradient 80 2 C/min 295 C (25 min)
Gaz vecteur Hlium, 1.5 ml/min.
Colonne 2 Capillaire, INNOWAX-1
Dimension de la Colonne 60 m, 0.32 mm, 0.50 m
Gradient 60 2 C/min 245 C (25 min)
Gaz vecteur Hlium, 1.3 ml/min.


II.5.5. Analyse en GC/MS
Les spectres de masse des composs volatils ont t obtenus sur un spectromtre de
masse quadriple et ionisation par bombardement lectronique Agilent coupl un
chromatographe Agilent dot dun injecteur automatique. Les informations concernant le
type de colonne, le dtecteur et les rglages du GC/MS sont rsumes dans le Tableau 8.




t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre II. Matriels et Mthodes



88
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

Tableau 8 : Conditions opratoires des analyses GC/MS

Composant
Particularit et temprature
Populations algriennes de L. stoechas
Lavandes Stoechas, Pogostemon cablin
et activit enzymatique des TPs
GC
Agilent HP 6850 et 7890 6850
Injecteur 250 C 250 C
Volume inject 0.2 l dans lhexane 2 l dans lhexane
Mode Splitless Splitless
Gaz vecteur Hlium, 1.3 ml/min. Hlium, 1 ml/min.
Colonne 1 Capillaire, HP-1 Capillaire, HP-5MS
Dimension de la colonne 50 m, 0.32 mm, 0.25 m 30 m, 0.25 mm, 0.25 m
Gradient 60 3 C/min 280 C (10 min) 60 3 C/min 246 C (4 min)
Colonne 2 Capillaire, INNOWAX-1
Dimension de la colonne 60 m, 0.32 mm, 0.50 m
Gradient 60 3 C/min 245 C (25 min)
MS
Agilent HP 5975 et 5975C, respectivement 5973
Ionisation Impact lectronique 70 eV Impact lectronique 70 eV
Balayage automatique
HP-1, 30-350 amu 2.4 scan/s
INNOWAX-1, 30-400 amu 2.4 scan/s
25-350 amu 2.4 scan/s
Source dion 230 C 230 C
MS, quadrupole 150 C 150 C

II.5.6. Identification des composes volatils
Lidentification des composs volatils a t faite par GC/FID et GC/MS aprs une
double sparation des chantillons sur plusieurs types de colonne capillaires polaire (HP-
INNOWAX-1) et apolaires (HP-1 et HP-5MS). Le nom dune molcule tait trouv en
comparant les spectres de masse (SM) obtenus aux bases de donnes lectroniques WILEY
275 et NIST 05, ainsi quavec la bibliographie notamment Adams (2007) et Joulain et
Knig (1998) en parallle avec lutilisation des indices de rtention (IR). Ces IRs sont
calculs sur les deux types de colonne apolaire et polaire en utilisant les temps de rtention
(TR) des alcanes d'un mlange de n-alcanes (C8 - C40, Fluka) analys dans les mmes
conditions chromatographiques (van Den Dool & Kratz, 1963) selon lquation suivante :
IR = 100 x Z + 100 x n [(t
RS
- t
RZ
)/(t
R(Z+n)
- t
RZ
)]
O :
t
RS
: temps de rtention absolu du solut tudi ;
t
RZ
: temps de rtention absolu de lalcane Z atomes de carbone qui prcde le solut ;
t
R(Z+n)
: temps de rtention absolu de lalcane (Z+n) atomes de carbone qui suit le solut ;
n : diffrence du nombre datome de carbone entre les deux alcanes (gnralement n = 1).
Lorsque nous disposions des standards commerciaux purs, nous avons vrifi que le
TR, lIR et le SM du standard pur correspondaient bien, respectivement, au TR, IR et SM
du compos identifier.
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre II. Matriels et Mthodes



8?
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

II.5.7. Quantification des composs volatils
Pour les HEs des populations algriennes de L. stoechas, les pourcentages relatifs des
composs volatils spars ont t calculs partir de donnes des aires des pics en GC/FID
gnres par une intgration lectronique sans l'utilisation de facteurs de correction. Les
valeurs rapportes sont la moyenne de trois valeurs obtenues partir de trois injections de
chaque chantillon d'huile. La concentration de chacun des composs volatils, a t
calcule en utilisant leugnol comme talon interne (COV de lavandes Stoechas).

II.6. Evaluation de lactivit antioxydante des huiles essentielles des populations de L.
stoechas
II.6.1. Criblage rapide de lactivit antioxydante par chromatographie sur couche
mince (CCM)
Comme dcrit par Cuendet et al. (1997), cinq microlitres de chaque HE dilue 1:10
dans de l'hexane, de hydroxytolune butyl (BHT) et d-tocophrol ont t spots sur une
plaque daluminium recouverte de gel de silice (Silicagel 60 F254, Merck). Le
dveloppement de la plaque seffectue dans une cuve en verre contenant la phase mobile,
d'actone/hexane (1:30, v/v). Pour la rvlation des spots, la plaque de CCM a t
pulvrise avec une solution de DPPH 0.2% dans l'thanol et laisse dans le noir
temprature ambiante pendant 30 min. Seuls les spots changeants la couleur du pourpre au
jaune sur un fond violet ont t nots en tant que constituants activit positive de
pigeage de radical libre de DPPH. En parallle lactivit antioxydante de fenchol, 1,8-
cinol, camphre, eugnol et carvacrol a t crible dans ce systme.

II.6.2. Evaluation de lactivit de pigeage du radical libre par la mthode de DPPH
Il s'agit de la mthode la plus largement utilise pour valuer l'activit antioxydante
des drogues vgtales. Ce test vise mesurer la capacit de l'huile piger le radical
relativement stable, 2,2-diphenyl-1-picrylhydrazyl (DPPH). Le pigeage des radicaux
libres de DPPH provoque un changement de couleur de la solution initiale du violet fonc
au jaune suite la rduction du DPPH en DPPH-H (diphnyl-picrylhydrazine). Selon,
Brand-Williams et al. (1995), 5 ml d'une solution thanolique de DPPH frachement
prpare (0,004 %), 50 l de diverses concentrations de chaque HE (2 - 44 mg/ml) et de
chaque standard (0,005 - 16 mg/ml) ont t ajouts. Les mlanges sont agits au vortex et
incubs dans l'obscurit temprature ambiante pendant 30 min. La disparition de DPPH a
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre II. Matriels et Mthodes



?u
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

t suivie par spectrophotomtrie 517 nm contre un blanc (solution d'thanol) l'aide
d'un spectrophotomtre (JASCO-V530). Le pourcentage d'inhibition (I %) du radical libre
DPPH a t calcul avec la formule suivante :
I% = [(A
blanc
- A
chantillon
)/A
blanc
] x 100
O :
A
blanc
: absorbance de la raction de contrle contenant tous les ractifs sauf l'huile ;
A
chantillon
: absorption de lchantillon contenant une dose d'HE teste.
La valeur de la concentration inhibitrice IC
50
reprsente la dose de l'HE qui cause la
neutralisation de 50 % des radicaux de DPPH. LIC
50
, utilise comme une estimation de
l'activit antioxydante par DPPH, a est estime par extrapolation en traant la courbe des
pourcentages dinhibition (I %) en fonction des concentrations (C). Tous les tests ont t
effectus en triplicata et les valeurs dIC
50
ont t reportes en tant que moyenne SD.

II.6.3. Evaluation de lactivit antioxydante par la mthode -carotne/acide
linolique
C'est l'une des mthodes complmentaires utilises pour le criblage de substances
antioxydantes. Elle est base sur le principe que l'acide gras insatur, acide linolique,
s'oxyde spontanment avec les espces ractives de l'oxygne "Reactive Oxygen Species"
(ROS) prsentes dans l'eau riche en oxygne. Alors, les produits de raction dclenchent la
transformation du -carotne en sa forme incolore. Le degr de dcoloration est mesur par
spectrophotomtrie et utilis comme une estimation de l'activit antioxydante (AA). La
mthode utilise est celle dcrite par Dapkevicius et al. (1998). Une solution stock de
mlange mulsion -carotne/acide linolique a t prpare comme suit : 0,5 mg de
cristaux de -carotne a t dissous dans 1 ml de chloroforme et 1 ml de cette solution a t
transfr dans un ballon contenant 25 l d'acide linolique et 200 mg de Tween-40. Aprs
l'limination complte de chloroforme par vaporation, 100 ml d'eau distille enrichie en
oxygne a t ajoute sous agitation vigoureuse. Des aliquotes de 2.5 ml de ce mlange ont
t transfrs dans une srie de tubes essai contenants 350 l dHE dilue dans de
l'thanol qui donne une concentration finale de 2 g/l. Aprs une agitation vigoureuse, les
tubes ont t incubs 50 C pendant 2 h. Un tube tmoin ngatif a t construit en
remplaant lHE par l'thanol. L'absorbance a t finalement mesure 490 nm contre un
blanc (mulsion sans -carotne). Les activits antioxydantes (AA %) ont t calculs en
utilisant la formules suivante :
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre II. Matriels et Mthodes



?1
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

AA % = [1- (A
0
-A
t
/A'
0
-A'
t
)] x 100
O :
A
0
, A'
0
: absorbance respective de l'chantillon et du contrle t = 0 min ;
A
t
, A'
t
: absorbance respective de l'chantillon et du contrle t = 2 h.
Tous les tests ont t effectus en triplicata et les pourcentages d'inhibition (AA %) ont
t reportes en tant que moyenne SD

II.7. Evaluation de lactivit antimicrobienne des huiles essentielles des populations de
L. stoechas
Les valeurs des concentrations minimales inhibitrices (CMI) pour les microorganismes
tests ont t dtermines in vitro en utilisant la mthode conventionnelle de dilution dagar
(Skmen et al., 2004). Des dilutions en srie des HEs ont t prpares avec la glose
nutritive, strile, fondue et enrichie avec le glucose (10 g/l) et le Tween-80 (0.5 %, v/v)
pour couvrir une gamme de concentration de 0.16 24 mg/ml. Les solutions de glose
nutritive obtenues ont t immdiatement coules dans des botes de Ptri aprs agitation.
Ces botes ont t mises scher temprature ambiante puis inocules par spot de 2 l de
chaque suspension de microorganisme cible en deux rptitions. Les suspensions de
microorganisme ont t prpares partir de cultures de 24 h pour les bactries et de 72 h
pour les champignons et ont t ajustes environ 10
6
CFU/ml. Le mme test a t
effectu sans HE comme tmoin ngatif. Les botes inocules ont t incubes 30 C/24 h
pour les bactries et 30 C/48 h pour les champignons. Aprs incubation, lobservation de
la gamme permet daccder la concentration minimale inhibitrice, qui correspond la
plus faible concentration en HE capable dinhiber la croissance du microorganisme.

II.8. Obtention des extraits dADN, ARN et ADNc
II.8.1. Extraction de lADN gnomique des feuilles de lavandes
Deux mthodes d'extraction ont t employes au cours de ce travail. LADNg de L.
pedunculata a t extrait selon un protocole driv de Doyle et Doyle (1987). Cette
mthode dextraction utilise du CTAB et nous avons modifi le protocole initial en
ajoutant deux tapes de lavage lthanol aprs la prcipitation faite avec de lisopropanol.
En rgle gnrale, 100 mg de tissu (poids frais de feuilles jeunes) sont broys dans lazote
liquide, puis additionns de 1 ml de tampon dextraction (Tris-HCl 100 mM pH 7,5 ;
NaCl 1,4 M ; EDTA 20 mM ; 2% CTAB). Aprs 90 min dincubation 65C, 450 l dune
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre II. Matriels et Mthodes



?2
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

solution de chloroforme/alcool isoamylique (24 :1) sont ajouts. Une centrifugation de 10
min 3700 g est ralise et la phase aqueuse est rcupre. Lajout dun volume identique
disopropanol permet la prcipitation de lADNg. Aprs centrifugation 12800 g pendant
1 min, le surnageant est limin et le culot est lav avec 500 l dthanol 70%. Cette
tape de lavage est rpte deux fois. Le culot dADNg obtenu est sch sous hotte
Sorbonne, puis repris dans 40 l deau strile. Dautres part, le kit Wizard Genomic DNA
Purification (Promega) est utilis pour les extractions dADNg de L. stoechas et L. viridis
sur environ 40 mg de poudre de feuilles jeunes broy dans l'azote liquide. Cette technique
repose sur la purification dADNg grce un tampon dextraction spcifique et une
colonne retenant les ADNs suivant le protocole dcrit par le fabricant. Dans tous les cas
lADNg extrait est conserv au conglateur -20 C.

II.8.2. Extraction d'ADN plasmidique bactrien
Deux mthodes d'extraction ont t employes au cours de ce travail, en fonction de
l'utilisation souhaite des ADNs plasmidiques. S'ils sont destins au squenage,
lextraction et la purification seffectuent grce au kit Pure Yield Plasmid Miniprep
(Promega) selon le protocole dcrit par le fabricant. Souvent un volume de 2 ml, prlev
dune culture bactrienne E. coli ge dune nuit 37 C et agit 150-250 rpm dans le
milieu LB contenant les antibiotiques appropris, est utilis pour cet effet. La purification
repose sur la fixation des acides nucliques sur une colonne contenant une matrice les
retenant spcifiquement, puis dun ou plusieurs lavages de la matrice prcdant ltape
dlution dans leau. Si les ADNs plasmidiques sont destins une utilisation de routine de
laboratoire, 2 ml de culture bactrienne sont centrifugs pendant 2 min 3700 g. Le culot
bactrien est repris avec 100 l dune solution de lyse (glucose 50 mM ; EDTA 10 mM pH
8 ; Tris-HCl 25 mM pH 8 ; lysozyme 4 mg/ml) et incub 5 min temprature ambiante.
Aprs la lyse des bactries, 200 l dune solution basique (SDS 1% (w/v) ; NaOH 0,2 N)
sont ajouts. Lensemble est incub 5 min dans la glace, puis additionn de 150 l dune
solution acide (actate de potassium 3M, pH 4.8) et plac nouveau dans la glace pendant
5 min. Aprs une centrifugation 12800 g pendant 5 min 4C, le surnageant est rcupr
et 500 l dune solution de phnol/chloroforme/alcool isoamylique (25:24:1) sont ajouts.
Une centrifugation de 5 min 12800 g est ralise, puis la phase aqueuse est rcupre et
additionne de 1 ml dthanol absolu. Lensemble est laiss 5 min temprature ambiante
pour permettre la prcipitation de lADN. Aprs 5 min de centrifugation 12800 g, le
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre II. Matriels et Mthodes



?J
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

surnageant est limin et le culot est lav par 1 ml dthanol 70 %, puis sch sous hotte
Sorbonne. Le culot (ADN plasmidique) obtenu est repris dans 50 l dune solution de Tris-
RNase (Tris 10 mM pH 7.5 ; RNase 40 g/ml). LADN plasmidique purifie est stock -
20 C.

II.8.3. Extraction des ARN totaux
Les feuilles jeunes de lavandes Stoechas prleves et congeles dans lazote liquide
sont broyes afin dextraire les ARNs totaux. A cet effet le kit dextraction NucleoSpin
RNA Plant (Macherey-Nagel) a t utilis. Cette technique repose sur la purification des
ARNs grce un tampon dextraction spcifique et une colonne retenant les acides
nucliques, couple une digestion sur la colonne la DNAse. Le protocole suivi est celui
dcrit par le fournisseur l'exception de l'lution des ARNs sans traitement la DNAse
dans la colonne alors que lincubation des ARNs avec la DNAse dans la colonne est
mentionne par le fournisseur. Donc, les ARNs sont lus avec 40 l d'eau 'nuclase free'
et sont ensuite traits la DNase (voir plus bas II.8.4.).
Spcifiquement pour la ralisation de la banque RACE, une purification
supplmentaire des ARNs poly-A (ARNm) partir des ARN totaux a t ralise par le kit
Indirect Quick Messenger RNA (Talent) selon les instructions du fabricant.
Lorsquon travaille avec l'ARN, il est trs important d'viter la contamination avec les
RNase pendant la procdure d'isolement dARN et de s'assurer que toutes les solutions sont
dpourvues de RNase. Par consquent, tous les matriaux utiliss pour l'extraction d'ARN
et pour llectrophorse sur gel ont t lavs avec une solution dlimination de RNase.
Afin de minimiser les contaminations possibles par la RNase, des gants ont t toujours
ports et ont t souvent changs au cours de l'extraction d'ARN.

II.8.4. Synthse dADN complmentaire
Malgr les prcautions prises lors de lextraction des ARN, il est possible que les
extraits contiennent des traces dADNg. Il est donc ncessaire de les traiter pour liminer
lADN restant. Dans un volume final de 100 l, 10 g dARN sont additionns de 10 l de
tampon RQ1 10X (400 mM Tris-HCl, 100 mM MgSO4, 10 mM CaCl2, pH 8, Promega),
d1 l de DNase (RQ1 5 U/l, Promega) et d1 l dinhibiteur de RNase (RNasin 40U/l,
Promega). Le mlange ractionnel est incub pendant 1h 37 C. A lissue, 100 l dune
solution de phnol/chloroforme/alcool isoamylique (25 : 24 : 1) pH 8 sont ajouts, puis
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre II. Matriels et Mthodes



?4
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

une centrifugation 12800 g pendant 10 min 4 C est ralise et la phase aqueuse est
rcupre. Cette tape, effectue deux fois, permet llimination des protines. Les ARN
sont prcipits avec 1/10 volume dactate de sodium 3 M (pH 5,8) et 2 volumes dthanol
absolu, pendant 2 h -20 C. Aprs 30 min de centrifugation 12800 g 4 C, le
surnageant est limin et le culot est lav avec 100 l dthanol 70 %, puis centrifug
nouveau pendant 10 min 12800 g 4 C. Cette tape de lavage est ralise deux fois. Les
culots dARN obtenus sont schs sous hotte Sorbonne, puis repris dans 10 l deau strile.
Les ARN traits la DNase sont utiliss immdiatement ou conservs -80 C.
Les ARNm totaux contenus dans lextrait ARN totaux sont rtro-transcrits (RT) en
ADNc afin deffectuer des amplifications par PCR. Un total de 2 g dARN totaux traits
la DNase sont additionns de 0.5 g doligo (dT) (Promega) dans un volume final de 11 l,
et sont incubs 5 min 70 C pour permettre la dnaturation des ARN, puis placs
immdiatement dans la glace pendant 30 sec. La raction de rtro-transcription est ralise
en ajoutant, pour un volume final de 25 l, du tampon M-MLV 5x (50 mM Tris-HCl, 75
mM KCl, 3 mM MgCl
2
, 10 mM DTT, pH 8.3, Promega), 1 mM de chaque dNTP, 400 U
de reverse transcriptase M-MLV (Promega) et 60 U dinhibiteur de RNase, RNasin
(Promega). Le mlange ractionnel est incub 42 C pendant 1 h, puis 5 min 95 C
pour inactiver la reverse transcriptase. Les ADNc simple brin sont conservs -20 C.

II.8.5. Dosage et contrles de la qualit des acides nucliques
Le dosage et le contrle de la qualit des acides nucliques sont raliss aprs chaque
extraction par spectrophotomtrie, laide dun spectrophotomtre (Biowave II), par
lectrophorse sur gel dagarose ou par PCR.
La concentration dacides nucliques extraits est dtermine par une mesure de la
densit optique (DO) 260 nm. Pour ces mesures des chantillons d'ADN ou d'ARN ont
t dilus 1:100, en admettant que 1 unit de DO
260 nm
quivalle 40 g/ml dARN ou 50
g/ml dADN (Sambrook et al., 1989). Aussi il convient de rechercher une ventuelle
contamination protique pour valuer la puret des acides nucliques. Pour cette raison on
effectue une seconde mesure de DO 280 nm. Un extrait dacides nucliques dune bonne
puret doit avoir un rapport DO
260 nm
/DO
280 nm
compris entre 1,6 et 2, alors quun rapport
au-dessous de 1.6 est trop bas et indique une contamination avec des protines. Une
ventuelle contamination par du phnol, peut tre recherche en mesurant l'absorption
270 nm.
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre II. Matriels et Mthodes



?-
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

Un dpt sur gel est effectu afin dapprcier la qualit et destimer la quantit des
ARNs totaux extraits par comparaison avec lintensit du marqueur de taille (voir plus bas
II.6.4.).
Labsence dADN contaminant dans les extraits dARN peut-tre vrifie en ralisant
une raction de PCR avec un couple damorces spcifiques de lADNg et namplifiant pas
lARN (e.g. dfini sur un intron). Aprs migration sur gel dlectrophorse et rvlation
aux UV il ne doit pas y avoir de bande visible. Sinon, lextrait contenant de lADNg doit
tre retir de ltude.

II.9. Amplifications par PCR
II.9.1. Dfinition des amorces
Lors de cette recherche, plusieurs couples damorces ont t utiliss pour la ralisation
de PCR, RACE-PCR, PCR-marche gnomique et RT-PCR semi-quantitative (Tableau 9).
Pour lisolement des squences partielles de gnes putatifs de TPS partir de feuilles de L.
pedunculata, des amorces dgnres ont t utilises en PCR. Ces amorces dgnres
ont t dsignes par correspondance aux zones conserves aprs alignement de 62
squences protiques de mono- et de sesquiTPSs de Lamiaces disponibles dans GenBank
(NCBI) en fvrier 2008. Au total, cinq amorces dgnres sens (TPS1F, TPS2F, TPS3F,
TPS4F et TPS5F) et trois amorces dgnres antisens (TPS6R, TPS7R et TPS8R) ont t
dfinies manuellement sur sept zones conserves avec une dgnrescence la plus faible
possible (absence de Leu, Arg et Ser).
Toutes les amorces spcifiques sont dsignes laide du logiciel bioinformatique
Primer3 version 0.4.0 accessible en ligne http://frodo.wi.mit.edu/ (Rozen & Skaletsky,
2000), afin que pas ou peu damorces ne shybrident entre elles et ne forment des dimres.
Ainsi, autant que possible, les amorces sens et antisens ont t conues pour avoir des
tempratures de fusion similaires (TM). Dans certains cas les amorces spcifiques ont t
dsignes manuellement par correspondance directe aux nuclotides de la matrice. Ainsi
les amorces spcifiques sens (TPS1exF, TPS2exF et TPS3exF) utilises en technique
Gateway ont t dfinies manuellement en incorporant une squence spcifique (CACC)
pour linsertion directionnelle dans le vecteur dentre et une autre
(TTGGTTCCGCGTGGATCC) pour la digestion par la thrombine lors de la purification
des protines de TPS.

t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre II. Matriels et Mthodes



?6
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

Tableau 9 : Liste des amorces utilises pour les amplifications dADN

Amorce
a
Squence
b
(5 3) Utilisation
TPS1dF TGGGA(CT)(GT)I(CT)(AG)A(CT)TA(CT)ATICA
Isolement des
squences partielles
de gnes de TPS
putatifs
TPS2dF (GT)GITT(CT)(CT)TIGA(CT)GCITA(CT)G
TPS3dF CA(AG)GCI(AC)CICA(AG)CA(AG)(GC)AIGA
TPS4dF GA(CT)GA(CT)(AG)TITA(CT)GA(CT)(AG)TITA(CT)GG
TPS5dF GA(CT)GA(CT)A(CT)IT(AT)(CT)GA(CT)(AG)(AC)ITA(CT)G
TPS6dR CC(AG)TAIA(CT)(AG)TC(AG)TAIA(CT)(AG)TC(AG)TC
TPS7dR A(CT)IGC(CT)TTIG(AT)IAC(AG)TCICC
TPS8dR (CT)C(CT)T(CT)(AG)TTIA(AGT)(AG)TC(CT)TTCCA
SP6 TATTTAGGTGACACTATAG Vrification et
squenage du
vecteur pGEM-T
easy avec insert
T7 TAATACGACTCACTATAGGG
AP1 CCATCCTAATACGACTCACTATAGGGC
Stratgie RACE-PCR
AP2 ACTCACTATAGGGCTCGAGCGGC
LpTPS1FP TGCTCATGATGTTCTCAAAGACAAGGG
RACE-3 LpTPS2FP CATGCAGTGCTGTTCCCAGATCATCG
LpTPS3FP CGCAACCCACTATGCCATTGAATCTC
LpTPS1RP AACATTGGACTGCTTTCGGCACATCG
RACE-5 LpTPS2RP TTACGGAGGCAAAGTGGTACTACAGTGG
LpTPS3RP AGGAAGATCCTACGCAACCCACTATGCC
LpTPS1fullF AGAGGATTAACAACCCCATCC
Isolement des ADNc
LpFENS1, LpPINS2
et LpGEAS3 en plein
longueur
LpTPS1fullR GCTCCATTATTCATGTTAATCGAGG
LpTPS2fullF CTTAACATTTCTGCAGC
LpTPS2fullR AACACTGAAACATGAGC
LpTPS3fullF CTCGCAAATTTCTCTCCTAGC
LpTPS3fullR CTTCTAGATTTGAATAGGATCCACG
LpTPS1pseuF GATGAAACCCGACGCTCTG Isolement des ADNc
LsFENSpm,
LvFENSpm,
LsPINSpm et
LvPINSpm
pseudomatures
LpTPS1pseuR TTAGGCGTATGGCTTGAACATC
LpTPS2pseuF GATGAAACGCGACGCTCCG
LpTPS2pseuR TCAGTCATATGGCTCGAACATG
LpTPS3full2F ATGGCTCAACCAAGAAGCAG Isolement des ADNc
LsGEAS et LvGEAS
en plein longueur
LpTPS3full2R CTAGATTTGAATAGGATCCACGAAC
TPS1SPR TTGTGTGCCTTGTCAAGTACTTCTCTTCC Amplification des
peptides signaux par
marche gnomique
TPS2SPR CTGTGTGCCTTGTCACGTACTTATCTTCC
AP1-GW GTAATACGACTCACTATAGGGC
FENSsemiF GATCCGATGAAACCCGACGCTCTG
Analyse par la RT-
PCR semi-
quantitative
FENSsemiR TTAGGCGTATGGCTTGAACATC
PINSsemiF GATCCGATGAAACGCGACGCTCC
PINSsemiR TCAGTCATATGGCTCGAACATG
GEASsemiF ATGGCTCAACCAAGAAGCAG
GEASsemiR CTAGATTTGAATAGGATCCACGAAC
ActF CCACAATCAAGACCAAGAGGACAATC Amplification de la
-actine ActR CGCCAGGGACCACGGTTG
TPS1exF
CACCTTGGTTCCGCGTGGATCCGATGAAACCCGACGCT
CTG
Prparation des
constructions pour
lexpression
htrologue de TPSs
des groupes FENS,
PINS et GEAS
TPS1exR TTAGGCGTATGGCTTGAACATC
TPS2exF
CACCTTGGTTCCGCGTGGATCCGATGAAACGCGACGCT
CC
TPS2exR TCAGTCATATGGCTCGAACATG
TPS3exF
CACCTTGGTTCCGCGTGGATCCATGGCTCAACCAAGAA
GCAG
TPS3exR CTAGATTTGAATAGGATCCACGAAC
a
Pour les motifs cibles et les positions des amorces dgnres (TPS1dF, TPS2dF, TPS3dF, TPS4dF,
TPS5dF, TPS6dR, TPS7dR et TPS8dR) sur lADNc de la limonene synthase voir Figure 47).
b
I = inositol.

t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre II. Matriels et Mthodes



?
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

II.9.2. Conditions ractionnelles
Quelque soit le fragment amplifier, les ractions de polymrisation en chane (PCR)
sont ralises dans des microtubes paroi mince de 0.2 ml en utilisant un thermocycleur
Eppendorf srie Mastercycler ou BioRad srie MyCycler avec plusieurs composants
(Promega) rsumes en Tableau 10. Les amplifications ont t effectues selon le
programme mentionn dans le Tableau 11. LADN polymrase Gotaq (Promega) a t
utilise pour toutes les PCR de routine tandis que lADN polymrase Pfu (Promega)
haute fidlit a t utilise pour les PCR o les erreurs de copiage devaient tre gardes au
minimum.

Tableau 10 : Elments des ractions damplification par
PCR

Elment Volume par raction
Tampon* 4.0 l
dNTPs (0.1 mM) 0.4 l
Amorce sens (10 M) 1-2.5 l
Amorce antisens (10 M) 1-2.5 l
GoTaq ou Pfu Polymrase (5 U/l) 0.2-0.25 l
ADN (typiquement 25 ng/l) 2.0 l
H
2
O Au total de 25 l
GoTaq 5x, 50 mM Tris-HCl pH 9, 250 mM KCl, 7.5 mM MgCl2; Pfu 10x,
200 mM Tris-HCl pH 8.8, 100 mM KCl, 100 mM (NH4)2SO4, 20 mM
MgSO4, 1 mg/ml SAB nuclease-free, 1 % Triton X-100



Tableau 11 : Conditions des ractions
damplification par PCR classique

Cycle Temprature
a
Dure
b




Dnaturation 94 C 5 min
Dnaturation 94 C 30 sec
Hybridation Variable 45 sec
Elongation 72 C Variable
Elongation finale 72 C 7 min
a
Temprature variable selon le couple damorce utilis.
b

Dure variable selon la polymrase utilise, GoTaq 1
min/kb, la pfu 2 min/1kb.



II.9.3. Stratgie RACE et marche gnomique
Les extrmits 5 et 3 des ADNc codants pour les TPSs sont obtenues en effectuant
des RACE-PCR. Pour cela, le kit Marathon damplification des ADNc (Clontech) a t
utilis en suivant les instructions du fabricant. Brivement, les ARN Poly-A totaux des
feuilles de L. pedunculata ont t utiliss comme matrice pour gnrer la banque RACE.
Cette banque est compose d'ADNc doubles brins ligaturs aux adaptateurs Marathon
x 30-40 cycles
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre II. Matriels et Mthodes



?8
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

dADN aux extrmits 5 et 3 avec un cocktail d'enzymes appropri. Pour rduire les
amplifications non-spcifiques, la PCR "Touchdown" a t applique aux chantillons
selon les recommandations du fabricant. Cette PCR utilise, pour les premiers cycles, une
temprature dhybridation suprieure la temprature optimale des amorces. Cycle aprs
cycle, la temprature est diminue jusqu ce quelle atteigne la temprature spcifique
("Touchdown") dhybridation des amorces (Tableau 12). En plus, lhybridation des
amorces et llongation se droulent en mme temps. Lors de ces PCR des combinaisons
entre les amorces spcifiques (LpTPS1FP, LpTPS2FP, LpTPS3FP, LpTPS1RP,
LpTPS2RP et LpTPS3RP, Tableau 9) aux fragments squencs des gnes de TPSs et
lamorce AP1 ou AP2 (Tableau 9) ont t utiliss. Les produits de la RACE-PCR de tailles
attendues ont t suivis sur gel d'agarose et traite comme ci-dessous pour le clonage et le
squenage.


Tableau 12 : Conditions des ractions
damplification par RACE-PCR "Touchdown"

Cycle Temprature Dure
Dnaturation 94 C 30 sec
Dnaturation 94 C 5 sec
x 5 cycles
Elongation 72 C 4 min
Dnaturation 94 C 5 sec
x 5 cycles
Elongation 70 C 4 min
Dnaturation 94 C 5 sec
x 20-25 cycles
Elongation 68 C 4 min
Elongation finale 68 C 7 min


La marche gnomique par PCR est une approche rapide et sensible, apparente la
RACE, qui sert trouver une squence inconnue d'ADN gnomique adjacente une autre
connue. Lapplication de cette mthode a t faite en utilisant le kit GenomeWalker
Universal (Clontech) selon les instructions du fabricant. Elle a t utile dans les cas des
TPSs de lavande pseudomatures, pour le squenage des peptides de transit
chloroplastique, dont on ne possde que les squences situes en aval du motif RRx8W
inclus.

II.9.4. Dtermination de l'expression des gnes de TPSs
La quantification relative de lexpression des gnes codants pour les TPSs de lavandes
Stoechas a t ralise grce lutilisation de la RT-PCR semi-quantitative. Cette RT-PCR
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre II. Matriels et Mthodes



??
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

est une technique rapide qui permet de quantifier de faon relative un ADN prsent dans
un chantillon. Afin de normaliser lexpression des gnes dintrts, la quantification
relative de lexpression du gne codant pour la -actine sert de rfrence. Les amorces sont
dsignes spcifiquement pour la PCR semi-quantitative (Tableau 9) avec laide du
logiciel Primer3 (voir au-dessus II.9.1.). A partir de 3 g dARNs totaux de feuilles des
lavandes Stoechas, les ADNc ont t synthtiss et utiliss comme matrice. Les PCRs de
quantification relatives de lexpression des gnes de TPSs en parallle avec celui de la -
actine ont t ralises selon les conditions ractionnelles dcrites ci-dessus (mme
section).

II.6.4. Electrophorse sur gel dagarose
Pour la sparation de fragments dADN et dARN, des lectrophorses sont ralises
en gel d'agarose 1 % (p/v) prpar dans le tampon Tris-Actate-EDTA (TAE) 1x (pH 8, 40
mM Tris base, 40 mM acide actique glacial, 1 mM EDTA) contenant 0.6 g/ml de
bromure dthydium. Les chantillons dposs sur le gel (1 l 15 l) sont au pralable
mlangs au tampon de charge 6 x (10 mM Tris-HCl pH 7.6, 0.03 % bleu de
bromophnol, 0.03 % xylne cyanol, 60 % glycrol, 60 mM EDTA, Promega), afin
dassurer leur sdimentation au fond des puits et de suivre la progression de la migration.
La migration est effectue dans du tampon TAE 1x voltage constant (85-100 V).
Lorsquun champ lectrique est appliqu au gel en prsence dune solution tampon (TAE),
les fragments dADN, chargs ngativement, migrent vers llectrode positive, une
vitesse dpendant de leur taille, de la concentration en agarose utilise et du voltage
appliqu. Laddition de bromure dthidium (BET, 0.5 g/ml final), un agent intercalant
fluorescent qui se fixe lADN en sintroduisant entre les paires de bases, permet de
visualiser lADN sous UV aprs migration. Des marqueurs de poids molculaires (1 kb
DNA ladder, 100 pb DNA ladder, Promega) sont galement dposs afin destimer la taille
des fragments. Les molcules d'ADN et d'ARN sont rvles en utilisant un trans-
illuminateur UV (254 nm) puis les gels sont photographis.

II.6.5. Purification des fragments dADN
Afin de purifier les fragments dADN dintrt, une migration dans un gel dagarose
0.8% TAE contenant le BET est effectue. Les bandes de gel contenant les fragments
dADN de taille attendue sont dcoups avec un scalpel puis purifies. La purification est
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre II. Matriels et Mthodes



1uu
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

ralise avec le kit Wizard SV Gel and PCR Clean-Up (Promega) en suivant les
instructions recommandes par le fabricant. Dans le cas o les ractions de PCR amplifient
un fragment unique, la purification est ralise directement depuis le mlange ractionnel
avec le mme kit. La quantit du fragment dADN purifi est estime par
spectrophotomtrie.

II.10. Techniques de clonage
II.10.1. Clonage de routine pour squenage
Le vecteur pGEM-T easy a t utilis pour le clonage pour squenage. Linsertion
des fragments PCR amplifis par la polymrase dADN GoTaq ou pfu dans le plasmide
pGEM-T easy est effectue sans passer par une tape de digestion enzymatique. Ce
systme implique que les produits PCR doivent possder une adnine en 3 pour tre
clons dans ce vecteur. Les PCR avec amorces dgnres sont ralises avec la
polymrase GoTaq (Promega) qui ajoute spontanment une adnine en 3 des produits de
PCR. Une raction de "A-tailing", consistant rajouter une adnine en 3 aux produits de
PCR, est ncessaire en cas de lutilisation de la pfu polymrase dADN qui gnre des
produits PCR dpourvus dadnine en 3. Pendant la "A-tailing" les adnines en 3 sont
ajoutes par une GoTaq dans un mlange ractionnel contenant le fragment dADN, les
dATP et un tampon de raction. La raction de ligation des produits de PCR dans le
pGEM-T easy est ralise dans un volume final de 5 l contenant du tampon de ligation
10x (300 mM Tris-HCl pH 7.3, 100 mM MgCl
2
, 100 mM DTT, 10 mM ATP, Promrga), 25
ng de vecteur, 15 ng dinsert et 1.5 U dADN ligase T4 (Promrga). Le mlange ractionnel
est incub une nuit 4 C. Lenzyme est inhibe par passage 70 C pendant 5 min.

II.10.2. Clonages par technologie Gateway
La technologie Gateway a t utilise pour le clonage des TPSs de lavandes Stoechas
afin de sur-exprimer leurs protines recombinantes dans E. coli. Cette mthode permet la
recombinaison directionnelle dun produit PCR et dun vecteur donneur grce une
raction de recombinaison par une topoisomrase I. Le produit de cette premire
recombinaison, appel vecteur dentre (donneur), sert de matrice une seconde
recombinaison (dite de "LR") avec un vecteur de destination pour obtenir un vecteur
dexpression (Figure 32).


t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre II. Matriels et Mthodes



1u1
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e



Figure 32 : Reprsentation schmatique du systme Gateway
attL et attR, sites de recombinaison. ccdB, gne codant pour une protine toxique pour la
plupart des souches bactriennes.



