Vous êtes sur la page 1sur 4

CORRIGE DU 1er CONTROLE CONTINU

(3 novembre 2005)

Q 1 : Faire le schéma détaillé de la structure du désoxyribonucléotide pGpT, en indiquant à l'aide


d'une flèche la position de toutes les liaisons esters.

Liaison
ester phosphate O

C
N
C NH

O-
CH G
C C
N N NH2
O P O CH2
O O

O- H H
CH3 C
H H
C NH
H
O T
Liaison HC C
N O
ester phosphate O P O CH2
O

O- H H

H H

OH H
Liaison
ester phosphate

Les expériences suivantes sont réalisées en parallèle, sur deux échantillons du même ADN
circulaire double brin qui présente des sites uniques de restriction pour les enzymes BglII et SacI.
Les enzymes BglII et SacI hydrolysent les séquences suivantes :
BglII : A/GATCT SacI : GAGCT/C

Q 2 : Faire les schémas de l'ADN plasmidique obtenu après l'hydrolyse par BglII (produit A1),
d'une part, et par SacI (produit B1), d'autre part. Ecrire la séquence et le type des extrémités
obtenues (représentation linéaire acceptée)

A3' GAGCT3'
TCTAG5' C5'
5'

3'
GATCT

TCGAG
3'

5'
A

Produit A1 : Produit B1 :
extrémités cohésives, 5' sortantes ou 3' rentrantes extrémités cohésives, 3' sortantes ou 5' rentrantes
Les molécules d'ADN ainsi clivées (produits A1 et B1) sont incubées en présence d'une ADN
polymérase (fragment de Klenow) et des quatre désoxyribonucléotides dNTP.

Q 3 : Donner les activités enzymatiques de l'ADN polymérase I d'E. coli et du fragment de Klenow

• L'ADN polymérase I d'E. coli a une activité polymérase 5'⇒3' et deux activités exonucléasiques
5'⇒3' et 3'⇒5'.
• Le fragment de Klenow a une activité polymérase 5'⇒3' et une activité exonucléasique 3'⇒5'.

Q 4 : Ecrire la séquence des extrémités des fragments d'ADN obtenus après la réaction avec le
fragment de Klenow et les 4 dNTP, dans le cas des extrémités BglII (produit A2), d'une part, et
par SacI (produit B2)

AGATC3' GAGCT3'
TCTAG5' C5'
3'
5'

3'
CTAGA
GATCT

TCGAG
5'
C
Produit A2 Produit B2
Le fragment de Klenow a besoin d'une matrice et d'une amorce 3'OH pour son activité polymérase

Après la réaction avec le fragment de Klenow, les molécules d'ADN A2 et B2 sont incubées avec
l'ADN ligase du bactériophage T4 (cette ADN ligase est une enzyme qui permet de former des
liaisons phosphodiesters entre deux extrémités franches ou deux extrémités cohésives).

Q 5 : Est-il possible de joindre les extrémités des fragments d'ADN du produit A2? Même
question pour l'ADN du produit B2? Justifiez vos réponses à l'aide de schémas des fragments
d'ADN après la réaction de ligation (produits A3 et B3, respectivement).

Oui, on peut lier les extrémités des fragments d'ADN dans les deux cas car cette ADN ligase
permet de joindre les extrémités franches ou cohésives, à condition que ces extrémités
possèdent des séquences compatibles, antiparallèles et complémentaires.
AGATCGATCT GAGCTC
TCTAGCTAGA CTCGAG

Produit A3 Produit B3
Q 6 : Après la jonction des extrémités, est-il possible de cliver l'ADN du produit A3 par l'enzyme
de restriction BglII? Même question pour l'ADN du produit B3 avec l'enzyme SacI?

• Sur A3, le site de restricition pour BglII n'étant pas reconstitué, il n'y a pas d'hydrolyse possible
(cf. séquence sur le schéma précédent)
• Sur B3, le site de restriction pour SacI n'a pas été modifié : une nouvelle hydrolyse par cette
enzyme est donc possible.

Vous voulez amplifier par PCR un fragment d'ADN compris exactement entre les positions 100 et
750 de la séquence suivante.
100
5’…………GCTACTCGTACGATCGTCGCTCCTTCTCCTTCAGTGCCC…………………//…………………GTCC
3’…………CGATGAGCATGCTAGCAGCGAGGAAGAGGAAGTCACGGG…………………//…………………CAGG

750
TGGAGCCTGGATTGTGCGTAGCGAACTGTACGAGC……………3’
ACCTCGGACCTAACACGCATCGCTTGACATGCTCG……………5’

Q 7 : Des amorces de 20 nucléotides sont utilisées pour cette PCR. Donner les séquences des
oligonucléotides amorces qui vous permettront d'amplifier ce fragment d'ADN 100-750 par PCR
(les nucléotides en gras et soulignés indiquent les bornes du fragment d'ADN désiré). Précisez
l'orientation 5'-3' des ces oligonucléotides.

• Oligonucléotide 1 : 5'CTCCTTCTCCTTCAGTGCCC3'
• Oligonucléotide 2 : 5'CACAATCCAGGCTCCAGGAC3'

Q 8 : Donner une définition du Tm et calculer les Tm de ces amorces.


[On rappelle qu le Tm d'un petit oligonucléotide (jusqu'à 40 mers) est donnée par la formule : Tm =
2(A+T) + 4(G+C)]

Le Tm ou température de demi-dénaturation est la température à laquelle 50% des molécules


passent de l'état bicaténaire à l'état monocaténaire (cf. définition donnée en note de bas de page
dans le poly de TD de Biologie moléculaire)
• Tm de l'oligonucléotide 1 : Tm = 2(1+7) + 4(2+10) = 64°C
• Tm de l'oligonucléotide 2 : Tm = 2(6+2) + 4(4+8) = 64°C

Q 9 : Donner les étapes composant un cycle de cette PCR en nommant les étapes, en précisant les
températures utilisées pour chaque étape et l'état moléculaire de l'ADN à la fin de chaque étape.
Pas de dessin.

• 1ere étape : dénaturation


94 ou 95°C; l'ADN est sous forme monocaténaire
• 2eme étape : hybridation
Ta = Tm - 5°C, soit Ta = 64°C - 5°C = 59°C; appariemment des amorces sur l'ADN dénaturé
• 3eme étape : élongation ou allongement des amorces
72°C; l'ADN est sous forme double brin à partir des amorces

Q 10 : Pour réaliser cette réaction PCR, que devez-vous ajouter à l'ADN étudié at aux deux
oligonucléotides amorces? Quelle particularité présente l'enzyme utilisée?
Il faut ajouter à l'ADN et aux amorces :
• l'enzyme, la Taq polymérase, qui est une ADN polymérase résistante aux passages répétés à
haute température.
• un tampon qui contient des cations bivalents Mg2+, indispensables au fonctionnement de
l'enzyme.
• les 4 désoxyribonucléotides dNTP

Q 11 : Quelle est la taille du fragment d'ADN attendue pour cette PCR? Comment effectuer
cette analyse? Précisez le mode de visualisation de l'ADN.

La taille attendue est donc de : (750-100) + 1 = 651 paires de bases


Une électrophorèse en gel d'agarose de l'échantillon PCR et d'un marqueur de taille permet de
connaître la taille du fragment PCR.
Pour visualiser l'ADN, le gel est incubé dans une solution de bromure d'éthidium (Bet), un
intercalant de l'ADN.