Vous êtes sur la page 1sur 7

TD : Biologie moléculaire – l’expression des gènes

Le phénotype d’un individu est sous la dépendance d’une catégorie de molécules : les protéines. Elles sont très
nombreuses et constituent sa « boite à outils », lui permettant d’assurer différentes fonctions vitales comme la
digestion, la production d’énergie, la fabrication de ses constituants…
Le phénotype d’un individu dépend de son génotype (séquence codante d’un gène) dont l’expression se traduit par la
synthèse de protéines.
Exemples :
Protéines Fonctions biologiques
ADN polymérase, amylase

Hémoglobine

Actine, Myosine Protéines contractiles musculaires


Collagène, kératine Protéines de structure de la peau,
ongles, cheveux…
Protéines de défense

Protéines hormonales

Problématique : Quelle est la correspondance entre le message porté par l’ADN (génotype) et la nature des
protéines fabriquées par un individu (phénotype) ?

Rappel : les protéines appartiennent à la famille des protides qui désignent des molécules de base : les acides
aminés et leurs polymères ou polypeptides (enchaînement d’acides aminés) => Voir cours de 1ère et de BT.

1) La relation entre gène et protéine


Observation historique : en 1908, Archibald Edward Garrod, médecin anglais fit les observations suivantes :
Observations Mécanisme Pathologie
Pas d’oxydation de l’acide
Urines jaunes homogentisique car présence d’une
Sujet sains Pas de pathologie
limpides enzyme fonctionnelle qui dégrade
l’acide homogentisique.
Oxydation de l’acide homogentisique car
Urines noirâtres il y a un déficit de cette enzyme
Maladie héréditaire
Sujets malades fonctionnelle dû à une modification de la
appelé alcaptonurie
séquence du gène codant pour cette
enzyme.
Proposer une hypothèse permettant d’expliquer cette observation.

2) Du gène à la protéine
2.1) Localisation de la synthèse des protéines
Principe de l’autoradiographie : une cellule est placée dans un milieu contenant une molécule de son métabolisme
dont un atome est remplacé par un de ses isotopes radioactifs (3H, 14C…). La présence de ces isotopes ne modifie en
rien l’utilisation des molécules marquées par les cellules mais permet de les localiser dans la cellule. En effet, les
substances radioactives émettent un rayonnement beta qui peut impressionner une émulsion photographique
maintenue quelque temps au contact du matériel biologique.
Il y a alors précipitation de grains d’argent qui apparaissent sombres aux endroits précis où se trouvent les isotopes
radioactifs.

1
Des autoradiographies de cellules cultivées en présence d’uracile radioactif (précurseur de l’ARN) sont présentées dans
le document 1.

t0 min t15 min t 1h30

Document 1 : observation de la radioactivité à différents temps

2.1.1) Qu’observez-vous aux différents temps de l’expérience ?


2.1.2) Proposez une hypothèse :
2.1.3) On qualifie les ARN d’ARNm (= ARN messager). Justifiez ce terme.

2.2) La première étape de la synthèse des protéines : la transcription de l’ADN en ARNm


2.2.1 ) Mécanisme de la transcription
Observation de la vidéo: faire une première lecture sans légende, puis cliquer sur légende.
www.biologieenflash.net/animation.php?ref=bio-0025-2
a) Le gène à transcrire est délimité par deux séquences : lesquelles ? Quels sont leurs rôles respectifs ?
b) Quel est le nom de l’enzyme qui permet la synthèse d’ARNm ?
c) Donner la succession des étapes de la transcription
d) Les bases azotées de l’ADN sont-t-elles toutes identiques à l’ARN ?
e) Les 2 brins d’ADN sont-ils transcrits ?
f) Où a lieu la transcription ?
g) Faire un comparatif des différences entre ADN et ARN sous forme d’un tableau
ADN : acide désoxyribonucléique ARN : acide ribonucléique

Exercice d’application : Convertir le brin d’ADN en ARN


☻ Attention ! L’ARN polymérase ne peut synthétiser que dans le sens 53’

2
2.2.2) La maturation de l’ARNm
La transcription de l’ADN n’aboutit pas directement à la synthèse d’un ARN mature
prêt à être traduit en protéine.
La transcription d’un gène est en fait la fabrication d’une molécule d’ARN pré-
messager, complémentaire du brin codant du gène considéré. Ce n’est qu’après
maturation que l’ARNm peut-être traduit en protéine.

Document 2 : résultat d’expérience sur le gène de l’ovalbumine chez les


eucaryotes

2.2.2.1) ADN et ARNm de l’ovalbumine ont-ils la même taille ? Que peut-on en


conclure ?

Ce mécanisme d’élimination des introns est appelé épissage ou excision.


Le document 3 en présente le mécanisme.

Doc 3 : le mécanisme de l’épissage


2.2.2.2) Nommer les différents acides nucléiques par ordre d’apparition dans le doc 3.
Rem : chez les procaryotes (bactéries) :
- Il n’y a pas d’épissage
- La transcription est cytoplasmique (pas de noyau)
2.2.2.3) Faire un schéma bilan de la transcription en localisant le phénomène
Nous avons vu que la transcription d’un gène correspond à un premier langage codé, nous allons étudier un deuxième
langage codé correspondant à la synthèse des protéines à partir de l’ARNm.