Les cadres de lecture ouverts (ORF) des TPSs tudies (sesquiTPSs en pleine longueur
et monoTPS tronques de lavandes Stoechas) ont t amplifis par PCR par la Pfu
polymrase dADN haute fidlit. Les amorces sens (Tableau 9) utilises pour ces
amplifications ont t dfinies en incorporant en 5 un site de recombinaison (CACC) pour
permettre le clonage directionnel suivi par une squence codante pour le site de clivage la
thrombine. Tandis que, les amorces antisens sont pourvues dun codon stop en 5 (Tableau
9).
Le vecteur pENTR/D-TOPO (Figure 30) est li de manire covalente une enzyme
topoisomrase I qui joue successivement les rles des enzymes de restriction et de ligation.
Cette enzyme permet le clonage directionnel de produits PCR en quelques minutes sur la
paillasse grce la reconnaissance du site CACC. A cet effet, un mlange ractionnel de
0.5 - 4 l de produit PCR + 1 l dune solution sale + 1 l vecteur pENTR/D-TOPO +
H
2
O un volume final de 6 l est ralis pour produire pENTR/D-TOPO/TPS pour chaque
TPS. Grce la recombinaison LR des clones d'expression contenant les rgions codantes
compltes de TPSs en phase avec la squence du vecteur codante pour la protine de
fusion N-terminale et pour ltiquette poly-His sont gnrs. La raction de recombinaison
LR a t ralise entre le vecteur d'entre recombinant contenant la boite attL (pENTR/D-
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre II. Matriels et Mthodes



1u2
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

TOPO/TPS) et un vecteur de destination contenant la boite attR laide du kit Clonase II
(Invitrogen) suivant les instructions du fabricant. Les vecteurs de destination
(dexpression) utiliss sont pHGWA, pHGGWA, pHMGWA, pHNGWA et pHXGWA
(Figure 31, Busso et al., 2005). Les construits obtenus (e.g. pHXGWA/LpFENS) servent
la transformation de la souche TOP10 dE. coli, pour la propagation des plasmides afin de
raliser un squenage de vrification. Une fois ralises, les squences des constructions
sont vrifies (cadres de lecture en phase) et les vecteurs dexpression recombinants sont
conservs -20 C pour une utilisation ultrieure en expression htrologue.

II.10.3. Transformation bactrienne
La transformation bactrienne est effectue par choc thermique. Le mlange de 5 l de
produit de ligation avec 50-100 l de bactries chimiocomptentes (DH5 ou JM109,
Promega), incubes pralablement dans la glace, est incub 30 min dans la glace avant
dtre transfr dans un bain marie 42C pendant 45 sec o les bactries sont
transformes par choc thermique. Aprs un passage de 2 min dans la glace, puis 5 min
temprature ambiante, les bactries sont rcupres dans 1 ml du milieu LB liquide (10 g/l
chlorure de sodium, 10 g/l tryptone, 5 g/l extrait de levure, pH 7) sans antibiotique.
Ensuite, elles sont incubes 37 C pendant 1 h sous agitation 200 rpm, pour permettre
lexpression du gne de rsistance. Le culot bactrien, obtenu aprs une centrifugation de 2
min 680 g, est remis en suspension dans environ 100 l de surnageant. Les bactries sont
tales sur milieu LB agar contenant 100 g/ml dampicilline, 8 mmol dIPTG et 2 mg de
5-bromo-4-chloro-3-indolyl--D-galactoside (X-Gal) (Horwitz et al., 1964), et places une
nuit 37 C. Les clones sont slectionns selon leur couleur grce l-complmentation
de la -galactosidase (Ullmann et al., 1967). Les bactries ayant incorpor un plasmide
vide seront bleues puisquelles traduiront lintgralit de la -galactosidase et pourront
librer le compos chromogne contenu dans le X-Gal. Celles ayant incorpor un plasmide
contenant un insert seront Lac Z
-
et formeront des colonies blanches du fait de la cration,
par lintroduction de linsert, dun dphasage du cadre ouvert de lecture dans la squence
codant pour la partie N-terminale de la -galactosidase. Les colonies blanches sont
slectionnes et mises en culture dans 5 ml de milieu LB additionn dampicilline 100
g/ml et cultives pendant une nuit 37 C sous agitation 250 rpm.
Il faut noter que lors du clonage par Gateway, et aprs transformation de la souche
TOP10, seules les bactries porteuses dun vecteur de destination recombin vont crotre.
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre II. Matriels et Mthodes



1uJ
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

En effet, la cassette de contre-slection (ccdB) prsente dans les vecteurs non recombins
(vides) est toxique pour les bactries (e.g. DH5, TOP10 F, TOP10). Lorsquil
sexprime, ccdB provoque linsertion dune arginine dans la protine A de la gyrase,
bloquant ainsi les processus de rplication de lADN.

II.10.4. Squenage dADN
Les squences dADN sont dtermines dans les deux directions par le service de
squenage automatique de la socit Eurofins MWG Operon (Ebersberg, Allemagne). Les
rsultats du squenage sont tlchargs, via le compte du BVpam sig dans le site
http://www.eurofinsdna.com/home.html, sous forme de chromatogrammes dont chaque pic
correspond une base ou sous forme FASTA. Pour une raction de squenage, les
produits PCR ou les plasmides ont t pralablement purifis et ensuite prpars en
parallle si ncessaire avec des amorces spcifiques des concentrations daprs les
recommandations denvoi au squenage. Une fois que les squences sont obtenues, elles
sont ensuite soumises diffrents logiciels pour analyses bioinformatique (in silico).

II.11. Expression htrologue de TPSs de lavandes Stoechas et mesure dactivit
II.11.1. Expression htrologue de TPSs
Pour l'expression htrologue des gnes putatifs de TPS de lavandes Stoechas, la
souche Rosetta (DE3) pLysS dE. coli a t utilise. Cette souche prsente deux avantages
majeurs pour la production de TPSs. Tout d'abord elle possde le plasmide pRARE qui
code des ARNt pour 6 codons eucaryotes rares dans les bactries E. coli. De plus, elle
possde le plasmide pLysS qui code pour le lysozyme T7 permettant de rduire le niveau
basal de production et donc de s'affranchir de tout problme de toxicit qui pourrait tre
associ la production de TPSs. L'expression du gne dintrt commence quand un grand
nombre de copies de plasmide est prsent. A cet effet, des bactries Rosetta (DE3) pLysS,
sont transformes avec les constructions dexpression (voir II.10.2.) selon le mme
protocole utilis prcdemment pour la transformation des bactries de la souche DH5 ou
JM109 (voir II.10.3.). Les bactries Rosetta (DE3) pLysS sont ensuite tales sur milieu
LB agar avec 100 g/ml dampicilline et 34 g/ml de chloramphnicol, et places une nuit
37 C. Seules les bactries recombinantes se dveloppent sur ce milieu slectif. Plusieurs
colonies sont slectionnes alatoirement. La prsence de linsert dans ces colonies est
vrifie par PCR, en utilisant les amorces spcifiques pour chaque TPS ayant permis
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre II. Matriels et Mthodes



1u4
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

damplifier les fragments clons. Des clones de Rosetta (DE3) pLysS recombinantes ont
t slectionns et cultivs pendant une nuit 37 C sous agitation 120 rpm dans 5 ml de
LB, contenant les antibiotiques appropris. Pour chaque exprience dinduction, 4 ml d'une
prculture frache a t inocule dans 200 ml de milieu TB contenant toujours les
antibiotiques appropris et mise en culture sous les conditions prcdentes. Lorsque la
DO
600nm
des cultures atteint une valeur comprise entre 0.4 et 0.8, la surexpression de la
protine recombinante est dclenche suite une induction par IPTG une concentration
finale de 0,2 mM. Juste aprs induction les cultures sont incubes pendant une nuit 16
C sous agitation 120 rpm.

II.11.2. Extraction de protines de TPSs recombinantes
Toutes les tapes dextraction et de purification ont t effectues 4 C ou dans la
glace afin dobtenir des TPSs recombinantes natives avec une activit enzymatique intacte.
Aprs surexpression de la protine recombinante de TPS, les cultures bactriennes de 200
ml sont centrifuges 5000 g, pendant 15 min. Le culot cellulaire est repris dans 10 ml de
tampon natif de liaison (50 mM NaH
2
PO
4
, 0.5 M NaCl, 20 mM imidazole, 5 % glycrol, 5
mM DTT, pH 8) additionn dinhibiteurs de protase et de lysozyme. La lyse des bactries
est renforce par sonication. Lextrait bactrien est ensuite centrifug 20 min 10000 g. Le
surnageant ainsi obtenu constitue la fraction de protines contenant la protine dintrt en
conditions natives.

II.11.3. Purification partielle de protines de TPSs recombinantes par
chromatographie daffinit sur rsine de nickel
La chromatographie daffinit sur rsine de Nickel utilise un adsorbant NTA (Nitrilo-
Tri-Acetic acid), complexant le mtal (Nickel), fix sur une rsine spharose (Clontech).
La protine recombinante, qui interagit par des interactions lectrostatiques avec le Nickel
par ltiquette poly-His (6 His), peut tre ainsi retenue sur la rsine. Dans notre cas
llution spcifique de la protine recombinante est assure grce la digestion par la
thrombine.
Aux 8 ml de surnageant rcuprs prcdemment sont ajouts environ 300 l de gel de
Nickel agarose, pralablement lav et quilibr 3 fois avec 8 ml de tampon natif de liaison.
Cette suspension est place sous agitation douce 100 rpm pendant 1 h. Aprs
centrifugation du mlange 2000 g pendant 5 min le surnageant est limin et la rsine est
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre II. Matriels et Mthodes



1u-
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

lave 5 fois avec 8 ml de tampon de lavage natif (50 mM NaH
2
PO
4
, 0.5 M NaCl, 20 mM
imidazole, pH 8) intercal par des centrifugations 2000 g pendant 5 min. Ensuite, au
dernier lavage le tampon de lavage natif est compltement limin et la rsine fixant les
TPSs recombinantes est mise en digestion avec 10 U de thrombine dans 200 l de tampon
natif de liaison pendant une nuit 4 C. Lors de la prparation des constructions
dexpression (voir II.10.2.) un site de liaison la thrombine a t introduit entre ltiquette
poly-His et le gne dintrt. Cette protase reconnat spcifiquement la squence Leu-Val-
Pro-Arg-Gly-Ser, et clive la liaison Arg-Gly. Les TPSs recombinantes spares des
protines de fusion sont utilises immdiatement dans des tests dactivit enzymatique. La
purification des protines de Rosetta (DE3) pLysS sans vecteur dexpression a t ralise
en parallle comme contrle ngatif.

II.11.4. Dosage colorimtrique des protines
La technique utilise pour la quantification des protines est la mthode
spectrophotomtrique dcrite par Bradford et al. (1976) en utilisant le ractif de Protein
Assay (BioRad). Cette technique se base sur la fixation du bleu de Coomassie R250 sur les
protines (interaction de type ionique) causant le dplacement du maximum dabsorption
du colorant de 465 nm (rouge) 595 nm (bleu). Les DO des chantillons sont mesures
595 nm laide dun spectrophotomtre Biowave II. En utilisant une gamme talon
ralise avec des quantits croissantes (0 1 mg) de lalbumine de srum de buf (BSA),
il est possible de calculer la quantit de protine prsente dans les chantillons.

II.11.5. Electrophorse sur gel dnaturant (SDS-PAGE)
Les protines sont incubes en prsence de SDS qui les dnature et leur confre une
charge globale ngative par formation de micelles mixtes protines-dtergent. Elles sont
ensuite spares sous linfluence dun champ lectrique en fonction de leur masse
molculaire, par passage travers les mailles du rseau de polyacrylamide (SDS-PAGE).
Les lectrophorses des fractions protiques obtenues lors de la purification des TPSs de
lavandes ont t ralises sur gel de polyacrylamide 10 % (paisseur 0.75 mm) en
condition dnaturantes selon la mthode Laemmli (1970).
Les chantillons protiques solubles sont dissous dans un tampon de charge (Laemmli,
1970), appel tampon de Laemmli (Tableau 13). Les chantillons sont chauffs pendant 5
mn 95 C avant dtre dposs sur gel dlectrophorse.
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre II. Matriels et Mthodes



1u6
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

Tableau 13 : Recettes du tampon de Laemmli, gels de SDS-PAGE et
tampon de migration

Tampon de Laemmli
Composant Composition
Tris pH 6.8 62.5 mM
SDS 3 %
Glycrol 10 %
Bleu de bromophnol 0.001 %
-Mercaptothanol 1.25 %
Gels d'lectrophorse
Composant Composition
Gel de concentration Gel de sparation
Acrylamide/Bisacrylamide 5 % 15 %
Tris pH 6.8 125 mM /
Tris pH 8.8 / 375 mM
SDS 0.1 % 0.1 %
Persulfate dammonium (PSA) 0.1 % 0.1 %
N,N,N',N'-Tetramethylethylenediamine
(TEMED)
0.1 % 0.04 %
Tampon de migration
Composant Composition
Tris pH 8.8 25 mM
Glycine 192 mM
SDS 0.1 %


Les extraits bruts de TPS et les diffrentes fractions d'lution ont t analyss par des
mthodes classiques sur gel de SDS-PAGE. Les gels ont t prpars et couls selon le
protocole illustr dans le Tableau 13. La polymrisation seffectue en ajoutant
extemporanment le TEMED et le persulfate dammonium. Les gels sont constitus dun
gel de sparation et dun gel de concentration. Le matriel utilis est le systme Mini-
Protean 3 (BioRad).
Les chantillons sont dposs dans un volume maximal de 20 l. Aprs chargement
des chantillons dans les puits, la migration est effectue 90 V dans le gel de
concentration, puis 180 V dans le gel de sparation dans du tampon de migration Tris-
Glycine-SDS (Tableau 13).
Aprs migration, les protines sont colores en agitant doucement le gel dacrylamide
pendant une heure dans une solution de coloration (bleu de Coomassie R 250 0.2 %,
thanol 25 %, acide actique 10 %). Ensuite, le gel est dcolor par une solution dthanol
20 %, acide actique 10 % deux fois pendant 30 min. Une phase finale de dcoloration est
ralise pendant une nuit dans leau distille. Le bleu de Coomassie permet de dtecter des
quantits de protines suprieures 50 ng.


t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre II. Matriels et Mthodes



1u
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

II.11.6. Mesure in vitro de lactivit de terpne synthases de lavandes Stoechas
Les mesures de lactivit des TPSs ont t ralises dans des flacons en verre
(Sodipro) dans un volume final de 500 l contenant de 10 20 g de TPS recombinantes,
tampon de raction (25 mM Tris-HCl, pH 7.5, 10 % glycrol, 1 mM DTT, 1 mg/ml SAB)
et les cofacteurs (10 mM MgCl
2
+ 1 mM MnCl
2
). La raction est dclenche par laddition
de 50 M GPP ou FPP ou GGPP en tant que substrat et le mlange est recouvert avec 500
l d'hexane.
Aprs une priode d'incubation de 3 18 h au bain marie 30 C, le mlange est
vortex vigoureusement pour extraire les terpnes puis centrifug pendant 35 min 2000 g
pour la sparation des phases. La phase suprieure d'hexane est recueillie, sche travers
le sulfate de sodium anhydre (Na
2
SO
4
), concentre sous un courant d'azote et analyse par
GC/MS pour la dtection des produits enzymatiques. Des contrles ngatifs ont t raliss
dans les mmes conditions en utilisant les protines purifies depuis Rosetta (DE3) pLysS
sans vecteur d'expression ou en utilisant des TPSs chauffes 95 C pendant 15 min.

II.12. Analyses bioinformatiques et statistiques de donnees
II.12.1. Alignement de squences
Les squences nuclotidiques ou dacides amins ont t alignes par paire ou plus en
utilisant lalgorithme ClustalW (Thompson et al., 1994) du logiciel BioEdit version
7.0.9.0. (Hall, 1999). Ce logiciel a t configur en options full multiple alignement et
bootstrap NJ tree = 1000, et paramtre par dfaut pour les Gap penalties. Puis, pour affiner
lalignement des squences entre elles, quelques corrections manuelles ont t apportes en
utilisant la fonction Edit du logiciel. Lalignement de squences a t sauvegard au format
FASTA pour pouvoir tre transfr vers dautres logiciels.

II.12.2. Analyses BLAST
Des recherches dhomologie ont t effectues afin de pouvoir identifier les ADNs
isols. Les bases de donnes molculaires sont riches en squences de gnes de TPSs. Des
BLAST (Basic Local Alignement Search Tool, Altschul et al., 1997) nuclotidiques ou
protiques, entre les squences de nos chantillons et celles de la base de donnes
GenBank, ont t raliss sur le site BLAST (http://blast.ncbi.nlm.nih.gov/) du NCBI
(www.ncbi.nlm.nih.gov). Lalgorithme renvoie certains paramtres qui permettent de
dterminer sil y a une cohrence entre les alignements. Plus la E-value (probabilit que la
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre II. Matriels et Mthodes



1u8
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

squence similaire retrouve lait t par hasard) est faible, plus lalignement est
significatif. Ainsi, en cas de besoin, des squences nuclotidiques ou protiques ont t
tlcharges en format FASTA depuis le site NCBI.

II.12.3. Prdiction de peptide de transit chloroplastique (CTP)
Loutil bioinformatiques ChloroP (Emanuelsson et al., 1999) du centre d'analyse des
squences biologiques (CBS) de l'Universit technique de Danemark (DTU) a t utilis
dans ce travail pour la prdiction de la prsence dun peptide signal de nos TPSs de
lavandes. Le serveur ChloroP 1.1 (accessible gratuitement en ligne
http://www.cbs.dtu.dk/services/ChloroP/), prdit la prsence de peptides de transit
chloroplastique (CTP) dans les squences protiques et la localisation des sites potentiels
de clivage de CTP.

II.12.4. Autres prdictions
La prdiction des ORFs, des poids molculaires et des compositions en acides amins
de squences nuclotiques ou protiques des TPSs de lavandes a t ralises en utilisant le
logiciel BioEdit. Les valeurs protiques thoriques des points isolectriques (pI) ont t
calcules en utilisant l'outil bioiformatique pI disponible dans le site web ExPASy
http://web.expasy.org/compute_pi (Bjellqvist et al., 1993).

II.12.5. Analyses phylogntiques
La premire analyse phylogntique a t ralise avec 62 squences protiques de
TPSs de Lamiaces disponibles sur GenBank en fvrier 2008 (Figure 45). A laide du
logiciel CLC viewer 4, les squences ont t alignes selon un algorithme dalignement
propre ce logiciel, et un arbre a t gnr par lalgorithme UPGMA (Unweighted Pair
Group Method with Arithmetic mean). Lanalyse de "bootstraps" a t calcule partir de
100 rptitions.
Pour la deuxime analyse phylogntique (Figure 52), la version 4 du software MEGA
(Tamura et al., 2007) a t utilise aprs une tape dalignement initiale de squences de
TPSs effectue par ClustalW (BioEdit). Les squences dacides amins choisies de TPSs
caractrises fonctionnellement et reprsentant les diffrentes sous-familles de TPSs (TPSa
- TPSh) ont t rcupres de la base de donnes GenBank (NCBI). Les squences de
TPSs de lavandes Stoechas clones dans ce travail, LpFENS, LpPINS, LpGEAS, LsFENS,
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre II. Matriels et Mthodes



1u?
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

LsPINS, LsGEAS, LvFENS, LvPINS et LvGEAS, sont galement rpertories dans la base
de donnes du GenBank sous les numros daccession, JX501511, JX501512, JX501513,
JX501514, JX501515, JX501516, JX501517, JX501518 et JX501519, respectivement.
Larbre et la longueur des branches ont t obtenus selon l'algorithme "neighbor-joining"
(NJ, (Saitou & Nei, 1987) bas sur le nombre de substitution par site. Les distances
volutives ont t calcules en utilisant la mthode de correction de Poisson (Zuckerkandl
& Pauling, 1965). La solidit de la topologie de l'arbre de NJ a t value l'aide d'une
analyse de "bootstrap" avec 5000 rplications. Les distances par paire de diffrents
alignements ont t calcules par ressemblance maximum en utilisant le logiciel MEGA.

II.12.6. Analyses statistiques
L'analyse typologique (distance euclidienne et mthode 1-r de Pearson) pour mettre en
vidence l'existence de chmotypes, a t ralise avec le logiciel STATISTICA version
5.1 (Stat Soft, Inc, Tulsa, OK, USA) sur les donnes quantitatives (composition en
pourcentage dtermin par GC/FID) de quatre constituants principaux des HEs de 11
chantillons de populations algriennes de L. stoechas.
Pour lidentification des composs de lHE potentiellement associs des activits
biologiques, les coefficients de corrlation de Pearson ont t calculs entre les abondances
des composs et les activits biologiques en question. Pour faciliter l'interprtation des
rsultats, les valeurs IC
50
de lactivit antioxydante estime par le test au DPPH ont t
transformes en 100-IC
50
pour avoir des valeurs qui augmentent avec laugmentation du
pouvoir antioxydant. La signification de la corrlation par paires de composants de lHE a
t teste aprs correction de Bonferroni pour les comparaisons multiples. Le niveau de
signification a t fix alpha = 0.05 et p < 0.005 a t accept comme significatif.











t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre III. Rsultats et Discussion



11u
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e



















R
RE ES SU UL LT TA AT TS S
E ET T D
DI IS SC CU US SS SI IO ON N


















t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre III. Rsultats et Discussion



111
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e



















I II II I. .1 1. . V Va ar ri ia at ti io on n e et t b bi io od di iv ve er rs si it t d de es s H HE Es s a ac cc cu um mu ul l e es s p pa ar r d de es s p po op pu ul la at ti io on ns s
a al lg g r ri ie en nn ne es s d de e L L. . s st to oe ec ch ha as s


I II II I. .2 2. . A Ac ct ti iv vi it t s s b bi io ol lo og gi iq qu ue es s d de es s H HE Es s a ac cc cu um mu ul l e es s p pa ar r d de es s p po op pu ul la at ti io on ns s
a al lg g r ri ie en nn ne es s d de e L L. . s st to oe ec ch ha as s


I II II I. .3 3. . V Va ar ri ia at ti io on n e et t b bi io od di iv ve er rs si it t d de es s C CO OV Vs s c ch he ez z L L. . s st to oe ec ch ha as s
S Se en ns su u L La at to o


I II II I. .4 4. . B Bi io os sy yn nt th h s se e d de es s t te er rp p n ne es s c ch he ez z L L. . s st to oe ec ch ha as s
S Se en ns su u L La at to o
















t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre III. Rsultats et Discussion



112
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

III.1. Variation et biodiversit des HEs accumules par des populations
algriennes de L. stoechas

III.1.1. Introduction
Les huiles essentielles (HEs) sont des mlanges naturels complexes de mtabolites
secondaires volatils, isols des plantes par plusieurs techniques. Lhydrodistillation et
lentranement la vapeur deau restent les moyens les plus employs pour produire les
HEs, en particulier des fins commerciales. Le volume dHE rcupr est variable, chez
une mme plante, en fonction de plusieurs facteurs biotiques et abiotiques. Parmi les
composants majoritaires des HEs, les terpnes sont les plus couramment rencontrs. Ils
possdent un rle cologique important. Par ailleurs, les plantes aromatiques productrices
dHEs, ont fait lobjet de diverses recherches en particulier dans le domaine de la
parfumerie et des industries agroalimentaire et pharmaceutique.
La diversification de la production dHEs ne peut tre envisage que si la
caractrisation de ces substances naturelles est ralise et celle-ci passe par la connaissance
de la composition chimique, qui constitue un facteur dterminant en vue de leur
commercialisation. La caractrisation de ces substances naturelles ncessite la mise en
uvre de diverses techniques analytiques qui permettent non seulement dapprcier sa
valeur marchande, mais aussi de raliser le contrle de la qualit ou encore de mettre en
vidence une ventuelle spcificit vis--vis dune norme pr-tablie. Ltude des HEs est
toujours dune brlante actualit malgr son anciennet et les dveloppements exponentiels
des biotechnologies vgtales. LAlgrie, de part sa position gographique, possde
plusieurs facteurs de pdogense et des zones bioclimatiques contrastes auxquels
sajoutent des ressources hydriques. Tous ces facteurs sont favorables au dveloppement
des cultures intensives des plantes aromatiques et mdicinales.
Conventionnellement, lidentification des constituants des mlanges naturels peut tre
ralise laide de diffrentes techniques analytiques, en fonction de lobjectif fix, de la
complexit du mlange et de la nature des constituants. Lanalyse des HEs est une
opration dlicate qui ncessite la mise en uvre de plusieurs techniques. Lapproche la
plus couramment employe, est lutilisation du couplage dune technique
chromatographique, gnralement la chromatographie gazeuse permettant
lindividualisation des constituants, avec une technique de visualisation, gnralement la
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre III. Rsultats et Discussion



11J
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

spectromtrie de Masse, permettant lidentification des constituants par comparaison des
donnes de masses des produits de fragmentation avec celles de produits de rfrence ou
celles contenues dans des banques de spectres. Les donnes de spectres de masse sont
systmatiquement associes lutilisation des indices de rtention, qui sont calculs
partir des temps de rtention des produits dintrt et de ceux dune gamme talon
dalcanes. Des molcules structurellement proches peuvent en effet prsenter des spectres
de masse similaires et un gradient chromatographique ne peut pas sparer lensemble des
substances dun mlange. La probabilit que deux substances aient le mme indice de
rtention et le mme spectre de masse est cependant rare (sauf pour des stroisomres).
La combinaison de ces deux informations est donc ncessaire pour assoir une identification
de compos.
L. stoechas est lespce de lavande qui possde la plus grande aire de rpartition
puisquelle couvre presque tout le pourtour mditerranen sauf un petit arc lest allant du
Liban la Lybie. Son centre de biodiversit, et probablement dorigine, est le sud de la
pninsule ibrique (Upson & Andrews, 2004). Si 2 sous-espces (stoechas et luisieri) y
cohabitent, une seule, L. stoechas subsp. stoechas en sort. Cette espce de lavande est trs
courante dans la partie nord de lAlgrie o elle se rencontre de manire spontane des
altitudes assez variables. Elle est utilise dans de nombreuses rgions dAlgrie pour ses
HEs ou sous forme dherbe sche pour des prparations alimentaires comme celle du
couscous. Elle nest pas cultive mais prleve dans le compartiment sauvage. Des
analyses compositionnelles ralises sur de nombreuses populations sauvages ont
dmontr lexistence de plusieurs chmotypes poussant des fois de manire sympatrique.
Ces donnes sont cependant trs fragmentes dun point de vue gographique et sont
quasiment absentes pour des populations dorigine algrienne. Les analyses entreprises ici
ont eu pour but damliorer les connaissances actuelles sur la composition chimique des
HEs de L. stoechas et de dterminer si des variations chmotypiques existent au sein des
populations algriennes. Les HEs des parties ariennes fleuries rcoltes sur onze
populations couvrant laire de rpartition de cette espce en Algrie (Tableau 5, Figure 28),
ont t extraites puis soumisses des analyses compositionnelles par GC/FID et GC/MS.
Ces rsultats ont donn lieu une publication (Benabdelkader et al., 2011, Annexe I).



t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre III. Rsultats et Discussion



114
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

III.1.2. Rsultats
III.1.2.1. Rendements en huile essentielle de 11 populations algriennes de L. stoechas
Les extractions par hydrodistillation conventionnelle des parties ariennes fleuries de
L. stoechas ont t optimises puis ralises dans des conditions opratoires strictement
identiques sur 11 populations algriennes sauvages. Ces extractions ont fourni des HEs
ayant des colorations variables allant du jaune claire au jaune relativement fonc mais
ayant toujours une trs forte, et persistante, odeur caractristique de L. stoechas. Les
rendements en HEs des populations de L. stoechas sont exposs dans la Figure 33. Les
valeurs reprsentent la moyenne des rendements dextraction obtenus sur 3 extractions
indpendantes sauf pour les populations LS1, LS2, LS7 et LS11 pour lesquelles une seule
extraction a t ralise. Les 11 populations tudies ont prsent des rendements
variables, allant de 0.34 % 1.63 % (m/m, poids sec). Il est noter que les meilleurs
rendements (1.14 - 1.63 %) ont t obtenus sur les populations LS5, LS8, LS3 et LS6.
Toutes ces populations sont situes dans la rgion nord-centre dAlgrie pas loin dAlger la
capitale (LS5 et LS6 de la wilaya de Bouira, LS8 de la wilaya de Blida et LS3 de la wilaya
de Boumerdes, Figure 28). Cependant, dautres populations de la mme rgion de Bouira
avaient des rendements faibles. Cest le cas des populations LS4 et LS7 qui avaient des
rendements respectifs de 0.52 % et 0.60 %. Ainsi, les populations LS4, LS5, LS6 et LS7
rcoltes presque de la mme localit (wilaya de Bouira), prsentaient une variabilit
importante de rendements, s'tendant de 0.52 % 1.63 %.

















Figure 33 : Variation des rendements dextractions par hydrodistillation
des HEs de populations algriennes de L. stoechas

t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre III. Rsultats et Discussion



11-
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

III.1.2.2. Composition chimique des huiles essentielles de 11 populations algriennes
de L. stoechas
Les HEs des populations de L. stoechas originaires de 11 localits diffrentes
d'Algrie ont t soumises des analyses dtailles par GC/FID et GC/MS.
Lidentification des constituants a t ralise par lutilisation des indices de rtention (IR)
sur colonne polaire et apolaire, par lanalyse des spectres de masse des composs
constitutifs et par la comparaison de ces donnes celles de bases de donnes
lectroniques, WILEY et NIST, de bases bibliographiques (Adams, 2007 ; Joulain &
Knig (1998) et celles obtenues sur des composs standards purs. Les constituants
identifis sont lists dans le Tableau 14 selon leur ordre d'lution sur la colonne apolaire
HP-1. Leurs indices de rtention sur deux colonnes capillaires, apolaire HP-1 et polaire
INNOWAX-1, leurs pourcentages relatifs (quantification base sur les analyses GC/FID
sur colonne HP-1) ainsi que les mthodes d'identification sont galement rpertories dans
le Tableau 14.
Ces analyses chimiques ont permis d'identifier 121 composs dont la teneur est
suprieure ou gale 0.01 %. Ces 121 composs ont une aire cumule qui correspond
69.88 - 91.2 % des aires cumules de l'ensemble des constituants des HEs. Au minimum
73 composs sont identifis dans lHE extraite de la population LS6 et au maximum 111
pour celle extraite de la population LS8. Au meilleur de notre connaissance, 83 de ces
composs sont dtects ici pour la premire fois dans une HE de L. stoechas algrienne et
54 n'avaient jamais t rapportes sur aucune HE de L. stoechas (voir composs portant
lexposant
e
et
f
, respectivement, dans le Tableau 14). De plus, 66 constituants ont t
communment dtects dans les onze populations, alors que les autres composs nont t
dtects que dans une, ou un sous-jeu de, population.








t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre III. Rsultats et Discussion



116
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

Tableau 14 : Compositions chimiques des huiles essentielles des parties ariennes fleuries de onze populations algriennes sauvages de L.
stoechas

Constituant
a
IR
b
IR
c

Composition (%)
Identification
d

LS1 LS2 LS3 LS4 LS5 LS6 LS7 LS8 LS9 LS10 LS11
Benzaldehyde
e
929 1546 -
g
- - - - - - tr
h
- - - GC, MS
-Pinene 932 1037 - - - - - - - 0.06 - - - GC,MS, CoGC
-Fenchene 943 1077 - - - - - - - 0.03 - - - GC,MS
Camphene
f
945 1088 tr - - - - - - 0.11 - - - GC,MS
Verbenene
f
948 1147 - - - - - - - tr - - - GC,MS, CoGC
Hexanoic acid
e,f
949 1860 0.37 - 0.11 0.29 - - - - 0.3 0.19 0.13 GC,MS
1-Octen-3-ol
f
959 1463 0.07 - - 0.07 - - - 0.02 0.14 0.07 - GC,MS
-Pinene 972 1129 - - - - - - - 0.03 - - - GC,MS, CoGC
2,3-Dehydro 1,8-cineole
e,f
979 1211 - - - - - - - 0.04 - - - GC,MS
Lavander lactone
e,f
998 1700 0.21 0.1 0.13 0.06 0.08 0.26 0.17 0.06 0.16 0.12 0.11 GC,MS
-Phellandrene 999 1185 - - - - - - - 0.01 - - - GC,MS
Benzyl alcohol
e,f
1004 1881 0.19 - 0.09 0.07 - - 0.15 0.04 0.24 0.11 0.05 GC,MS
-3-Carene 1007 1173 - - - - - - - 0.12 - - - GC,MS, CoGC
o-Cymene
f
1010 1287 - 0.05 0.2 0.12 0.03 - 0.11 0.06 - 0.19 0.22 GC,MS
-Terpinene 1011 1202 - 0.07 0.2 0.12 0.11 - 0.09 0.03 - 0.12 0.02 GC,MS, CoGC
p-Cymene 1013 1295 - 0.08 tr tr 0.1 - 0.44 0.22 - - - GC,MS, CoGC
Limonene
f
1023 1219 - - - - - tr - - - - - GC,MS, CoGC
1,8-Cineol 1023 1229 0.16 8.71 8.49 4.28 4.19 2.21 1.3 7.51 2.63 5.69 7.85 GC,MS, CoGC
o-Cresol
e,f
1034 - - - - - - - - 0.03 0.07 0.05 - MS
p-Cresol
e,f
1046 2062 0.08 tr tr 0.05 - - 0.05 0.07 0.09 - - GC,MS
-Terpinene 1050 1269 tr tr tr tr tr tr tr 0.03 tr tr tr MS
trans-Thujan-4-ol
f
1054 1482 0.05 - - - 0.11 0.12 0.07 0.11 tr 0.06 0.11 GC,MS
cis-Linalool oxide (furanoid)
f
1058 1463 0.26 0.41 0.21 0.5 0.25 1.15 0.37 0.39 0.45 0.45 0.38 GC,MS
Camphenilone
e,f
1060 1486 0.12 0.06 tr 0.05 tr tr 0.11 0.02 0.04 0.05 0.07 GC,MS
Fenchone 1068 1427 11.27 37.48 24.11 24.14 36.76 16.35 14.56 34.48 26.52 29.92 32.42 GC,MS, CoGC
p--Dimethyl styrene
e,f
1073 1463 - - - - - - - 0.09 - - - GC,MS
trans-Linalool oxide (furanoid)
f
1073 1491 0.34 0.4 0.22 0.39 0.29 1.01 0.29 0.33 0.38 0.35 0.35 GC,MS
C
h
a
p
i
t
r
e

I
V
.

R

s
u
l
t
a
t
s

e
t

D
i
s
c
u
s
s
i
o
n


T
h

s
e

d
e

D
o
c
t
o
r
a
t

E
c
o
l
e

N
o
r
m
a
l
e

S
u
p

r
i
e
u
r
e

d
e

K
o
u
b
a
-
A
l
g
e
r
/
U
n
i
v
e
r
s
i
t


J
e
a
n

M
o
n
n
e
t

d
e

S
a
i
n
t

E
t
i
e
n
n
e

B B
i i
o o
d d
i i
v v
e e
r r
s s
i i
t t

, ,

B B
i i
o o
a a
c c
t t
i i
v v
i i
t t


e e
t t

B B
i i
o o
s s
y y
n n
t t
h h

s s
e e

d d
e e
s s

C C
o o
m m
p p
o o
s s
e e
s s

T T
e e
r r
p p

n n
i i
q q
u u
e e
s s

V V
o o
l l
a a
t t
i i
l l
s s

d d
e e
s s

L L
a a
v v
a a
n n
d d
e e
s s

A A
i i
l l

e e
s s
, ,

L L
a a
v v
a a
n n
d d
u u
l l
a a

s s
t t
o o
e e
c c
h h
a a
s s

S S
e e
n n
s s
u u

L L
a a
t t
o o
, ,

u u
n n

C C
o o
m m
p p
l l
e e
x x
e e

d d

E E
s s
p p

c c
e e
s s

M M

d d
i i
t t
e e
r r
r r
a a
n n

e e
n n
n n
e e
s s

d d

I I
n n
t t

r r

t t

P P
h h
a a
r r
m m
a a
c c
o o
l l
o o
g g
i i
q q
u u
e e

Suite du tableau la page suivante


1
1
6

t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre III. Rsultats et Discussion



11
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

Tableau 14 (suite)

Constituant
a
IR
b
IR
c

Composition (%)
Identification
d

LS1 LS2 LS3 LS4 LS5 LS6 LS7 LS8 LS9 LS10 LS11
Terpinolene 1080 1308 tr tr tr tr tr tr tr 0.01 tr tr tr MS
Nonanal
e,f
1082 1414 0.02 - - - - - - - 0.05 - tr MS
Linalool 1084 1561 0.36 0.48 0.15 0.5 0.23 1.06 0.45 0.15 0.46 0.37 0.53 GC,MS, CoGC
cis-Thujan-4-ol
f
1084 1569 0.06 - - - 0.1 - - 0.11 0.07 0.1 0.1 GC,MS
Hotrienol
e,f
1084 1627 0.12 0.07 tr - 0.03 tr tr 0.01 tr 0.1 tr GC,MS
Phenethyl alcohol
e,f
1084 1936 0.12 tr 0.43 0.1 0.09 0.13 0.24 0.04 0.05 0.12 0.27 GC,MS, CoGC
-Thujone
e,f
1087 1463 0.08 0.16 0.19 0.15 0.14 0.14 0.25 0.08 0.29 0.2 0.14 GC,MS
-Fenchol 1099 1607 0.42 1.37 0.61 0.75 1.01 0.58 0.93 1.0 1.3 0.79 0.8 GC,MS, CoGC
Chrysanthenone
f
1100 1505 0.1 0.13 0.16 0.22 0.06 0.01 0.65 0.13 tr 0.09 0.09 GC,MS
cis-p-2,8-Menthadien-1-ol
f
1104 1649 0.05 0.11 0.06 tr 0.08 - - 0.08 - - - GC,MS
-Campholenal
f
1105 1510 0.16 0.22 0.24 0.17 0.29 0.13 0.27 0.15 0.21 0.23 0.19 GC,MS
cis-Pinan-2-ol
e,f
1107 - 0.05 0.19 0.19 0.11 - 0.16 0.11 0.15 0.15 0.23 0.22 MS
Nopinone
e,f
1108 1616 tr 0.12 0.01 0.07 - 0.05 0.1 0.19 0.1 0.08 0.14 GC,MS
Camphor 1121 1556 9.77 5.81 1.94 17.12 15.50 21.8 11.56 8.69 8.99 13.19 14.52 GC,MS, CoGC
trans-Pinocarveol
f
1124 1683 0.42 0.37 1.61 0.24 0.22 0.22 0.94 0.24 0.33 0.37 0.29 GC,MS
cis-Verbenol
f
1125 1675 0.45 0.56 0.45 0.3 0.22 0.34 0.36 0.28 0.46 0.54 0.48 GC,MS
Sabina ketone
e,f
1125 1668 0.04 0.07 0.12 tr 0.03 0.01 0.05 0.06 0.06 0.06 0.11 GC,MS
trans-Verbenol
f
1127 1699 3.0 2.33 0.11 1.0 0.83 0.76 0.7 0.03 1.29 1.33 0.58 GC,MS
-Phellandrene-8-ol
e,f
1130 1727 tr 0.18 tr 0.13 tr - - tr tr tr 0.13 GC,MS
exo-Methyl-camphenilol
e,f
1133 1625 0.14 0.09 0.21 0.1 0.18 0.09 0.35 0.1 0.14 0.1 0.1 GC,MS
Pinocarvone
f
1139 1604 0.19 0.31 0.14 0.3 0.13 0.13 0.25 0.3 0.17 0.19 0.26 GC,MS
-Phellandrene-8-ol
e,f
1145 1735 0.16 0.15 0.02 0.52 0.19 0.15 0.25 0.32 0.18 0.16 tr GC,MS
-Terpineol
e,f
1146 1699 0.05 0.5 0.64 0.16 0.13 0.76 0.45 0.26 0.34 0.57 0.88 GC,MS, CoGC
cis-Linalool oxide (pyranoid)
e,f
1148 1762 0.51 0.18 tr 0.18 0.1 0.29 0.15 0.17 0.29 0.42 0.16 GC,MS
Borneol 1150 1720 1.13 0.2 0.21 0.71 0.73 0.52 0.95 0.32 0.63 0.87 0.29 GC,MS, CoGC
Lavandulol 1150 1688 0.20 0.11 0.21 0.09 0.08 0.11 0.13 0.11 0.3 0.29 0.18 GC,MS, CoGC
trans-Linalool oxide (pyranoid)
e,f
1152 1783 0.42 0.21 tr 0.18 0.15 0.2 0.28 0.16 0.35 0.37 0.23 GC,MS
p-Methylacetophenone
e,f
1154 1803 0.18 0.16 0.28 0.11 0.11 0.29 0.4 0.18 0.18 0.22 0.18 GC,MS
C
h
a
p
i
t
r
e

I
V
.

R

s
u
l
t
a
t
s

e
t

D
i
s
c
u
s
s
i
o
n


C
h
a
p
i
t
r
e

I
V
.

R

s
u
l
t
a
t
s

e
t

D
i
s
c
u
s
s
i
o
n


C
h
a
p
i
t
r
e

I
V
.

R

s
u
l
t
a
t
s

e
t

D
i
s
c
u
s
s
i
o
n


T
h

s
e

d
e

D
o
c
t
o
r
a
t

E
c
o
l
e

N
o
r
m
a
l
e

S
u
p

r
i
e
u
r
e

d
e

K
o
u
b
a
-
A
l
g
e
r
/
U
n
i
v
e
r
s
i
t


J
e
a
n

M
o
n
n
e
t

d
e

S
a
i
n
t

E
t
i
e
n
n
e

B B
i i
o o
d d
i i
v v
e e
r r
s s
i i
t t

, ,

B B
i i
o o
a a
c c
t t
i i
v v
i i
t t


e e
t t

B B
i i
o o
s s
y y
n n
t t
h h

s s
e e

d d
e e
s s

C C
o o
m m
p p
o o
s s
e e
s s

T T
e e
r r
p p

n n
i i
q q
u u
e e
s s

V V
o o
l l
a a
t t
i i
l l
s s

d d
e e
s s

L L
a a
v v
a a
n n
d d
e e
s s

A A
i i
l l

e e
s s
, ,

L L
a a
v v
a a
n n
d d
u u
l l
a a

s s
t t
o o
e e
c c
h h
a a
s s

S S
e e
n n
s s
u u

L L
a a
t t
o o
, ,

u u
n n

C C
o o
m m
p p
l l
e e
x x
e e

d d

E E
s s
p p

c c
e e
s s

M M

d d
i i
t t
e e
r r
r r
a a
n n

e e
n n
n n
e e
s s

d d

I I
n n
t t

r r

t t

P P
h h
a a
r r
m m
a a
c c
o o
l l
o o
g g
i i
q q
u u
e e


Suite du tableau la page suivante

1
1


t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre III. Rsultats et Discussion



118
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

Tableau 14 (suite)

Constituant
a
IR
b
IR
c

Composition (%)
Identification
d

LS1 LS2 LS3 LS4 LS5 LS6 LS7 LS8 LS9 LS10 LS11
m-Cymene-8-ol
e,f
1155 1867 0.14 0.23 2.06 2.02 1.7 0.42 0.42 3.21 0.79 0.11 0.81 GC,MS
p-Cymene-8-ol 1160 1874 2.64 1.32 2.0 1.81 1.60 1.31 1.78 2.77 2.74 1.53 1.83 GC,MS
Terpinene-4-ol 1162 1622 0.32 0.5 1.17 0.31 0.18 0.3 2.14 0.4 0.35 0.35 0.5 GC,MS, CoGC
Myrtenal
f
1170 1665 0.43 0.5 0.48 0.36 0.33 0.27 0.43 0.36 0.56 0.49 0.47 GC,MS
-Terpineol 1172 1715 0.22 0.55 0.62 0.21 0.3 0.41 0.37 0.41 0.53 0.39 0.96 GC,MS, CoGC
Methyl chavicol
e,f
1175 1705 - 0.26 0.64 0.16 0.17 - 0.28 0.09 0.05 0.23 0.15 GC,MS
Myrtenol 1179 1821 0.59 0.66 0.56 0.41 0.3 0.47 0.66 0.56 1.13 0.8 0.64 GC,MS
Verbenone 1180 1749 2.67 2.18 1.22 1.78 1.43 0.7 1.36 2.07 1.49 1.22 0.9 GC,MS
trans-Piperitol
e,f
1191 1775 - - - 0.15 - - - - - - - GC,MS
trans-Carveol
f
1197 1860 0.88 0.81 0.69 0.42 0.59 0.48 0.71 0.4 0.86 0.57 0.54 GC,MS
exo-2-Hydroxycineole
e,f
1198 1881 0.18 tr 0.22 0.09 0.03 0.04 0.35 0.14 0.55 0.49 0.34 GC,MS
-Fenchyl-acetate
f
1207 1495 tr 0.37 0.12 0.12 0.15 0.2 0.28 0.36 0.21 0.31 0.25 GC,MS
Cuminaldehyde
f
1213 1821 tr 0.06 0.15 0.26 0.13 tr 0.08 0.08 0.23 0.05 0.28 GC,MS
Carvone 1215 1769 0.52 0.74 0.83 0.34 0.52 0.46 0.71 0.58 0.71 0.67 0.79 GC,MS, CoGC
cis-Piperitone oxide
e,f
1222 - 0.74 0.09 0.48 0.29 0.29 0.13 0.58 0.45 0.59 0.31 0.15 GC,MS
2-Phenylethyl acetate
e
1225 1839 0.08 - 0.4 tr tr - 0.08 0.12 0.29 0.12 0.17 GC,MS, CoGC
trans-2-Hydroxy pinocamphone
e,f
1226 - 0.18 - - - 0.06 - - - - - - MS
Piperitone
f
1226 1764 0.11 - - 0.08 0.18 - 0.19 - - - - GC,MS
trans-Piperitone oxide
e,f
1232 - 0.85 0.26 tr 0.1 0.33 0.3 0.32 0.11 0.3 0.22 0.1 GC,MS
Geraniol
e,f
1233 1866 0.14 0.09 - 0.23 - - 0.29 0.17 0.21 0.12 0.28 GC,MS, CoGC
Perillaldehyde
e,f
1245 1829 0.18 0.13 0.17 0.13 0.14 0.21 1.31 0.12 0.27 0.26 0.18 GC,MS
Cuminol
e,f
1263 2134 - - - - - - - 0.09 - 0.25 0.18 GC,MS
Thymol
f
1267 2213 tr - - 0.09 - - - tr tr tr tr GC,MS, CoGC
-Necrodyl acetate
f
1269 1601 - - 0.83 - - - 1.34 - - - - GC,MS
Bornyl acetate 1270 1612 2.82 0.47 0.46 2.36 3.03 3.73 4.0 1.61 1.52 3.12 0.92 GC,MS, CoGC
Lavandulyl acetate 1271 1606 0.13 tr tr tr 0.05 tr tr 0.08 0.11 0.11 0.08 GC,MS, CoGC
Undecanone-2
e,f
1273 1619 - - 0.61 0.4 tr - - - - - - GC,MS
Carvacrol
f
1276 2240 tr - - 0.24 - - - 0.02 tr tr tr GC,MS, CoGC
C
h
a
p
i
t
r
e

I
V
.

R

s
u
l
t
a
t
s

e
t

D
i
s
c
u
s
s
i
o
n


T
h

s
e

d
e

D
o
c
t
o
r
a
t

E
c
o
l
e

N
o
r
m
a
l
e

S
u
p

r
i
e
u
r
e

d
e

K
o
u
b
a
-
A
l
g
e
r
/
U
n
i
v
e
r
s
i
t


J
e
a
n

M
o
n
n
e
t

d
e

S
a
i
n
t

E
t
i
e
n
n
e

B B
i i
o o
d d
i i
v v
e e
r r
s s
i i
t t

, ,

B B
i i
o o
a a
c c
t t
i i
v v
i i
t t


e e
t t

B B
i i
o o
s s
y y
n n
t t
h h

s s
e e

d d
e e
s s

C C
o o
m m
p p
o o
s s
e e
s s

T T
e e
r r
p p

n n
i i
q q
u u
e e
s s

V V
o o
l l
a a
t t
i i
l l
s s

d d
e e
s s

L L
a a
v v
a a
n n
d d
e e
s s

A A
i i
l l

e e
s s
, ,

L L
a a
v v
a a
n n
d d
u u
l l
a a

s s
t t
o o
e e
c c
h h
a a
s s

S S
e e
n n
s s
u u

L L
a a
t t
o o
, ,

u u
n n

C C
o o
m m
p p
l l
e e
x x
e e

d d

E E
s s
p p

c c
e e
s s

M M

d d
i i
t t
e e
r r
r r
a a
n n

e e
n n
n n
e e
s s

d d

I I
n n
t t

r r

t t

P P
h h
a a
r r
m m
a a
c c
o o
l l
o o
g g
i i
q q
u u
e e



Suite du tableau la page suivante

1
1
8

t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre III. Rsultats et Discussion



11?
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

Tableau 14 (suite)

Constituant
a
IR
b
IR
c

Composition (%)
Identification
d

LS1 LS2 LS3 LS4 LS5 LS6 LS7 LS8 LS9 LS10 LS11
Inconnu (MM150 et MM164) 1276 - 0.46 - 2.03 1.6 2.18 0.58 0.51 2.39 1.32 0.27 1.25 MS
Filifolide A
e,f
1278 - 0.58 0.14 tr 0.12 tr - - 0.06 0.17 0.11 tr MS
Myrtenyl acetate
f
1305 1704 1.27 0.61 2.17 1.69 1.62 2.54 1.72 1.01 2.51 1.68 2.14 GC,MS, CoGC
Piperitenone
f
1308 1967 0.14 tr tr 0.08 tr tr tr 0.03 0.09 tr tr GC,MS
Eugenol
e,f
1327 2196 0.20 0.08 0.13 0.19 - 0.08 0.44 0.04 0.29 0.23 0.08 GC,MS, CoGC
Inconnu (MM168) 1351 2157 1.02 - - 0.21 0.36 0.44 0.29 0.13 0.19 0.21 0.14 MS
Cyclosativene
f
1369 1506 0.06 0.11 0.1 0.24 0.07 - - 0.11 - 0.16 0.07 GC,MS
-Copaene 1377 1517 tr tr tr 0.06 - - - 0.06 - 0.08 0.06 GC,MS, CoGC
Sativene
e,f
1391 1569 - - - - - - - 0.02 - - - GC,MS
trans--Caryophyllene
f
1419 1628 - - - - - - - 0.08 - - - GC,MS, CoGC
allo-Aromadendrene
f
1459 1681 - - - - - - - 0.09 - - - GC,MS
-Selinene
e,f
1482 1750 0.21 0.11 - 0.05 - - 0.11 0.05 - 0.13 - GC,MS
Dihydroactinidiolide
e,f
1486 - 0.17 - - - - - - - - - - MS
epi-Cubebol
e,f
1488 1967 0.57 0.52 0.15 0.47 0.17 0.33 0.14 0.26 0.34 1.0 0.52 GC,MS
Ledene
f
1491 1730 0.16 0.15 - 0.36 - - - 0.09 0.28 0.25 0.14 GC,MS
-Muurolene 1494 1753 0.16 0.25 - 0.19 - 0.13 0.14 0.10 0.17 0.13 0.08 GC, MS, CoGC
-Cadinene 1508 1792 0.05 0.03 0.12 0.06 tr 0.01 0.02 0.04 0.1 0.26 0.06 GC,MS
Cubebol
e,f
1509 1914 0.38 0.71 0.44 0.25 0.16 0.29 0.32 0.29 0.38 0.15 0.67 GC,MS
Calamenene
f
1510 1860 0.15 tr 0.21 0.2 tr 0.12 0.1 0.12 0.08 0.21 0.11 GC,MS
-Amorphene
e,f
1511 1730 0.23 0.59 0.18 0.46 tr 0.17 0.22 0.15 0.2 0.59 0.32 GC, MS
-Cadinene 1515 1787 0.11 tr tr tr tr tr tr 0.04 0.04 0.12 0.06 GC,MS
Cadina-1,4-diene
e,f
1525 1816 0.18 tr - 0.14 - - - 0.06 - 0.12 - GC,MS
-Calacorene
e,f
1529 1946 - tr - 0.18 - 0.16 - 0.12 0.11 0.2 - GC,MS
Myrtenyl valerate
e,f
1542 - 0.69 0.56 0.33 0.26 0.22 0.45 0.24 0.1 0.14 0.41 0.2 GC,MS
cis--Copaene-8-ol
e,f
1550 2077 0.54 0.57 0.7 0.28 0.39 1.24 - 0.38 0.3 0.45 1.06 GC,MS
Palustrol
e,f
1562 1973 0.27 tr 0.17 0.15 tr 0.21 0.15 0.11 tr 0.14 tr GC,MS
Suite du tableau la page suivante


C
h
a
p
i
t
r
e

I
V
.

R

s
u
l
t
a
t
s

e
t

D
i
s
c
u
s
s
i
o
n


T
h

s
e

d
e

D
o
c
t
o
r
a
t

E
c
o
l
e

N
o
r
m
a
l
e

S
u
p

r
i
e
u
r
e

d
e

K
o
u
b
a
-
A
l
g
e
r
/
U
n
i
v
e
r
s
i
t


J
e
a
n

M
o
n
n
e
t

d
e

S
a
i
n
t

E
t
i
e
n
n
e

B B
i i
o o
d d
i i
v v
e e
r r
s s
i i
t t

, ,

B B
i i
o o
a a
c c
t t
i i
v v
i i
t t


e e
t t

B B
i i
o o
s s
y y
n n
t t
h h

s s
e e

d d
e e
s s

C C
o o
m m
p p
o o
s s
e e
s s

T T
e e
r r
p p

n n
i i
q q
u u
e e
s s

V V
o o
l l
a a
t t
i i
l l
s s

d d
e e
s s

L L
a a
v v
a a
n n
d d
e e
s s

A A
i i
l l

e e
s s
, ,

L L
a a
v v
a a
n n
d d
u u
l l
a a

s s
t t
o o
e e
c c
h h
a a
s s

S S
e e
n n
s s
u u

L L
a a
t t
o o
, ,

u u
n n

C C
o o
m m
p p
l l
e e
x x
e e

d d

E E
s s
p p

c c
e e
s s

M M

d d
i i
t t
e e
r r
r r
a a
n n

e e
n n
n n
e e
s s

d d

I I
n n
t t

r r

t t

P P
h h
a a
r r
m m
a a
c c
o o
l l
o o
g g
i i
q q
u u
e e


1
1
?


t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre III. Rsultats et Discussion



12u
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

Tableau 14 (suite)

Constituant
a
IR
b
IR
c

Composition (%)
Identification
d

LS1 LS2 LS3 LS4 LS5 LS6 LS7 LS8 LS9 LS10 LS11
Spathulenol 1565 2157 0.22 tr 0.23 0.19 tr 0.31 0.27 0.08 0.27 0.16 0.28 GC,MS
Caryophyllene oxyde 1571 2024 0.81 0.55 0.98 0.31 0.53 2.22 0.6 0.52 0.48 0.65 0.46 GC,MS
Globulol 1576 2095 0.82 0.98 0.59 0.2 0.28 0.67 0.52 0.45 0.57 0.73 0.38 GC,MS
Viridiflorol
f
1583 2103 7.38 4.88 6.81 4.34 3.58 7.14 6.44 3.01 3.8 5.07 2.89 GC,MS
Ledol
f
1593 2065 1.01 1.70 1.96 2.09 0.5 1.8 1.96 0.47 1.28 1.24 0.99 GC,MS
Inconnu 1594 - 3.27 1.23 2.09 0.56 1.57 4.48 4.09 1.36 1.22 1.77 0.86

epi-Cubenol
e
1616 2095 0.60 0.64 0.62 0.51 0.27 0.79 0.59 0.37 0.61 0.63 0.4 GC,MS
-Cadinol
f
1626 2203 0.43 0.36 0.7 0.55 0.41 0.92 0.51 0.3 0.52 0.5 0.38 GC,MS
-Muurolol
e,f
1630 2233 0.38 0.2 0.25 tr tr tr 0.31 0.08 tr - - GC,MS
Cubenol
e
1633 2101 0.22 0.22 0.06 0.1 - - 0.07 0.06 - 0.09 - GC,MS
-Eudesmol
e,f
1636 2268 0.43 0.31 0.35 0.16 - - 0.11 0.09 - - - GC,MS
Sesquiterpne oxygn (MM218) 1654 - 1.67 1.66 1.37 1.11 0.51 1.31 1.01 0.7 0.98 1.09 0.56 MS
-Cyperone
e,f
1725 2398 0.39 - - - - - - - - - - GC,MS
Sesquiterpne oxygn (MM236) 1822 - 2.43 2.15 2.46 2.17 1.15 4.77 2.22 1.48 3.75 2.55 2.78 MS
Sesquiterpne oxygn (MM236) 1829 - 1.83 1.73 1.98 1.75 0.92 3.83 1.98 1.2 3.05 1.99 2.11 MS
Monoterpnes hydrocarbons

0.0 0.2 0.4 0.24 0.24 0.0 0.64 0.71 0.0 0.31 0.24

Monoterpnes oxygns

46.19 71.3 55.27 66.27 75.37 61.32 55.73 71.33 62.36 70.87 74.43

Sesquiterpnes Hydrocarbons

1.31 1.24 0.61 1.94 0.07 0.59 0.59 1.13 0.98 2.25 0.9

Sesquiterpnes oxygns

20.38 17.18 19.82 14.63 8.87 25.83 17.2 9.85 16.33 16.44 13.48

Autres

2.0 0.55 2.41 1.78 0.29 0.21 1.24 0.63 1.74 1.33 0.85

Total identifi

69.88 90.47 78.51 84.86 84.84 87.95 75.4 83.65 81.41 91.2 89.9

a
) Lordre dlution des constituants et leurs pourcentages sont donns sur la colonne capillaire apolaire HP-1 avec une dtection FID.
b
) IR = Indices de rtention sur la colonne apolaire
HP-1.
c
) IR = Indices de rtention sur la colonne polaire INNOWAX-1.
d
) Mthode didentification : GC, identification base sur les indices de rtention ; MS, identification base sur la
comparaison des spectres de masse avec les banques lectroniques WILEY et NIST et la littrature (Adams, 2007 ; Joulain & Knig, 1998) ; Co-GC, identification base sur la co-
injection de composs authentiques.
e
) Composants signals pour la premire fois dans lhuile essentielle de L. stoechas.
f
) Composants rapports pour la premire fois dans lhuile
essentielle de L. stoechas Algrienne.
g
) - = Non dtect.
h
) tr = trace (< 0,01%). Les composs majoritaires et dautres avec des pourcentages notables sont en gras.



C
h
a
p
i
t
r
e

I
V
.

R

s
u
l
t
a
t
s

e
t

D
i
s
c
u
s
s
i
o
n


T
h

s
e

d
e

D
o
c
t
o
r
a
t

E
c
o
l
e

N
o
r
m
a
l
e

S
u
p

r
i
e
u
r
e

d
e

K
o
u
b
a
-
A
l
g
e
r
/
U
n
i
v
e
r
s
i
t


J
e
a
n

M
o
n
n
e
t

d
e

S
a
i
n
t

E
t
i
e
n
n
e

B B
i i
o o
d d
i i
v v
e e
r r
s s
i i
t t

, ,

B B
i i
o o
a a
c c
t t
i i
v v
i i
t t


e e
t t

B B
i i
o o
s s
y y
n n
t t
h h

s s
e e

d d
e e
s s

C C
o o
m m
p p
o o
s s
e e
s s

T T
e e
r r
p p

n n
i i
q q
u u
e e
s s

V V
o o
l l
a a
t t
i i
l l
s s

d d
e e
s s

L L
a a
v v
a a
n n
d d
e e
s s

A A
i i
l l

e e
s s
, ,

L L
a a
v v
a a
n n
d d
u u
l l
a a

s s
t t
o o
e e
c c
h h
a a
s s

S S
e e
n n
s s
u u

L L
a a
t t
o o
, ,

u u
n n

C C
o o
m m
p p
l l
e e
x x
e e

d d

E E
s s
p p

c c
e e
s s

M M

d d
i i
t t
e e
r r
r r
a a
n n

e e
n n
n n
e e
s s

d d

I I
n n
t t

r r

t t

P P
h h
a a
r r
m m
a a
c c
o o
l l
o o
g g
i i
q q
u u
e e



1
2
u

t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre III. Rsultats et Discussion




Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

Ainsi, ces analyses ont montr la prdominance de composs monoterpniques
oxygns (alcools, esters, thers, aldhydes, ctones, lactones, phnols, thers phnoliques)
avec une teneur combine variant de 46.19 % 75.37 %. Cette fraction est domine soit
par le fenchone (11.27 - 37.48 %) soit par le camphre (1.94 - 21.8 %). La Figure 34
reprsente les structures chimiques dveloppes des composs majoritaires ainsi que de
quelques composs dtects pour la premire fois dans lHE de L. stoechas. Les profils des
monoterpnes oxygns mettent en vidence l'importance du 1,8-cinol dans les
chantillons des HEs de la plupart des populations (0.16 - 8.71 %) o il a t dtect
comme deuxime ou troisime compos majoritaire. Ensuite, ce sont lactate de bornyl
(0.46 - 4.0 %), le m-cymne-8-ol (0.11 - 3.21 %), le trans-verbenol (0.03 - 3.0 %), le p-
cymne-8-ol (1.31 - 2.77 %), le verbenone (0.7 - 2.67 %), lactate de myrtnyl (0.61 -
2.54 %) et le terpinne-4-ol (0.18 - 2.14 %) qui sont les autres monoterpnes oxygns les
plus reprsents. Les sesquiterpnes oxygns reprsentent la deuxime classe de
molcules la plus abondante (8.87 - 25.83 %). Parmi ceux-ci, le viridiflorol est le plus
abondant, reprsentant de 2.89 % 7.38 % des constituants des HEs, suivi par le ledol
(0.47 - 2.09 %). Les sesquiterpnes hydrocarbons et les monoterpnes hydrocarbons sont
trs minoritaires dans toutes les HEs analyses, puisque aucune fraction des deux na t
identifie un taux suprieur 2.25 % (Tableau 14). Cependant, malgr le travail
danalyse ralis, il reste encore un certain nombre de composs non identifis (8.8 - 30.12
%).



















Figure 34 : Structures chimique des composs majoritaires et de certains composs dtects
pour la premire fois dans des HEs de L. stoechas dAlgrie
121
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre III. Rsultats et Discussion



122
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

III.1.2.3. Variabilit et biodiversit des huiles essentielles des 11 populations
algriennes de L. stoechas
Daprs les rsultats prsents dans le Tableau 14, les HEs de populations algriennes
de L. stoechas prsentent une immense variation qualitative et quantitative. Bien quutilis
brivement ici, lanalyse statistique est un outil puissant permettant de complter les
mthodes purement analytiques car elle permet notamment dans notre cas, de comparer les
diffrents jeux de donnes chimiques obtenus sur des huiles essentielles diffrentes. Afin
d'estimer la nature de la variabilit de la composition chimique de ces HEs, nous avons
ralis une analyse de classification hirarchique. Cette analyse statistique est base sur
une matrice de la composition (%) des HEs limite aux quatre principaux composants (le
fenchone, le camphre, le 1,8-cinol et le viridiflorol). Ces composs unis reprsentent une
proportion de 28.58 % 60.03 % du contenu total des l'HEs. La Figure 35 illustre le
dendrogramme de la classification hirarchique des HEs des onze populations de L.
stoechas algriennes. Cette analyse spare les populations algriennes de L. stoechas en
deux principaux clusters. Le cluster I regroupe les HEs de toutes les populations except
celle de la population LS6. Ces dix HEs regroupes ensembles sont caractrises par le
fenchone comme composant majoritaire, donc chmotype fenchone. Cependant, lHE de
la population LS6 est caractrise par le camphre comme composant majoritaire, donc
chmotype camphre (cluster II). Lanalyse du cluster I a rvl l'existence d'une grande
diversit chimique des HEs des populations chmotype fenchone. Les populations de ce
cluster sont globalement classes dans deux sous-clusters IA et IB (Figure 35). Le sous-
cluster IA regroupe les HEs des populations LS1 et LS7 possiblement sur la base de leurs
teneurs plus leves de viridiflorol (7.38 et 6.44 %, respectivement) en parallle avec des
teneurs plus faibles en 1,8-cinol (0.16 et 1.30 %, respectivement). Ainsi, au sein de ce
cluster I les populations LS3 et LS4 sont relativement loin des autres populations
probablement sur la base de leurs pourcentages en camphre qui est trs faible dans lHE de
la population LS3 (1.94 %) et trs fort dans lHE de la population LS4 (17.12 %).
Cependant, il est noter que mme si les HEs des populations LS2 et LS3 sont
caractrises par le 1,8-cinol comme second composant majeur, elles ne sont pas groupes
dans un groupe distinct au sein du sous-cluster IB.



t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre III. Rsultats et Discussion



12J
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e




.















Figure 35 : Dendrogramme de lanalyse hirarchique de onze populations algriennes de L.
stoechas
Cette classification est base sur les teneurs (%) des quatre principaux constituants des HEs de ces populations, le
fenchone, le camphre, le 1,8-cinol et le viridiflorol (donnes issues du Tableau 14)



III.1.3. Discussion
Les rendements dextractions en HE de onze populations algriennes sauvages de L.
stoechas ont prsent une variabilit remarquable (0.34 % 1.63 %, Figure 33). Cette
variabilit est peut tre une des caractristiques typiques de L. stoechas sauvage. Des
populations espagnoles sauvages de L. stoechas ont galement montr des variations aussi
leves en rendements en HE (Garcia-Vallejo, 1992). Des conclusions semblables ont
galement t faites sur des populations sauvages de Crte (Skoula et al., 1996) et des les
de Corse (Baldovini et al., 1998). Skoula et al. (1996) ont trouv aussi que la teneur en HE
des inflorescences est plus importante que celles des feuilles. Mme si toutes ces tudes
indiquent une forte variabilit dans la teneur en HE de populations sauvages de L.
stoechas, elles sont toutes daccord pour dire que cette espce, comme quelques autres
espces de lavande est riche en HE et permet de la considrer comme une plante
aromatique HE (Lis-Balchin, 2002).
Ces diffrences de rendement en HE peuvent tre attribues aux facteurs biotiques et
abiotiques incontrls ou aux diffrences gntiques inhrentes comme prcdemment
dcrit pour d'autres plantes productrices dHE (Putievsky et al., 1986 ; Figueiredo et al.,
1997). Les Citrus par exemple ont une teneur plus importante en HE lorsque la
temprature est leve (Bruneton, 1999). Les fleurs de Chrysanthemum coronarium sont
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre III. Rsultats et Discussion



124
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

plus riches en HE sous l'effet de fertilisants (Alvarez-Castellanos & Pascual-Viilalobos,
2003). Selon Vekiari et al. (2002), la priode de rcolte, lorgane de la plante, la dur de
schage et la mthode dextraction sont des facteurs parmi dautres qui peuvent aussi avoir
un impact direct sur les rendements en HE.

Les analyses par GC/FID et GC/MS ont prouv que les HEs des populations
algriennes de L. stoechas contiennent plus de composs oxygns que de composs
hydrocarbons. En plus, ces composs oxygns sont majoritairement monoterpniques.
Les HEs des espces Lavandula sont gnralement riches en monoterpnes (Lis-Balchin,
2002 ; Upson & Andrews, 2004). De plus, ces analyses ont mis en vidence la prsence de
deux chmotypes, le chmotype fenchone (LS1 - LS5 et LS7 - LS11) et le chmotype
camphre (LS6) avec une forte variabilit de composition au sein du chmotype fenchone.
En accord avec notre tude, les HEs extraites des populations de L. stoechas sont
reconnues pour la complexit de leur composition chimique et la variabilit de leurs
constituants. Si 1 3 composs sont majoritaires, elles renferment en parallle un trs
grand nombre dautres molcules, souvent prsentes ltat de trace. Des travaux
antrieurs la prsente tude ont port sur la variation de la composition chimique des HEs
de L. stoechas de diffrentes rgions mditerranennes. Nos rsultats sont en accord avec
ceux obtenus sur dautres populations nord africaines et du reste du basin mditerranen.
Ces tudes ont rvl lexistence de plusieurs chmotypes. Le chmotype le plus dcrit de
L. stoechas est le chmotype fenchone/camphre enregistr au Maroc (Zrira & Benjilali,
2003), en Tunisie (Bouzouita et al., 2005), en Espagne (Garcia-Vallejo, 1992), en Italie
(Angioni et al., 2006), en Crte (Grce) (Skoula et al., 1996), en Hatay (Turquie)
(Dadaliolu & Evrendilek, 2004), Chypre (Valentini et al., 1993) et en Corse (France)
(Ristorcelli et al., 1998). Aussi, en accord avec nos rsultats, les tudes qui ont compar les
diffrentes populations d'une zone gographique restreinte ont observ que le rapport entre
le fenchone et le camphre peut varier considrablement et peut mme s'inverser (Garcia-
Vallejo, 1992 ; Valentini et al., 1993 ; Skoula et al., 1996 ; Baldovini et al., 1998 ;
Ristorcelli et al., 1998 ; Zrira & Benjilali, 2003). Dans quelques unes de ces tudes,
certaines populations du chmotype fenchone/1,8-cinol ont t dcrites dans la mme
rgion phytogographique que des populations chmotype fenchone/camphre comme en
Espagne (Garcia-Vallejo, 1992) et en Crte (Skoula et al., 1996). Dans cette dernire tude
ralise sur quatre populations sauvages de L. stoechas de la Crte, Skoula et al. (1996),
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre III. Rsultats et Discussion



12-
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

ont montr que les principaux constituants des HEs sont alternativement, ou en
combinaison le fenchone, le camphre, le 1,8-cinol, l-pinne et l'actate de myrtnyle.
Ainsi, alors que le fenchone tait un lment majeur de lHE de toutes les quatre
populations, trois taient galement riches en camphre et la quatrime en 1,8-cinol. En
Turquie, un chmotype 1,8-cinol/camphre a mme t dcrit (Arabaci & Bayram, 2005).
Dans les HEs de deux de nos populations (LS2 et LS3), le 1,8-cinol tait le deuxime
compos le plus abondant aprs le fenchone et reprsente plus de 8 % de la teneur totale de
lHE. Mme si les analyses statistiques de notre chantillonnage ne supportent pas la
distinction du chmotype fenchone/camphre du chmotype fenchone/1,8-cinol en Algrie,
il est clair d'aprs nos donnes que les populations ayant un contenu lev de 1,8-cinol ne
sont pas limites la cte nord de la mer Mditerrane. Des populations ayant un taux
lev de 1,8-cinol, peuvent galement tre trouves dans le nord de l'Afrique. En
revanche, tous ces chmotypes diffrent compltement de celui publi par Gren et al.
(2002) dont lHE dune L. stoechas originaire de Turquie se caractrisait plutt par un
profil jamais retrouv ayant une forte teneur en pulgone (40.4 %), menthol (18.1 %) et
menthone (12.6 %) en parallle avec une absence totale de fenchone et de camphre.

Au sein d'une mme espce de plante, la composition de l'HE des divers individus peut
prsenter des profils chimiques ou chmotypiques diffrents. L'exemple le plus tudi est
celui de l'espce sauvage Thymus vulgaris prsente dans le sud de la France. Il existe en
effet six chmotypes diffrents pour cette seule espce. Ces diffrences sont au niveau de
la nature du monoterpne majoritaire de l'HE qui peut tre soit le graniol, l'-terpinol, le
thuyanol-4, le linalol, le carvacrol ou le thymol (Thompson et al., 2003). Ce
polymorphisme chimique existe aussi pour bien d'autres espces : Origanum vulgare
(Vokou et al., 1993), Mentha spicata (Kokkini & Vokou, 1989), Artemisia herba-alba
(Benjilali et al., 1982 ; Salido et al., 2004a) en sont des exemples.
Les 11 HEs de L. stoechas algriennes diffrent galement, et considrablement,
d'autres HEs publies de L. stoechas, dans la composition des substances minoritaires.
Chez une autre population algrienne de L. stoechas (Dob et al., 2006a), la prsence de
quantits leves de p-cymne (6.5 %) a t rvle, paralllement avec dautres HEs de L.
stoechas non-algriennes. Cependant, dans nos HEs le p-cymne a t, au mieux, dtect
sous forme de trace (Tableau 14). Inversement, dans la mme tude, Dob et al. (2006a)
n'ont pas dtect la prsence de l'actate de myrtnyle, compos relativement important
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre III. Rsultats et Discussion



126
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

dans nos HEs (0.61 - 2.54 %). Daprs la large tude de Garcia-Vallejo (1992) mene sur
plusieurs populations de plusieurs espces de Lavandula espagnoles et potugaises, l'actate
de myrtnyle a t marqu comme composant caractristique des HEs de L. stoechas. En
plus, nos HEs diffrent de toutes les autres HEs de L. stoechas par la prsence dun taux
lev de viridiflorol (2.89 - 7.38 %). Cependant, elles sont aussi caractrises par l'absence
totale de quelques composs comme l'actate de linalyle, le -phllandrne, le longifolne
et le germacrne D dfinis auparavant dans les HEs de L. stoechas. Cela sexplique
probablement par la perte de ces composs lors de lhydrodistillation surtout sils sont
ltat de trace. Guenther (1948), dans sa comparaison descriptive de plusieurs mthodes
dextraction dHEs, souligne la possibilit d'hydrolyse de certains des composs des HEs
lors de lhydrodistillation. Guenther (1948) mentionne galement la perte de certains
composs qui sont solubiliss dans les eaux rsiduaires.
Il est galement important de noter la prsence de lactate d-ncrodyle
exclusivement dans les HEs des populations LS3 et LS7. Les COV faisant partie de la
famille chimique des ncrodanes sont les molcules de lavande les plus spcifiques dans le
rgne vgtal puisquelles ne sont connues que chez L. stoechas subsp. luisieri qui
comporte dans son HE comme constituants majeurs le cis et le trans--ncrodol et lactate
de trans--ncrodol (Garcia-Vallejo, 1992 ; Garcia-Vallejo et al., 1994 ; Lavoine-
Hanneguelle & Casabianca, 2004 ; Sanz et al., 2004 ; Baldovini et al., 2005). En dehors du
rgne vgtal, cette substance na t dtecte que chez certains insectes (Millar et al.
2005).
La diffrence de composition constate entre les HEs des populations de L. stoechas
de cette tude ou avec dautres populations travers le basin mditerranen est
vraisemblablement lie une rgulation diffrentielle des divers constituants de lHE par
des facteurs abiotiques et biotiques. De nombreux facteurs externes peuvent influencer la
composition chimique de l'HE. La temprature, le taux d'humidit, la dure
d'ensoleillement, la composition du sol sont autant de facteurs d'ordre environnemental
susceptibles dinduire des modifications chimiques. Chez la Mentha piperita par exemple,
les nuits froides favorisent la formation de menthol alors que les nuits tempres favorisent
celle du menthofurane (Bruneton, 1999). Les tudes portant sur la variation de la
composition chimique des HE en fonction du site de rcolte, du cycle circadien et des
saisons sont nombreuses (Assad et al., 1997 ; Lopes et al., 1997). L'heure de la rcolte du
matriel vgtal ainsi que le moment dans l'anne sont en effet des facteurs importants. A
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre III. Rsultats et Discussion



12
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

titre d'exemple, il a t dmontr que la composition de l'HE de feuilles d'Ocimum
gratissimum varie considrablement en fonction de l'heure de la rcolte (Vasconcelos et
al., 1999). Linfluence du procd dextraction sur la labilit des constituants des HEs
explique que la composition du produit obtenu par hydrodistillation soit, le plus souvent,
diffrente de celle du mlange initialement prsent dans les organes scrteurs du vgtal.
Le chauffage prolong et puissant engendre en effet la dgradation de certaines de
molcules aromatiques. Au cours de lhydrodistillation, leau, lacidit et la temprature
peuvent induire hydrolyses, dprotonations, hydratations et cyclisation, mais aussi
rarrangements, isomrisations, racmisations, oxydations, etc et ce dautant plus que la
distillation est longue et le pH acide (Granger et al., 1975).






































t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre III. Rsultats et Discussion



128
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

III.2. Activits biologiques in vitro des HEs accumules par des
populations de L. stoechas

III.2.1. Introduction
Les organismes vivants sont capables de produire des substances naturelles que
lhomme exploite pour diverses raisons. Les plantes sont elles seules une source immense
de molcules chimiques complexes utilises dans les parfums, lagroalimentaire, et
lindustrie pharmaceutique. Actuellement, la majorit des molcules synthtises par les
plantes dintrt pharmaceutique sont extraites directement de la plante entire ou de lun
de ces organes. Plusieurs de ces molcules, appeles mtabolites secondaires, constituent
des entits chimiques impliques dans la protection contre les pathognes et les ruminants
ou agissent comme signaux chimiques.
Il a t dmontr que les peuples utilisant une alimentation riche en antioxydants
(Hertog et al., 1993 ; Adamson et al., 1999) sont moins exposs des maladies
cardiovasculaires (Vinson et al., 1995) ou certaines formes de cancer (Hertog et al.,
1993). Les antioxydants naturels sont apparus comme une alternative aux antioxydants de
synthses qui sont de moins en moins utiliss dans lindustrie alimentaire cause de leurs
effets secondaires nuisibles pour la sant humaine. Les antioxydants de synthses les plus
couramment utiliss sont le butylhydroxyanisole (BHA), le butylhydroxytolune (BHT), le
gallate de propyle (PG) et le tert-butylhydroquinone (TBHQ) (Sherwin, 1990). Cependant,
le BHA et le BHT sont suspects d'tre responsables de dommages au foie et dinduire
certains cancers (Grice, 1986 ; Wichi, 1988). Par consquent, le dveloppement et
l'utilisation dantioxydants plus efficaces d'origine naturelle sont souhaits. Les
antioxydants naturels peuvent protger le corps humain contre les radicaux libres et
retarder la progression de nombreuses maladies chroniques, ainsi que le rancissement
oxydatif des lipides dans les aliments (Pryor, 1991 ; Kinsella et al., 1993 ; Lai et al., 2001 ;
Glin et al., 2003a, b). Les HE sont des sources potentielles de constituants chimiques
naturels dous dactivit antioxydante. Les HE ont la particularit dinhiber la
peroxydation des lipides en agissant comme donneur de proton et accepteur de radicaux
libres, stoppant ainsi le mcanisme dauto-oxydation (Okuda et al., 1989 ; Teissedre et al.,
1996 ; Bohm et al., 1998 ; Debra et al., 2001 ;). Ainsi lincorporation des HEs directement
dans les aliments sous plusieurs formes contribue prserver la qualit des aliments
principalement par la prvention de la dgradation oxydative des constituants lipidiques
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre III. Rsultats et Discussion



12?
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

(Caillet & Lacroix, 2007). Malgr l'utilisation traditionnelle de lHE de L. stoechas, son
potentiel antioxydant n'a jamais t valu.
Si la dcouverte des agents thrapeutiques antimicrobiens est lune des plus grandes
avances mdicales du XX
me
sicle, la trop grande utilisation (souvent inadapte et
gnralise galement) des antibiotiques en mdecine humaine et vtrinaire depuis 50 ans
a malheureusement entrain la slection de souches bactriennes multirsistantes. Cest le
cas par exemple des bactries productrices de -lactamase spectre largi, rsistantes
toutes les -lactamines. Il est maintenant clair que larsenal existant dantibiotiques est
insuffisant pour nous protger long terme. Par consquent, il est ncessaire de rechercher
de nouvelles sources non traditionnelles dantibiotiques, notamment naturelles, permettant
de dvelopper des inhibiteurs qui agissent diffremment de ceux classiquement utiliss.
Lidentification de nouveaux antimicrobiens se base sur la recherche de molcules
capables dinduire la mort cellulaire des microorganismes en agissant simultanment sur
plusieurs cibles cellulaires ou ayant de nouveaux mcanismes daction. La complexit, et
la diversit, molculaire des HEs font de ces dernires des candidates privilgies pour
entreprendre de telles recherches. Les enqutes sur les activits antimicrobiennes, le mode
d'action et les utilisations potentielles des HEs vgtales ont retrouv l'impulsion et il
semble y avoir une renaissance dans l'utilisation des mthodes traditionnelles de protection
du btail ainsi que dans la conservation des aliments. De ce fait, ont a jugs utile dvaluer
lactivit antimicrobienne des HEs des 11 populations algriennes de L. stoechas tudies
dans le chapitre prcdent afin de valoriser cette immense source naturelle dune part et
dautre part de justifier son utilisation traditionnelle comme antiseptique en Algrie et le
reste du bassin mditerranen. Ces rsultats ont donn lieu une publication
(Benabdelkader et al., 2011, Annexe I).