2.3) La deuxième étape de la synthèse des protéines : la traduction de l’ARNm en protéine


Un gène code pour une protéine spécifique. C’est donc la séquence nucléotidique d’un gène (et donc de son ARN
transcrit) qui détermine la séquence des acides aminés d’une protéine.
Le problème est de comprendre comment une molécule formée de 4 nucléotides différents permet la synthèse d’une
molécule formée à partir de 20 acides aminés différents. Autrement dit comment à partir d’un alphabet à 4 ≪ lettres ≫
peut-on écrire 20 ≪ mots ≫ différents ?

3
2.3.1) Le système de correspondance entre nucléotides et acides aminés ou le code génétique universel

Doc 4 : le code génétique universel

a) Comment est codé chaque acide aminé ?


b) Combien de triplets de nucléotides (ou codons) existent-ils ?
c) Pour combien d’acides aminés codent-ils ?
d) Si on prend le codon CCG, à quel(s) acide(s) aminé(s) correspond-il ?
e) Si on prend « la leucine », combien de codons codent pour cet acide aminé ? On dit que le code génétique est
redondant. Justifier cette affirmation.
f) Que signifie l’expression « codé de façon non ambiguë » ?
g) Il existe des codons-stop.
 Quels sont-ils ?
 Le dernier triplet de chaque gène est un codon-stop, formulez une hypothèse sur le rôle de ces codons-
stop.
Bilan :

Exercice d’application :
Chez les mammifères, l’hypophyse postérieure élabore deux hormones de nature polypeptidique :
- L’ocytocine qui favorise les contractions de l’utérus lors de l’accouchement
- La vasopressine qui provoque la constriction (diminution du diamètre) des artères et la réabsorption de
l’eau par les reins.
Le document 5 indique la séquence des bases de la portion d’ADN du brin codant pour l’ocytocine. Des deux brins
d’ADN, seul le brin non transcrit a été représenté. Le document 6 donne le même type d’information dans le cas de la
vasopressine.
5’ TGCTACATCCAGAACTGCCCCCTGGGC 3’

Doc 5 : portion de gène codant pour l’ocytocine

5’
TGCTACTTCCAGAACTGCCCAAGAGGA 3’
Doc 6 : portion de gène codant pour la vasopressine

a) Donner, en utilisant le tableau du code génétique, la séquence en acides aminés de chacune de ces deux
hormones.
b) Quelles sont les différences observées au niveau des 2 fragments d’ADN codant pour la vasopressine ou
l’ocytocine ?
c) Ces différences se traduisent-elles ou non dans la structure des deux polypeptides élaborés ? Pourquoi ?

4
2.3.2) Les «acteurs» de la traduction
On sait que la transcription de l’ADN a lieu dans le noyau et la traduction dans le cytoplasme.

2
3

Doc 7 : ultrastructure cellulaire siège d’une synthèse protéique

2.3.2.1) Annoter le document 7


Observation plus détaillée de l’ultrastructure cellulaire de l’organite 4 :

4a

4b

Doc 8a : microphotographie du REG x 40 000 Doc 8b : Schéma d’interprétation

2.3.2.2) Annoter le document 8b

4b

Doc 9a : chapelet de polysomes x 400 000 Doc 9b : schéma d’interprétation


observés dans le cytoplasme

2.3.2.3) Annoter le document 9b

5
Doc 10 : structure d’un ribosome

Un ribosome est un organite globulaire forme de deux sous-unités de taille différente (elles sont non liées s’il n’y a pas
de synthèse). Le rôle d’un ribosome est de traduire l’ARNm codon par codon et d’assembler la séquence d’acides
aminés par des liaisons peptidiques.
Un même ARNm peut être traduit plusieurs fois et simultanément par plusieurs ribosomes avec un sens de lecture
unidirectionnel grâce à l’existence d’un codon initiateur (AUG) et d’un codon stop.

Doc 10 : microphotographie d’un polysome en activité au MET Doc 11 : Les ARN de transfert : ARNt

La structure en trèfle que vous observez représente un ARNt.


2.3.2.4) Qu’observe-t-on face à chaque codon de l’ARNm ?
2.3.2.5) Que retrouve-t-on d’autre sur chaque ARNt ?
2.3.2.6) Quel est le rôle des ARNt ?
2.3.2.7) Bilan : citer les 3 acteurs de la traduction

2.3.3 Le mécanisme de la traduction


Observer la vidéo suivante et répondre aux questions
www.biologieenflash.net/animation.php?ref=bio-0026-2
a) Où a lieu la traduction ?
b) Comment s’appelle la molécule qui va être traduite ? Par quoi est-elle délimitée ?
c) Comment s’appelle la première phase ? Qu’observe-t-on ? Pourquoi le 1er aa correspond-il à la méthionine ?
d) Comment s’appelle la 2ème phase ? Qu’observe-t-on ? Justifier le fait que le 2ème aa soit la cystéine.
e) Comment s’appelle la 3ème phase ? Qu’observe-t-on ?

Exercice d’application : voici une courte séquence du brin transcrit d’une molécule d’ADN
ADN = TACAGTCCA
 Transcrire pour donner le brin complémentaire d'ARNm (3 codons) =
 Donner les 3 anticodons de l'ARNt correspondants =
 Donner la séquence en acides aminés associés aux codons d'ARNm (traduction) =

6
3) Bilan de la synthèse des protéines
Compléter le schéma bilan présenté ci-après, faisant intervenir les différentes étapes et les différents acteurs (sauf
ARNt).

5’ 3’

3’ 5’