III.2.2. Rsultats
III.2.2.1. Activit antioxydante des huiles essentielles de 11 populations de L. stoechas
III.2.2.1.1. Evaluation de lactivit antioxydante par la mthode du DPPH
Lactivit antioxydante des HEs de L. stoechas value par le test DPPH est exprime
en IC
50
. LIC
50
est inversement li la capacit antioxydante d'un compos ou dune HE,
car il exprime la quantit d'antioxydant ncessaire pour diminuer la concentration du
radical libre de 50 %. Plus la valeur dIC
50
est basse, plus l'activit antioxydante est grande.
Les valeurs dIC
50
pour les 11 HEs de L. stoechas, ainsi que pour les composs de
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre III. Rsultats et Discussion



1Ju
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

rfrence, le BHT et l-tocophrol, sont prsentes dans la Figure 36. Sur la base de ce
test, nos 11 HEs ont montr des diffrences significatives dans leur capacit de pigeage
du radical libre (Figure 36a). Les HEs des populations LS4 et LS2 taient les plus actives
et pouvaient ramener le radical libre stable 2,2-diphenyl-1-picrylhydrazyl (DPPH) violet en
diphenyl-picrylhydrazine jaune avec des IC
50
de 5.10 mg/ml 0.32 et de 10.97 mg/ml
0.98, respectivement. Les HEs des populations LS5 et LS7 taient les moins actives avec
des IC
50
respectifs de 32.42 mg/ml 1.46 et de 26.80 mg/ml 0.91. Les IC
50
extrme
diffrent donc dun facteur de 8. Lorsque lactivit antioxydante des huiles est compare
celle des substances de rfrence (BHT et -tocophrol), toutes les HEs de L. stoechas
taient trouves moins efficaces. L-tocophrol et le BHT prsentent des IC
50
trs
infrieure de 0.02 mg/ml 0.001 et 0.11 mg/ml 0.01, respectivement.

III.2.2.1.2. Evaluation de lactivit antioxydante par la mthode du -carotne/acide
linolique
En tant que test complmentaire, le test de blanchissement du -carotne (galement
li l'inhibition de la peroxydation de l'acide linolique) a t utilis. Ce test dmontre des
caractristiques antioxydantes des produits naturels diffrentes de celles mises en lumire
par le test DPPH. Ainsi, il peut rvler des substances antioxydantes diffrentes dans les
extraits vgtaux (Kulisic et al., 2004). Selon ce test, l'activit antioxydante la plus leve a
t de nouveau associe lHE de la population LS4 (AA = 79.72 % 0.45) suivie par
lHE de la population LS2 (AA = 68.79 % 0.62) comme illustr dans la Figure 36b.
Cependant, lHE de la population LS3 est apparue moins active (AA = 16.32 % 0.46)
tout comme lHE de la population LS5 qui se classe toujours parmi les HEs les moins
actives (AA = 21.60 % 1.20). Toutes les HEs ont t, nanmoins, des inhibiteurs moins
puissants de l'oxydation du systme -carotne/acide linolique que les substances de
rfrence, le BHT et l-tocophrol qui prsentaient des activits AA = 99.86 % 0.19 et
98.40 % 0.38, respectivement.






t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre III. Rsultats et Discussion



1J1
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e









































Figure 36 : Activit antioxydante des HEs des populations
de L. stoechas (LS1 - LS11) et des standards contrle
(BHT et -tocophrol)
A) mthode du DPPH de pigeage des radicaux libres. B) mthode
de blanchissement du -carotne/acide linolique. Les donnes sont
fournies en tant que moyenne S.D. (n = 3).




t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre III. Rsultats et Discussion



1J2
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

III.2.2.2. Activit antimicrobienne des huiles essentielles de populations de L. stoechas
Nous avons aussi estim lactivit antimicrobienne in vitro des HEs des 11 populations
de L. stoechas algriennes sur seize microorganismes pathognes ou phyto-pathognes.
Lors de cette exprience, les tests ont t raliss par la technique de microdilution en
milieu solide car elle fournit des donns quantitatives prcises sous forme de concentration
minimale inhibitrice (CMI). Les rsultats de ce criblage sont rsums dans le Tableau 15.
Le tween-80 est ajout dans le milieu pour amliorer la solubilit des HEs. Un milieu avec
le tween-80 et leau distille la place des HEs a servi de contrle ngatif. Selon
Aligiannis et al. (2001), lactivit antimicrobienne est considre comme forte lorsque les
valeurs de CMI sont comprises entre 0.05 mg/ml et 0.50 mg/ml, modre quand elles sont
entre 0.6 mg/ml et 1.50 mg/ml et faibles quand elles sont suprieures 1.50 mg/ml. En
accord avec la grande variabilit de leurs compositions chimiques, les HEs des 11
populations que nous avons testes ont t diffrentiellement efficaces envers les
microorganismes cibles. Gnralement, des valeurs de CMI variant entre 0.23 mg/ml et
11.36 mg/ml ont t obtenues sur les bactries, entre 0.23 mg/ml et 8.52 mg/ml sur les
champignons filamenteux et entre 0.16 mg/ml et 11.9 mg/ml sur les levures. Selon ce
systme dvaluation, lHE de la population LS3 prsente, in vitro, une bonne activit
inhibitrice vis--vis des microorganismes tests. L'HE de la population LS6 a prsent la
mme tendance d'activit inhibitrice, lexception des champignons A. flavus et F.
oxysporum et de la levure C. albicans (b) envers lesquels elle a t modrment active.
LHE de la population LS5 avait une activit antimicrobienne modre envers toutes les
bactries et les champignons filamenteux avec une CMI maximale de 1.4 mg/ml.
Cependant, cette HE avait une faible activit envers les deux souches de C. albicans. La
Figure 37 prsente les CMI cumules de chaque HE de L. stoechas envers les seize
souches testes. Globalement, les HEs des populations LS3, LS6, LS5 et LS11 taient les
plus actives avec des CMI cumules respectives de 4.6 mg/ml, 6.08 mg/ml, 18.9 mg/ml et
24.5 mg/ml. Tandis que, les HEs des populations LS8, LS2, LS1 et LS4 taient les moins
actives avec des CMI cumules trs levs (156.2 mg/ml, 84.48 mg/ml, 76.23 mg/ml et
73.44 mg/ml, respectivement).







t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre III. Rsultats et Discussion



1JJ
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e


Tableau 15 : Activit antimicrobienne (CMI) des huiles essentielles des populations algriennes de
L. stoechas

Microorganismes
CMI (mg/ml)
LS1 LS2 LS3 LS4 LS5 LS6 LS7 LS8 LS9 LS10 LS11
Gram-negative
E. coli E13 4.84 3.84 0.23 2.04 1.4 0.32 4.76 11.36 3.78 3.7 1.96
E. coli E195 6.05 > 7.68 0.23 > 8.16 0.7 0.32 1.19 8.52 3.78 5.18 1.96
E. coli ATCC 25925 1.21 1.28 0.23 0.51 0.7 0.32 1.19 8.52 2.16 1.48 1.96
E. coli K12 4.84 3.84 0.23 2.55 0.7 0.32 1.19 11.36 2.16 2.96 0.49
K. pneumoniae E40 4.84 > 7.68 0.23 > 8.16 0.7 0.32 1.19 8.52 2.7 0.74 0.49
K. pneumoniae Kp19 4.84 > 7.68 0.23 > 8.16 0.7 0.32 1.19 11.36 2.7 3.7 1.96
S. enterica 4.84 > 7.68 0.23 > 8.16 0.7 0.32 1.19 11.36 2.7 3.7 1.96
P. aeruginosa 1.21 > 7.68 0.23 > 8.16 0.7 0.32 1.19 8.52 2.16 4.44 1.96
A. baumannii 4.84 > 7.68 0.23 5.1 0.7 0.32 1.19 8.52 2.16 0.74 0.98
Gram-positive
B. subtilis 4.84 3.84 0.23 2.55 0.7 0.32 1.19 11.36 2.16 1.48 0.98
Champignons filamenteux
A. niger 6.05 4.48 0.46 2.55 0.7 0.32 5.95 8.52 2.7 5.18 1.96
A. flavus 6.05 5.12 0.46 2.55 1.4 0.64 5.95 8.52 2.7 5.18 1.96
F. oxysporum f. sp lini 4.84 2.56 0.23 2.04 1.4 0.64 5.95 8.52 2.16 3.7 0.98
M. ramannianus 4.84 2.56 0.23 2.04 1.4 0.32 1.19 11.36 2.16 1.48 0.98
Levures
C. albicans (a) 6.05 4.48 0.46 2.55 3.5 0.16 5.95 8.52 10.8 3.7 1.96
C. albicans (b) 6.05 > 6.4 0.46 > 8.16 2.8 0.8 11.9 11.36 10.8 5.18 1.96






Figure 37 : CMI cumules de chaque HE des 11 populations de L. stoechas envers les seize
souches cibles




t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre III. Rsultats et Discussion



1J4
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

La Figure 38 prsente les CMI cumules des 11 HEs de L. stoechas sur chacune des
souches de microorganisme testes. Les microorganismes tudis nont pas manifest la
mme sensibilit vis--vis des HEs testes. Toutes les souches bactriennes se sont avres
sensibles aux HEs de L. stoechas contrairement aux souches fongiques. Avec des CMI
cumules respectives de 19.56 mg/ml, 28.56 mg/ml, et 29.65 mg/ml, E. coli (ATCC
25925), M. ramannianus et B. subtilis taient les plus sensibles laction des HEs. Il est
noter galement que les souches E. coli testes ont prsent une vulnrabilit variable
envers les HEs. La souche E. coli (ATCC25925) tait la plus sensible (CMI = 19.56
mg/ml) et la souche E. coli E195 tait la plus rsistante (CMI = 43.77 mg/ml). En
revanche, Les deux souches de C. albicans (b) et (a) taient les plus tolrantes aux HEs
avec des CMI cumules respectives de 65.87 mg/ml et 48.13 mg/ml en parallle avec la
bactrie E. coli E195 (CMI cumule = 43.77 mg/ml). Il est noter aussi que la levure C.
albicans (a), malgr sa forte tolrance, a prsent une forte sensibilit laction de lHE de
la population LS6 avec une CMI la plus basse de 0.16 mg/ml (Tableau 15).























Figure 38 : CMI cumules des 11 HEs de L. stoechas sur chaque souche de
microorganisme cible






t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre III. Rsultats et Discussion



1J-
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

III.2.3. Discussion
De nombreuses tudes ont montr que les activits biologiques des HEs des plantes
aromatiques sont lies leur composition chimique et notamment aux composs
majoritaires. Cependant, des composs minoritaires peuvent interagir directement, ou
dune faon synergique ou antagoniste, pour crer un mlange dot dactivit biologique.
Plusieurs composs que nous avons dtects dans les HEs de L. stoechas ont dj t
dcrits comme antioxydants lors de tests de criblage chimique. Il s'agit notamment de
l'eugnol, du carvacrol, du thymol, du terpinolne, de l-terpinne, du -terpinne
(Ruberto & Baratta, 2000) et du terpinne-4-ol (Lertsatitthanakorn et al., 2006). Afin de
voir si certains composs de lhuile exercent un rle important dans l'activit antioxydante
des HEs de L. stoechas, on a calcul le coefficient de corrlation de Pearson entre les 93
composs les plus abondants de nos HEs et les activits antioxydantes au regard des tests
DPPH et -carotne de nos 11 HEs. Cette analyse a prouv quil n'y avait aucune
corrlation significative entre les teneurs des quatre composants principaux (fenchone,
camphre, 1,8-cinol et viridiflorol) et les activits antioxydantes des HEs. Ce rsultat est en
accord avec les rapports prcdents sur labsence d'activit antioxydante de ces composs
(Ruberto & Baratta, 2000). Seulement 4 substances prsentes dans au moins 7 HEs ont
donn des corrlations positives avec R
2
> 0.4. Ces substances sont le pinocarvone (R
2
=
0.583 ; p = 0.006), le -phllandrne-8-ol (R
2
= 0.511 ; p = 0.013) et l-muurolne (R
2
=
0.506 ; p = 0.014) avec le test -carotne et le ledne (R
2
= 0.445 ; p = 0.025) avec le test
DPPH. Malheureusement, ces composs ne sont pas disponibles sous forme pure. Nous
navons donc pas pu confirmer exprimentalement ces corrlations. En plus, aucune tude
na dj tent d'valuer leur potentiel antioxydant. Nanmoins, des substances
supplmentaires, mme ltat de trace, participent l'activit antioxydante de certaines de
nos 11 HEs. L'HE trs antioxydante de la population LS4 a t la seule contenir le thymol
et le carvacrol. Ces deux substances sont connues pour leur pouvoir antioxydant
remarquable (Ruberto & Baratta, 2000). Ainsi, la prsence de carvacrol mme faible
concentration dans les HEs peut expliquer lactivit de pigeage du radical DPPH
(Economou et al., 1991). Il semble daprs ces rsultats que l'activit antioxydante des HEs
de L. stoechas algriennes peut tre due la prsence de diffrentes molcules. En accord,
lHE qui contient le plus grand nombre de molcules antioxydantes sest avre tre
galement la plus antioxydante. Cette conclusion est confirme par une sparation par
CCM des composs de nos 11 HEs suivie par une coloration sur plaque de couche mince
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre III. Rsultats et Discussion



1J6
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

des zones antioxydantes avec une solution de DPPH 2 % (Figure 39). Lors de cette
exprience, l'HE la plus active (celle de la population LS4) a affich le plus grand nombre
de spots jaunes rvlateurs des composs antioxydants. Ces spots incluent notamment le
carvacrol (test en parallle comme standard). Les HEs les moins actives ont gnr moins
de spots jaunes. Ce screening a de plus confirm les donnes de la littrature cites ci-
dessus selon lesquelles les trois composs majoritaires (fenchone, camphre et 1,8-cinol)
des HEs de L. stoechas ont un faible pouvoir antioxydant.






















Figure 39 : Screening semi-quantitatif sur plaque de CCM de lactivit
antioxydante au test DPPH des 11 HEs de L. stoechas en parallle avec le fenchone,
le camphre, le 1,8-cinole, leugnol, le carvacrol, le BHT et l-tocophrol


Cette valuation reprsente un premier rapport sur l'activit antioxydante des HEs de
L. stoechas. Cependant, Glin et al. (2004) ont signal une activit antioxydante des
extraits aqueux et thanoliques dune population de L. stoechas originaire de Turquie.
Diffrents extraits d'autres espces du genre Lavandula ont galement mis en vidence leur
pouvoir antioxydant. Il s'agit notamment des extraits mthanoliques et actate d'thyle des
cultures cellulaires de L. vera (Kovatcheva et al., 2001), des extraits aqueux et
mthanoliques des parties ariennes de L. angustifolia (Hohmann et al., 1999) et de
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre III. Rsultats et Discussion



1J
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

diffrentes fractions issues des dchets industriels de L. x intermedia (Torras-Claveria et
al., 2007).

L'activit antimicrobienne des HEs des plantes a t signale comme tant lie
spcifiquement la prsence de composs antimicrobiens. Rcemment, des tentatives ont
t faites pour identifier les composs responsables dune telle bioactivit. Les molcules
oxygnes qui entrent dans la composition des HEs sont gnralement plus actives que les
molcules hydrocarbones qui sont, par contre, connues pour leurs faibles pouvoirs
antimicrobiennes (Kalemba & Kunicka, 2003). Les effets antimicrobiens sont lis, entre
autre, la prsence de groupements hydroxyles libres qui permettent une bonne
solubilisation de ces composs dans les milieux physiologiques aqueux (Knobloch et al.,
1989 ; Manohar et al., 2001 ; Giordani et al., 2004 ; Ben Arafa et al., 2006). Certains de
ces composs sont connus pour leur fort pouvoir antimicrobien du fait de leur grande
solubilit dans leau et donc de leur forte capacit accder aux cellules microbiennes et
pntrer les parois des cellules bactriennes et fongiques (Knobloch et al., 1989). Dautres
composs vgtaux sont hydrophobes. Cette proprit facilite leur insertion entre les
phospholipides membranaires des cellules microbiennes, assurant ainsi leur solubilisation
dans la bicouche lipidique (Carson et al., 2006). De ce fait, lactivit des molcules
oxygnes des HEs dpend la fois du caractre lipophile de leur squelette hydrocarbon
et du caractre hydrophile de leurs groupements fonctionnels (Kalemba & Kunicka, 2003).
Parmi ceux-ci on cite titre dexemple, le camphre, le linalol, le 1,8-cinol (Pattnaik et al.,
1997), le carvacrol, l'eugnol, le perillaldehyde (Burt, 2004), le terpinne-4-ol (Carson et
al., 2002), l'oxyde de caryophyllne, le spathulnol (Ulubelen et al., 1994), le bornol
(Tabanca et al., 2001), le viridiflorol, le trans-pinocarvol, le ldol (Guinoiseau, 2010) et
le myrtnal (Angioni et al., 2006) qui manifestent une puissante activit antiseptique. Les
activits antimicrobiennes de nos 11 HEs de L. stoechas sont sans doute lies
principalement leurs profils chimiques et notamment leurs fortes teneurs en composs
oxygns (Tableau 14).
LHE de la population LS3 qui prsentait le plus fort pouvoir antimicrobien tait
caractrise par la prsence dominante du fenchone. Le fenchone est, cependant, connu
pour tre peu, voire pas, actif (Lis-Balchin & Roth, 2000). Il ne peut donc tre responsable
des effets gnrs par les HEs sur les microorganismes. Les travaux de Ghalem et
Mohamed (2008), ont indiqu que les composs majoritaires peuvent ne pas tre
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre III. Rsultats et Discussion



1J8
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

ncessairement responsables de lactivit antibactrienne des HEs. LHE dEucalyptus
deglupta (30 % de 1,8-cinol et 5 % d-pinne) et lHE dE. alba (10 % de 1,8-cinol et
2.5 % d-pinne) ont par exemple prsent le mme spectre dactivit antibactrienne. Le
mme rsultat a t obtenu pour lactivit antibactrienne de lHE dE. camadulensis (2 %
de cryptone) en comparaison avec celle dE. deglupta (20 % de cryptone). Cependant,
plusieurs composs connus pour leurs activits antimicrobiennes sont prsents dans nos
HEs en tant que constituants majoritaires ou minoritaires. De ce fait, nous pouvons
suggrer que la bonne activit antimicrobienne des deux HEs des populations LS3 et LS6
est peut tre due la richesse en 1,8-cinol et viridiflorol pour la premire et en camphre et
viridiflorol pour la deuxime. Nanmoins, nos rsultats danalyse statistique (donnes non-
prsentes) n'ont pas rvl l'existence d'une corrlation significative entre la teneur dune
substance spcifique de lHE et lactivit antimicrobienne de cette dernire envers lune
des souches testes. Cela est peut tre d au fait que plusieurs composs partagent une
mme activit antimicrobienne. Delaquis et al. (2002) ont estim que lactivit
antimicrobienne de certaines HEs pourrait tre attribue la prsence des composs
mineurs prsents ltat de trace, tels que le nrol, le nral, le bornol, le linalol,
laldhyde de cinnamyl, le carvacrol, le graniol, le myrtnal et leugnol connus pour
avoir une activit antibactrienne. Mme si leur faible teneur dans nos HEs suggre quils
leurs confrent un faible pouvoir antimicrobien, leur prsence combine peut tre
lorigine dun effet de synergie confrant lHE un pouvoir antimicrobien tonnamment
important. Le p-cymne, une molcule hydrocarbone sans activit antimicrobienne
potentialise les effets antimicrobiens du carvacrol en facilitant la pntration intracellulaire
de ce dernier dans B. cereus (Ultee et al., 2002). Viljoen et al. (2003) ont dmontr que
leffet synergique peut tre actif dans une association entre le 1,8-cinol et le camphre. Des
synergies du mme ordre pourraient tre impliques dans laction des HEs de L. stoechas.
Leffet antimicrobien observ serait alors attribuable une ou plusieurs molcules actives,
prsentes en forte ou faible proportion dans les HEs. De cette faon, diffrentes
combinaisons de plusieurs composs actifs peuvent gnrer des activits biologiques
quivalentes. Ceci est une suggestion intressante car elle permettrait des plantes de
varier leur composition de composs organiques volatils pour s'adapter diverses
contraintes cologiques, tout en conservant un niveau inchang de leur tolrance envers
leurs principaux ravageurs.
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre III. Rsultats et Discussion



1J?
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

Les rsultats de cette tude sur les activits antimicrobiennes sont en accord avec
dautres rapports indiquant que les HEs de populations non-algriennes de L. stoechas
possdent galement des activits antimicrobiennes. Il a t rapport que l'huile volatile de
plantes en provenance de Tunisie a une activit antibactrienne envers Staphylococcus
aureus (Bouzouita et al., 2005). De mme, des activits antibactriennes ont t signales
pour lHE de L. stoechas sauvage de Turquie (Gren et al., 2002 ; Dadaliolu &
Evrendilek, 2004), Cagliari, Italie (Angioni et al., 2006) ou partir de plantes cultives en
Australie (Moon et al., 2007). Additionnellement, lHE de L. pedunculata, une autres
espce de lavande de la section Stoechas, a dmontr une activit antifongique
significative contre des souches dermatophytes (Zuzarte et al., 2009). Rcemment, divers
rapports ont document l'activit antimicrobienne de plusieurs espces du genre
Lavandula. Les HEs de L. angustifolia et L. x intermedia, ont des effets antifongiques
remarquables contre Aspergillus nidulans et Trichophyton mentagrophytes (Moon et al.,
2007). Cependant, la comparaison de lefficacit des HEs, ou des constituants individuels,
travers les diffrentes publications reste difficile tablir. Cette difficult rside dans le
fait que les paramtres exprimentaux (mthodes employes pour lvaluation de lactivit
antimicrobienne, choix et conditions physiologiques des microorganismes, priode de
lexposition du microorganisme lHE, dose de lHE utilise, mulsifiant utilis pour la
solubilisation de lHE) diffrent entre les tudes.
Les composs des HEs activit antimicrobienne agissent selon plusieurs
mcanismes. Leur premier site daction sur les cellules bactriennes est la membrane
plasmique. Les composs phnoliques sont reconnus toxiques et auraient pour cible les
enveloppes des microorganismes telles que la membrane plasmique et la paroi (Weber et
al, 1996). Certains agents antimicrobiens dtruisent la membrane plasmique de manire
irrversible conduisant ainsi la mort cellulaire par un processus lytique (Denyer & Hugo,
1991 ; Hamouda & Baker, 2000 ; Song & Kim, 2003 ; Razzaghi-Abyaneh et al., 2006).
Dautres agents ne lysent pas les cellules bactriennes mais compromettent lintgrit
structurale de la membrane plasmique en induisant une perte du matriel cytoplasmique
(Carson et al., 2002 ; Reichling et al., 2002). Ils agiraient comme des -lactamines dont le
site daction est la paroi bactrienne. Dautres molcules de lhuile, en se fixant aux sites
protiques de liaison des pnicillines, inhibent la synthse du peptidoglycane, composant
essentiel de la paroi bactrienne. Dautres accroissent leurs effets antibactriens en inhibant
les -lactamases. A des concentrations relativement faibles, les monoterpnols, grce leur
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre III. Rsultats et Discussion



14u
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

groupement hydroxyle et leur cycle ouvert pour certains, agissent sur les enzymes
impliques dans la respiration cellulaire et modifient la permabilit membranaire par
action directe sur les porines et les phospholipides membranaires des procaryotes. A de
fortes concentrations, ils provoquent une perte totale de lhomostasie, ce qui entraine la
destruction des membranes cellulaires (Carson et al, 2002). En plus, la cible des molcules
antibactriennes des HEs serait probablement lADN bactrien. Leur action sur lADN
serait favorise par leur bonne diffusion travers les membranes bactriennes (Guessennd
et al., 2008). Compte tenu de la diversit molculaire des HEs, il semble plus probable que
leur activit antimicrobienne rsulte de lassociation de plusieurs mcanismes qui
sexercent conjointement sur diffrentes cibles cellulaires (Burt, 2004). Daprs Kalemba
et Kunicka (2003), la sensibilit dun microorganisme aux HEs dpend des proprits de
lHE et du microorganisme lui-mme. Il est bien connu que les bactries Gram (+) sont
plus sensibles aux HEs que les bactries Gram (-). Plusieurs tudes testant lactivit
inhibitrice des HEs confirment ce phnomne (Poole, 2001 ; Cimanga et al., 2002 ; Burt,
2004). Selon ces auteurs la grande rsistance des bactries Gram (-) est lie, en partie, la
complexit de leur enveloppe cellulaire qui contient une double membrane, contrairement
la structure simple de la membrane des bactries Gram (+).


























t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre III. Rsultats et Discussion



141
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

III.3. Biodiversit des COVs et variation chmotypique chez L. stoechas
Sensu Lato

III.3.1. Introduction
La nature des composs organiques volatils (COVs) est influence par des facteurs
gntiques et cologiques et, de faon significative, par le mode dextraction. Ainsi, une
mme plante peut scrter des COVs biochimiquement diffrents selon les conditions
environnementales et des groupes de plantes gntiquement distants peuvent diffrer de
par leurs COVs. Une variation dans la nature chimique des COVs majoritaires entre deux
groupes de vgtaux ne diffrant pas, ou trs peu, ou niveau botanique engendre la notion
de chmotype (aussi dsign chimiotype). La notion de chmotype dsigne donc une
entit chimique distincte au sein d'une mme espce ou mme au sein dune section
botanique troite. Elle nest pas base sur la seule molcule majoritaire mais peut prendre
en compte plusieurs molcules majoritaires. Elle ne concerne pas les trs nombreuses
molcules minoritaires.
La section Stoechas du genre Lavandula contient actuellement 3 espces (L. stoechas,
L. pedunculata et L. viridis) et 7 sous-espces. Elle est clairement spare du reste du genre
de par, notamment, la prsence de longues bractes colores au sommet dinflorescences
cylindriques qui confre ses membres le nom de lavandes ailes. Cependant, les contours
taxonomiques ont t, et sont toujours, le sujet de dbats. Le genre L. stoechas qui fut
pourtant un des premiers genres de lavande tre cr fut dcoup en sous-espces dont
certaines sont devenues des espces autonomes. Les diffrences anatomiques entre les
genres ainsi crs sont en fait minimes et portent souvent sur un seul paramtre comme la
longueur de la tige portant linflorescence qui est significativement plus longue pour L.
pedunculata et labsence de poils et de pigmentation anthocyane chez L. viridis. Les
tudes dcrivant la nature des COVs mis par les trois espces de la section Stoechas nont
pas permis de soutenir les diffrences taxonomiques au sein de la section. De nombreux
chmotypes, souvent sympatriques, ont t dcrits pour lespce large distribution
gographique L. stoechas. Les rares populations analyses des autres espces prsentent
galement des variations dans leurs COVs mais restent sur des gammes de COVs
galement dcrites chez L. stoechas. Si nos tudes dans les deux sections prcdentes ont
uniquement port sur des populations de L. stoechas Sensu Stricto car il sagit du seul
taxon prsent en Algrie, les tudes suivantes visant comprendre les bases molculaires
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre III. Rsultats et Discussion



142
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

de ces diffrences de chmotypes porteront sur lensemble de la section Stoechas. Nous
avons appel cet ensemble botanique L. stoechas Sensu Lato du fait des ambiguts
taxonomiques rcentes entre les taxons de cette section botanique et du fait de labsence de
dlimitations claires entre eux de par leurs COVs.
Des exemples de taxons comme L. stoechas Sensu Lato qui prsentent un
polymorphisme de chmotypes sont courants dans le rgne vgtal. Les bases molculaires
de ces diffrences ne sont, cependant, jamais connues. Les connaissances sur les voies de
biosynthse des COVs ont pourtant considrablement augment ces dernires annes. Mais
avant de sengager plus en avant dans une tude comparative des voies de biosynthse de
plantes aux chmotypes diffrents, il nous faut dabord tablir les diffrences prcises qui
existent entre pieds individuels ayant pouss dans un environnement similaire. En effet, les
tudes publies sur la composition chimique des HEs de L. stoechas Sensu Lato ont
toujours t faites sur des HEs obtenues sur des populations sauvages distantes
gographiquement et aprs distillation de lots de centaines dinflorescences prleves sur
de trs nombreux pieds au sein dune population.
Pour sassurer davoir des chmotypes trs diffrents, nous avons analys les COVs
produits par 3 pieds de 3 espces de la section Stoechas (L. stoechas, L. pedunculata et L.
viridis) que nous avons fait pousser, et que nous avons chantillonn, dans des conditions
similaires. Du fait du faible nombre dtudes publies sur la composition chimique des
COVs de L. pedunculata et L. viridis, cette tude va considrablement augmenter notre
connaissance dans ce domaine. Les rsultats de la caractrisation chimique de cette partie
de thse serviront de base pour la dernire partie de cette thse sur la biosynthse des
terpnes chez ces espces de lavande.

III.3.2. Rsultats
Le Tableau 16 rsume le compte-rendu global de nos rsultats quant la nature
chimique des COVs. Les constituants identifis sont lists suivant leur ordre dlution sur
une colonne HP-5MS. Lidentification des COVs est ralise par comparaison de leurs
spectres de masse et de leurs indices de rtention avec ceux de banques de donnes
lectroniques (WILEY et NIST) et ceux de donnes bibliographique (Adams, 2007) ou
obtenus sur des standards disponibles.


t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre III. Rsultats et Discussion



14J
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

Tableau 16 : Composition chimique des COVs de feuilles des lavandes Stoechas (L .pedunculata, L.
stoechas et L. viridis)

N Constituant
a
IR
b
IR
c

Composition (g eq. eugnol/g poids sec)
d

Identification
e

L. pedunculata L. stoechas L. viridis
1 2-Methyl butyric acid
h
832 832 -
i
- 0.460.01 GC, MS
2 trans-3-Hexenol
f,g,h
840 844 4.890.65 3.900.45 1.630.34 GC, MS
3 Tricyclene 922 921 - 2.110.27 1.280.08 GC, MS
4 -Pinene 932 932 43.807.79 16.900.59 29.904.85 GC, MS, CoGC
5 2(5H)-Furanone, 5,5-dimethyl
h
944 945 - - 0.270.05 GC, MS
6 Camphene 948 946 6.521.76 35.551.91 20.021.98 GC, MS
7 Verbenene
h
953 961 - - 0.310.04 GC, MS, CoGC
8 Sabinene 971 969 2.150.15 1.650.50 4.610.79 GC, MS
9 1-Octen-3-one 974 972 - - 5.890.97 GC, MS
10 -Pinene 977 974 5.801.36 5.720.02 10.992.05 GC, MS, CoGC
11 Methyl heptenone
h
982 981 - - 0.490.01 GC, MS
12 Myrcene 988 988 4.731.57 0.560.31 1.180.45 GC, MS, CoGC
13 Dehydro-1,8-cineole
h
990 988 - 0.150.08 0.420.01 GC, MS
14 2-Octanol
h
996 994 - - 0.740.15 GC, MS
15 trans-3-Hexenyl acetate
g,h
1003 1001 0.280.01 0.230.02 0.450.04 GC, MS
16 -Phellandrene 1007 1002 0.820.15 0.190.03 0.300.04 GC, MS, CoGC
17 -3-Carene 1009 1008 - 0.240.01 - GC, MS, CoGC
18 -Terpinene
f
1016 1014 1.130.56 - - GC, MS, CoGC
19 p-Cymene 1023 1020 2.840.58 0.520.08 1.110.12 GC, MS, CoGC
20 Limonene 1028 1024 32.740.66 5.970.18 3.850.63 GC, MS, CoGC
21 1,8-Cineole 1031 1026 200.2113.08 133.5815.64 247.8921.53 GC, MS, CoGC
22 Lavender lactone 1034 1034 - 0.720.17 - GC, MS
23 Phenyl acetaldehyde
g,h
1041 1036 - 0.360.02 0.290.06 GC, MS
24 trans--Ocimene
h
1044 1044 1.130.31 - 0.720.21 GC, MS
25 -Terpinene
f
1056 1054 0.910.14 - 0.240.01 GC, MS
26 Acetophenone
h
1064 1059 - - 0.460.03 GC, MS
27 cis-Sabinene hydrate
f,g
1069 1065 17.101.54 9.051.43 24.802.83 GC, MS
28 Camphenilone 1083 1078 - 1.650.03 - GC, MS
29 Fenchone 1084 1083 624.5664.50 23.420.10 - GC, MS, CoGC
30 trans-Linalool oxide (furanoid) 1086 1084 - 3.750.41 7.430.76 GC, MS
31 -Terpinolene 1090 1086 4.970.30 - - GC, MS, CoGC
32 Linalool 1100 1095 68.045.97 21.635.92 43.989.69 GC, MS, CoGC
33 trans-Sabinene hydrate 1103 1098 - - 3.230.09 GC, MS
34 Nonanal
g
1104 1100 - 0.190.02 - GC, MS
35 Phenylethyl alcohol
h
1113 1106 - 0.150.07 5.111.46 GC, MS, CoGC
36 -Fenchol 1118 1114 19.931.21 - - GC, MS, CoGC
37 Dehydrosabinaketone
g,h
1119 1117 - 0.200.02 1.490.01 GC, MS
38 trans-p-2,8-Menthadien-1-ol
h
1121 1119 - - 0.800.01 GC, MS

Suite du tableau la page suivante
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre III. Rsultats et Discussion



144
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

Tableau 16 (suite)

N Constituant
a
IR
b
IR
c

Composition (g eq. eugnol/g poids sec)
d

Identification
e

L. pedunculata L. stoechas L. viridis
39 -Campholenal 1122 1122 - 0.840.32 7.290.78 GC, MS
40 Chrysanthenone 1125 1124 - 0.260.04 - GC, MS
41 cis-Limonene oxide
f,h
1132 1132 0.890.19 - 0.400.01 GC, MS
42 cis-p-2,8-Menthadien-1-ol
f
1136 1133 2.840.36 - - GC, MS
43 Nopinone
h
1139 1135 - 0.770.05 2.350.11 GC, MS
44 trans-Pinocarveol
h
1140 1135 3.520.28 1.200.33 11.881.33 GC, MS
45 trans-Verbenol 1140 1140 3.190.04 - - GC, MS
46 Camphor 1146 1141 64.701.27 229.0422.35 158.1812.12 GC, MS, CoGC
47 Camphene hydrate
f,h
1154 1145 1.150.36 - 0.870.27 GC, MS
48 Pinocarvone 1160 1160 - 0.870.37 16.541.31 GC, MS
49 -Terpineol
f,h
1162 1162 4.160.53 4.101.09 24.064.21 GC, MS, CoGC
50 Lavandulol 1169 1165 32.315.88 - - GC, MS, CoGC
51 Borneol 1171 1165 4.280.52 4.140.26 17.261.62 GC, MS, CoGC
52 trans-Linalool oxide (pyranoid) 1173 1173 - 0.940.04 - GC, MS
53 Terpinene-4-ol 1179 1174 1.510.77 2.160.46 2.610.43 GC, MS, CoGC
54 p-Methylacetophenone
f,h
1183 1179 0.290.15 1.050.17 3.260.18 GC, MS
55 p-Cymen-8-ol 1186 1179 6.240.09 1.060.18 3.530.33 GC, MS
56 Verbenone 1205 1204 5.530.99 1.680.32 18.051.34 GC, MS, CoGC
57 2,E-Octenol acetate
h
1210 1208 - - 0.430.02 GC, MS
58 trans-Carveol 1216 1215 3.710.33 0.910.26 5.500.46 GC, MS
59 -Fenchyl acetate 1218 1218 1.310.67 - - GC, MS
60 trans-Geraniol
f
1223 1224
1
0.510.05 - - GC, MS, CoGC
61 exo-2-Hydroxycineole
f,h
1226 1228
2
1.230.25 0.630.07 3.670.17 GC, MS
62 cis-Carveol
f,h
1231 1226 2.510.29 - 1.410.08 GC, MS
63 Carvone
h
1242 1239 4.340.33 0.940.22 5.430.22 GC, MS, CoGC
64 Linalyl acetate
f
1248 1254 18.122.39 - 7.382.13 GC, MS, CoGC
65 2-Phenethyl acetate 1252 1254 - 0.680.15 - GC, MS, CoGC
66 Isopiperitenone
f,g,h
1266 1266
3
0.510.05 0.450.05 0.930.05 GC, MS
67 Bornyl acetate 1282 1287 - 28.342.63 - GC, MS, CoGC
68 Lavandulyl acetate 1282 1288 59.852.33 - 27.820.90 GC, MS, CoGC
69 p-Cymen-7-ol
g,h
1290 1289 - - 1.590.43 GC, MS
70 Myrtenyl acetate
h
1321 1324 0.620.08 59.510.62 0.520.10 GC, MS, CoGC
71 Neryl acetate
f,g,h
1357 1359 1.490.83 1.980.12 0.770.07 GC, MS
72 Cyclosativene 1365 1369 - 2.310.81 - GC, MS
73 -Copaene 1373 1374 - 6.822.36 - GC, MS, CoGC
74 Geranyl acetate 1377 1379 - 1.290.02 18.732.62 GC, MS, CoGC
75 trans-Sobrerol
h
1381 1382
2
- - 1.550.06 GC, MS
76 Benzyl isovalerate
h
1384 1385
4
- - 0.980.02 GC, MS
77 -Elemene* (Germacrene A)
f,g,h
1387 1389 0.660.07 2.800.02 0.850.21 GC, MS, CoGC

Suite du tableau la page suivante
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre III. Rsultats et Discussion



14-
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

Tableau 16 (suite)

N Constituant
a
IR
b
IR
c

Composition (g eq. eugnol/g poids sec)
d

Identification
e

L. pedunculata L. stoechas L. viridis
78 Sativene
f,h
1391 1390 1.040.13 0.800.03 0.400.01 GC, MS
79 2-Phenylethyl isobutyrate
h
1391 1393 - - 2.530.14 GC, MS
80 -Gurjunene
g
1403 1409 - 1.490.74 - GC, MS
81 -Caryophyllene
f
1416 1417 2.570.74 7.092.18 - GC, MS, CoGC
82 Carvone hydrate
h
1426 1422 - - 2.570.57 GC, MS
83 Z--Farnesene
h
1431 1440 - - 0.800.08 GC, MS
84 n-Octyl 2-methyl butyrate
h
1433 1434
5
- - 4.970.56 GC, MS
85 -Humulene 1451 1452 - 0.960.50 - GC, MS
86 trans--Farnesene
h
1452 1454 - - 0.880.17 GC, MS
87 Allo-Aromadendrene 1456 1458 - 3.421.06 - GC, MS
88 epi-Bicyclosesquiphellandrene
f
1458 1452
6
1.040.38 - - GC, MS
89 -Amorphene
g
1472 1483 - 0.790.04 - GC, MS
90 Germacrene D 1477 1484 0.910.59 5.732.18 12.430.72 GC, MS, CoGC
91 Eremophilene 1484 1483
7
46.145.96 - - GC, MS
92 Phenethyl 2-methylbutyrate 1484 1484
8
- - 44.292.55 GC, MS
93 -Selinene
f,h
1485 1489 0.910.22 1.950.83 10.960.90 GC, MS
94 Valencene
f,h
1489 1496 0.330.01 8.902.95 6.460.32 GC, MS
95 -Selinene 1492 1498 - 37.652.90 3.550.65 GC, MS
96 -Muurolene 1495 1500 - 1.200.65 - GC, MS, CoGC
97 -Bisabolene
h
1498 1506 - - 10.285.48 GC, MS
98 -Amorphene
f
1509 1511 0.730.42 - - GC, MS
99 -Cadinene 1512 1513 - 12.481.75 2.090.59 GC, MS
100 -Cadinene
h
1515 1522 - 14.590.87 2.350.69 GC, MS
101 trans-Calamenene
f
1516 1521 0.590.31 - - GC, MS
102 Ethyl p-ethoxybenzoate
h
1521 1521
9
- - 1.820.35 GC, MS
103 trans-Cadina-1,4- diene
h
1528 1533 - 2.901.27 4.982.49 GC, MS
104 -Cadinene
f,g,h
1533 1537 0.670.08 1.300.04 6.751.68 GC, MS
105 Selina-3,7(11)-diene
g
1537 1545 - 7.141.81 18.424.49 GC, MS
106 Germacrene B
f
1554 1559 0.260.07 - 2.700.67 GC, MS
107 cis--Copaene-8-ol 1559 - - 33.652.15 - MS
108 Palustrol 1566 1567 - 0.900.30 - GC, MS
109 Dodecanoic acid
h
1565 1565 - - 1.220.11 GC, MS
110 cis-3-Hexenyl benzoate
h
1568 1565 - - 1.880.12 GC, MS
111 Germacrene D-4-ol
g,h
1573 1574 - 3.741.10 1.280.10 GC, MS
112 Caryophyllene oxide 1577 1582 2.240.86 4.760.67 - GC, MS
113 Globulol 1581 1590 - 0.950.21 - GC, MS
114 Viridiflorol 1589 1592 - 22.012.95 - GC, MS
115 Ledol 1600 1602 - 5.260.67 - GC, MS
116 E-Sesquilavandulol
f,g
1623 1631 4.240.70 0.730.16 - GC, MS

Suite du tableau la page suivante
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre III. Rsultats et Discussion



146
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

Tableau 16 (suite)

N
Constituant
a
IR
b
IR
c

Composition (g eq. eugnol/g poids sec)
d

Identification
e

L. pedunculata L. stoechas L. viridis
117 2-Phenethyl hexanoate
h
1639 1640 - - 7.360.34 GC, MS
118 t-Muurolol 1640 1640 - 6.431.87 - GC, MS
119 -Eudesmol
f,h
1650 1649 9.920.84 1.400.02 4.390.66 GC, MS
120 Cinnamyl isovalerate
g,h
1674 1670
10
- 0.530.03 3.940.41 GC, MS
121 -Bisabolol 1683 1685 - - 2.910.68 GC, MS
122 Juniper camphor 1692 1690
11
- - 6.392.24 GC, MS
123 Aristolone
h
1757 1762 - - 1.870.17 GC, MS
124 Benzyl benzoate
g,h
1761 1759 - 1.690.60 23.461.34 GC, MS

Monoterpnes hydrocarbons 107.5415.33 69.413.9 76.0611.31

Monoterpnes oxygns 1154.36105.18 535.2653.6 698.266.7

Sesquiterpnes hydrocarbons 55.858.98 120.3222.99 90.2921.39

Sesquiterpnes oxygns 16.42.4 79.8310.1 18.393.91

Autres 5.460.81 9.551.58 115.379.42

Total identifi
1339.61132.7
(74.34 %)
814.3792.17
(89.09 %)
998.31112.73
(72.33 %)

a
) Constituants lists par ordre d'lution sur la colonne capillaire HP-5MS.
b
) IR = Indices de rtention exprimentaux dtermins sur la colonne HP-5MS
par co-injection dune srie de n-alcanes.
c
) IR = Indices de rtention tirs de la bibliographie :
1
Vujisic et al., 2006 ;
2
Lalel et al., 2003 ;
3
Alma et al.,
2004 ;
4
Grujic-Jovanovic et al., 2004 ;
5
Javidnia et al., 2005 ;
6
Zhao et al., 2009 ;
7
Pino et al., 2005 ;
8
Saroglou et al., 2006 ;
9
Nogueira et al., 2001 ;
10

Afsharypuor & Jahromy, 2003 ;
11
Karioti et al., 2004.
d
) Composition, en g eq. eugnol/g poids sec, obtenue par la normalisation de lair des pics (FID)
en utilisant l'eugnol en tant que standard interne ; les valeurs reprsentent la moyenne de trois dterminations lerreur standard.
e
) Mthode
didentification : GC, identification base sur les indices de rtention ; MS, identification base sur la comparaison des spectres de masse avec les banques
lectroniques WILEY et NIST et la littrature (Adams, 2007) ; Co-GC, identification base sur la co-injection des composs authentiques.
f
) Constituants
rapports pour la premire fois dans les COVs de L. pedunculata.
g
) Constituants rapports pour la premire fois dans les COVs de L. stoechas.
h
)
Constituants rapports pour la premire fois dans les COVs de L. viridis.
i
) - = Non dtect. *) Le -lmne est dtect ici entant que produit de
rarrangement thermique du germacrne A en injection 250 C.



Ces analyses chimiques ont conduit lidentification de 124 constituants, dont 58
(74.34 %) chez L. pedunculata, 76 (81.37 %) chez L. stoechas et 87 (72.33 %) chez L.
viridis. Parmi ces constituants 27, 18 et 52 sont dtects pour la premire fois chez L.
pedunculata, L. stoechas et L. viridis, respectivement. Parmi les 124 constituants identifis,
34 sont identifis dans les COVs des trois lavandes conjointement. Dans les COVs des
feuilles des trois lavandes, toutes les classes de composs sont reprsentes : terpnes,
composs aromatiques et drivs dacide gras. Nanmoins, les monoterpnes oxygns
sont majoritaires puisquils reprsentent 1154 g eq. eugnol/g PS (L. pedunculata), 535
g eq. eugnol/g PS (L. stoechas) et 698.2 g eq. eugnol/g PS (L. viridis) des taux
globaux des composs identifis (Tableau 16, Figure 40). A noter aussi que la quantit
totale de COVs est trs importante dans les feuilles de L. pedunculata (1339.61 g eq.
eugnol/g PS 132.7) par rapport celle des feuilles des deux autres lavandes Stoechas
(814.37 g eq. eugnol/g PS 29.17 pour L. stoechas et 998.31 g eq. eugnol/g PS
112.73 pour L. viridis).
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre III. Rsultats et Discussion



14
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e



Figure 40 : Teneurs et variation des classes chimiques des COVs de feuilles
des lavandes Stoechas


La Figure 41 prsente un histogramme facilitant la comparaison des constituants
majoritaires des COVs entre nos trois lavandes et la Figure 42 prsente leurs structures
dveloppes en parallles avec dautres composs identifis dans les COVs des trois
lavandes. Le fenchone (624.56 g eq. eugnol/g PS 64.50) est le constituant majoritaire
des COVs de L. pedunculata, suivi du 1,8-cinol (200.21 g eq. eugnol/g PS 13.08),
linalol (68.04 g eq. eugnol/g PS 5.97), camphre (64.70 g eq. eugnol/g PS 1.27),
actate de lavandulyl (59.85 g eq. eugnol/g PS 2.33) et lavandulol (32.31 g eq.
eugnol/g PS 5.88). Les COVs de L. stoechas possdent une composition riche en
camphre (229.04 g eq. eugnol/g PS 22.35) suivie de 1,8-cinol (133.58 g eq.
eugnol/g PS 15.64), actate de myrtnyl (59.51 g eq. eugnol/g PS 0.62), actate de
bornyl (28.34 g eq. eugnol/g PS 2.63), fenchone (23.42 g eq. eugnol/g PS 0.10) et
linalol (21.63 g eq. eugnol/g PS 5.92). Par contre les COVs de L. viridis sont
caractriss par le 1,8-cinol (247.89 g eq. eugnol/g PS 21.53) comme compos
majeur suivi du camphre (158.18 g eq. eugnol/g PS 12.12), linalol (43.98 g eq.
eugnol/g PS 9.69) et actate de lavandulyl (27.82 g eq. eugnol/g PS 0.90). Mise
part labsence du fenchone dans les COVs de L. viridis, labsence du lavandulol dans les
COVs de L. stoechas et L. viridis, labsence de lactate de bornyl dans les COVs de L.
pedunculata et L. viridis et labsence de lactate de lavandulyl dans les COVs de L.
viridis, nous retrouvons les mmes constituants majoritaires dans les trois espces mais
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre III. Rsultats et Discussion



148
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

avec des teneurs diffrentes. De ce fait, L. pedunculata prsente un chmotype fenchone,
L. stoechas prsente un chmotype camphre et L. viridis prsente un chmotype 1,8-cinol.





















Figure 41 : Teneurs et variation des constituants majoritaires des COVs
de feuilles des lavandes Stoechas



Les autres COVs sont prsents en plus faibles proportions (Figure 40). Il sagit
majoritairement de monoterpnes hydrocarbons, comme l-pinne (16.90 0.59 - 43.80
g eq. eugnol/g PS 7.79) et le camphne (6.52 1.76 - 35.55 g eq. eugnol/g PS
1.91) dans les trois lavandes, des sesquiterpnes hydrocarbons comme lrmophilne
(46.14 g eq. eugnol/g PS 5.96), le slina-3,7(11)-dine (18.42 g eq. eugnol/g PS
4.49) et l-slinne (37.65 g eq. eugnol/g PS 2.90), respectivement chez L.
pedunculata, L. viridis et L. stoechas, et enfin par des sesquiterpnols, comme le cis-
copane-8-ol (33.65 g eq. eugnol/g PS 2.15) et le viridiflorol (22.01 g eq. eugnol/g
PS 2.95) strictement chez L. stoechas (Figure 42). Nous remarquons aussi que la teneur
en composs non terpniques est plus importante dans les COVs de L. viridis (115.37 g
eq. eugnol/g PS 9.42), avec notamment la prsence de phnylthyl 2-mthylbutyrate
44.29 g eq. eugnol/g PS 2.55 et benzyl benzoate 23.46 g eq. eugnol/g PS 1.34
(Figure 42). En plus, les COVs des feuilles des trois lavandes contiennent des drivs
dacide gras comme le trans-3-hexnol et lactate de trans-3-hexnyle (Figure 42).

t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre III. Rsultats et Discussion



14?
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e



Figure 42 : Composs en formules dveloppes identifis dans les COVs de
feuilles des lavandes Stoechas
Les numros au-dessus des noms des composs correspondent leur numrotation dans le
Tableau 16

t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre III. Rsultats et Discussion



1-u
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

III.3.3. Discussion
Un des rsultats de cette tude est que seulement 34 des 124 composs identifis lont
t conjointement dans les trois lavandes Stoechas. Cela tmoigne de la grande diversit de
composition des COVs entre ces lavandes. La majorit dentre eux taient hydrocarbons
et oxygns, avec des squelettes carbons trs varis. Qualitativement, la plupart des 34
constituants communs sont des monoterpnes hydrocarbons ou oxygns. Certains font
partie des composs majeurs ce qui indique que ces trois espces sont relativement proches
gntiquement. Les teneurs de ces composs taient cependant variables entre espces. Les
trois constituants majeurs taient le fenchone, le 1,8-cinol et le camphre. Il est clair quon
est devant une variation chmotypique inter-spcifique au sein de la section Stoechas : L.
pedunculata reprsente le chmotype fenchone, L. stoechas reprsente le chmotype
camphre et L. viridis reprsente le chmotype 1,8-cinol (Tableau 16, Figure 41).
Cependant, ces lavandes sont plus diversifies en leurs fractions sesquiterpniques. En
tout, quinze sesquiterpnes identifis parmi les COVs de L. pedunculata avec la dominance
drmophilne/-eudesmol, 29 sesquiterpnes dans les COVs de L. stoechas avec la
dominance de -selinne/cis--copane-8-ol/viridiflorol, tandis que, 21 sesquiterpnes des
COVs de L. viridis sont domins par le slina-3,7(11)-diene (Tableau 16, Figure 42). Un
dernier rsultat notable est que les COVs de L. viridis se distinguent de ceux des deux
autres lavandes Stoechas par la prsence exclusive de 14 composs non-terpniques.
La composition chimique des COVs de L. pedunculata en culture au laboratoire est
relativement proche de celle rcemment dcrite par Zuzarte et al. (2009) sur des
populations sauvages portugaises. Elles prsentaient galement un chmotype fenchone.
En plus, Zuzarte et al. (2009) ont misent en vidence un polymorphisme chimique intra-
spcifique au sein des L. pedunculata portugaise avec la prsence de deux autres
chmotype, 1,8-cinol et camphre. En parallle, une tude ancienne ralises par Garcia-
Vallejo (1992) sur un grand nombre de populations de L. pedunculata portugaises et
espagnoles a prouv aussi le polymorphisme chimique des COVs au sein de lespce L.
pedunculata avec la prsence de trois chmotype, chmotype fenchone, chmotype
camphre et chmotype 1,8-cinol. Cependant, plusieurs monoterpnes (le lavandulol,
lhydrate de cis-sabinne et lactate de linalyle) et sesquiterpnes (le -caryophyllne, le
sativne, le germacrne B, le -eudesmol, le E-sesquilavandulol), sont prsents dans les
COVs de notre chantillon, alors quils nont pas t observs dans le travail de Zuzarte et
al. (2009) et de Garcia-Vallejo (1992). Ainsi, le profil des sesquiterpnes de notre
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre III. Rsultats et Discussion



1-1
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

chantillon est domin par lrmophilne, tandis que, ceux analyss par Zuzarte et al.
(2009) et Garcia-Vallejo (1992) sont domins par l-cadinol. Ce compos na pas t
dtect dans les chantillons des trois lavandes.
Les principaux COVs de nos chantillons de L. stoechas taient le camphre, le 1,8-
cinol et lactate de myrtnyle. Le fenchone, l-selinne, le cis--copane-8-ol et le
viridiflorol, tous des terpnes habituellement rencontrs chez L. stoechas, taient
galement prsents en quantits importantes. Cette composition chimique des COVs de L.
stoechas en culture prsente des similitudes avec celles rapportes pour des populations
sauvages de L. stoechas originaires de plusieurs rgions mditerranennes, savoir
l'Espagne (Garcia-Vallejo, 1992), la Chypre (Valentini et al., 1993), la Grce (Kokkalou,
1988 ; Skoula et al., 1996), la Corse (Ristorcelli et al., 1998), lItalie (Angioni et al., 2006),
la Turquie (Dadaliolu & Evrendilek, 2004), la Tunisie (Bouzouita et al., 2005), lAlgrie
(Dob et al., 2006a) et le Maroc (Zrira & Benjilali, 2003). En comparaison avec les 11
populations sauvages algriennes tudies dans la premire section rsultats, les plantes
cultives au laboratoire ont un profil de COV qui se rapproche le plus de la population LS6
avec galement un chmotype camphre.
La composition chimique de COVs de L. viridis est trs proche de celles publies par
Garcia-Vallejo, (1992), Nogueira et Romano, (2002), Zuzarte et al. (2011). Cependant,
quelques diffrences sont observes lors de lanalyse qualitative et quantitative des
constituants minoritaires. A notre connaissance, nous reportons pour la premire fois la
prsence de quelques composs en quantit modre tels que le -terpinol, le trans-
pinocarvol, le -selinne, le valencne et le benzoate de benzyle (Tableau 16, Figure 42).
Dans dautres tudes prcdentes ralises par Garcia-Vallejo (1992) et Zuzarte et al.
(2011), certains chantillons individuels ou collectifs de L. viridis originaires de diffrents
sites du Portugal et de l'Espagne ont t analyss. La composition chimique de ces
chantillons tait toujours trs semblable celle de nos chantillons, le 1,8-cinol et le
camphre tant toujours les deux composants principaux. Une autre tude portant sur des
plantes cultives au champ de L. viridis, des plantes cultives in vitro depuis des tiges et
des plantes en micropropagation d'un mme clone, ont rvl la prsence de COVs
globalement similaires entre ces lots de plantes (Nogueira & Romano, 2002). Le 1,8-cinol
et le camphre taient toujours les composs les plus abondants.
Plusieurs tudes ont montr que les COVs de la plupart des espces du genre
Lavandula sont constitus principalement de composs monoterpniques et que les autres
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre III. Rsultats et Discussion



1-2
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

composs (principalement des sesquiterpnes) ne sont prsents quavec des teneurs faibles.
Les COVs de L. lanata analyss par GC et GC/MS ont ainsi montr que le camphre (46.6
%) et le lavandulol (29.2 %) taient les principaux composs (Tomei et al., 1995). Les
tudes de Gamez et al. (1990) et Bousmaha et al. (2005, 2006) sur la composition des
COVs de L. dentata ont rvl le 1,8-cinol comme constituant principal (21% 75% du
total du COVs). La composition des COVs de L. bipinnata a montr le trans-carvol
(18.93 %), le pulgone (8.45 %) et le camphre (7.09 %) comme constituants principaux
(Hanamanthagouda et al., 2010). L. angustifolia est une des plantes aromatiques les plus
importantes commercialement. L'actate de linalyle, le linalol et le 1,8-cinol en sont les
COVs principaux, bien que leurs concentrations puissent varier selon le gnotype de plante
et la zone de culture (Venskutonis et al., 1997 ; Hajhashemi, et al., 2003 ; Cong et al.,
2008).
En rsum, cette tude confirme des travaux antrieurs et met en lumire plusieurs
points intressants. Elle confirme la prsence de 3 chmotypes au sein de L. stoechas Sensu
Lato qui sont bass sur des proportions diffrentes de fenchone, 1,8-cinol et camphre. Elle
confirme que les composs les plus abondants sont des monoterpnes oxygns ou
purement hydrocarbons. En complment des tudes pralablement publies sur ce groupe
vgtal, elle confirme que la plupart de ces composs sont communs aux 3 espces de la
section Stoechas mais diffrent davantage des principaux COVs des autres espces de
lavande bien que ceux-ci soient aussi des monoterpnes, Les mmes diffrentiations des
chmotypes sont prsentes aussi chez les 3 espces actuellement reconnues dans la section
Stoechas. Tout ceci conforte la faible diffrentiation taxonomique entre ces espces (Upson
& Andrews, 2004). Nos plantes tant cultives de manire artificielle loin de leur aire de
distribution, notre tude indique galement que les composs monoterpniques principaux
ont une accumulation qui est peu module par les conditions environnementales. Les
diffrences de COV des 3 taxons de la section Stoechas de cette tude se situent surtout au
niveau des COVs minoritaires (sesquiterpnes et composs non-terpniques). Ce sont aussi
ces composs qui diffrent entre nos analyses et celles des autres tudes. Mme si les
diffrences entre nos rsultats et ceux dautres tudes peut reflter des diffrences
environnementales (plantes cultives en dehors de leur aire naturelle et populations
sauvages), ceci ne peut tre le cas quand on compare les rsultats obtenus sur les 3 taxons
de cette tude car les plantes analyses taient cultives dans des conditions similaires. La
plus grande variabilit des composs minoritaires reflte donc soit leur rle cologique
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre III. Rsultats et Discussion



1-J
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

une chelle microgographique, soit une forte sensibilit aux stimuli environnementaux,
soit, loppos, une absence de pression de slection (et une libert volutive non-
restreinte par slection). De plus amples tudes seront ncessaires pour rpondre cette
question. Par contre, ce que notre tude indique pour la premire fois est que la grande
diversit des COVs dcrits dans des populations sauvages de L. stochas Sensu Lato nest
pas du lanalyse de mlanges de plantes prsentant individuellement des profils en COV
simplifis et diffrents. Nous avons observ les mmes profils de COVs dans des plantes
diffrentes issues dun mme lot de graines dune mme population sauvage. Chaque
plante possde, peu de choses prs la grande diversit en COVs de sa population
dorigine. Une population chmotype 1,8-cinol/camphre, par exemple, nest pas un
mlange dindividus aux phnotypes 1,8-cinol ou camphre. Une premire question
intrigante est donc de savoir comment une plante peut, avec son nombre de gnes limit,
produire autant de COVs aussi diffrents dans leurs squelettes carbons. Une seconde
question est de savoir comment des individus dune mme espce (ou groupe proche
despces comme celles de la section Stoechas) peuvent diffrer entre elles de part leur
chmotype et par autant de COVs minoritaires alors quelles conservent en commun la
majorit de leurs COVs majoritaires.
























t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre III. Rsultats et Discussion



1-4
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

III.4. Biosynthse des terpnes chez L. stoechas Sensu Lato

III.4.1. Introduction
Une des conclusions du chapitre prcdent est que les trois plants de L. stoechas
Sensu Lato en culture au laboratoire ont des profils sesquiterpniques entirement
diffrents et diffrent aussi par leur taux de fenchone. Ce compos reprsente plus de la
moiti des composs organiques volatils (COVs) accumuls par L. pedunculata alors quil
est un taux trs faible chez L. stoechas et non-dtectable chez L. viridis. Ces trois espces
avaient cependant en commun des taux importants de deux autres formes bicycliques
indpendantes de monoterpnes, le 1,8-cinol et le camphre et des quantits significatives
de nombreux monoterpnes dont une troisime forme de monoterpne bicyclique, l-
pinne. Le but du travail prsent dans ce chapitre est de donner des bases molculaires
aux diffrences de COVs observes entre ces trois plantes de ces trois espces pourtant
proches taxonomiquement.
Durant ces dernires dcennies, des progrs considrables ont t raliss sur la
connaissance des voies de biosynthse des composs terpniques. La grande diversit des
squelettes carbons des monoterpnes et sesquiterpnes est tablie par laction dune seule
famille denzyme, les terpnes synthases (TPS), partir de deux substrats respectifs
uniques et universels dans le rgne vgtal, le granyl diphosphate (GPP) et le farnsyl
diphosphate (FPP). Ceux-ci ne sont dailleurs que deux oligomres pyrophosphoryls de
lisoprne. Du fait du mode de catalyse de ces enzymes qui ncessite la cration dun
intermdiaire carbocationique et qui peut subir de multiples rarrangements, il est frquent
que les membres de cette famille denzymes coproduisent plusieurs types de produits. Il est
galement frquent que laccs au site catalytique soit poreux et laisse pntrer une
molcule deau durant la catalyse. Le fort pouvoir nuclophile de leau, et la capacit du
site catalytique de de-protonner et orienter cette molcule deau, permettent leau de
neutraliser le carbocation intermdiaire et ainsi gnrer un produit hydroxyl. Les produits
des mono- et sesquiTPS peuvent donc tre soit hydrocarbons, soit mono-hydroxyls. Les
produits des TPSs peuvent ensuite tre modifis par oxydation ou tre hydroxyls par des
oxydases ou bien tre actyls par des actyl transfrases. Dans le cas des principaux
monoterpnes de L. stoechas Sensu Lato, le 1,8-cinol et l-pinne sont connus pour tre
des produits directs de laction de TPS (McKay et al., 2003 ; Phillips et al., 2003 ; Chen et
al., 2004 ; Shimada et al., 2005 ; Gnnewich et al., 2007 ; Kampranis et al., 2007 ; Roeder
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre III. Rsultats et Discussion



1--
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

et al., 2007) alors que le fenchone et le camphre sont des produits doxydation de deux
produits de TPS, le fenchol (Croteau et al., 1978 ; Croteau et al., 1980) et le bornol
(Croteau & Karp, 1977, 1979 ; Croteau et al., 1978 ; Wise et al., 1998), respectivement
(Figure 43). Au vue des faibles quantits de bornol et fenchol dtectes dans nos extraits,
il est probable que les activits enzymatiques responsables de leur oxydation soient trs
actives chez L. stoechas Sensu Lato. Nous avons donc fait lhypothse que les diffrences
de teneur en fenchone et de nature en sesquiterpnes entre nos taxons soient lies une
action diffrentielle dune, ou plusieurs, mono- et sesquiTPS.


Figure 43 : Biosynthse d-fenchol, -pinne, 1,8-cinol, bornol et du camphre partir
du granyl diphosphate via le -terpinyl cation
Toutes les tapes ractionelles sont catalyses par des TPSs (1,8-cinol synthases, bornyl diphosphate
synthase, bornol synthase, fenchol synthase, pinne synthase) sauf pour la formation par oxydation du
camphre et du fenchone qui sont catalyses, respectivement, par la bornol dshydrognase (Croteau et
al., 1978) et la fenchol dshydrognase (Croteau et al., 1980). * La conversion du granyl diphosphate en
cation -terpinyle comprend plusieurs tapes ne sont pas prsentes. Les numros au-dessous des noms
des composs correspondent leur numrotation dans le Tableau 16.


t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre III. Rsultats et Discussion



1-6
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

De nombreuses tudes fonctionnelles sur les TPS ont permis dtablir que des
modifications artificielles de certains acides amins indipendants de ceux ncessaires pour
laccomplissement du processus catalytique conduisent une modification de la nature
chimique des produits quelles forment (e.g. Cane et al., 1996a, b ; Little & Croteau, 2002 ;
Seemann et al., 2002 ; Prosser et al., 2004 ; Hyatt & Croteau, 2005). Quelques rares tudes
ont suggr que de telles mutations ponctuelles ont pu se produire lors des processus
volutifs et conduire une volution des profils de COVs. Ainsi, Kampranis et al. (2007)
ont montr que le rsidu Asn338 de la 1,8-cinol synthase de Salvia fruticosa joue un rle
primordial dans la fixation dune molcule deau et que sa mutation N338I comme prsent
dans les sabinne synthases de S. officinalis et S. pomifera empche lenzyme de S.
fruticosa de produire des monoterpnes hydroxyls et la transforme en une sabinne
synthase. Inversement, la mutation I338N sur la sabinne synthase de S. pomifera a permis
cette enzyme de produire des monoterpnes oxygns dont le 1,8-cinol. Seuls 48.3 %
des produits forms par la 1,8-cinol synthase de S. fruticosa N338I taient du sabinne.
Un double mutant possdant aussi la mutation A339T pour mieux mimer les squences des
sabinne synthases de S. officinalis et S. pomifera a augment le taux de conversion en
sabinne 62.1 %. Finalement, le dcalage dun rsidu proline dune position (I449P suivi
de P450T), toujours pour rapprocher la squence de S. fruticosa de celles de deux autres
sauges a conduit un taux de conversion de 86.8 %. Mais des mutations ponctuelles ne
sont pas les seuls vnements volutifs pouvant expliquer une modification de chmotype.
Lors dune tude comparative des voies de synthse des armes des varits de fraise
cultives Fragaria ananassa et de fraises sauvages F. vesva, Aharoni et al. (2004) ont
observ que ces deux espces possdent toutes deux deux gnes de TPSs, nrolidol
synthase et -pinne synthase, dans leurs gnomes respectifs mais que lexpression du
gne de nrolidol synthase nest importante que chez F. ananassa et celui de -pinne
synthase que chez F. vasca, justifiant ainsi la production de nrolidol et linalol chez la
fraise cultive et -pinne et produits drivs (myrtnol et actate de myrtnyl) chez la
fraise sauvage. Labsence dexpression du gne d-pinne synthase dans lespce de
fraise cultive sexpliquait par la prsence dans sa squence dune insertion de 2 pb (deux
C) qui crent un codon stop juste aprs. Le faible niveau dexpression du gne de nrolidol
synthase dans lespce de fraise sauvage tait plus difficile expliquer car les produits
recombinants purifis des deux gnes homologues possdaient la mme activit
enzymatique. Le gne de la fraise sauvage possdait cependant une diffrence structurale
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre III. Rsultats et Discussion



1-
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

majeure qui tait un peptide dadressage N-terminal la mitochondrie et au plaste qui
ntait pas traduit chez la fraise domestique (codons start alternatifs). De telles tudes sont
cependant rares et, pour les deux qui ont t cites, ont concern des espces
botaniquement distantes ou ayant t spares par un processus de domestication. Elles ne
permettent donc pas de prdire comment des chmotypes ont pu voluer au sein dune
espce ou entre espces botaniquement trs proches comme au sein de L. stoechas Sensu
Lato.
Jusqu'en 2008 inclus, date laquelle cette tude a t entame, 92 monoTPSs depuis la
limonne synthase (Mentha spicata, Colby et al., 1993) et 113 sesquiTPSs depuis la 5-epi-
aristolochne synthase (Nicotiana tabacum, Facchini & Chappell, 1992) avaient t isoles
et clones chez des vgtaux (Degenhardth et al., 2009). Parmi ces squences, 62
appartenaient des TPSs de Lamiaces dont 45 de monoTPSs et 17 de sesquiTPSs (Figure
44). La plupart de ces TPSs avaient t isoles des genres Perilla (17), Mentha (12),
Ocimum (9) et Salvia (9). Trois gnes codant des monoTPSs et un gne codant une
sesquiTPS de Lavandula avaient t caractriss lorsque ce travail a dbut. Un premier
chez L. latifolia a t dpos directement dans Genbank en 2006 et ensuite trois autres chez
L. angustifolia (Landmann et al., 2007). Landmann et al. (2007) ont isol et caractris une
limonne synthase (LaLIMS), une linalool synthase (LaLINS) et une bergamotne
synthase (LaBERS) de fleurs de L. angustifolia. Ces TPSs expliquent la synthse de 5 des
mono- et sesquiterpnes les plus produits par cette espce. Vers la fin de notre tude, et
toujours partir des fleurs de L. angustifolia, une -phllandrne synthase (LaPHLS) a
t clone (Demissie et al., 2011) suivi dune 1,8-cinol synthase (LiCINS) clone est
caractrise depuis le lavandin L. x intermdedia (Demissie et al., 2012). Les deux parents,
L. angustifolia et L. latifolia, possdaient des squences 100 % similaires.
A lheure actuelle, seulement 5 TPSs ont t clones, caractrises et publies en
dtail chez L. angustifolia (Tableau 17). Comme aucune des monoTPS et sesquiTPS de
lavandes dj caractrises ne gnre les mono- et sesquiterpnes typiques des lavande
Stoechas, nous navons pas utilis leurs squences comme matrice pour dcouvrir les TPS
des lavandes Stoechas. Nous avons utilis une approche base sur lusage damorces
dgnres et qui nous a permis de dcouvrir deux monoTPS et une sesquiTPS chez L.
pedunculata et leurs homologues chez L. stoechas et L. viridis. Ltude fonctionnelle
comparative des enzymes recombinantes pures correspondant ces 9 gnes et lvaluation
de leurs niveaux dexpression ont ensuite permis dexpliquer lorigine de certaines
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre III. Rsultats et Discussion



1-8
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

diffrences de COVs produits par ces 3 espces. Les rsultats de ce chapitre de thse sont
en cours de soumission pour publication.

Tableau 17 : Rcapitulatif de terpne synthases de lavandes

TPS Abrviation Type Produit Rfrence
limonne synthase LaLIMS Mono Limonne (39%)
Terpinolne (22%)
Camphne (16%)
-Pinne (14%)
-Myrcne (8%)
-Phllandrne (1%)
Landmann et al. (2007)
linalo synthase LaLINS Mono Linalol (100%)
bergamotne synthase* LaBERS Sesqui trans--Bergamotne (74%)
(E)-Nrolidol (10%)
(Z)--Bisabolne (6%)
(E)--Farnesne (5%)
-Sesquiphllandrne (5%)
Mono -Pinne (30%)
Sabinne (27%)
Limonne (17%)
-Pinne (11%)
Camphne (8%)
-Myrcne (7%)
-phllandrne synthase LaPHLS Mono -Phllandrne (>86.1%)
Limonne (??%)
Demissie et al. (2011)
1,8-cinol synthase LaCINS Mono 1,8-cinol (80%)
Sabinne (7.9%)
-Phllandrne (6.6%)
Limonne (2.3%)
-terpinol (1.7%)
Demissie et al. (2012)
* La bergamotne synthase interagie avec le FPP comme une sesquiTPS et avec le GPP comme une monoTPS.



III.4.2. Rsultats
III.4.2.1. Isolement de gnes de TPSs impliqus dans la biosynthse des terpnes chez
L. stoechas Sensu Lato
III.4.2.1.1. Amplification de fragments de TPSs avec des amorces dgnres sur
lADNg de L. pedunculata
Nous avons dabord dvelopp manuellement des amorces dgnres partir de
lalignement des squences protiques de TPSs de Lamiaces, afin damplifier par PCR
des gnes codant des TPSs. Pour cela, un arbre a t construit partir de 62 squences
protiques de TPSs de Lamiaces disponibles en fvrier 2008, pour mettre en vidence
dventuelles sous-classes denzymes. A laide du logiciel CLC, les squences ont t
alignes selon un algorithme dalignement propre ce logiciel, et un arbre (Figure 44) a t
gnr par lalgorithme UPGMA (Unweighted Pair Group Method with Arithmetic mean).
Lanalyse de "bootstraps" a t calcule partir de 100 rptitions. Larbre obtenu
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre III. Rsultats et Discussion



1-?
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

regroupe les TPSs selon les homologies de leurs squences protiques. Dautres
algorithmes dalignement de squences ou dagglomration ont galement t tests
(ClustalW, NJ) et ont donn des rsultats trs proches de ceux obtenus par CLC.
Le profil de cet arbre a permis de dfinir six clusters de TPSs (Figure 44) : les clusters
1, 2, 4 et 6 regroupent des monoTPSs, tandis que les clusters 3 et 5 regroupent des
sesquiTPSs. Pour chaque cluster, les squences protiques ont t alignes dans le logiciel
Bioedit en utilisant lalgorithme ClustalW. Ces alignements ont permis de dgager des
rgions conserves partir desquelles des amorces dgnres ont t dfinies pour tenter
damplifier des fragments de gnes de lavandes. Les couples damorces ont t dfinis
dans des zones conserves et pauvres en leucine, arginine et srine car ces trois acides
amins sont issus dune forte dgnrescence de codons. Les squences nuclotidiques des
amorces dgnres ont ensuite t obtenues manuellement par la correspondance du code
gntique (un exemple est montr sur la Figure 45). Elles ont t annotes "TPSxd", suivi
de "F" (Forward) pour les amorces sens ou "R" (Reverse) pour les amorces antisens. Un
total de huit amorces dgnres (Tableau 9) ont ainsi t dsignes et synthtises, cinq
sens (TPS1dF, TPS2dF, TPS3dF, TPS4dF et TPS5dF) et trois antisens (TPS6dR, TPS7dR
et TPS8dR). La Figure 46 montre la position et la squences en acides amins des 8
amorces dgnres sur la limonne synthase de L. angustifolia.
Nous avons ensuite dfini partir de quel organe il serait le plus judicieux de travailler
pour raliser le clonage des ADNc impliqus dans la synthse des terpnes. Des analyses
par GC/MS sur les extraits hexanes des feuilles et de diffrentes organes floraux de L.
pedunculata ont t ralises afin dtablir les profiles des COVs (rsultats non montrs).
Ces analyses nous ont permis de constater que les profiles des COVs sont similaires entre
ces diffrents organes. Les feuilles ont t choisies parce quelles sont pratiquement
disponible tous au long de lanne. Feuilles et inflorescences sont utilises de manire
quivalente lors des usages traditionnels. Lespce L. pedunculata a t slectionne pour
lobtention des premires squences car les rsultats du chapitre prcdent montrent que
cest lespce qui accumule le plus grand nombre, et la plus grande quantit, de COVs. Elle
a de plus un chmotype trs typ par la prsence de fenchone, une substance prsente en
faible quantit ou absente chez les deux autres espces.
Il aurait t prfrable deffectuer nos premires PCRs directement partir dADNc de
feuilles pour nobtenir que des squences de TPSs exprimes dans ce tissu. Cependant, nos
premiers rsultats de PCR sur ADNc ont t un chec. Nous avons donc commenc
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre III. Rsultats et Discussion



16u
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

amplifier des fragments de TPS avec des amorces dgnres partir dADNg de L.
pedunculata. Cet ADN peut tre obtenu trs pur, et en grande quantit, partir de feuilles
de cette espce cultive en hydroponie.




Figure 44 : Arbre de regroupement de 62 TPSs de Lamiaces
Cet arbre est tabli sur lhomologie des squences en acides amins disponibles en fvrier 2008, en utilisant le
logiciel CLC viewer 4. Sur la figure apparaissent les valeurs de bootstrap ainsi que les clusters de TPSs qui ont t
dfinis. La barre d'chelle indique une divergence de squence de 60%.









t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre III. Rsultats et Discussion



161
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e











Figure 45 : Dfinition dune amorce dgnre sur une zone conserve
La figure reprsente lexemple de dfinition de lamorce dgnre TPS4dF sur une zone conserve de
lalignement des squences peptidique de TPSs du cluster 2.
















Figure 46 : Reprsentation schmatique de la position et les motifs cibles des amorces dgnres
(TPS1dF, TPS2dF, TPS3dF, TPS4dF, TPS5dF, TPS6dR, TPS7dR et TPS8dR) utilises pour
lamplification des gnes partiels de TPS de L. pedunculata
Les positions relatives des 8 amorces dgnres sont indiques sur la squence nuclotidique de l'ADNc de la limonne
synthase (la bar d'or) de L. angustifolia (DQ263740, Landmann et al., 2007). L'chelle suprieure et les squences protiques
montrent respectivement, les emplacements et les motifs cibles o les amorces dgnres ont t conues.







t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre III. Rsultats et Discussion



162
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

Plus dune centaine damplifications ont t ralises en faisant varier les paramtres
du PCR tels que le volume et la temprature dhybridation des amorces et le volume de
lADNg. Toutes les combinaisons possibles de couples damorces ont t testes et ont
permis damplifier un grand nombre de fragments de tailles diverses (200 pb 950 pb).
Ces fragments ont t clons dans le vecteur pGEM-T easy qui a ensuite t insr dans
des bactries E. coli (DH5 ou JM109). Linsertion du fragment dADN dans le plasmide
pGEM-T easy va interrompre lexpression du peptide lacZ, empchant les bactries
transformes par ce plasmide de digrer le X-Gal. Quand ce dernier est ajout dans le
milieu en prsence dIPTG (inducteur de LacZ), les bactries possdant le plasmide avec le
fragment dADN insr apparaissent en blanc alors que celles qui nont pas incorpor de
fragment PCR apparaissent en bleu. Ensuite, la prsence de linsert a t vrifie par PCR
sur les plasmides extraits en utilisant les amorces universelles (T7 et SP6) puis a t
squenc.
Aprs squenage et pour identifier les clones positifs qui contenaient
potentiellement des fragments de TPS, nous avons soumis toutes les squences obtenues
des analyses par les diffrents types de BLAST (GenBank-NCBI). Aprs ces analyses de
BLAST, il sest avr que les combinaisons damorces qui ont donn des produits
damplification identifis comme TPSs putatives sont les suivantes : TPS2dF/TPS6dR,
TPS3dF/TPS6dR, TPS4dF/TPS7dR et TPS5dF/TPS8dR. Il sest avr aussi que seuls huit
squences partielles diffrentes entre elles prsentaient des homologies avec les squences
de TPSs de plantes. Tous les fragments obtenus prsentaient dimportantes homologies
avec les squences nuclotidiques de mono- et de sesquiTPSs. Cinq des 8 squences
(LpMTPS1g-383, LpMTPS2g-768, LpMTPS3g-768, LpMTPS4g-792 et LpMTPS5g-795)
taient homologues des gnes de monoTPSs connues, tandis que 3 des 8 squences
(LpSTPS1g-894, LpSTPS2g-896 et LpSTPS3g-909) taient homologues des gnes de
sesquiTPSs connues. Aucun fragment similaire aux diTPSs na t amplifi.


III.4.2.1.2. Amplification de fragments de TPSs sur ADNc de L. pedunculata
Dans un premier temps, nous avons tent de confirmer lexpression de ces gnes
partiels dans les feuilles de L. pedunculata. Sur les ARN extraits des feuilles de cette
lavande, nous avons ralis des RT-PCR laide dune seconde srie damorces. Les 8
squences partielles de gnes de TPSs putatives obtenues dans la section ci-dessus ont t
dabord pices in silico de leurs introns laide de lalgorithme BLAST et ensuite
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre III. Rsultats et Discussion



16J
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

utilises pour la conception d'amorces spcifiques. Ces amorces spcifiques (Tableau 9)
ont t utilises dans des PCR pour amplifier des squences partielles de TPSs sur ADNc
de feuilles de L. pedunculata. Cette dernire dmarche confirme ou infirme l'expression de
nos 8 gnes de TPSs putatives. Toutes les couples ont permis lamplification de fragment
sauf un couple. De cela, le nombre de TPS putatives a t rduit 7 car le huitime gne de
TPS (LpSTPS3g-909) est non-exprim sur des ADNc de feuilles (chec damplification sur
ADNc). Ces squences partielles amplifies ont t squences et soumises lalgorithme
BLAST contre toutes les squences prsentes dans GenBank pour confirmer leur nature.
En plus, ces squences ont servi de matrice pour dsigner dautres amorces spcifiques qui
seront ensuite utilises pour lamplification de leurs parties en amont et en aval par
lapproche RACE-PCR.

III.4.2.1.3. Obtention de squences compltes de TPS de L. pedunculata par RACE-
PCR
Il sagit ici dobtenir des squences compltes dADNc par la technique RACE-PCR.
Cette technique permet de dcouvrir les squences en amont et en aval dune zone connue.
Le kit RACE-PCR (Marathon) contient le bagage enzymatique ncessaire de la synthse
des ADNc doubles brins ainsi que lenzyme de ligation qui sert lier des adaptateurs aux
extrmits des ADNc pour tablir la banque RACE. A laide dune amorce spcifique
dune zone connue dun gne et dune amorce complmentaire ladaptateur (AP1 et AP2,
Tableau 9), il est possible damplifier par PCR la squence inconnue comprise entre les
deux. La longueur de cette squence va dpendre de la position de lamorce spcifique.
Cest pourquoi on utilise en gnral plusieurs amorces spcifiques afin dobtenir des
produits de PCR de tailles diffrentes. De ce fait des amorces spcifique (LpTPS1RP,
LpTPS2RP et LpTPS3RP, Tableau 9) sont dsignes pour la 5-RACE afin damplifier
lextrmit 5 et dautres amorces spcifiques (LpTPS1FP, LpTPS2FP et LpTPS3FP,
Tableau 9) sont dsignes pour amplifier lextrmit 3 (3-RACE). Aprs lapplication de
la technologie RACE-PCR sur les 7 squences partielles de gnes de TPSs putatives nous
avons russi isoler trois extrmits 3 compltes (incluent la queue poly-A) et trois
extrmits 5 compltes (UTR-5) de trois gnes de TPSs putatives. Enfin, a laide de trois
couples damorce (LpTPS1fullF/LpTPS1fullR, LpTPS2fullF/LpTPS2fullR et
LpTPS3fullF/LpTPS3fullR, Tableau 9) dsign sur les rgions UTR-5 et UTR-3
dcouvertes par la RACE-PCR et non-transcrites, nous avons russi isoler par PCR trois
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre III. Rsultats et Discussion



164
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

squences entires dADNc que nous avons appeles LpFENS, LpPINS et LpGEAS (Figure
47). Elles sont respectivement issues des squences partielles, LpMTPS3g-768,
LpMTPS4g-792 et LpSTPS2g-896. Chaque squence a t insre dans le plasmide pGEM-
T easy, puis clone et squence.

III.4.2.1.4. Obtention de gnes homologues de LpFENS, LpPI NS et LpGEAS chez L.
stoechas et L. viridis
Nous avons voulu vrifier lexistence de gnes homologues aux gnes de TPSs putatifs
de L. pedunculata dcouverts dans la section ci-dessus. Au vue du lien botanique fort entre
ces trois espces, trois couples damorces distincts, LpTPS1pseuF/LpTPS1pseuR,
LpTPS2pseuF/LpTPS2pseuR et LpTPS3full2F/LpTPS3full2R (Tableau 9), ont t
dsigns manuellement sur les squences des gnes de TPSs putatives en pleine longueur
isols ci-dessus chez L. pedunculata. Ils ont ensuite t utiliss pour lamplification par
PCR sur des ADNc de feuilles de L. stoechas et de L. viridis puis le clonage pour
squenage. Deux couples damorces ont t utiliss pour amplifier des squences
tronques sans peptide plastidial ("squence pseudomature") de LpFENS, LsFENSpm et
LvFENSpm et de LpPINS, LsPINSpm et LvPINSpm. Un seul couple damorce a t utilis
pour amplifier des squences compltes de LsGEAS et LvGEAS (Figure 47). Par la suite,
afin davoir les squences compltes de LsFENS, LvFENS, LsPINS et LvPINS (Figure 47),
les squences nuclotidiques des peptides dadressage plastidiaux adjacentes aux
squences tronques "pseudomature" ont t amplifis puis squencs en utilisant la
technique de marche gnomique par PCR. Cette technique diffre de la technique RACE
par lusage dADNg comme matrice. LADNg est trait par diffrentes enzymes de
restriction (gnralement quatre) et, aprs ligation des adaptateurs aux extrmits, quatre
banques dADNg digr et ligatur sont constitues. Aprs plusieurs sries de PCR sur les
quatre banques en couplant lamorce spcifique des adaptateurs (AP1-GW, Tableau 9) aux
amorces spcifiques de nos gnes (TPS1SPR et TPS2SPR, Tableau 9), il a t possible
damplifier les squences gnomiques manquantes correspondant aux peptides dadressage
plastidiaux. Aprs clonage des produits damplification PCR de LsFENS, LsPINS,
LsGEAS, LvFENS, LvPINS et LvGEAS dans le plasmide pGEM-T easy, 5 clones distincts
ont t squencs. Ceci a mis en vidence des squences de TPSs putatives haut degr de
similarit avec celles de L. pedunculata. A chaque gne de L. pedunculata correspondait
un seul gne homologue chez les deux autres espces de lavandes.
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre III. Rsultats et Discussion



16-
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e


Figure 47 : Alignement des squences d'ADNc des TPSs putatives de L. pedunculata, L. stoechas et L.
viridis
Les squences nuclotidiques ont t alignes en utilisant le programme ClustalW (Bioedit). Les codons dinitiation et
de stop sont indiqus par des botes rouges.
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre III. Rsultats et Discussion



166
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e


Figure 47 : (suite)


t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre III. Rsultats et Discussion



16
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

III.4.2.2. Analyse des squences de TPS putatives de L. stoechas Sensu Lato
Tous nos ADNc sont, priori, complets. Leurs cadres de lecture (ORF) ont t
identifis avec un codon dinitiation ATG et un codon stop TAA ou TGA (Figure 47). Des
alignements multiples des polypeptides prdits ont t effectus par BLAST sur des TPS
prsentes dans GenBank. Ces alignements ont confirm la nature de nos ORFs. La
prdiction dun peptide signal dadressage plastidial a t effectue avec lalgorithme
ChloroP. Ils correspondent des extensions N-terminales sur les polypeptides, extensions
qui sont facilement visibles lorsque de nombreuses monoTPS et sesquiTPS sont alignes.
Ces signaux dadressage chloroplastiques sont au N-terminal dun motif conserv chez les
monoTPSs, RRx8W (Bohlmann et al., 1998a).
Les recherches de similarit de squences ont t ralises en utilisant plusieurs
algorithmes BLAST sur les squences nuclotidiques ou protiques disponibles dans
GenBank (NCBI). Les squences nuclotidiques et les squences prdites d'acides amins
de l'ensemble de nos 9 squences en pleine longueur ont dmontr des homologies des
gnes de TPS connus pour tre responsables de la biosynthse de terpnes chez les plantes
et dautres organismes. Plus prcisment, les groupes de squences correspondant nos
FENS et PINS sassocient prfrentiellement des monoTPSs connues et principalement
la limonne synthase de L. angustifolia, la linalol synthase de L. latifolia, la -myrcne
synthase et la fenchol synthase dOcimum basilicum. Les squences correspondant nos
GEAS sassocient quant elles prfrentiellement des sesquiTPSs connues, la valencne
synthase de Perilla frutescens et la germacrne A synthase de Pogostemone cablin. Donc,
nos gnes FENS et PINS sont potentiellement des monoTPSs et nos gnes GEAS sont
potentiellement des sesquiTPSs. Labsence de relation obligatoire entre la squence
protique dune TPS et les produits quelle forme ne nous permet cependant pas de prdire
les produits forms par nos TPS sur la seule base de similarits de squences.
Les caractristiques de nos 9 TPS de lavande Stoechas sont rsumes dans le Tableau
18. Un diagramme montrant lalignement, et les homologies entre les squences protiques
prdites, est prsent Figure 48. Les donnes caractristiques de nos TPSs putatives sont
similaires aux monoTPSs et sesquiTPSs vgtales dj caractrises. Tous nos gnes de
monoTPSs putatifs (groupes FENS et PINS) clons ont un cadre de lecture ouvert de 1785
1803 pb. Les protines correspondantes sont constitues de 594 600 rsidus dacides
amins (aa), soit des masses molculaires (PM) prdites de 69.38 70.22 kDa et des points
isolectriques (pI) entre 5.39 et 5.67. Les gnes de sesquiTPSs putatifs du groupe GEAS
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre III. Rsultats et Discussion



168
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

sont plus petits en longueur : de 1629 1644 pb et de 542 547 rsidus aa, soit des PMs
prdites de 63.75 64.10 kDa et des pIs entre 4.99 et 5.02. Dans les cas des groupes FENS
et PINS, leurs polypeptides prdits sont caractriss par une forte teneur en Leu (12.17 -
12.46 %), tandis que, les TPSs du groupe GEAS se caractrisent par un contenu lev en
Glu (10.68 - 11.33 %). Toutes les TPSs putatives sont dpourvues de rsidus Cys et Tyr.


Tableau 18 : Caractristiques des squences des gnes clons de TPSs putatives de L. pedunculata, L.
stoechas et L. viridis


Gne de TPS
ORF
(pb)
Taille
(aa)
PM
(kDa)
pI
Acide
amine
haut (%)
Peptide
dadressage
plastidial (aa)
RRx8W GVYxEP
Activit
putative
LpFENS 1785 594 69.38 5.61 L, 12.46 Oui (50) Oui Non mono
LsFENS 1785 594 69.45 5.67 L, 12.46 Oui (50) Oui Non mono
LvFENS 1785 594 69.39 5.61 L, 12.46 Oui (50) Oui Non mono
LpPINS 1803 600 69.99 5.39 L, 12.17 Oui (31) Oui Non mono
LsPINS 1803 600 70.22 5.49 L, 12.17 Oui (31) Oui Non mono
LvPINS 1803 600 70.21 5.44 L, 12.17 Oui (31) Oui Non mono
LpGEAS 1644 547 64.10 4.99 E, 11.33 Non Non Oui sesqui
LsGEAS 1629 542 63.75 5.02 E, 10.70 Non Non Oui sesqui
LvGEAS 1632 543 63.82 5.02 E, 10.68 Non Non Oui sesqui
*
Les donnes d'analyse ont t calcules en utilisant ClustalW (Bioedit), sauf pour les pI et les longueurs des peptides signaux qui ont
t prdits par les algorithmes des sites Web http://web.expasy.org/compute_pi/ et http://www.cbs.dtu.dk/services/ChloroP/,
respectivement. Les abrviations utilises dans ce tableau sont : ORF, cadre ouvert de lecture ; pb, paires de bases ; aa, acide amin ;
PM, poids molculaire ; pI, point isolectrique.



Les alignements de squences protiques de toutes les TPSs putatives des groupes
FENS et PINS avec celles dautres TPSs vgtales, notamment de Lamiaces, mettent en
vidence la prsence dun ventuel peptide dadressage plastidial prcdent le motif
RRx8W. Un algorithme de prdiction des peptides dadressage (ChloroP), disponible sur le
site internet : http://www.cbs.dtu.dk/services/ChloroP/, a t utilis pour prdire lexistence
dun tel peptide. Cet algorithme a respectivement mis en vidence dans les protines des
groupes FENS et PINS une squence de 50 aa et de 31 aa dadressage aux plastes.
Cependant, les protines du groupe GEAS sont prdites sans peptide dadressage mais
avaient un motif GVYxEP caractristique des sesquiTPSs des Angiospermes (Cai et al.,
2002). Ces donnes danalyse de squences confirment laffectation initiale des TPSs des
groupes FENS et PINS en monoTPSs putatives et les TPSs du groupe GEAS en sesquiTPS
putatives.



t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre III. Rsultats et Discussion



16?
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

















































Figure 48 : Alignement des squences d'acides amins prdites des clones d'ADNc des TPSs putatives
des groupes FENS, PINS et GEAS de L. pedunculata, L. stoechas et L. viridis
Les squences protiques ont t alignes en utilisant le programme ClustalW (Bioedit). Les acides amins identiques et
similaires sont indiqus par les botes noires et grises, respectivement. Le peptide signal dadressage plastidial est indiqu
par une flche. Les motifs conservs caractristiques des TPSs sont souligns.








t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre III. Rsultats et Discussion



1u
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

Les scores didentit entre les TPSs putatives de L. stoechas Sensu Lato sont donns
dans le Tableau 19. Quelles soient nuclotidiques ou protiques, une trs forte homologie a
t observe au sein des TPSs de chaque groupe (96.7 - 99.8 %, au niveau aa). Les ORF
des ADNc de TPSs de chaque groupe (FENS, PINS et GEAS) des trois lavandes ont
prsent exactement les mmes squences nuclotidiques, sauf pour un nuclotide
polymorphe dans LsFENS et LvFENS de L. stoechas et L. viridis, respectivement, la
position 75 et 1726. A cette position, la substitution de la thymine (T) par ladnine (A)
pour LsFENS et la guanine (G) par ladnine (A) pour LvFENS a modifi les acides amins
encods la position 25 de la Ser lArg et de la Val lIle, respectivement. De mme,
LsPINS et LpPINS ont prsent un polymorphisme single et double aux positions 25 et 118
et 1535, respectivement. A ces positions, la substitution de G par A pour LsPINS et A par
G et T par C pour LpPINS ont modifi les acides amins encods la position 9 de la Gly
lArg et la position 41 de lArg la Gly et la position 512 de la Val lAln,
respectivement. De manire assez diffrente, les ADNc, LpGEAS, LsGEAS et LvGEAS ont
prsent un polymorphisme plus important et plus complexe car il incluait aussi des
insertions/dltions. Ceci a engendr un polymorphisme important sur les squences
protiques correspondantes. Ce polymorphisme est moins accentu entre LsGEAS et
LvGEAS. Par contre, lhomologie baisse quand elle est faite entre les groupes de TPSs
(27.6 - 73.8 % au niveau aa), quoi quelle reste encore leve entre les TPSs des groupes
FENS et PINS (73.3 - 73.8 % au niveau aa). Cependant, elle est trs faible entre les TPSs
de ces deux groupes et les TPSs du groupe GEAS (27.6 - 30.1 % au niveau aa, Tableau
19). En rgle gnrale, les identits au niveau nuclotidique (43.4 - 99.9 %) sont plus
leves que celles au niveau acide amin (27.6 - 99.8%).

Tableau 19 : Scores didentit de gnes clons de TPSs putatives de L. pedunculata, L. stoechas et L.
viridis

Gne de TPS
Identit
*
(%)
LpFENS LsFENS LvFENS LpPINS LsPINS LvPINS LpGEAS LsGEAS LvGEAS
LpFENS - 99.9 99.9 80.1 80.1 80.1 44.3 43.9 44.0
LsFENS 99.8 - 99.8 80.1 80.1 80.2 44.3 43.9 44.0
LvFENS 99.8 99.6 - 80.0 80.0 80.1 44.3 43.9 44.1
LpPINS 73.3 73.5 73.3 - 99.8 99.8 43.9 43.4 43.6
LsPINS 73.5 73.6 73.5 99.5 - 99.9 43.9 43.5 43.7
LvPINS 73.6 73.8 73.6 99.6 99.8 - 43.9 43.5 43.7
LpGEAS 29.1 27.6 27.6 30.1 28.6 28.6 - 97.8 97.9
LsGEAS 28.8 28.8 28.0 29.7 29.7 28.7 96.7 - 99.6
LvGEAS 28.8 28.8 28.8 29.6 29.7 29.7 96.8 99.8 -
*
Les valeurs de pourcentages didentit par paire entre les squences nuclotidiques (en italique) et les squences prdites dacides
amins (en gras) des gnes clons de TPSs.

t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre III. Rsultats et Discussion



11
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

Tous les produits des gnes de TPSs putatives que nous avons clons prsentent toutes
les caractristiques structurales des TPSs. Elles possdent les motifs spcifiques de TPSs
tels que les motifs riches en aspartates "DDxxD" et "NSE/DTE" et dautres comme le
motif "RDR" et le motif "LQLYEASFLL" (Figure 48).

III.4.2.3. Expression htrologue et purification des TPSs recombinantes
Parmi les objectifs de cette tude figurait l'expression fonctionnelle des gnes de
TPSs putatives de L. stoechas Sensu Lato. Afin datteindre cet objectif, et parce que les
fonctions spcifiques d'enzymes de TPSs ne peuvent pas tre prdites sur la base de
ressemblances de squence, nous avons dcid danalyser les activits enzymatiques des
polypeptides purs initialement produits de manire recombinante dans E. coli. Dans cette
phase, la bactrie comptente chimiquement E. coli, souche Rosetta (DE3) pLysS a t
utilise. La souche Rosetta est une souche drive de la souche BL21 pour en amliorer
l'expression des protines eucaryotes qui contiennent des codons rarement utiliss dans E.
coli. La souche Rosetta fournit des quantits additionnelles des ARNt des codons AUA,
AGG, AGA, CUA, CCC et GGA grce un plasmide pRARE. En lalimentant avec des
codons rares, la souche Rosetta assure la traduction universelle, ce qui est surtout utile dans
les cas o la traduction, autrement, serait limite par l'usage des codons ordinaire dE. coli.
De plus, le driv pLysS de cette souche possde le plasmide pLysS qui code le lysozyme
T7 et rpresseur lac permettant de rguler les niveaux dexpression.
Dans de trs nombreux cas, la production dune protine de fusion entre la protine
dintrt et une protine porteuse a conduit une amlioration importante de la
proportion de protine dintrt sous forme soluble et ayant le bon repliement. Nous
disposions dune famille de vecteurs (pHxxWA, Gateway-based vectors) permettant de
cloner et dexprimer des gnes en fusion ayant en plus une tiquette poly-histidine (6His)
en C-terminal ou en N-terminal. Pour analyser l'effet du type de protine porteuse sur
l'expression et l'activit de nos TPSs putatives, nous avons test 4 types de vecteurs
dexpression, pHGGWA, pHMGWA, pHNGWA et pHXGWA (Figure 31) comportant 4
types de protines de fusion, GST, MBP, NusA et TRX, respectivement, et un vecteur
dexpression pHGWA sans protine de fusion. Ces essais ont t raliss exclusivement
sur les TPSs putatives de L. pedunculata. Des diffrences significatives ont t observes
au niveau de la solubilit des protines recombinantes (concentration de la protine
purifie) ou au niveau de l'activit enzymatique de ces protines. A lissue de ces tests
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre III. Rsultats et Discussion



12
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

prliminaires, le vecteur pHXGWA a t retenu pour les monoTPSs putatives et le vecteur
et pHGGWA pour les sesquiTPS putatives.
Dans le but de produire des polypeptides qui imitent au mieux les protines natives,
nous avons exprim des polypeptides dpourvus de peptide signal quand celui-ci tait
prdit. Les squences tronques ont t obtenues par amplification PCR avec des couples
damorces spcifique (TPS1exF/TPS1exR, TPS2exF/TPS2exR et TPS3exF/TPS3exR,
Tableau 9). Ces peptides signaux sont en effet supprims du corps de la protine lors de
lentre dans le chloroplaste et leur prsence inhibe lactivit enzymatique. Si les sites de
clivage peuvent varier, ils sont en gnral reconnaissables par une diminution de la
frquence des rsidus srine et une augmentation correspondante de la frquence de
tyrosine et des rsidus acides, l'acide aspartique et lacide glutamique (Keegstra & Olsen,
1989 ; Gavel & von Heijne, 1990 ; von Heijne & Nishikawa, 1991). Dans la plupart des
eucaryotes suprieures, des arginines se trouvent aux positions -2 et -6 -10 par rapport au
site de clivage. Sur la base de toutes ces caractristiques et aussi en se rfrant ltude de
Landmann et al. (2007) sur les monoTPSs de L. angustifolia, le site potentiel de coupure
des clones LpFENS, LsFENS et LvFENS est DYKPV
50
D
51
ETRRx8W et pour les clones
LpPINS, LsPINS et LvPINS est DGKPL
53
D
54
ETRRx8W. Les produits d'amplification,
censs tre sans la squence codant le peptide de transit putatif, des groupes FENS et PINS
(LpFENSpm, LpPINSpm, LsFENSpm, LsPINSpm, LvFENSpm et LpPINSpm) ont t clons
dans le vecteur dexpression pHXGWA et les ADNc en pleine longueur du groupe GEAS
(LpGEAS, LsGEAS et LvGEAS) ont t clons dans le vecteur d'expression pHGGWA
donnant aprs expression des protines fusionnes en N-terminus avec les protines TRX
et GST, respectivement. Il est noter que lors des clonages de ces ADNc dans les vecteurs
dexpression, seule ltiquette poly-His en N-terminale a t maintenue, ainsi quun
oligopeptide prsentant le site de clivage la thrombine entre les deux protines
fusionner (permet la libration de la protine dintrt pendant la purification). Pour
sassurer que les constructions soient correctes, tous les clones ont t squencs. Aprs
clonage, les 9 constructions dexpression ont t nommes : pHXGWA/LpFENSpm,
pHXGWA/LpPINSpm, pHGGWA/LpGEAS, pHXGWA/LsFENSpm,
pHXGWA/LsPINSpm, pHGGWA/LsGEAS, pHXGWA/LvFENSpm, pHXGWA/LvPINSpm
et pHGGWA/LvGEAS. Lexpression de tous ces vecteurs d'expression est rgule et
dirige par la polymrase ARN-T7. Ils contiennent un promoteur lac inductible par lIPTG
permettant un haut niveau dexpression.
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre III. Rsultats et Discussion



1J
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

Nous avons ensuite tabli des conditions exprimentales permettant de surexprimer les
protines de TPSs putatives des niveaux levs. Un protocole trs efficace de purification
des TPSs a t ralis en prenant avantage des proprits de chlation du mtal nickel
ltiquette poly-histidines. En ralisant une culture liquide (TB) de 200 ml 37 C, suivie
dune induction par 0.2 mM dIPTG quand la DO
600nm
tait comprise entre 0.2 et 0.8, les
protines recombinantes sont obtenues en quantits relativement importante sous forme
soluble aprs une incubation pendant une nuit 16 C. Il existe ensuite des systmes de
chromatographie par gel daffinit au nickel (Ni
2+
) qui permettent de retenir des protines
possdant une extrmit riche en rsidus histidines, ce qui tait le cas de nos TPSs
putatives recombinantes. Les surnageants ont donc t soumis une chromatographie
daffinit sur gel de nickel. Les protines ont ensuite t lues grce au clivage
protolytique par la thrombine des protines de fusion immobilises. La purification des
protines a t possible par cette mthode partir dextraits bruts de bactries. Il y avait
vraisemblablement une quantit suffisante de protines solubles natives dans les extraits
pour permettre une purification efficace et les quantits des TPSs purifies taient de 2
18 g de protine par opration de purification (200 ml culture liquide initiale).
La solubilit et la puret des protines recombinantes de TPSs putatives ont t juges,
par lectrophorse SDS-PAGE (Figure 49). Ces critres ont t jugs suffisants pour
effectuer les tests dactivit enzymatique. Lanalyse par SDS-PAGE des fractions purifies
a indiqu la prsence des protines comme fortement exprimes et solubles mais pas
exactement avec les tailles attendues. On trouve une taille de 65 kDa au lieu de 69 kDa
pour les FINS, 66 kDa au lieu de 70 kDa pour les PINS et 59 kDa au lieu de 64 kDa pour
les GEAS. On observe toutefois sur gel dlectrophorse la prsence de contaminants
rsiduels de hauts poids molculaires (Figure 49).


Figure 49 : Analyse par SDS-PAGE des TPSs recombinantes putatives de lavandes exprimes dans E.
coli, souche Rosetta et purifies par chromatographie daffinit au Ni
2+

Piste M, marqueurs de poids molculaires de 20 250 kDa. Piste L, lysat brut de cellules recombinantes induites de
Rosetta pour chaque TPS putative. Piste P, protines recombinantes purifies par chromatographie daffinit au Ni
2+

partir des cellules de Rosetta recombinantes induites. Les bandes de protines ont t visualises par coloration au bleu de
Coomassie.
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre III. Rsultats et Discussion



14
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

III.4.2.4. Caractrisation fonctionnelle de nouvelles TPSs de lavandes
Toutes les enzymes recombinantes de TPSs (2 -18 g) ont t testes immdiatement
aprs purification avec les trois substrats habituels des TPSs sparment, le GPP, le FPP ou
le GGPP dans un tampon normalis pour l'activit des TPSs (25 mM Tris-HCl, pH 7.5, 5
% glycrol, 1 mM DTT, 10 mM MgCl
2
, 1 mM MnCl
2
, 1 mg/ml BSA, 50 M GPP, FPP ou
GGPP, Landmann et al., 2007). En l'absence d'valuation cintique pour nos TPSs
putatives, la concentration en substrats GPP, FPP ou GGPP utilise pour ces analyses a t
fixe 50 M, une concentration proche des constantes de Michaelis (Km) mesures
exprimentalement sur des TPSs connues (Cane, 1990 ; Landmann et al., 2007). LsPINS et
LvPINS ayant les mmes squences nuclotidiques en dehors de la zone codant pour le
peptide signal, seuls les rsultats obtenus avec lADNc de la forme pseudomature de
LvPINS sont prsents. L'activit enzymatique des TPSs putatives a t mesure par
GC/MS. L'identification des produits volatils des ractions enzymatique a t ralise sur
la base de leurs indices de rtention et spectres de masse en comparaison avec des
standards et/ou de lHE de patchouli comme illustr dans le Tableau 20. Les aires des pics
ont t estimes partir des chromatogrammes GC/MS (courant total en ions vs. temps de
rtention). Ainsi la Figure 50 prsente les chromatogrammes types obtenus lissue des
ractions enzymatiques (courants dions totaux des produits terpniques synthtiss in vitro
par toutes les enzymes recombinantes). Les spectres de masse des terpnes principaux sont
galement indiqus.
Les enzymes recombinantes purifies des monoTPSs putatives pseudomatures et des
sesquiTPSs putatives en pleine longueurs de L. stoechas Sensu Lato se sont toutes avres
catalytiquement actives. Les enzymes du groupe FENS et PINS ne ltaient que quand le
GPP tait le substrat et celles du groupe GEAS ne ltaient que quand le FPP tait utilis
comme substrat. Toutes nos enzymes de TPSs putatives taient incapables d'utiliser le
GGPP comme substrat.
Afin de valider nos rsultats, des contrles ngatifs ont t raliss. Ils incluaient des
tests raliss sur protines purifies partir de bactries sans vecteur dexpression et/ou sur
des enzymes recombinantes bouillies dans les mmes conditions de culture, de purification
et de dosage dactivit enzymatique. Il est noter quil est impossible de transformer des
bactries avec des vecteurs dexpression vides car cette condition est ltale (critre de
slection).


t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre III. Rsultats et Discussion



1-
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

Tableau 20 : Identification et caractristiques des produits volatils synthtiss
in vitro par les TPSs putatives recombinantes de L. stoechas sensu lato

Pic
a
Compos TR
HP-5MS
IR
HP-5MS
IR
DB5
b
Validation
c

1 -Pinne 5.84 932 932 Std
2 -Myrcne 7.37 987 988 Std
3 -Phllandrne 7.97 1007 1002 Std
4 Limonne 8.73 1027 1024 Std
5 -Terpinolne 10.79 1084 1086 Std
6 -Fenchol 12.15 1118 1114 Std
7 -Elemne 23.48 1387 1389 HEPt
8 Germacrne A 28.24 1503 1508 HEPt
a
Les numros de pic ont t attribus selon leur ordre dlution en GC/MS (HP-5MS).
b
IR pris de la
librairie dAdams (Adams, 2007).
c
Des standards authentiques ont t utiliss pour la validation de
lidentification en GC/MS (indiqus par Std), tandis que, la validation sur la base de l'HE de patchouli
en tant que standard est indique par HEPt. TR, temps de rtention ; IR, indice de rtention.




III.4.2.4.1. Identification des clones d'ADNc LpFENS, LsFENS et LvFENS en tant
que -fenchol synthases
Les produits des ractions ralises avec les enzymes LpFENSpm, LsFENSpm et
LvFENSpm taient qualitativement et quantitativement semblables. Les faibles diffrences
de squences entre ces enzymes nont donc pas eu dinfluence sur leur activit. Le Tableau
21 liste les terpnes produits in vitro avec leurs pourcentages respectifs dabondance. Il
sagit du : -fenchol 6 (71.97 - 72.76 %), limonne 4 (13.62 - 14.08 %), -pinne 1 (8.59 -
9.28 %), -terpinolne 5 (2.27 - 2.54 %), -phllandrne 3 (1.23 - 1.42 %) et -myrcne 2
(1.16 - 1.42 %) (Figure 50A, Tableau 21). Ces produits enzymatiques n'ont pas t dtects
dans nos ractions tmoin ralises sur des fractions solubles purifies dE. coli sans
vecteur d'expression et sur des fractions solubles purifies bouillies des TPSs. Ainsi l-
fenchol tait le principal produit des enzymes LpFENS, LsFENS et LvFENS. Nous les
avons donc nommes -fenchol synthases. Ces enzymes recombinantes, -fenchol
synthases, sont incapables in vitro de catalyser la transformation du FPP et du GGPP. Les
squences des ADNc de LpFENS, LsFENS et LvFENS ont t dposes GenBank sous
les numros respectifs daccession JX501511, JX501514 et JX501517.
Les COVs des feuilles de L. pedunculata sont majoritairement des monoterpnes avec
le fenchone, produit doxydation de l-fenchol, comme compos caractristique majeure
en parallle avec des quantits minimes d-fenchol (Tableau 16). Le fenchone est
galement un des COVs des feuilles de L. stoechas bien quil ny soit prsent quen
quantit mineure. L-fenchol y est cependant absent. Etonnamment, dans les COVs de
feuilles de L. viridis, nous navons pas dtect d-fenchol et fenchone. Les autres
monoterpnes produits par les trois -fenchol synthases de L. stoechas Sensu Lato sont
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre III. Rsultats et Discussion



16
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

galement prsents dans les profils monoterpniques de nos trois espces de lavande sauf
pour l-terpinolne 5 qui nest prsent que dans la fraction monoterpnique de L.
pedunculata.

III.4.2.4.2. Identification des clones d'ADNc LpPI NS, LsPI NS et LvPI NS en tant que
-pinne synthases
L'analyse des produits des enzymes recombinantes LpPINSpm et LvPINSpm par
GC/MS a rvl la prsence de l-pinne 1 comme produit principal (90.57 - 93.20 %)
ainsi que d'autres monoterpnes cycliques, le limonne 3 (4.9 - 6.8 %), l-phllandrne 2
(1.63 - 1.71 %) et l-terpinolne 4 (1.08 - 1.64 %) avec le GPP en tant que substrat
(Figure 50B, Tableau 21). Ces produits n'ont pas t dtects lorsque les ractions
enzymatiques taient ralises avec les fractions solubles purifies dE. coli ne contenant
pas de vecteur d'expression ou avec des fractions solubles purifies des TPSs puis
chauffes. Comme l-pinne tait la principale substance des enzymes LpPINS et LvPINS
dune part et la squence protique de LsPINS est, hors peptide signal, identique celles de
LvPINS, nous les avons toutes dsignes -pinne synthases. Ces enzymes recombinantes,
-pinne synthases, sont incapables in vitro de catalyser la transformation du FPP et du
GGPP. Les squences des ADNc de LpPINS, LvPINS et LsPINS ont t dposes
GenBank sous les numros respectifs daccession JX501512, JX501518 et JX501515.
Les produits forms par les enzymes du groupe des PINS sont similaires ceux
produits par les enzymes du groupe des FENS sauf pour la plus grande abondance d-
pinne et labsence d-fenchol et -myrcne.


Tableau 21 : Produits forms in vitro par les TPSs de L. stoechas Sensu Lato

Composant
a

Composition
b
(%)
LpFENS LsFENS LvFENS LpPINS LvPINS LpGEAS LsGEAS LvGEAS
-Pinne 8.70 8.59 9.28 93.20 90.57 00 00 00
-Myrcne 1.42 1.27 1.16 00 00 00 00 00
-Phllandrne 1.42 1.31 1.23 1.63 1.71 00 00 00
Limonne 14.08 13.62 13.82 4.09 6.08 00 00 00
-Terpinolne 2.27 2.45 2.54 1.08 1.64 00 00 00
-Fenchol 72.12 72.76 71.97 00 00 00 00 00
-Elemne 00 00 00 00 00 100 100 100
Germacrene A 00 00 00 00 00 100 100 100
Annotation
fonctionnelle
c

-Fenchol synthase -Pinne synthase Germacrene A synthase
a
Le -lmne est dtect ici comme produit de rarrangement thermique du germacrne A en injection chaud 250 C et le
germacrne A est dtect en injection froid 150 C.
b
Les donnes de composition (pourcentage d'abondance) ont t calcules sur
la base des aires des pics issus de lanalyse GC/MS sur colonne capillaire HP-5MS.
c
Lannotation fonctionnelle est fonde sur le
principal produit terpnique (en gras) d'enzyme recombinante exprime dans E. coli.

t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre III. Rsultats et Discussion



1
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e















































Figure 50 : Analyses par GC/MS des produits terpniques forms in vitro par les enzymes
recombinantes de TPSs des lavandes Stoechas avec le GPP ou le FPP en tant que substrats
A. Chromatogrammes montrant les courants dions totaux des produits enzymatiques des enzymes purifies LpFENSpm.
Des profils similaires ont t obtenus avec LsFENSpm et LvFENSpm.
B: Chromatogrammes montrant les courants dions totaux des produits enzymatiques des enzymes purifies LpPINSpm.
Des profils similaires ont t obtenus avec LvPINSpm, LsPINS stant avre inactive...
C: Chromatogrammes montrant les courants dions totaux des produits enzymatiques des enzymes purifies LpGEAS
injecte chaud (250 C). Des profils similaires ont t obtenus avec LsGEAS et LvGEAS..
D: Chromatogrammes montrant les courants dions totaux des produits enzymatiques des enzymes purifies LpGEAS
injecte froid (150 C). Des profils similaires ont t obtenus avec LsGEAS et LvGEAS
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre III. Rsultats et Discussion



18
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

III.4.2.4.3. Identification des clones d'ADNc LpGEAS, LsGEAS et LvGEAS en
tant que germacrne A synthases
Les analyses GC/MS des produits enzymatiques des enzymes LpGEAS, LsGEAS et
LvGEAS avec le FPP comme substrat ont rvl la prsence dun produit unique, le -
lmne (Tableau 21, Figure 50C). Il est cependant connu que les hautes tempratures,
comme la temprature du port d'injection 250C de la GC lors de lanalyse, induisent des
rarrangement de nombreuses molcules telles que le germacrne A qui se transforme
thermiquement en -lmne (Takeda, 1974 ; de Kraker et al., 1998). Une injection froid
(150C) dans la GC des mmes extraits a rvl la prsence dune seule substance, le
germacrne A (Tableau 21, Figure 50D). Les identits du germacrne A et du -lmne
ont t confirmes par GC/MS en analysant l'HE de patchouli (Pogostemon cablin) en
injection chaude et froide, les molcules germacrne A et -lmne ntant pas
disponibles commercialement sous forme pure. LHE de P. cablin referme le germacrne
A en quantits importantes et dtectables par GC/MS (Deguerry et al., 2006). Les spectres
de masse et les indices de rtention du germacrne A et du -lmne sont identiques
ceux des mmes composs contenus dans lHE de patchouli, ainsi qu ceux des librairies
lectroniques WILEY et NIST et aux donnes publies par Adams (2007). Les enzymes
LpGEAS, LsGEAS et LvGEAS sont donc des germacene A synthases. Le germacrne A,
n'a pas t produit lors de ractions enzymatiques effectues avec les fractions solubles
purifies dE. coli sans vecteur d'expression et avec des fractions solubles purifies des
TPSs chauffes. Ces enzymes recombinantes, germacrne A synthases, sont incapables in
vitro de catalyser la transformation du GPP et du GGPP. Les squences des ADNc ont t
dposes GenBank sous les numros respectifs daccession JX501513, JX501516 et
JX501519.
Le -lmne a t dtect dans les extraits de composs organiques volatils de nos 3
espces de lavandes quand les injections taient ralises chaud (250C) mais tait
indtectable quand les injections taient ralises froid (150C). Inversement, le
germacrne A ntait dtectable que dans les extraits injects froid. Le -lmne ntait
cependant prsent quen faible quantits (0.66 0.07 - 2.80 g eq. eugnol/g PS 0.02,
Tableau 16).
En rsum, toutes nos enzymes possdent une activit terpne synthase permettant de
synthtiser des terpnes prsents chez les trois lavandes Stoechas. Ces rsultats nous
permettent de dire que deux types denzymes, les -fenchol synthases (LpFENS, LsFENS
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre III. Rsultats et Discussion



1?
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

et LvFENS) et les -pinne synthase (LpPINS, LsPINS et LvPINS) sont des TPSs multi-
produits alors que les germacrne A synthase (LpGEAS, LsGEAS et LvGEAS) sont des
TPSs un produit unique. Les produits forms par ces TPSs sont prsents dans les 3
espces de lavandes analyses mais pas systmatiquement et, des fois, des taux trs
variables.

III.4.2.5. Analyse par RT-PCR semi-quantitative de l'expression des gnes de TPSs de
L. stoechas Sensu Lato
Comme les diffrences de chmotype entre les 3 espces de lavandes ne pouvaient tre
expliques par des diffrences dactivit des 3 TPSs que nous avons dcouvertes, nous
avons compar, dans les feuilles des trois lavandes Stoechas, lexpression des trois types
de gnes clons dans cette tude (-fenchol synthase, -pinne synthase et geramcrene A
synthase) par la mthode de RT-PCR semi-quantitative. Cette technique consiste
amplifier de faon simultane (co-amplification) lADNc dun gne dintrt et celui dun
gne contrle laide de deux couples damorces distincts. Le gne de -actine, dont la
protine est exprime de manire constitutive dans la cellule, a t choisi comme standard
interne pour normaliser les diffrents chantillons dADNc utiliss. Des conditions
exprimentales damplification et dhybridation compatibles ont t dfinies pour les trois
types de gnes. Les amorces ActF et ActR (Tableau 9) amplifient un fragment de 220 pb
du gne de -actine une temprature de fusion leve (66 C et 68 C, respectivement) et
donc assez spcifiques. Les amorces spcifiques aux gnes de TPSs
(FENSsemiF/FENSsemiR, PINSsemiF/PINSsemiR et GEASsemiF/GEASsemiR, Tableau
9) ont t choisies lintrieur des ORF des gnes de TPS. Elles prsentent des
tempratures de fusion de 59 C 72 C permettant une amplification la plus spcifique
possible de chaque gne tout en permettant une co-amplification spcifique du gne de -
actine. Les rsultats de cette analyse sont reprsents dans la Figure 51.
Le premier aperu sur les rsultats de cette analyse semi-quantitative montre que les
transcrits de tous les gnes de TPS clons sont exprims dans les feuilles de toutes les
lavandes mais des intensits trs diffrentes. Le gne de l-fenchol synthase est exprim
trs fortement dans les feuilles de L. pedunculata. Il lest faiblement dans les feuilles de L.
stoechas et trs faiblement dans les feuilles de L. viridis en corrlation avec la teneur trs
leve du fenchone dans cette premire lavande (624.56 64.50 g eq. eugnol/g PS,
Tableau 16), la faible prsence de cette molcule chez L. stoechas (23.4 g eq. eugnol/g
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre III. Rsultats et Discussion



18u
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

PS) et sa non-dtection dans les feuilles de L. viridis. Le fenchone est la forme oxyde de
l-fenchol qui tait prsent en faible quantit dans les feuilles de L. pedunculata et
indtectable dans les feuilles des deux autres lavandes. L-fenchol est donc
vraisemblablement trs fortement oxyd en fenchone dans ces espces de lavandes et le
niveau de transcription du gne FENS est mettre en corrlation avec le taux du couple
l-fenchol/fenchone chez les trois lavandes. Les transcrits de FENS ont tout de mme t
dtects sur gel partir de 40 cycles de PCR chez L. viridis (Figure 51). Dune faon
similaire, les cinq autres produits synthtiss par l-fenchol synthase prsentent des
teneurs au moins 6 fois plus leves dans les feuilles de L. pedunculata par rapport celles
observes chez les autres lavandes en corrlation avec lexpression du gne correspondant
sauf pour l-pinne dont la teneur chez L. pedunculata nest que 1.4 fois suprieure celle
chez L. viridis et 2.6 fois suprieure celle chez L. stoechas. L-pinne est aussi la seule
molcule dont les proportions relatives aux autres substances produites par l-fenchol
synthase diffrent entre celles observes lors des tests de dosage enzymatique et celles des
extraits de COVs des 3 lavandes. Cette substance est en effet la plus abondante des 5 co-
produits des FENS hors -fenchol dans les feuilles des trois lavandes alors quelle est la
troisime molcule la plus produite par l-fenchol synthase aprs l-fenchol et le
limonne.

Figure 51 : Analyse des niveaux relatifs des transcrits des gnes de TPSs par
RT-PCR dans les feuilles des trois lavandes
Les ARN totaux ont t isols partir des feuilles et utiliss comme matrice pour l'analyse par
RT-PCR. Lactine a servi comme un contrle endogne (gne de mnage). Les PCR ont t
ralises avec 25 cycles d'amplification pour l'actine et pour tous les gnes de TPSs, sauf pour
ceux mentionns par un astrisque (LvFENS, LsPINS et LvGEAS) qui ont t amplifis avec
40 cycles.
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre III. Rsultats et Discussion



181
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

Le gne d-pinne synthase est surtout exprim dans les feuilles de L. pedunculata et
L. viridis mais est exprim un niveau trs infrieur (dtectable 40 cycles) chez L.
stoechas (Figure 51). Lexpression de ce gne chez L. pedunculata et L. viridis explique
laccumulation presque similaire de l-pinne chez ces espces malgr une expression trs
diffrente de l-fenchol synthase. Il explique aussi la plus forte prsence de l-pinne
chez ces lavandes par rapport au limonne bien que le rapport de production de ces deux
molcules par l-fenchol synthase soit inverse. La trs faible expression de ce gne chez
L. stoechas et notre incapacit mettre en vidence une activit enzymatique de LsPINS
sont par contre surprenants. L. stoechas accumule en effet des quantits plus faible mais
tout fait significative d-pinne (16.9 g eq. eugnol/g PS). Cette espce accumule
aussi, contrairement aux deux autrses, une forte quantit dactate de myrtnyle (59.51 g
eq. eugnol/g PS) qui est un driv biosynthtique de l-pinne. Il est donc possible quun
autre gne de TPS encore inconnu soit responsable dune synthse additionnelle d-
pinne au moins chez cette espce.
Les ARNm des gnes de germacrne A synthase sont quant eux prsents en plus
forte quantit dans les feuilles de L. pedunculata que dans celles de L. stoechas. Leur
abondance tait faible, et uniquement dtecte aprs 40 cycles de PCR, chez L. viridis
(Figure 51). Ces niveaux respectifs dexpression sont cependant trs diffrents des niveaux
daccumulation du germacrne A dans les feuilles de ces trois espces.

III.4.2.6. Analyse phylogntique
Afin de clarifier les relations phylogntiques entre les gnes de TPS de lavandes
Stoechas clons ici et ceux dj clones et caractriss fonctionnellement chez les
Angiospermes, nous avons construit un arbre de relations phylogntiques. Cet arbre a t
construit grce aux squences protiques des TPSs du genre Lavandula, des TPSs ayant les
mmes activits catalytiques et un ou plusieurs TPSs reprsentatives de chacune des sous-
familles des TPSs (TPSa - TPSh). Les squences protiques des TPSs ont t alignes en
utilisant le programme ClustalW (Thompson et al., 1994) du logiciel BioEdit. Larbre des
relations phylogntiques a t construit en utilisant la mthode de neighbor-joining
(MEGA 4) et est prsent dans la Figure 52.







t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre III. Rsultats et Discussion



182
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e





Figure 52 : Relations phylogntiques des TPSs des lavandes Stoechas avec dautres TPSs connues




t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre III. Rsultats et Discussion



18J
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

Figure 52 : (suite)
Les squences protiques des TPSs de lavandes ainsi que dautres mono-, sesqui- et ditTPSs choisis
d'Angiospermes et de Gymnospermes ont t alignes (Bioedit) et utilises pour reconstituer larbre phylogntique
(Mega 4, Tamura et al., 1997) des TPSs vgtales. Larbre phylogntique est gnr selon la mthode du
Neighbor-joining (Saitou & Nei, 1987). Les distances volutives ont t calcules en utilisant la mthode de
correction de Poisson (Zuckerkandl & Pauling, (1965). La barre d'chelle indique une divergence de squence de
20%. Les TPSs de lavandes Stoechas clones et caractrises dans cette tude sont mises en vidence en gras.
Numros daccession Genbank : H. annuus Germacrene A synthase 1 et Germacrene A synthase 2, EU439590 et EU443249
(Gopfert et al., 2009); H. annuus Germacrene A synthase 3, GU176380 (Gopfert et al., 2010); P. cablin Germacrene A synthase,
AY508728 (Deguerry et al., 2006); A. majus Nerolidol/Linalool synthase, EF433761 (Nagegowda et al., 2008); A. majus
Myrcene synthase, AY195609 (Dudareva et al., 2003); A. grandis -Humulene synthase, U92267 (Steele et al., 1998); C.
formosensis -Pinene synthase, EU099434 (Chu et al., 2009); A. grandis Pinene synthase, U87909 (Bohlmann et al., 1997); P.
taeda (+)--Pinene synthase et (-)--Pinene synthase, AF543530 et AF543527 (Phillips et al., 2003); P. sitchensis Pinene
synthase, AY237645 (McKay et al., 2003); P. abies (-)-/-Pinene synthase, AY473622 (Martin et al., 2004); C. breweri Linalool
synthase, U58314 (Dudareva et al., 1996); C. maxima ent-Kaurene synthase, U43904 (Yamaguchi et al., 1996); A. thaliana ent-
Copalyl diphosphate synthase, NM116512 (Mayer et al., 1999); Z. mays ent-Copalyl diphosphate synthase, AY562491 (Harris et
al., 2005); L. latifolia Linalool synthase, DQ421801 (Tan et al., 2006, soumission direct au genBank); L. angustifolia Limonene
synthase, Linalool synthase et trans--Bergamotene synthase, DQ263740, DQ263741 et DQ263742 (Landmann et al., 2007); O.
basilicum Fenchol synthase, AY693648 (Iijima et al., 2004); Q. ilex Pinene synthase, AM283099 (Andres-Montaner et al., 2006,
soumission direct au genBank); A. annua (-)--Pinene synthase, AF276072 (Lu et al., 2002); C. sativa (+)--Pinene synthase,
DQ839405 (Guennewich et al., 2006, soumission direct au genBank); T. parthenium Germacrene A synthase, JF819848 (Majdi et
al., 2011); V. vinifera Germacrene A synthase, HQ326230 (Martin et al., 2010); I. dentata Germacrene A synthase, AY082672
(Kim et al., 2005); C. sonchifolium Germacrene A synthase, DQ186657 (Ren & You, 2005, soumission direct au genBank); S.
canadensis Germacrene A synthase, AJ304452 (Prosser et al., 2002); A. annua Germacrene A synthase, DQ447636 (Bertea et al.,
2006); C. intybus Germacrene A synthase short form et Germacrene A synthase long form, AF498000 et AF497999
(Bouwmeester et al., 2002); L. sativa Germacrene A synthase LTC1 et Germacrene A synthase LTC2, AF489964 (Bennett et al.,
2002); H. muticus Vetispiradiene synthase, U20187 (Back & Chappell, 1995); N. tabacum 5-epi-Aristolochene synthase, L04680
(Facchini & Chappell, 1992); R. officinalis Pinene synthase, EF495245 (Tan et al., 2007, soumission direct au genBank); S.
moellendorffii Copalyl diphosphate synthase et kaurene synthase, XM_002967320 et XM_002960304 (Grigoriev et al., 2010,
soumission direct au genBank); L. angustifolia -Phellandrene synthase, HQ404305 (Demissie et al., 2011); L.x intermedia 1,8-
Cineole synthase, JN701459, L. angustifolia 1,8-Cineole synthase, JN701461 et L. latifolia 1,8-Cineole synthase, JN701460
(Demissie et al., 2012).




Les huit sous-familles des TPSs vgtales (TPSa - TPSh), dj dfinies sur la base des
liens gntiques (Bohlmann et al., 1998a ; Trapp & Croteau, 2001b ; Aubourg et al., 2002 ;
Dudareva et al., 2003 ; Chen et al., 2011), sont clairement spares et nos nouvelles TPSs
de lavandes sintgrent dans ces sous-familles. Comme illustr dans la Figure 52, les l-
fenchol synthases et l-pinne synthases des lavandes Stoechas sintgrent parmi les TPSs
de la sous-famille TPSb et les germacrne A synthases des lavandes Stoechas sintgrent
dans la sous-famille TPSa. Les deux groupes de monoTPSs des lavandes Stoechas sont
groups dans deux sous-clusters distincts de la sous-famille TPSb. Ainsi, les -fenchol
synthases de L. stoechas Sensu Lato prsentent les plus fortes ressemblances avec la
limonne synthase de L. angustifolia (Landmann et al., 2007) et la linalol synthase de L.
latifolia (GenBank), en dpit des diffrences fonctionnelles entre ces enzymes. Lensemble
de ces TPSs est sur des pinnes synthases des lavandes Stoechas.
Les germacrne A synthases des lavandes Stoechas sont groupes dans la sous-famille
TPSa qui est constitue majoritairemnt de sesquiTPSs. Cette sous-famille regroupe
notamment toutes les germacrne A synthases connues ce jour bien que provenant de
familles botaniques trs diffrentes comme des Astraces, des Vitaces et des Lamiaces.
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre III. Rsultats et Discussion



184
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

Les germacrne A synthases que nous avons dcouvertes sont les premiers membres
connus de TPSs de lavande de la sous-famille TPSa. Leur plus grande affinit de
squences au sein de la sous-famille TPSa seffectue avec la germacrne A synthase de P.
cablin qui est la seule autre TPS de la famille des Lamiaces. Les autres TPS les plus
proches sont la 5-epi-aristolochene synthase (TEAS) et la vetispiradine synthase (VHS)
du tabac et dHyoscyamus muticus respectivement. Il est noter que ces deux dernires
enzymes produisent du germacrne A comme intermdiaire catalytique.

III.4.3. Discussion
Le peu dinformation gnomique disponible (absence de gnome squenc et absence
de banque dEST) et TPS connues sur le genre Lavandula ne permet pas le clonage direct
des ADNc codants les TPSs. Donc, nous avons dbut notre travail par des amplifications
PCR des TPSs sur lADNg en utilisant lapproche des amorces dgnres. Cette approche
est souvent utilise pour le clonage de gnes prsentant des zones conserves sur leurs
squences, ce qui est le cas des TPSs. Les squences protiques de TPSs publies depuis
une varit de plantes possdent plusieurs rgions hautement conserves. Ceci offre la
possibilit d'isoler de nombreux nouveaux gnes de TPSs dautres plantes par PCR avec
des amorces dgnres. A cet effet, un arbre phylogntique (Figure 44) a t gnr suite
lalignement de 62 squences protiques de TPSs de Lamiaces. Le fait dtablir un arbre
partir de TPSs dune mme famille botanique entraine ncessairement un biais car il ne
permet de ne voir que les zones conserves des enzymes dj connues dans cette famille. Il
nous empche de dsigner des amorces sur des enzymes encore inconnues dans cette
famille. Heureusement pour nous, la famille des Lamiaces a t dj trs tudie pour son
mtabolisme des terpnes. Larbre construit dans notre tude a permis de dfinir six
clusters de TPSs : quatre clusters (1, 2, 4 et 6) regroupant des monoTPSs, et deux clusters
(3 et 5) regroupant des sesquiTPSs. Le cluster 5 renfermant des sesquiTPSs se dtache
distinctement du reste de larbre. Il pourrait sagir de gnes qui ont diverg trs tt au cours
de lvolution. Ceci avait dj t mis en vidence dans larbre gnr par Bohlmann et al.
(1998a) qui montre quau sein des Angiospermes, les monoTPSs sont clairement distinctes
des sesquiTPSs. A contrario, le cluster 3 qui renferme galement des sesquiTPSs, se situe
au milieu des clusters de monoTPSs. Il regroupe deux sesquiTPSs, la -zingiberne
synthase dOcimum basilicum (Iljima et al., 2004b) et la trans-bergamotne synthase de L.
angustifolia (LaBERS, Landmann et al., 2007). Cette dernire fait partie des trois TPSs
caractrises par Landmann et al. (2007) chez L. angustifolia. Cette tude montre que
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre III. Rsultats et Discussion



18-
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

LaBERS est plus troitement apparente aux monoTPSs quaux sesquiTPSs. Il est
probable que ces deux enzymes, ici regroupes dans le cluster 3, drivent de monoTPSs
par la perte dun peptide signal pour le ciblage chloroplastique et par llargissement de la
poche catalytique de fixation du substrat pour inclure le FPP prsent dans le cytosol et non
le chloroplast. Cette ide est soutenue par le fait que la protine LaBERS accepte le GPP
avec une plus grande affinit. Les fortes homologies de ces enzymes avec les monoTPSs
peuvent expliquer les raisons pour lesquelles Landmann et al. (2007) ont pu amplifier des
gnes de sesquiTPSs et de monoTPSs avec deux couples damorces dgnres possdant
la mme amorce antisens. Les squences de sesquiTPSs du cluster 5 sont, quant--elles,
trop divergentes pour tre amplifies avec le mme couple damorces.
Au cours de cette phase de notre tude, des amorces dgnres ont t dfinies sur
chaque cluster pour amplifier des gnes de TPSs sur ADNg de L. pedunculata. Les
squences amplifies ont t BLASTes contre la base de donnes GenBank ce qui
permit dtablir que cinq dentre elles sont des squences partielles diffrentes,
LpMTPS1g-383, LpMTPS2g-768, LpMTPS3g-768, LpMTPS4g-792 et LpMTPS5g-795,
homologues des monoTPSs du cluster 1, 2 et 6 et trois squences partielles diffrentes,
LpSTPS1g-894, LpSTPS2g-896 et LpSTPS3g-909, homologues des sesquiTPSs du cluster
5. Enfin, en couplant des amorces spcifiques dsignes sur les huit squences partielles
non introniques avec la RACE-PCR, trois gnes, LpFENS, LpPINS et LpGEAS, en pleine
longueur codants pour des TPSs ont t amplifis sur ADNc de L. pedunculata. Ceci peut
sexpliquer par le fait que lADNc reflte uniquement les gnes en expression. Ainsi,
seules les TPSs exprimes ont t amplifies. Les diffrents niveaux dexpression des
gnes de TPSs peuvent galement influer sur le rendement de la raction PCR dans le sens
o il est plus probable damplifier un gne trs exprim en admettant que lhybridation des
amorces dgnres sur les gnes de TPSs soit quiprobable.
Ainsi, par le couplage des amorces spcifiques dsignes sur les trois squences pleine
longueur de TPSs de L. pedunculata avec la marche gnomique, nous avons russi isoler,
cloner et squencer trois ADNc de TPSs orthologues des feuilles de L. stoechas (LsFENS,
LsPINS et LsGEAS) et des feuilles de L. viridis (LvFENS, LvPINS et LvGEAS). Aucun
autre gne orthologue additionnel na t trouv dans aucune espce. La comparaison des
diffrentes squences avec leurs ortologues a rvl des pourcentages didentit trs levs
(~ 99 %, Tableau 19). La prsence des mmes gnes dans L. pedunculata, L. stoechas et L.
viridis avec une trs haute identit (Figure 48), confirme que ces plantes sont troitement
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre III. Rsultats et Discussion



186
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

lies gntiquement comme indiqu par leur lien botanique troit (mme section botanique,
section Stoechas et dnomination originelle de ces trois espces au sein dune mme
espce). Nos trois gnes nont pas subit dvnement de duplication au sein du complexe
despces Stoechas en accord avec les plodies similaires entre les espces. Les quelques
mutations ponctuelles et insertions/dltions qui diffrentient les formes orthologues de ces
trois gnes nont pas modifi les profils des produits des enzymes.

Comme illustr sur la Figure 48, toutes les TPSs de lavande Stoechas clones
manifestent les motifs caractristiques des TPSs. Il s'agit notamment du motif N-terminal
RRx8W caractristique de la plupart des monoTPSs membres des sous-familles TPSb et
TPSd (Bohlmann et al., 1998a ; Aubourg et al., 2002). Ce motif est prsent dans nos -
fenchol synthases et -pinne synthases en tant que RRS(G/A)NYQPSAW et moins
conserv en tant que RPLANFSPSLW dans nos germacrne A synthases du fait du
remplacement du deuxime Arg par un Pro. Le motif RRx8W a t signal comme
essentiel l'activit des monoTPSs pour la production des monoterpnes cycliques en
participant dans l'tape initiale de la migration du diphosphate (Savage et al., 1994). Ainsi,
le deuxime rsidu arginine dans ce motif a t propos comme tant impliqu dans
l'isomrisation du GPP en un intermdiaire cyclisable, tel que le cation de linalyle
(Williams et al., 1998 ; Dudareva et al., 2003). Les motifs riches en aspartate, "DDxxD" et
"NSE/DTE", abrviation du consensus (L,V)(V,L,A)(N,D)D(L,I,V)x(S,T)x3E, sont
galement prsents dans nos TPSs en tant que DD(I,V,T)YD et
DD(L,I)(G,A)T(A,Y)(P,L,E)(F,H,V)E, respectivement (Figure 48). Cependant, le motif
DDxxD est hautement conserv chez la quasi-totalit des TPSs vgtales et microbiennes
alors que le motif NSE/DTE semble tre moins conservs (Tarshis et al., 1994, 1996 ;
Lesburg et al., 1997 ; Starks et al., 1997 ; Cane & Kang, 2000 ; Christianson, 2006). Peters
et al. (2003) ont rvl que les ractions de cyclisation se produisent dans des sites actifs
spars. Un site actif est localis dans une rgion centrale contenant le motif DDxxD
responsable de la liaison du mtal divalent pour les ractions de protonation tandis que
lautre site est localis dans la rgion C-terminale contenant le motif NSE/DTE
responsable des ractions d'ionisations. En outre, toutes nos TPSs putatives sont
caractrises par la prsence du motif RxR hautement conserv (Bohlmann et al., 1998a).
Ce motif, sous forme de RDR dans nos TPSs, est situ environ 34 aa en amont du motif
DDxxD. Daprs Stark et al. (1997), ce motif aide orienter l'anion diphosphate loin du
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre III. Rsultats et Discussion



18
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

carbocation ractif aprs lionisation du substrat pour empcher lattaque nuclophile sur
les intermdiaires carbocationiques. Ainsi, spcifiquement nos germacrne A synthases
sont caractrises par la prsence dun motif conserv "GVYxEP" dans les sesquiTPSs des
Angiospermes en tant que GVYHEP (Cai et al., 2002). En plus, une autre rgion conserve
est aussi apparente dans nos TPSs, il sagit du motif LQLYEASFLL qui joue un rle dans
la catalyse (McGeady & Croteau 1995 ; Wise et al., 1998).

La comparaison de Bohlmann et al. (1997, 1998a) a montr que des TPSs avec une
haute identit en acides amins (70 - 90 %) peuvent tre responsables de la catalyse de
ractions diffrentes, tandis que dautres TPSs avec seulement 30 % d'identit peuvent
catalyser la mme cyclisation. Cette faible corrlation entre la structure et la fonction des
TPSs rend impossible la classification d'une nouvelle TPS putative avant qu'elle n'ait t
analyse biochimiquement. Il a t rapport que le peptide signal dadressage
chloroplastique est enlev lentre des TPSs dans les chloroplastes cause de son action
inhibitrice (Robinson & Ellis, 1984 ; Hawlitschek et al., 1988 ; Arretz et al., 1991). Ainsi,
les monoTPSs tronques en amont des deux Arg du motif RRx8W montrent une activit
maximale (Williams et al., 1998). La dtermination du site potentiel de clivage des
peptides signaux lgrement en amont du motif RRx8W, pour l'enlvement des 50
premiers aa pour les monoTPSs du groupe FENS et des 53 premiers acides amins pour les
monoTPSs du groupe PINS (Figure 48), a t fonde, en parallle, sur la consultation
minutieuse des tudes publies sur les TPSs (Fischbach et al. 2001, Dudareva et al. 2003,
Chen et al., 2004, Martin et al., 2004 ; Landmann et al., 2007) et en utilisant lalgorithme
ChloroP du site web http://www.cbs.dtu.dk/services/ChloroP/. Le motif RRx8W est jug
pour dfinir le site de clivage approximative du peptide dadressage plastidial dans les
enzymes monoTPSa (Williams et al., 1998). L'absence de rsidus N-terminaux en amont
ce motif dans l'une des quelconques des structures cristallises reportes des monoTPSs,
non seulement donne penser qu'ils sont superflus l'activit enzymatique, mais peut-tre
plus important encore, qu'ils sont susceptibles de former une structure secondaire ou tout
autre structure ordonne. En plus, le peptide signal doit tre exclu pendant le clonage pour
amliorer la solubilit de la protine recombinante. Le peptide de transit dirige les
protines exprimes de manire htrologue dans E. coli vers la cavit priplasmique o
les protines sont agrges sous forme de corps d'inclusion insolubles (Hannig &
Makrides, 1998). Son exclusion, par consquent, amliore le dpt des protines
recombinantes dans le cytoplasme bactrien sous une forme soluble (Williams et al.,
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre III. Rsultats et Discussion



188
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

1998). De ce fait, les peptides signaux dadressage chloroplastique de toutes les monoTPSs
des groupes FENS et PINS ont t limins par l'amplification d'un cadre de lecture ouvert
tronqu commenant par les trois acides amins (DET) en amont du motif conserv
RRx8W (Figure 48). Cette amplification-dltion nous a permis dobtenir les formes
tronques pseudomatures (pm) marques par ltiquette poly-His de toutes nos monoTPSs
(LpFENSpm, LsFENSpm, LvFENSpm, LpPINSpm, LsPINSpm et LvPINSpm). Lutilisation
de la souche Rosetta (DE3) pLysS de E. coli pour lexpression htrologue et la
chromatographie daffinit au Ni
2+
nous ont permis de purifier les protines natives de
toutes nos TPSs en quantits notables et solubles allant de 2 18 g.
Daprs lanalyse SDS-PAGE (Figure 49) de nos TPSs recombinantes, les poids
molculaires des protines recombinantes des groupes FENS, PINS et GEAS ont t
estims, respectivement, ~ 65, ~ 66 et ~ 59 kDa. Ces valeurs de PM sont infrieures
celle prdites partir de la traduction thorique des ADNc (Tableau 18). Ces incohrences
entre les prvisions des PMs et les estimations des PMs bases sur lanalyse SDS-PAGE
sont couramment observs (Fischer et al., 2004), et pourraient rsulter de repliement ou
dassociation particulires avec le dtergent SDS (Deguerry et al., 2006). Comme plusieurs
tudes ont prouv que les TPSs peuvent fonctionner avec plusieurs types dions
mtalliques divalents, habituellement le Mg ou le Mn (Poulter & Rilling 1981 ; Croteau,
1987 ; Cane, 1990), nous avons ralis des essais enzymatiques avec l'assistance du Mg et
du Mn conjointement selon les conditions optimises par Landmann et al. (2007).

Les essais enzymatiques coupls la GC/MS nous ont permis didentifier sans
ambigit les activits catalytiques in vitro des TPSs de lavandes clones lors de cette
tude. Ainsi l-fenchol tait le principal produit des TPSs du groupe FENS et nous les
avons dsignes -fenchol synthases (LpFENS, LsFENS et LvFENS). De la mme faon,
nous avons identifi les TPSs du groupe PINS en tant qu-pinne synthases (LpPINS,
LsPINS et LvPINS) ainsi que les TPSs du groupe GEAS en tant que germacrne A
synthases (LpGEAS, LsGEAS et LvGEAS).
La fraction volatile de L. pedunculata est trs riche en fenchone (Tableau 16). Vu que
le fenchone est la forme oxydate d-fenchol et que LpFENS est trs fortement exprime
dans cette espce, il est probable que lexpression forte de LpFENS soit responsable du
chmotype fenchone de L. pedunculata. Croteau et al. (1980) ont dmontr quune fenchol
dshydrognase, isole en tant quenzyme soluble partir des feuilles de Foeniculum
vulgare, catalyse la dshydrognation pyridine nuclotide-dpendante d-fenchol en
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre III. Rsultats et Discussion



18?
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

fenchone. Le fenchone joue un rle cologique important sur la reproduction de L.
pedunculata car il agit comme signal dattraction des insectes pollinisateurs (Duke, 1992).
Par contre, l-fenchol est totalement absent des fractions volatiles des autres lavandes
Stoechas, et le fenchone est non-dtectable parmi les terpnes volatils de L. viridis en
parallle avec la faible expression de la fenchol synthase chez ces deux espces. Les deux
autres TPSs que nous avons dcouvertes (PINS et GEAS) ne sont pas capables de produire
l-fenchol pour compenser le manque dactivit de FENS (Figure 50).
La capacit de TPSs (y compris nos TPSs) de produire des produits multiples peut
rsulter de l'volution incomplte des sites actifs de la protine ancestrale pour atteindre la
prcision de son activit catalytique (Christianson, 2006). De faon inattendue, les
enzymes produits multiples que nous avons dcouvertes, les -fenchol synthases et les -
pinne synthases, ne catalysent pas la biosynthse des constituants tels que le -pinne et le
-phllandrne, qui sont des isomres (anomres) structurellement semblable l-pinne
et l-phllandrne, respectivement, qui eux sont produits par nos enzymes. Phillips et al.
(2003) et Chu et al. (2009) ont clon des -pinne synthases de Pinus taeda et de
Chamaecyparis formosensis, respectivement, responsables de la synthse in vitro
exclusivement d-pinne sans son isomre -pinne. Nanmoins, le -pinne et le -
phllandrne sont naturellement prsents dans les feuilles des trois lavandes Stoechas.
Cela, nous laisse suggrer la prsence chez les trois lavandes dune autre pinne synthase
ou phllandrne synthase ou mme dautres monoTPSs responsables de la production du -
pinne et/ou du -phllandrne comme produits principaux ou secondaires. Par exemple, la
-phllandrne synthases du sapin grandissime produit in vitro le -phllandrne (52 %), le
-pinne (34 %), l-pinne (8.5 %) et le 4S-limonne (6 %) (Bohlmann et al. 1999). Il est
cependant noter que toutes les monoTPSs du genre Lavandula qui ont t dcrites ce
jour produisent in vitro de faibles niveaux d'-phllandrne (Demissie et al., 2011 ;
Landmann et al., 2007). Dautre part, comme L. stoechas prsente un chmotype camphre
et L. viridis prsente un chmotype 1,8-cinol et que ces deux terpne sont prsents dans
les trois lavandes sources en grandes quantit, il est trs probable que deux autres TPSs,
une bornyl diphosphate synthase et une 1,8-cinol synthase encore inconnues soient actives
dans ces lavandes. La dcouverte de ces synthase putatives serait un lment important
pour mieux comprendre la production de terpnes volatils dans ces lavandes. Trs
rcemment, Demissie et al. (2012) ont clon une premire 1,8-cinol synthase depuis les
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre III. Rsultats et Discussion



1?u
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

fleurs des trois lavandes L. x intermedia, L. angustifolia et L. latifolia. Cette dcouverte
nous aidera peut tre dcouvrir son homologue dans les lavandes Stoechas.
Lactivit enzymatique in vitro des GEAS des lavandes Stoechas a rvl quelles ne
produisent quun seul terpne, le germacrne A. Il est ainsi surprenant de remarquer que
cette substance nest prsente quen faible quantit dans les lavandes Stoechas. Tout aussi
surprenant est le manque de corrlation entre le niveau dexpression de cette enzyme et le
taux de germacrne A dans les 3 espces de cette tude. Plusieurs autres TPSs
recombinantes sont connues pour synthtiser in vitro des terpnes qui ne sont pas produits
dans la plante d'origine. Cest par exemple le cas de la bergamotne synthase de L.
angustifolia qui synthtise un jeu de sesquiterpnes (dont majoritairement le bergamotne)
qui nont jamais t dtects chez la plante hte (Landmann et al., 2007). Ceci peut avoir
plusieurs causes. Premirement, les composs volatils produits sont peut tre mis trs
rapidement dans latmosphre et ne se sont donc peut tre jamais accumuls en assez
grande quantit pour pouvoir tre dtect lors dune extraction avec un solvant organique.
Autre possibilit, les conditions de raction enzymatique in vitro (tels que les cofacteurs
mtalliques utiliss) sont peut tre trop diffrentes des conditions in vivo et modifient le
mcanisme de catalyse pour gnrer un autre lot de produits. Le ratio entre les
concentrations en Mg
2+
et Mn
2+
ont ainsi t dmontrs comme tant un facteur contrlant
les produits forms (Croteau & Karp, 1979 ; Landmann et al., 2007). Finalement, il est
possible que le germacrne A soit bien produit dans les lavandes Stoechas mais soit trs
rapidement transform en une autre substance et reste ainsi des taux trs bas in vivo.
Cette dernire hypothse est intressante car il est connu que le germacrne A joue un rle
dintermdiaire ractionnel dans la biosynthse des lactones sesquiterpniques au got
amer, des substances trop polaires pour tre extraites par les solvants organiques
classiquement utiliss pour extraire les terpnes des Lamiaces (de Kraker et al., 1998,
2001 ; Bennette et al., 2002 ; Majdi et al., 2011). Mme si la dcouverte dune germacrne
A synthase dans les lavandes Stoechas a t surprenante, elle est intressante et nous
pousse tudier de plus prs le rle de ce compos chez ces plantes.
Les proprits enzymatiques dune -fenchol synthase ont t initialement dtermines
partir dextraits protiques bruts des feuilles de Foeniculum vulgare (Croteau et al.,
1980). L-fenchol synthase que nous dcrivons est la deuxime TPS clone et caractrise
fonctionnellement qui catalyse la formation de l-fenchol comme substance principale.
Une seule autre -fenchol synthase a t dcrite ce jour, et ce dans une autre Lamiace,
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre III. Rsultats et Discussion



1?1
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

Ocimum basilicum (Iljima et al., 2004b). Ce travail, qui prsente des rsultats assez
similaires ceux de notre tude, a montr que l-fenchol synthase O. basilicum synthtise
in vitro de l-fenchol comme produit principal mais aussi de l-pinne, du limonne et
un monoterpne non-identifi. Par contre, les squences protiques de nos -fenchol
synthases ne sont similaires cette -fenchol synthase dO. basilicum qu 67 %. Les
squences protiques de nos synthases sont plus proches (78 % didentit) de celles de la
limonne synthase et la linalol synthase clones chez L. angustifolia (Landmann et al.,
2007) et de L. latifolia (GenBank), respectivement. Ces donnes signifient une fois de plus
que la similarit des squences toute seule ne fournit pas une indication certaine sur les
proprits catalytiques dune TPS. Elle est par contre souvent une image miroir des liens
phylogntiques entre les plantes (Bohlmann et al., 1998a).
L-pinne synthase des lavandres Stoechas dcouverte dans cette tude constitue la
deuxime TPS de ce type tre clone et caractrise dans la famille des Lamiaces aprs
celle de Rosmarinus officinalis (GenBank). Auparavant, dautres -pinne synthases
avaient t clones et caractrises depuis quatre Gymnospermes et trois Angiospermes
(Bohlmann et al., 1997 ; Trapp & Croteau, 2001a ; Lu et al., 2002 ; McKay et al., 2003 ;
Phillips et al., 2003 ; Martin et al. 2004 ; Chu et al., 2009). La plupart de ces synthases
produisent in vitro un mlange d-pinne et -pinne. Cependant, des -pinne synthases
clones des conifres produisent in vitro l-pinne en tant que produit principal sans le -
pinne (Phillips et al., 2003 ; Chu et al., 2009). En outre, une pinne synthase extraite
directement des feuilles de Salvia officinalis est responsable de la synthse in vitro de trois
terpnes, (+)--pinne, (+)-limonne et (+)-camphne (Gambliel & Croteau, 1984). Les
pinne synthases cites prcdemment ont une similarit de squence faible (25 - 42 %)
avec nos -pinne synthases. Cependant, ces dernires, prsentent une similarit de
squence beaucoup plus leve avec la limonne synthase (74 %) et la linalol synthase (60
%) de L. anugustifolia (Landmann et al., 2007).
A ce jour, environ quatorze germacrne A synthases ont t isoles, clones et
caractrises exclusivement depuis des Angiospermes : Astraces, Vitaces et Lamiaces.
Le premier rapport tait celui sur la chicore (Cichorium intybus) o deux germacrne A
synthases ont t isoles, les deux catalysant exclusivement la formation du (+)-
germacrne A (Bouwmeester et al., 2002). Les germacrne A synthases des lavandes de
cette tude, sont les deuximes signales et clones partir des Lamiaces. La premire
tait de Pogostemon cablin (Deguerry et al., 2006). Ces germacrne A synthases comme
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre III. Rsultats et Discussion



1?2
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

pour la plupart des autres germacrne A synthases catalysent in vitro la formation de
germacrne A comme sesquiterpne unique (Bennette et al., 2002 ; Kim et al., 2005 ;
Bertea et al., 2006 ; Degurry et al., 2006 ; Gpfert et al., 2009, 2010 ; Majdi et al., 2011).
Exceptionnellement, deux germacrne A synthases de Vitis vinifera et Solidago canadensis
produisent le germacrne A comme sesquiterpne majeur en parallle avec dautres
sesquiterpnes secondaires (Prosser et al., 2002; Martin et al., 2010). Dautres TPSs,
comme la 5-pi-aristolochne synthase (TEAS) (Back et al., 1994 ; Starks et al., 1997) et
la vetispiradiene synthase (HVS) (Back & Chappell, 1995) sont capables de convertirent le
FPP en 5-pi-aristolochne et en vetispiradiene, respectivement, via la production du
germacrne A comme intermdiaire catalytique li lenzyme. En outre, dautres TPSs
synthtisent le germacrne A comme sesquiterpne secondaire. Citons titre dexemple, la
germacrne C synthase de Lycopersicon esculentum (Colby et al., 1998), la germacrne D
synthase et la patchoulol synthase de P. cablin (Deguerry et al., 2006), la -selinne
synthase dAbies grandis (Steel et al., 1998) et la -cubebne synthase de Magnolia
grandiflora (Lee & Chappell, 2008). Les protines LpGEAS, LsGEAS et LvGEAS ont des
identits de squence faibles (36 - 46 %) avec les germacrne A synthase vgtales cites
prcdemment sauf avec la germacrne A synthase de patchouli (P. cablin) et la TEAS du
tabac avec qui elles ont des similarits de 64 % et 59 %, respectivement. D'autre part,
contrairement toutes les germacrne A synthases dj connues, celles des lavandes
Stoechas et de P. cablin sont plus courtes (-12 aa).

Les monoterpnes vgtaux sont synthtiss dans les plastes aprs le transfert des
monoTPSs du cytosol par leurs peptides de transit. Comme est montr dans la Figure 53A,
les voies de la biosynthse des monoterpnes dbute par l'association de lIPP et du
DMAPP, gnrs depuis la voie du MEP, ce qui gnre le GPP. Cette raction
enzymatique est ralise par la GPP synthase. Les ractions catalyses par les TPSs sont
inities par l'assistance lectrophile au clivage C-O des phosphoesters de diphosphate
(Croteau, 1987 ; Cane, 1990). Le GPP, substrat des monoTPSs, est converti en cation de
granyle puis en cation de linalyle par l'intermdiaire trs ractif, le LPP. La formation des
monoterpnes acycliques pourrait se dcouler soit via l'intermdiaire cation de granyle ou
via le cation de linalyle. Les voies de biosynthses de tous les monoterpnes cycliques
passent par le cation d-terpinyle issu de la conversion du cation de linalyle (Bohlmann et
al., 1997). Le cation d-terpnyle est considr comme lintermdiaire unique central
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre III. Rsultats et Discussion



1?J
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

dans la synthse des monoterpnes cycliques. Depuis cet intermdiaire central, les voies de
synthse divergent, conduisant la formation de monoterpnes hydrocarbons et/ou
monoterpnes hydroxyls. En effet, les carbocations peuvent subir une gamme
disomrisation, de cyclisation, et de rarrangement avant que ces ractions ne soient
acheves par des dprotonations ou par des captures d'eau conduisant au monoterpne
final. De ce fait, les -fenchol synthases de lavandes Stoechas catalysent in vitro des
ractions ncessitant la formation de plusieurs intermdiaires carbocationiques. Au cours
de ces ractions, le GPP est converti en un seul monoterpne acyclique (-myrcne) et cinq
monoterpnes cycliques (-pinne, -phlladrne, limonne, -terpinolne et -fenchol)
tandis que, les -pinne synthases catalysent in vitro la conversion du GPP en quatre
monoterpnes cycliques (-pinne, -phllandrne, limonne et -terpinolne). Le
limonne et l-terpinolne drivent directement de cation -terpinyl, alors que l-fenchol,
l-pinne et l-phllandrne sont indirectement forms via les cations fenchyle, pinyle et
phllandryle, respectivement (Figure 53A). Cependant, la synthse du -myrcne peut
driver soit du cation granyle soit du cation de linalyle.

t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre III. Rsultats et Discussion



1?4
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e


Figure 53 : Proposition de fonctionnement des TPSs de lavandes Stoechas dcouvertes dans
cette tude
Ce schma est adapt daprs Degenhardt et al. (2009). Les produits des TPSs de lavandes Stoechas
dcouvertes dans cette tude sont placs dans des cercles de couleur diffrente selon les synthases
considres : rouge pour FENS, bleu pour PINS et noire pour GEAS. A, monoterpnes forms par FENS et
PINS. B, sesquiterpne form par GEAS. OPP dsigne le groupement diphosphate.



La biosynthse des sesquiterpnes commence par la perte du pyrophosphate du FPP
sous l'action enzymatique des sesquiTPSs. Dans ce processus, les germacrne A synthases
de lavandes Stoechas sont capables de former le germacrne A en catalysant la conversion
du FPP en cation E,E-germacradienyle par une cyclisation entre le C1 et le C10 (Figure
53B). Ce carbocation est converti en germacrne A par dprotonation. Le germacrne A
sert de substrat la synthse de nombreux mtabolites secondaires. Loxydation du
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre III. Rsultats et Discussion



1?-
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

germacrne A, chez la chicor, la laitue, la camomille et probablement aussi chez d'autres
espces vgtales, conduit aux lactones sesquiterpniques des classes germacranolides,
eudesmanolides et guaianolides (de Kraker et al., 1998, 2001 ; Bennette et al., 2002 ;
Majdi et al., 2011). Ces mtabolites secondaires vgtaux (lactones sesquiterpniques) sont
principalement produits par les Astraces ainsi que chez d'autres familles, y compris les
Lamiaces (Ammon, 2004). En outre, le germacrne A est sensible aux conditions
lgrement acides, o des cyclisations chimiques spontanes sont induites pour produire le
selina-4,11-dine, l-selinne et le -selinne (de Kraker et al., 1998). Ces deux dernires
substances sont prsentes dans les profils terpniques des trois lavandes Stoechas
lexception de labsence de l-selinne chez L. pedunculata. L-selinne et le -selinne
avaient dj t dtects dans les profils d'HEs de L. stoechas et L. viridis (Nogueira &
Romano, 2002 ; Angioni et al., 2006 ; Benabdelkader et al., 2011). Donc, trs
probablement, le germacrne A reprsente la source d-selinene et -selinene. La TEAS
est une TPS de tabac capable de convertir le FPP en germacrne A qui reste attach
lenzyme. Les squences protiques des germacrne A synthases des lavandes Stoechas ont
une identit relativement leve avec la TEAS (59 %). Comme la structure cristalline de la
TEAS a t tablie, il est utile de comparer les squences des germacrne A synthasess de
lavandes Stoechas avec celle de la TEAS. Comme indiqu dans la Figure 54, plusieurs
acides amins dans la squence de la TEAS ont t proposes pour tre impliques dans la
formation de l'intermdiaire germacrne A ainsi que sa cyclisation supplmentaire. Par
exemple, dans la squence protique de la TEAS les rsidus R264 et R441 sont impliqus
en partie dans la liaison du Mg et dans l'ionisation du diphosphate en parallle avec le
rsidu D525 engag dans l'limination du proton en C13 du cation germacradienyle (Starks
et al., 1997). Les rsidu Y520, D444 et D525 ont t montrs pour tre les responsables de
la cyclisation supplmentaire du germacrne A en 5-epi-aristolochne par la TEAS (Starks
et al., 1997 ; Rising et al., 2000). En outre, Prosser et al. (2002) ont suggr que le
remplacement de la tyrosine (position 527 en TEAS) par la leucine dans la germacrne A
synthase de la verge d'or dstabilise le cation germacradienyle conduisant mettre fin la
raction en stade germacrne A. L'ensemble de ces rsidus actifs sont prsents dans les
germacrne A synthases des lavandes Stoechas (Figure 54), sauf que le germacrne A est
form en tant que produit enzymatique final. Cette comparaison n'a pas pu rvler une
diffrence vidente qui pourrait expliquer la cessation de la raction en germacrne A.
Probablement d'autres diffrences entre la TEAS et les germacrne A synthases de
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre III. Rsultats et Discussion



1?6
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

lavandes peuvent affecter le mcanisme ractionnel. Des donnes supplmentaires
proviendront de la mutagense dirige des germacrne A synthases de lavandes Stoechas.


Figure 54 : Rsidus d'acides amins impliqus dans la formation de l'intermdiaire germacrne A et
sa cyclisation additionnelle par la TEAS
Les flches dsigne la position des rsidus d'acides amins impliqus dans la formation de l'intermdiaire germacrne A
et de son cyclisation additionnelle par la TEAS


Les variations observes lors de lanalyse RT-PCR semi-quantitative (Figure 51) de
lexpression des gnes de TPS de lavandes Stoechas sont corrles en partie avec la teneur
en constituants produits par ces TPSs dans les fractions volatiles de feuilles de ces
lavandes. Chez les trois lavandes Stoechas le gne d-fenchol synthase est en relation
directe et partielle avec la variation chmotypique. Ce gne prsente des variations
dexpression trs leves entre les trois lavandes. Le niveau d'expression trs lev du gne
de l-fenchol synthase (LpFENS) chez les feuilles de L. pedunculata (Figure 51) indique
la grande capacit produire une grande quantit d-fenchol, apparemment trs
rapidement oxyd en fenchone car L. pedunculata possdait un niveau trs lev en
fenchone (chmotype fenchone). Par contre, le niveau trs bas de lexpression de ce gne
(LsFENS) remarqu dans les feuilles de L. stoechas (Figure 51) corrle avec les petites
quantits de fenchol/fenchone chez cette espce chmotype camphre. Dautre part, lors
de cette analyse RT-PCR, limpossibilit de dtecter les ARNm d-fenchol synthase
(LvFENS) dans les feuilles de L. viridis 25 cycles indique que la quantit de transcrits de
ce gne est trs faible (Figure 51). Cependant, les transcrits de l-fenchol synthase sont
dtects trs bas niveau 40 cycles de PCR dans les feuille de L. viridis en contradiction
avec le profil en composs volatils qui montrent une absence totale d-fenchol et
fenchone. De ce fait, on peut conclure que le gne d-fenchol synthase est rgul
diffrentiellement au niveau transcriptionel au sein du complexe despces L. stoechas
Sensu Lato, expliquant ainsi les prsences et absence de chmotype fenchone au sein des
diffrentes espces le constituant.
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre III. Rsultats et Discussion



1?
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

Finalement, compte tenu des rsultats de lanalyse semi-quantitative et de l'affinit
taxonomique entre ces trois lavandes (section Stoechas), nous pouvons suggrer que les
activits des trois TPSs clones ici sont, en partie, rgules au niveau transcriptionnel.
Cette suggestion est en accord avec dautres tudes sur les TPSs vgtales. Ces tudes ont
prouv dans divers modles exprimentaux que lactivit des TPSs est rgule au niveau
transcriptionnel. Par exemple, Lane et al., (2010) ont tabli une relation directe entre le
niveau des transcrits de la LaLINS et la quantit de linalol dans lHE de fleurs de L.
angustifolia. Boeckelmann (2008) a signal une augmentation concerte de l'accumulation
des transcrits de la LaLINS et du linalol (produit de la LaLINS) dans les plantes L.
angustifolia et L. x intermedia pendant la floraison. De bonnes corrlations ont t
mesures entre la composition des HEs et les concentrations, relatives et absolues, des
transcrits des TPSs chez diffrentes lignes dOriganum vulgare (Crocoll et al., 2010). Des
rsultats similaires ont t galement signals dans d'autres espces (Turner et al., 1999,
2000b ; Gershenzon et al., 2000 ; McConkey et al., 2000 ; Sharon-Asa et al.,
2003 ; Dudareva et al., 2005 ; Tholl, 2006 ; Nagegowda et al., 2008 ; Nagegowda, 2010).
Peters & Croteau (2004) suggrent que le fonctionnement du mtabolisme secondaire des
plantes est le plus souvent rgul au niveau de la transcription.
















t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre IV. Conclusion et Perspectives




Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e




















C
CO ON NC CL LU US SI IO ON N
E ET T P
PE ER RS SP PE EC CT TI IV VE ES S


















t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre IV. Conclusion et Perspectives



1??
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

Mon travail de thse sest inscrit dans le cadre des travaux de recherche mens par
deux laboratoires, le laboratoire de recherche sur les produits bioactifs et valorisation de la
biomasse (ENS, Alger) et le laboratoire de biotechnologies vgtales appliques aux
plantes aromatiques et mdicinales (UJM, Saint Etienne). Le premier laboratoire dirige ces
efforts vers lvaluation des activits biologiques des produits naturels, tandis que le
deuxime laboratoire focalise ces axes de recherche sur les voies de biosynthse des
terpnes. Lobjectif de mon travail a t dtudier la bioactivit et la biodiversit chimique
des huiles essentielles de lavandes du complexe despces L. stoechas Sensu Lato.
Lors de cette tude, nous avons, dans un premier temps, procd lextraction par
hydrodistillation des huiles essentielles (HEs) des parties ariennes fleuries de onze
populations de L. stoechas en croissance naturelle en Algrie. Nous avons tout dabord
augment la connaissance sur la nature chimique, et la variabilit, des composs volatils
constituants les HEs de L. stoechas. Ensuite, nous avons valu le potentiel antioxydant et
antimicrobien de ces HEs.
Lanalyse chimique des composs volatils des parties ariennes fleuries de ces plantes
a t effectue par GC/FID et GC/MS. Pour ces chantillons, nous avons constat une
variabilit chimique importante des constituants de lHE, notamment par la prsence, la
fois des HEs domines par le fenchone (10 populations), mais galement dune HE riche
en camphre (une population) contenant en deuxime lieu le fenchone. Ces HEs sont
caractrises aussi par la prsence importante de 1,8-cinol et viridiflorol en parallle avec
une grande biodiversit (au total 121 composs identifis) et variation qualitative et
quantitative de tous les constituants dans les diffrents chantillons. Ainsi, 54 composs
volatils rapports ici n'avaient jamais t signals auparavant dans les HEs de L. stoechas
travers le monde. Les HEs que nous avons extraites partir des populations sauvages de L.
stoechas font preuve d'une grande diversit dans la composition qui affecte des
constituants majeurs et mineurs. Les connaissances acquises sur leur composition
largissent davantage les connaissances actuelles sur la gamme de diversit des composs
organiques volatils dans cette espce avec la premire dtection de plusieurs constituants
mineurs. Avec sa grande biodiversit chimiques, nous confirmons que L. stoechas est une
trs bonne source de matriel vgtal pour une large gamme de molcules bioactives.
Nanmoins, notre tude confirme galement que les variations dans le contenu de
composants majeurs de lHE de L. stoechas ne sont pas limits aux (et peut ne pas
correspondre) vnements volutifs connus tels que les radiations ou la sous-spciation, car
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre IV. Conclusion et Perspectives



2uu
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

l'origine du rayonnement, de la diversification et l'emplacement actuel de la biodiversit
des sous-espces ont t clairement assigns en Espagne (Upson & Andrews, 2004). Des
grandes diffrences de composition peuvent tre observes sur une chelle gographique
fine de sorte qu'un chantillonnage dense de plantes individuelles sur une petite partie de
l'aire de rpartition de cette espce, comme l'Algrie, contient dj une part de la diversit
chimique de l'espce entire et peut tre utilise pour alimenter des programmes de
dveloppement varitaux.
Lactivit antioxydante des HEs des 11 populations de L. stoechas a t value et
compare en utilisant les mthodes suivantes : la mthode de DPPH et la mthode du -
carotne/acide linolique. On a remarqu que les 11 HEs ont montr des diffrences
significatives dactivit antioxydante en relation troite avec la variation de leur
composition chimique. Gnralement, ces HEs ont prsent une activit antioxydante. Elle
tait cependant faible par comparaison aux antioxydants de rfrence (BHT et -
tocophrol). Les donnes de cette activit antioxydante, rapporte pour la premire fois
dans cette tude, suggrent que cette activit de diffrentes HEs de L. stoechas, en dpit de
son potentiel relativement faible, peut tre intressante du fait de la diversit des
substances actives. Toutes ces substances taient prsentes en quantits trs faibles (le plus
souvent infrieures 0.3 % de la teneur totale de lhuile), si bien que nos huiles les plus
actives taient celles qui contenaient le plus grand nombre de molcules bioactives. Parce
que notre chantillonnage a t fait sur une petite zone gographique, cette analyse
souligne nouveau l'extraordinaire biodiversit de L. stoechas en termes de matriel
source de substances bioactives. Elle suggre galement que les HEs accumules dans les
populations sauvages contiendront un ensemble plus large de molcules antioxydantes par
rapport celles produites partir d'un seul clone cultiv.
L'activit antimicrobienne (CMI) des 11 HEs de L. stoechas a t value in vitro
envers onze microorganismes pathognes (bactries Gram plus, bactries Gram ngatives,
champignons filamenteux et levures reconnues pour leur impact clinique, sanitaire et
conomique). En parallle avec lactivit antioxydante, lactivit antimicrobienne des 11
HEs de populations algriennes a t trs variable travers les populations en relation avec
la variation en composition chimique. Gnralement, toutes les 11 HEs taient efficaces
envers tous les microorganismes notamment les HEs extraites de L. stoechas de la rgion
de Boumerdes (LS3) et de la rgion de Bouira-Guerrouma (LS6). Les diffrents travaux,
raliss au cours de cette valuation, ont permis de mettre en avant les proprits
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre IV. Conclusion et Perspectives



2u1
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

antibactriennes et antifongiques de ces HEs en lien avec leurs constituants contre
plusieurs bactries et champignons pathognes. L'activit antimicrobienne apprciable de
lHE de L. stoechas algrienne, rapporte ici pour la premire fois, a valid l'utilisation
traditionnelle de lHE de cette espce en tant que drogue antiseptique en Algrie et dans
certaines rgions mditerranennes. Nanmoins, certaines populations se sont avres tre
de meilleures sources de matriaux bioactifs (populations LS3 et LS6) envers un large
panel de microorganismes et peuvent donc avoir un plus grand potentiel applicatif dans les
industries pharmaceutiques, cosmtiques et de protection des cultures. Toutes ces
informations tmoignent du potentiel que prsentent les HEs pour la recherche de
molcules antimicrobiennes innovantes dans leur mode daction.
Nous nous sommes intresss dans un deuxime temps aux composs organiques
volatils (COVs) des feuilles de trois lavandes Stoechas, L. pedunculata, L. stoechas et L.
viridis, qui sont trs voisines dun point de vu botanique au sein du genre Lavandula. Elles
font partie de la mme section botanique (section Stoechas) et ont t considres jusque
rcemment comme des sous-espces de la mme espce, L. stoechas. Une analyse par
GC/MS dextraits hexane des COVs de feuilles de pieds individuels a permis didentifier
124 composs, parmi lesquels nous trouvons une majorit de molcules monoterpniques
oxygns. Nous avons mis en vidence une variation de la teneur des principaux COVs
entre les trois lavandes tudies en accord avec les variations chmotypiques connues au
niveau interspcifique dans chacune de ces espces. Les trois pieds que nous avons
slectionns correspondent un chmotype fenchone (L. pedunculata), un chmotype
camphre (L. stoechas) et un chmotype 1,8-cinol (L. viridis). Les diffrences de COVs
entre les 3 pieds des 3 espces que nous avons slectionns taient surtout importantes au
niveau des sesquiterpnes qui constituent la deuxime classe de composants aprs les
monoterpnes.
Au cours des cinq dernires dcennies, un vaste ensemble de littrature a t gnr au
sujet des voies de biosynthse des terpnes et, notamment, des terpnes synthases (TPS),
une famille denzymes qui est responsable de la diversification de leur squelette carbon.
Ceci est le rsultat de la recherche de nombreux groupes travers le monde, travaillant sur
les rles et la distribution des composs terpniques dans la nature, leur importance dans
les cultures agronomiquement importantes et leur utilisation dans les industries
alimentaires, cosmtiques et pharmaceutiques. Il y a aussi eu beaucoup de recherches sur la
relation structure-fonction des TPSs. Nous disposons ainsi dune meilleure comprhension
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre IV. Conclusion et Perspectives



2u2
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

de la faon dont ces enzymes ont volu, de comment elles peuvent tre manipules des
fins commerciales pour la mdecine et les secteurs de production agronomique. Toutefois,
il reste encore beaucoup apprendre sur l'volution de la famille des TPSs, les subtilits du
fonctionnement des TPS et les mcanismes par lesquels la production des terpnes par ces
enzymes est contrle. Dans ce contexte, mon travail de thse a contribu largir les
connaissances actuelles sur les voies de biosynthse des terpnes chez les Lamiaces en
caractrisant dans un premier temps trois nouvelles enzymes activit terpne synthase,
impliques dans les voies de biosynthse des terpnes chez les lavandes Stoechas. Dans
cette tude, nous avons russi cloner, squencer et caractriser fonctionnellement trois
nouvelles TPSs depuis les feuilles de L. Pedunculata ainsi que leurs orthologues chez L.
stoechas et L. viridis. Lutilisation damorces dgnres nous a permis d'isoler trois
ADNc de TPSs distincts de L. pedunculata (LpFENS, LpFENS et LpGEAS). Nous avons
ensuite isol leurs homologues respectifs avec des amorces spcifiques chez L. stoechas
(LsFENS, LsPINS et LsGEAS) et chez L. viridis (LvFENS, LvPINS et LvGEAS). Ces gnes
taient prsents en copies uniques dans ces trois espces. Tous les lments structuraux tels
que les motifs caractristiques des TPSs (e.g. RRx8W, DDxxD, NTE/NSE) sont prsents et
suggrent que ces ADNc encodent potentiellement des TPSs fonctionnelles. Ainsi,
l'expression htrologue de ces TPSs dans E. coli (Rosetta (DE3) pLysS) nous a permis de
confirmer lanalyse des squences. Les gnes des groupes FENS (LpFENS, LsFENS et
LvFENS) et PINS (LpPINS, LsPINS et LvPINS) encodent des monoTPSs actives qui
catalysent in vitro la formation de plusieurs monoterpnes cycliques et/ou acycliques avec
la dominance respective d-fenchol et d -pinne. Ceux du groupe GEAS (LpGEAS,
LsGEAS et LvGEAS) encodent des TPSs actives qui catalysent la formation dun
sesquiterpne cyclique unique, le germacrne A. Ainsi, lanalyse des produits
enzymatiques par GC/MS des TPSs que nous avons dcouvertes a conduit leur
identification fonctionnelle en tant qu-fenchol synthases (LpFENS, LsFENS et LvFENS),
-pinne synthases (LpPINS, LsPINS et LvPINS) et germacrne A synthases (LpGEAS,
LsGEAS et LvGEAS). Tous les trois types de TPSs sont exprims diffrentiellement dans
les feuilles de chacun des pieds de lavande Stoechas que nous avons analyss
prcdemment en corrlation avec la teneur de leurs composs associs dans la source
vgtale. Cela nous a permis de conclure que les activits de ces TPSs sont principalement
rgules au stade transcriptionnel. Une analyse phylogntique de nos TPSs de lavandes
Stoechas en prsence dun panel reprsentatif de TPSs dj caractrises dans dautres
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre IV. Conclusion et Perspectives



2uJ
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

espces vgtales, les place dans deux clusters distincts correspondant dans deux sous-
familles distinctes. LpFENS, LsFENS, LvFENS, LpPINS, LsPINS et LvPINS se classent
dans la sous-famille TPSb et LpGEAS, LsGEAS et LvGEAS sont dans la sous-famille
TPSa. Les squences connues les plus proches de nos protines FENS et PINS taient des
TPSs dautres genres de lavandes bien que celles-ci aient des activits enzymatiques
diffrentes (limonne synthase et linalol synthases de L. latifolia et L. angustifolia). La
caractrisation fonctionnelle de nos trois nouvelles activits TPSs chez les lavandes fournit
des ressources nouvelles pour les recherches sur le mtabolisme des terpnes spcialement
chez les espces Lavandula et, plus gnralement, chez les plantes suprieures. Nous
rapportons en effet ici pour la premire fois trois squences de TPSs jamais publies pour
le genre Lavandula. Il sagit aussi de la seconde description dune activit -fenchol
synthase chez les plantes et germacrne A synthase chez les Lamiaces.

Des tudes complmentaires pourront tre envisages dans plusieurs domaines.

Les terpnes, en tant quun large groupe de produits naturels, constituent une riche
source de molcules naturelles pour la dcouverte de nouveaux mdicaments et
composs bioactifs dintrt. Cela a t illustr par un sesquiterpne antipaludique,
lartimisinine et par un diterpne anticancreux, le taxol. Tous deux sont issus de
plantes et sont utiliss en mdecine traditionnelle. Dans ce contexte, leffet
antimicrobien des HEs de L. stoechas devra galement tre explor sur un spectre
plus large de microorganisme en utilisant plusieurs mthodes dvaluation. Il est
indispensable dvaluer la toxicit de cette HE sur lhomme pour viter tout
problme deffet secondaire. Il serait, en ce sens, utile denvisager de prciser la
nature du (ou des) compos(s) responsable(s) de cette activit par un fractionnement
men en parallle de tests biologiques (bioguidage). Aprs ces nombreux tests, cette
HE activit antimicrobienne pourra servir de base au dveloppement de nouveaux
antibiotiques afin de contribuer largir larsenal thrapeutique dont nous disposons
pour lutter contre le problme rcurrent de la rsistance microbienne aux
antibiotiques.
Les trois enzymes de TPS dcrites ici, pour chaque lavande, avec leur activit in
vitro ne semblent pas suffisantes pour expliquer laccumulation de tous les terpnes
dans les feuilles de ces lavandes. La prsence de grandes quantits de camphre et de
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Chapitre IV. Conclusion et Perspectives



2u4
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

1,8-cinol en parallle avec dautres mono- et sesquiterpnes dans les feuilles des
lavandes Stoechas, implique certainement le fonctionnement dautres TPSs. Parmi
ces TPSs, citons en particulier la 1,8-cinol synthase et la bornyl diphosphate
synthase. Des tudes complmentaires sont ncessaires comme complment
d'enqute dans la production des terpnes volatils et ainsi que dans la variation
chmotypique dans les lavandes Stoechas en parallle avec l-fenchol synthase
identifie dans le prsent travail. Cela sera facilit lorsque les informations de
squences des gnomes ou des banques dEST de ces espces de lavandes seront
disponibles. Le squenage du gnome entier conduira la dcouverte d'autres gnes
cls dans la biosynthse des terpnes. La comprhension de l'expression des gnes du
genre Lavandula de la biosynthse de lHE en relation avec le mtabolisme de lHE
pourrait gnrer des informations essentielles concernant la rgulation de la
biosynthse des HEs chez les plantes suprieures.
Les analyses GC/MS de lactivit in vitro des neuf TPSs de lavandes Stoechas ont
montr quil sagissait de trois types dactivit, -fenchol synthase, -pinne
synthase et germacrne A synthase. Cependant, la fonction in vivo de ces TPSs na
pas t dmontre. Lanalyse de COVs produits par des plantes dficientes dans
lexpression de ces gnes permettrait de rpondre cette question. Des protocoles de
transformation gntique de ces espces ne sont cependant pas disponibles.
Labsence de relation directe entre lexpression des gnes de germacrne A synthase
et de laccumulation du germacrne A dans les feuilles des lavandes Stoechas appelle
la poursuite des recherches pour lever cette ambigut. Des recherche
complmentaires pourraient avoir pour but de tester lutilisation du germacrne A
dans le mtabolisme terpnique de ces plantes.
Des expriences de mutagense dirige sur les gnes des groupes FENS et PINS
permettraient de mieux comprendre comment ces enzymes sont capables de raliser
des structures bicycliques de type -fenchol et -pinne. Les squences des
polypeptides correspondant sont en effet proches entre elles mais aussi proches de
celles de TPSs dautres genres de lavande synthtisant des produits monocycliques
(limonne) ou linaires (linalol). Lusage des nombreuses structures
cristallographiques de TPSs disponibles et la haute conservation des structures
secondaires et tertiaires dans cette famille denzymes devrait faciliter le choix des
acides amins cibler dans une telle tude.
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Bibliographie




Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e



















B
BI IB BL LI IO OG GR RA AP PH HI IE E























t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Biobliographie



2u6
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e en nn ne es s
d d I In nt t r r t t P Ph ha ar rm ma ac co ol lo og gi iq qu ue e

-A-
-Abbott, E., Hall, D. et al. (2010). Laser microdissection of conifer stem tissues: isolation
and analysis of high quality RNA, terpene synthase enzyme activity and terpenoid
metabolites from resin ducts and cambial zone tissue of white spruce (Picea glauca).
BMC Plant Biol. 10, 106-122.
-Aburjai, T., Hudiab, M. et al. (2005). Chemical composition of the essential oil from
different aerial parts of lavender (Lavandula coronopofolia Poiert) (Lamiaceae) grown
in Jordan. J. Essent. Oil Res. 17, 49-51.
-Adam, K. P. and Zapp, J. (1998). Biosynthesis of the isoprene units of chamomile
sesquiterpenes. Phytochemistry 48, 953-959.
-Adams, R. P. (2007). Identification of essential oils components by gas
chromatography/quadrupole mass spectroscopy. Carol Stream, Illinois, USA: Allured
Publishing Corporation.
-Adamson, G. E., Lazarus, S. A. et al. (1999). HPLC method for the quantification of
procyanidins in Cocoa and chocolate samples and correlation to total antioxidant
capacity. J. Agr. Food Chem. 47, 4184-4188.
-Adzet, T., Granger, R. et al. (1977). Le polymorphisme chimique dans le genre Thymus :
sa signification taxonomique. Biochem. Syst. Ecol. 5, 269-272.
-AFNOR. (1996). Huiles essentielles, recueil de normes franaises. AFNOR, Paris La
Dfense, France.
-Afsharypuor, S. and Jahromy, M. M. (2003). Constituents of the essential oil from
Tanacetum lingulatum (Boiss.) Bornm. J. Essent. Oil Res. 15, 74-76.
-Agranoff, B. W., Eggerer, H. et al. (1960). Biosynthesis of terpenes. J. Biol. Chem. 235,
326-332.
-Agricultural Research Service. (2000). Dr Duke's phytochemical and ethnobotanical
databases. http://www.ars-grin.gov/duke/.
-Aharoni, A., Giri, A. P. et al. (2004). Gain and Loss of Fruit Flavor Compounds Produced
by Wild and Cultivated Strawberry Species. Plant Cell. 16, 3110-3131.
-Aharoni, A., Giri, A. P. et al. (2003). Terpenoid metabolism in wild-type and transgenic
Arabidopsis plants. Plant Cell. 15, 2866-2884.
-Ait-Ali, T., Swain, S. M. et al. (1997). The LS locus of pea encodes the gibberellin
biosynthesis enzyme ent-kaurene synthase A. Plant J. 11, 443-454.
-Akers, C. P., Weybrew, J. A. et al. (1978). Ultrastructure of glandular trichomes of leaves
of Nicotiana tabacum L. Am. J. Bot. 65, 282-292.
-Alchanati, I., Patel, J. A. A. et al. (1998). The enzymatic cyclization of nerolidyl
diphosphate by delta cadinene synthase from cotton stele tissue infected with
Verticillium dahliae. Phytochemistry 47, 961-967.
-Aligiannis, N., Kalpotzakis, E. et al. (2001). Composition and antimicrobial activity of the
essential oils of two Origanum species. J. Agr. Food Chem. 40, 4168-4170.
-Alma, M. H., Nitz, S. et al. (2004). Chemical composition and antimicrobial activity of
the essential oils from the gum of Turkish Pistachio (Pistacia vera L.), J. Agr. Food
Chem. 52, 3911-3914.
-Alonso, W. R. and Croteau, R. (1993). Prenyltransferases and cyclases. Methods Plant
Biochem. 9, 239-260.
-Altschul, S. F., Madden, T. L. et al. (1997). Gapped BLAST and PSI-BLAST: a new
generation of protein database search programs. Nucleic Acids Res. 25(17), 3389-
3402.
t
e
l
-
0
0
9
5
2
6
9
5
,

v
e
r
s
i
o
n

1

-

2
7

F
e
b

2
0
1
4
Biobliographie



2u
Thse de Doctorat
Ecole Normale Suprieure de Kouba-Alger/Universit Jean Monnet de Saint Etienne
B Bi io od di iv ve er rs si it t , , B Bi io oa ac ct ti iv vi it t e et t B Bi io os sy yn nt th h s se e d de es s C Co om mp po os se es s T Te er rp p n ni iq qu ue es s V Vo ol la at ti il ls s d de es s L La av va an nd de es s A Ai il l e es s, , L La av va an nd du ul la a s st to oe ec ch ha as s S Se en ns su u L La at to o, , u un n C Co om mp pl le ex xe e d d E Es sp p c ce es s M M d di it te er rr ra an n e